Cartilage Development and Maturation In Vitro and In Vivo

Johnathan Ng

Submitted in partial fulfillment of

the requirements for the degree of

Doctor of Philosophy

in the Graduate School of Arts and Sciences

Columbia University

2017

© 2017

Johnathan Ng

All rights reserved

Abstract

Cartilage Development and Maturation In Vitro and In Vivo

Johnathan Ng

The articular cartilage has a limited capacity to regenerate. Cartilage lesions often

result in degeneration, leading to osteoarthritis. Current treatments are mostly palliative

and reparative, and fail to restore cartilage function in the long term due to the

replacement of hyaline cartilage with fibrocartilage. Although a stem-cell based approach

towards regenerating the articular cartilage is attractive, cartilage generated from human

mesenchymal stem cells (hMSCs) often lack the function, organization and stability of

the native cartilage. Thus, there is a need to develop effective methods to engineer

physiologic cartilage tissues from hMSCs in vitro and assess their outcomes in vivo.

This dissertation focused on three coordinated aims: establish a simple in vivo

model for studying the maturation of osteochondral tissues by showing that subcutaneous

implantation in a mouse recapitulates native endochondral ossification (Aim 1), (ii)

develop a robust method for engineering physiologic cartilage discs from self-assembling

hMSCs (Aim 2), and (iii) improve the organization and stability of cartilage discs by

implementing spatiotemporal control during induction in vitro (Aim 3).

First, the usefulness of subcutaneous implantation in mice for studying the

development and maintenance of osteochondral tissues in vivo was determined. By

studying juvenile bovine osteochondral tissues, similarities in the profiles of

endochondral ossification between the native and ectopic processes were observed. Next,

the effects of extracellular matrix (ECM) coating and culture regimen on cartilage

formation from self-assembling hMSCs were investigated. Membrane ECM coating and

seeding density were important determinants of cartilage disc formation. Cartilage discs

were functional and stratified, resembling the native articular cartilage. Comparing

cartilage discs and pellets, compositional and organizational differences were identified

in vitro and in vivo. Prolonged chondrogenic induction in vitro did not prevent, but

expedited endochondral ossification of the discs in vivo. Finally, spatiotemporal

regulation during induction of self-assembling hMSCs promoted the formation of

functional, organized and stable hyaline cartilage discs. Selective induction regimens in

dual compartment culture enabled the maintenance of hyaline cartilage and potentiated

deep zone mineralization. Cartilage grown under spatiotemporal regulation retained zonal

organization without loss of cartilage markers expression in vivo. Instead, cartilage discs

grown under isotropic induction underwent extensive endochondral ossification.

Together, the methods established in this dissertation for investigating cartilage

maturation in vivo and directing hMSCs towards generating physiologic cartilage in vitro

form a basis for guiding the development of new treatment modalities for osteochondral

defects.

i

Table of Contents

List of Tables and Figures ............................................................................................... iv

Acknowledgments ......................................................................................................... xiv

Chapter 1: Background ................................................................................................... 1

1.1 Cartilage Development .............................................................................................. 1

1.2 Clinical Problem ........................................................................................................ 4

1.3 Cartilage Tissue Engineering and Its Challenges ...................................................... 6

Chapter 2: Goals, Rationale and Approach ................................................................. 12

2.1 Goals ........................................................................................................................ 12

2.2 Hypothesis ............................................................................................................... 13

2.3 Overall Approach and Specific Aims ...................................................................... 13

Aim 1: Investigate subcutaneous implantation in mice as an ectopic model for

studying osteochondral tissues in vivo .................................................................. 14

Aim 2: Develop a robust self-assembly method for making cartilage discs from

hMSCs and evaluate the in vitro and in vivo outcomes ........................................ 15

Aim 3: Improve the organization and stability of cartilage discs by implementing

spatiotemporal regulation during induction .......................................................... 16

ii

Chapter 3: Subcutaneous implantation in mice as an ectopic model for studying

osteochondral tissues in vivo .......................................................................................... 17

3.1 Abstract .................................................................................................................... 17

3.2 Introduction ............................................................................................................. 18

3.3 Methods ................................................................................................................... 20

3.4 Results ..................................................................................................................... 26

3.5 Discussion ................................................................................................................ 39

3.6 Conclusion ............................................................................................................... 45

3.7 Future Work ............................................................................................................. 47

Chapter 4: Evaluation of cartilage discs grown from self-assembling hMSCs in vitro

and in vivo ........................................................................................................................ 48

