Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist...

23
WHO WANTS TO BE A MILLIONAIRE: SICKLE CELL DISEASE Cassie, Abbie, Marie

Transcript of Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist...

Page 1: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

WHO WANTS TO BE A MILLIONAIRE:

SICKLE CELL DISEASE

Cassie, Abbie, Marie

Page 2: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$1,000

A medical career that is involved with SCD would be:

A. Cardiologist

B. Blood Spatter Analyst

C. Hematologist

D. DNA Analyst

Page 3: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$2,000

If you were to fall down and scrape your hands, what would stop the bleeding?

A. White Blood Cells

B. Plasma

C. Red Blood Cells

D. Platelets

Page 4: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$4,000

Another Name for Red Blood Cells is:

A. Erythrocytes

B. Leukocytes

C. Thrombocytes

D. Anemia

Page 5: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$6,000

How does the shape of the sickle cells affect its movement?

A. Makes it harder to move through vessels

B. Slows down blood flow

C. Stops blood flow

D. All of the above

Page 6: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$8,000

A hematocrit tests what percentage of whole blood is made up of:

A. Oxygen

B. White Blood Cells

C. Red Blood Cells

D. Plasma

Page 7: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$10,000

Symptoms of SCD may include:

A. Severe infection

B. Longer life expectancy

C. Bloating

D. Both A and C

Page 8: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$20,000

Treatment for SCD may include:

A. Antibiotics

B. Chronic Transfusion Therapy

C. Bone Marrow Transplant

D. All of the above

Page 9: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$30,000

What is the function of hemoglobin?

A. Carries Oxygen to body and CO₂ to the lungs

B. Carries Red Blood Cells to the bodyC. Carries White Blood Cells to

enemiesD. None of the above

Page 10: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$40,000

SCD:

A. Is an infectious disease

B. Can be inherited by one parent

C. Must be inherited by two parents

D. Both B and C

Page 11: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$50,000

How is the RNA molecule a “script” for protein production?

A. mRNA is read by tRNA

B. tRNA brings amino acids

C. Amino acids match with 3 mRNA sequences at a time, creating a protein

D. All of the above

Page 12: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$60,000

Change this DNA sequence into mRN

TACCATTGAAAGCATATCGAATGATGG

A. AUGACCCCCGUACAAACUACGUUCCGA

B. AUGGUAACUUUCGUAUAGCUUACUACC

C. AUGCGGCUUAUCUUUCUAUAUCUUCAG

D. AUGGUAACUUUCGUGUAGCUUACUUAC

Page 13: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$70,000

What amino acid must all protein sequences start with?

A. Thr

B. Pro

C. Val

D. Met

Page 14: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$80,000

Valine is:

A. Hydrophobic

B. Hydrophilic

C. Positive

D. Both A and C

Page 15: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$90,000

What type of mutation is responsible for SCD?

A. Point Mutation

B. Frameshift Mutation

C. SCD Mutation

D. Hemoglobin Mutation

Page 16: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$100,000

The replacement of glutamic acid with valine causes proteins be shaped in a way that causes them to:

A. Not move

B. Stick together

C. Run away from each other

D. Cry

Page 17: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$200,000

SCD is:

A. Always fatal

B. Dominate

C. Always homozygous

D. Recessive

Page 18: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$300,000

Clint is heterozygous with SCD, so is his wife. What is the percentage their child will have SCD and/or be a carrier?

A. 25%

B. 50%

C. 75%

D. 100%

Page 19: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$400,000

A woman is a homozygous SCD carrier and her husband is not a carrier. What is not the genotypic ratio their child will have SCD?

A. 1:2:1

B. 1:1

C. 2:2

D. 1

Page 20: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$500,000

Proteins:

A. Are based on A, T, C, U

B. Produce all genetic traits

C. Responsible for half our body functions

D. Dictate our life expectancy

Page 21: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$600,000

Change this DNA sequence into mRNA:

AACGATACCAACGATACC

A. UUGCUAUGGUUGCUAUGA

B. UUCCUAUUGUUGCUAUGG

C. UUGCUAUUGCUGGCUAUG

D. UUGCUAUGGUUGCUAUGG

Page 22: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$800,000

What does not determine the shape of a protein?

A. Amino Acids present

B. Number of Amino Acids

C. Order of Amino Acids

D. Surrounding Environment

Page 23: Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

$1,000,000

Which is not a step of protein synthesis?

A. Info on DNA is copied to mRNA

B. mRNA enters the nucleus

C. Ribosome attaches to mRNA and tRNA brings amino acids

D. Amino acids match w/ 3 at a time and ribosomes assemble amino acids into specific protein originally coded for by the gene on the DNA