Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist...
-
Upload
toby-fisher -
Category
Documents
-
view
213 -
download
1
Transcript of Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist...
![Page 1: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/1.jpg)
WHO WANTS TO BE A MILLIONAIRE:
SICKLE CELL DISEASE
Cassie, Abbie, Marie
![Page 2: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/2.jpg)
$1,000
A medical career that is involved with SCD would be:
A. Cardiologist
B. Blood Spatter Analyst
C. Hematologist
D. DNA Analyst
![Page 3: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/3.jpg)
$2,000
If you were to fall down and scrape your hands, what would stop the bleeding?
A. White Blood Cells
B. Plasma
C. Red Blood Cells
D. Platelets
![Page 4: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/4.jpg)
$4,000
Another Name for Red Blood Cells is:
A. Erythrocytes
B. Leukocytes
C. Thrombocytes
D. Anemia
![Page 5: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/5.jpg)
$6,000
How does the shape of the sickle cells affect its movement?
A. Makes it harder to move through vessels
B. Slows down blood flow
C. Stops blood flow
D. All of the above
![Page 6: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/6.jpg)
$8,000
A hematocrit tests what percentage of whole blood is made up of:
A. Oxygen
B. White Blood Cells
C. Red Blood Cells
D. Plasma
![Page 7: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/7.jpg)
$10,000
Symptoms of SCD may include:
A. Severe infection
B. Longer life expectancy
C. Bloating
D. Both A and C
![Page 8: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/8.jpg)
$20,000
Treatment for SCD may include:
A. Antibiotics
B. Chronic Transfusion Therapy
C. Bone Marrow Transplant
D. All of the above
![Page 9: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/9.jpg)
$30,000
What is the function of hemoglobin?
A. Carries Oxygen to body and CO₂ to the lungs
B. Carries Red Blood Cells to the bodyC. Carries White Blood Cells to
enemiesD. None of the above
![Page 10: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/10.jpg)
$40,000
SCD:
A. Is an infectious disease
B. Can be inherited by one parent
C. Must be inherited by two parents
D. Both B and C
![Page 11: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/11.jpg)
$50,000
How is the RNA molecule a “script” for protein production?
A. mRNA is read by tRNA
B. tRNA brings amino acids
C. Amino acids match with 3 mRNA sequences at a time, creating a protein
D. All of the above
![Page 12: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/12.jpg)
$60,000
Change this DNA sequence into mRN
TACCATTGAAAGCATATCGAATGATGG
A. AUGACCCCCGUACAAACUACGUUCCGA
B. AUGGUAACUUUCGUAUAGCUUACUACC
C. AUGCGGCUUAUCUUUCUAUAUCUUCAG
D. AUGGUAACUUUCGUGUAGCUUACUUAC
![Page 13: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/13.jpg)
$70,000
What amino acid must all protein sequences start with?
A. Thr
B. Pro
C. Val
D. Met
![Page 14: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/14.jpg)
$80,000
Valine is:
A. Hydrophobic
B. Hydrophilic
C. Positive
D. Both A and C
![Page 15: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/15.jpg)
$90,000
What type of mutation is responsible for SCD?
A. Point Mutation
B. Frameshift Mutation
C. SCD Mutation
D. Hemoglobin Mutation
![Page 16: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/16.jpg)
$100,000
The replacement of glutamic acid with valine causes proteins be shaped in a way that causes them to:
A. Not move
B. Stick together
C. Run away from each other
D. Cry
![Page 17: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/17.jpg)
$200,000
SCD is:
A. Always fatal
B. Dominate
C. Always homozygous
D. Recessive
![Page 18: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/18.jpg)
$300,000
Clint is heterozygous with SCD, so is his wife. What is the percentage their child will have SCD and/or be a carrier?
A. 25%
B. 50%
C. 75%
D. 100%
![Page 19: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/19.jpg)
$400,000
A woman is a homozygous SCD carrier and her husband is not a carrier. What is not the genotypic ratio their child will have SCD?
A. 1:2:1
B. 1:1
C. 2:2
D. 1
![Page 20: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/20.jpg)
$500,000
Proteins:
A. Are based on A, T, C, U
B. Produce all genetic traits
C. Responsible for half our body functions
D. Dictate our life expectancy
![Page 21: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/21.jpg)
$600,000
Change this DNA sequence into mRNA:
AACGATACCAACGATACC
A. UUGCUAUGGUUGCUAUGA
B. UUCCUAUUGUUGCUAUGG
C. UUGCUAUUGCUGGCUAUG
D. UUGCUAUGGUUGCUAUGG
![Page 22: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/22.jpg)
$800,000
What does not determine the shape of a protein?
A. Amino Acids present
B. Number of Amino Acids
C. Order of Amino Acids
D. Surrounding Environment
![Page 23: Cassie, Abbie, Marie. $1,000 A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.](https://reader035.fdocuments.us/reader035/viewer/2022081603/56649f055503460f94c1a64f/html5/thumbnails/23.jpg)
$1,000,000
Which is not a step of protein synthesis?
A. Info on DNA is copied to mRNA
B. mRNA enters the nucleus
C. Ribosome attaches to mRNA and tRNA brings amino acids
D. Amino acids match w/ 3 at a time and ribosomes assemble amino acids into specific protein originally coded for by the gene on the DNA