4.1 Abstract .................................................................................................................... 48

4.2 Introduction ............................................................................................................. 49

4.3 Methods ................................................................................................................... 51

4.4 Results ..................................................................................................................... 58

4.5 Discussion ................................................................................................................ 68

4.6 Conclusion ............................................................................................................... 74

4.7 Future Work ............................................................................................................. 75

iii

Chapter 5: Spatiotemporal regulation promotes organization and in vivo stability of

cartilage grown from hMSCs ......................................................................................... 76

5.1 Abstract .................................................................................................................... 76

5.2 Introduction ............................................................................................................. 77

5.3 Methods ................................................................................................................... 79

5.4 Results ..................................................................................................................... 85

5.5 Discussion .............................................................................................................. 102

5.6 Summary ................................................................................................................ 106

5.7 Future Work ........................................................................................................... 107

References ..................................................................................................................... 108

iv

List of Tables and Figures

List of Tables

Table 4-1. Summary of studies on disc culture of self-assembling chondrocytes or

MSCs for in vitro cartilage formation. In some cases, MSCs failed to form discs. ...... 50

Table 4-2. List of primers used for qPCR ..................................................................... 57

Table 4-3. Comparison of the frequency of successful disc formation in different

experimental groups. Col1 coating enabled the highest yield of disc formation, but this

effect was abolished at high seeding density (1.5×106 per well)................................... 63

Table 5-1. List of primers used for qPCR ..................................................................... 82

List of Figures

Figure 1-1. A summary of major genes associated with the stages of mesenchymal

condensation during cartilage development: Initiate, Set Boundary, Proliferate, Adhere,

Grow, and Differentiate. TGF-β mediates condensation, driving the expression of Sox-

9 during early chondrogenesis. BMPs mediate overt chondroblast differentiation and is

regulated by Noggin for joint formation between skeletal elements. Adapted from Hall

et al [1]. ............................................................................................................................ 2

Figure 1-2. Schematic diagram of joint formation. Interzone appears and forms within

an uninterrupted condensed mesenchymal structure, and cavitation within the interzone

gives rise to the joint capsule. Adapted from Pacifici et al [2]. ....................................... 2

Figure 1-3. Histology of a developing (a) and a mature articular cartilage (b) of the

tibial plateau in 2-weeks (a) and 3-months (b) old mice. (a) The developing articular

cartilage is characterized by zones with morphologically distinct chondrocytes: resting,

proliferating, pre-hypertrophic, and hypertrophic. (b) The mature articular cartilage has

a calcified interface layer bridging the subchondral bone to the cartilage comprising

superficial, transition and radial layers. Adapted from Iwamoto et al [3]. ...................... 3

Figure 1-4. Treatment algorithm for cartilage lesions. MFX: Microfracture, OATS:

Osteochondral autograph transfer, OCA: Osteochondral allografting. ACI: Autologous

chondrocyte implantation. Adapted from Cole et al. ....................................................... 5

Figure 1-5. Schematics of NeoCart production and implantation. Adapted from

Crawford et al [21]. ......................................................................................................... 6

v

Figure 1-6. Self-assembling MSCs in chondrogenic culture form cartilage layers in

osteochondral constructs. (A) MSCs differentiated in membrane culture form stratified

cartilage on CPP scaffold. (B) MSCs differentiated in pellet culture and fused to form

stratified cartilage on decellularized bone. Adapted from Lee et al and Bhumiratana et

al. ..................................................................................................................................... 9

Figure 1-7. Histology of implanted cartilage tissues formed from chondrocytes (top

row) and BMSCs (bottom row). Stains for proteoglycans (Alcian blue) (A and F),

calcium (alizarin red/fast green) (B and G), type II collagen (C and H), type X collagen

(D and I), and type I collagen (E and J) are shown. Cartilage tissues formed from

chondrocytes do not undergo endochondral ossification. In contrast, cartilage tissues

formed form BMSCs undergo endochondral ossification. Adapted from Pelttari et al

[42]................................................................................................................................. 10

Figure 3-1. Experimental design. 4mm diameter cylindrical cores were harvested from

juvenile (2 month old) bovine femoral condyles and sectioned in the axial direction into

1mm slices. One slice from each core was fixed for analysis and one slice was

implanted subcutaneously in immunocompromised mouse for 4 weeks or 10 weeks. . 21

Figure 3-2. Image processing method for quantitatively comparing histological stains.

Images of immunostains were (A) deconvoluted using an ImageJ plugin to isolate the

color of interest, (B) thresholded to identify the cells and (C) cells were counted.

Representative deconvoluted images and particle counts are shown for the TRAP (A-C)

and a PDGF-BB (D) stains. ........................................................................................... 23

Figure 3-3. Method to determine spatial profiles of MD and BVF in the subchondral

bone. MD and BVF of 200-µm segments were determined by manual contouring of

each segment. Results were plotted with respect to the length of the subchondral bone

from bottom to top. . ...................................................................................................... 24

Figure 3-4. Representative H&E stains of osteochondral sections at day 0, and after 4

weeks and 10 weeks of subcutaneous implantation, and of a skeletally mature cow (2

year old). Articular cartilage and subchondral bone are denoted as AC and SB. Deep

zone cartilage was replaced by endochondral bone at the interface. Trabeculation was

nascent in the subchondral bone at 4 weeks and well established at 10 weeks. Scale bar:

200 µm. .......................................................................................................................... 26

Figure 3-5. Changes in tissue length and composition. (Top) Representative

photographs of whole tissue sections at day 0, after 4 weeks and 10 weeks of

vi

implantation. Scale bar: 1 mm. (Bottom) Length of cartilage determined from

representative histologies, and length of bone determined by µCT analysis, showing

osteochondral tissue composition before and after implantation. Cartilage length

decreased and bone length increased apparently by 4 weeks, and significantly at 10

weeks, respectively (n=4). . ........................................................................................... 27

Figure 3-6. Representative type X collagen stains of osteochondral sections at day 0,

after 4 weeks and 10 weeks of implantation. Hypertrophic chondrocytes (indicated by

red arrowheads) were observed initially at the interface, but diminished over time.

Scale bar: 200 µm. ........................................................................................................ 28

Figure 3-7. Representative Movat’s pentachrome stains of osteochondral tissues at day

0, and after 4 weeks and 10 weeks of implantation. Scale bar: 200 µm. ...................... 29

Figure 3-8. Representative µCT images of osteochondral tissues at day 0, and after 4

weeks and 10 weeks of implantation. Scale bar: 1mm. ................................................. 30

Figure 3-9. Spatial profiles of the mineral density (MD) and bone volume fraction

(BVF) of the subchondral bone at day 0, after 4 weeks and 10 weeks of implantation.

The 4 weeks group is shown in a lighter shade for ease of comparison between day 0

and 10 weeks. Newly formed bone at the interface exhibited higher BVF and lower

MD than native bone, whereas the bone in the deeper region exhibited significantly

higher MD and lower BVF after remodeling (*p<0.05; **p<0.01; n=4). ..................... 31

Figure 3-10. Visualization of plates (green) and rods (red) identified from µCT images

of osteochondral tissues at day 0 and 10 weeks. Plates were predominant at day 0,

whereas rods where predominant at 10 weeks .............................................................. 32

Figure 3-11. ITS-based analysis showed significant decrease in the plate volume and

density, increase in the rod volume and density, and increase in the rod-rod junction

density (****p<0.001; n=4). ......................................................................................... 32

Figure 3-12. Representative stains of TRAP with Alcian Blue of osteochondral sections

at day 0, and after 4 weeks and 10 weeks of implantation. Magnified images with

pseudo-colored nuclear counterstains (DAPI) are shown in the right panels. TRAP+

cells were more abundant at 4 weeks than at 10 weeks following implantation. Large,

multi-nuclear TRAP+ cells (indicated by red arrowheads) seen at 4 weeks indicate the

presence of mature osteoclasts mediating cartilage resorption and bone remodeling.

Scale bars: 200 µm (main images) and 100 µm (magnified images). ........................... 34

vii

Figure 3-13. Quantitative analysis of TRAP stains. The number of TRAP+ cells and

average stain area of TRAP+ cells were significantly higher at 4 weeks than at 10

weeks following implantation (n=4).............................................................................. 34

Figure 3-14. Representative PDGF-BB stains of osteochondral sections at day 0, and

after 4 weeks and 10 weeks following implantation. Magnified images are shown in the

right panels. PDGF+ cells were seen at 4 weeks and 10 weeks following implantation,

and were more abundant at 4 weeks. Scale bars: 200 µm (main images) and 100 µm

(magnified images). ....................................................................................................... 35

Figure 3-13. Quantitative analysis of TRAP stains. The number of TRAP+ cells and

average stain area of TRAP+ cells were significantly higher at 4 weeks than at 10

weeks following implantation (n=4).............................................................................. 34

Figure 3-14. Representative PDGF-BB stains of osteochondral sections at day 0, and

after 4 weeks and 10 weeks following implantation. Magnified images are shown in the

right panels. PDGF+ cells were seen at 4 weeks and 10 weeks following implantation,

and were more abundant at 4 weeks. Scale bars: 200 µm (main images) and 100 µm

(magnified images). ....................................................................................................... 35

Figure 3-15. Representative CD-31 stains of osteochondral sections at 4 weeks and 10

weeks. Vascular lumens (indicated by red arrowheads) were seen at 4 weeks but not 10

weeks following implantation. Scale bar: 100 µm. ....................................................... 35

Figure 3-16. Quantitation of PDGF-BB and CD-31 stains. The numbers of PDGF-BB+

cells and CD-31+ area were significantly greater at 4 weeks than at 10 weeks (n=4). . 36

Figure 3-17. Host cells populate the subchondral bone and drive endochondral

ossification. (A) Representative H&E stains of osteochondral sections at day 0 and at 4

weeks following implantation. Sections were stripped of bone marrow (BM) cells in

the subchondral bone prior to implantation by sterile rinsing. Magnified images are

shown in the right panels. The subchondral bone was densely populated with cells at 4

weeks, indicating host involvement. Scale bar: 200 µm. (B) Representative µCT

images of osteochondral sections at day 0 and at 4 weeks following implantation

showing new endochondral bone formation and subchondral bone remodeling. (C) The

lengths of cartilage (determined from representative histologies) and bone (determined

by µCT analysis) showing osteochondral tissue composition before and after

implantations. Cartilage length decreased and bone length increased markedly by 4

weeks following implantation (n=4). (D) Implantation outcomes of cartilage-only

grafts. H&E and Von Kossa stains at day 0 and after 4 weeks of implantation.

viii

Hypertrophic chondrocytes mineralized during implantation without visible

endochondral bone formation. Scale bar: 200 µm. ........................................................ 37

Figure 3-18. Macrophages selectively regulate cartilage and bone turnover. (Left) Cells

expressing classically activated (M1) marker iNOS were observed extensively at the

interface as well as in the subchondral bone region at 4 weeks. At 10 weeks, the

presence of iNOS+ cells persisted near the interface but attenuated in the subchondral

bone. (Right) Cells expressing alternatively activated (M2) marker Arg-1 were

observed extensively at 4 weeks, especially at the interface. At 10 weeks, Arg-1+ cells

were abundant near the interface and lined the newly formed endochondral bone in the

subchondral region. ....................................................................................................... 38

Figure 3-19. Semi-quantitative analyses of iNOS and Arg-1 immunohistochemistry.

Particles were counted using multiple representative frames of binarized images. There

were slightly more iNOS+ cells than Arg-1+ cells at 4 weeks, albeit not significantly.

In contrast, there were more Arg-1+ cells than iNOS+ cells at 10 weeks. .................... 39

Figure 3-20. Summary of ectopic implantation outcomes. Schematics illustrating that

osteochondral tissues comprising articular cartilage (AC) and subchondral bone (SB)

with or without bone marrow (BM) underwent endochondral ossification (EO)

characterized by the replacement of cartilage by bone at the interface. Instead, full-

thickness cartilage mineralized in the deep zone but did not undergo EO. ................... 46

Figure 4-1. Self-assembly methods for cartilage formation by hMSCs. (A) Top, disc

culture: hMSCs were seeded in transwell inserts coated with vehicle control (Veh),

type I collagen (Col1), or type II collagen (Col2); Veh group failed to form discs.

Bottom, pellet culture: hMSCs were seeded in round-bottom wells and formed

spherical aggregates. (B) Representative images of hyaline discs formed in coated

transwells are shown. ..................................................................................................... 52

Figure 4-2. Histology of Col1, Col2, vehicle control and pellet. Poor ECM deposition

in the deep zone was seen in Col2 discs. Vehicle control condensed into a hemisphere.

Type I collagen rich fibrillar structure formed at the surface of the pellet and vehicle

control. Discs exhibited more uniform type II collagen and GAG distribution whereas

GAG was visibly denser at the center of the pellet. Scale bar: 200 µm.. ...................... 59

Figure 4-3. Histology of Col1 and Col2 discs after 17 days and 42 days of

chondrogenic induction. Although both groups formed stratified discs that grew in

thickness and deposited ECM over time, less ECM was observed in the deep zone of

Col2 discs. Scale bar: 200 µm. ...................................................................................... 60

ix

Figure 4-4. Histology comparing lubricin stains. Lubricin was expressed at the entire

pellet surface but only at the top surface of the discs. Scale bar: 50 µm. ...................... 60

Figure 4-5. H&E stains show that Col1 discs seeded at 1.0×106 were thicker than those

seeded at 0.5×106. Scale bar: 200 µm............................................................................ 60

Figure 4-6. Type I collagen stains of pellets at different time points after chondrogenic

induction show initial expression throughout the pellet, and reduction to the surface

layer over time. Scale bar: 200 µm. ............................................................................... 61

Figure 4-7. Mechanical and physical properties of discs formed by self-assembling

hMSCs. (A) Young’s modulus measured by unconfined compressive loading revealed

that Col1 discs outperformed Col2 discs. Increasing seeding density from 0.5×106 to

1.0×106 further improved Col1 discs. (B) Disc thicknesses were comparable for the

Col1 and Col2 discs; increasing seeding density increased the thickness of Col1 discs.

(C) Representative stress-strain curves. Engineered and native tissues exhibited similar

profiles. .......................................................................................................................... 62

Figure 4-8. Biochemical quantification of glycosaminoglycan (GAG), collagen (COL)

and cellular (DNA) contents. (A) Comparisons of Col1 discs, Col2 discs and pellets

after 17 days or 42 days of chondrogenic induction. At day 42, pellets exhibited higher

GAG and DNA contents (per wet weight) and discs exhibited higher COL/DNA and

COL/GAG ratios; Col1 discs had higher GAG and DNA contents than Col2 discs. (B)

Comparisons of Col1 discs at different seeding densities. Doubling seeding density

from 0.5×106 to 1.0×106 increased GAG content (per wet weight) but not COL content.

....................................................................................................................................... 64

Figure 4-9. Gene expression analysis. Data are shown for Col1 discs, Col2 discs and

pellets after 17 days or 42 days of chondrogenic induction (by quantitative real-time

polymerase chain reaction, qPCR). Col2 discs displayed lower expression of

chondrogenic markers at day 17 than Col1 discs. Pellets displayed lower

COL2A1/ACAN ratio and higher expression of COL1A1 than discs at day 42. All gene

expressions, unless otherwise stated, are normalized to GAPDH and expressed as 2-∆Ct.

....................................................................................................................................... 65

Figure 4-10. Overview of implantations. Discs cultured for 6 weeks, 8 weeks or 10

weeks, and pellets cultured for 10 weeks were implanted subcutaneously in mice.

Tissues were explanted after 4 weeks. ........................................................................... 66

x

Figure 4-11. Histological stains showed organization of discs after endochondral

ossification. (Left) Discs were more mineralized with length of culture and mature

bone was seen in 10w4Q discs. Bone formed at the bottom of the discs and the

infiltrating marrow-like cells were observed. This layer was covered by calcified

cartilage, with traces of non-calcified cartilage at the surface. (Right) Whole tissue

sections of pellets after endochondral ossification. Bone formed at the surface, with

infiltrating marrow-like cells beneath gradually resorbing the calcified cartilage. Scale

bar: 200 µm. ................................................................................................................... 67

Figure 4-12. µCT images and quantitative analysis. (Top) Representative images

showing mineralization of discs increased with length of culture. Whereas the discs

formed a sheet of mineral, the pellet formed a spherical shell. (Bottom) Quantitative

µCT analysis. Mineral density and volume increased with the length of culture; 10w4Q

discs exhibited the greatest mineral density and bone volume. ..................................... 68

Figure 5-1. Schematic of the induction regimens. hMSCs seeded in coated transwells

were cultured under isotropic chondrogenic induction for 3 weeks. After 3 weeks,

induction in the basal compartment was switched to a hypertrophic regimen to set up a

dual compartment culture. Isotropic chondrogenic or hypertrophic regimens were

maintained in control groups. All tissues were cultured for up to 10 weeks. ................ 80

Figure 5-2. Histology showing deep mineralization in the CH group (Von Kossa), and

maintenance of hyaline cartilage in both groups (Alcian Blue). Scale bar: 200 µm. .... 85

Figure 5-3. Histology showing widespread loss of GAG (Movats) and peripheral

mineralization (Von Kossa) in the IH group at 10 weeks. Scale bar: 200 µm. ............. 85

Figure 5-4. Transverse brightfield images of whole cartilage discs at 6 weeks (top) and

10 weeks (bottom). IC discs are shown on the left and CH discs are shown on the right.

....................................................................................................................................... 86

Figure 5-5. Histology confirming hyaline cartilage formation at 10 weeks. Uniform

deposition of type II collagen, but not type I collagen. Alcian Blue stains showed rich

GAG deposition. Von Kossa stains showed only the CH group was mineralized in the

deep zone. Scale bar: 200 µm. ....................................................................................... 87

Figure 5-6. Biochemical analyses. Lower DNA content (6 weeks) and GAG content (10

weeks) in the CH group. COL content, GAG and COL productivities (normalized to

DNA) were similar. ....................................................................................................... 88

xi

Figure 5-7. Cleaved caspase-3 expression. Following deep zone hypertrophic induction,

some apoptosis was seen as 6 weeks with incipient mineralization in the deep zone. In

contrast, no apoptosis was seen at 10 weeks, or in the isotropic control groups at both 6

weeks and 10 weeks. Scale bar: 200 µm. ...................................................................... 88

Figure 5-8. Scatter plot showing correlation between GAG and DNA data of both IC

and CH groups at 6 weeks and 10 weeks. Pearson correlation was determined to be

0.53. ............................................................................................................................... 89

Figure 5-9. Mechanical analyses showing similar attributes. The compressive Young’s

modulus and thickness of the CH group was slightly lower. ........................................ 89

Figure 5-10. Biochemical analyses. Significant, near complete loss of GAG in the IH

group at 10 weeks. ......................................................................................................... 90

Figure 5-11. Gene expression analyses of IC and CH groups at multiple time points.

CH group showed increased expression of cartilage homeostasis (SOX9, S100A1),

chondrocyte maturation (COL9A1, COL11A1), terminal differentiation (COL10A1,

RUNX2, SPP), and trophic markers (DKK1, BMP2, IHH) expression. Differences

between groups reached significance at 10 weeks. ACAN and COL2A1 expressions

were similar between groups. All gene expressions (2-∆∆Ct) are normalized to

GAPDH and 2 week controls. ....................................................................................... 91

Figure 5-12. Gene expression analyses of CH, IC, and IH groups at 10 weeks. Cartilage

maintenance markers (ACAN, COL2A1, SOX9) were downregulated and terminal

maturation marker (RUNX2) was upregulated. All gene expressions (2-∆Ct) are

normalized to GAPDH. ................................................................................................. 91

Figure 5-13. Type X collagen immunohistochemical stains and inverted images. Red

arrows indicate band of hypertrophy. Scale bar: 200 µm. ............................................. 92

Figure 5-14. Intensity profile of type X collagen stains showed distinct deep zone peaks

in the CH group. ........................................................................................................ 92

Figure 5-15. Overview of implantation. Tissues cultured for 10 weeks were implanted

for 4 weeks..................................................................................................................... 93

Figure 5-16. Histology of IH and CH discs post- implantation. H&E, Movat’s

pentachrome and Von Kossa stains showed mature bone infiltrated with marrow cells

xii

at the bottom of the IC but not the CH discs. Instead, the CH discs displayed columnar

chondrocytes and tidemark formation. Scale bar: 200 µm. ........................................... 94

Figure 5-17. Quantification of histological comparison. (Top) Segmentation and

quantitation of Movat’s pentachrome stains showed significant fractions of bone and

marrow present in the IC but not the CH group. (Bottom) Quantitation and profiling of

Von Kossa stains showed greater and more extensive mineralization in the IC group. 94

Figure 5-18. µCT analyses of the implanted IC and CH discs. (Left) Reconstructed

µCT images showed extensive mineral deposition in the IC group following

implantation but not the CH group. (Right) The increase in mineral volume was

significantly greater in the IC group than the CH group post-implantation, with a

slightly greater mineral density. .................................................................................... 95

Figure 5-19. Immunohistochemistry of implanted discs. IC group showed type I

collagen deposition, loss of type II collagen, faint lubricin expression in upper and

lower aspects and extensive osteopontin expression. CH group showed homogenous

type II collagen deposition, superficial zone lubricin expression and deep zone

osteopontin expression. PDGF-BB stains revealed pre-osteoclasts/osteoclasts invading

IC but not CH discs. ...................................................................................................... 96

Figure 5-20. Immunohistochemistry of type X collagen and ALP after implantation.

(A) Strong type X collagen expression was seen in the deep zone of the CH group and

near the superficial zone of the IC group that was undergoing endochondral

ossification. (B) ALP was expressed in the deep zone of the CH group and extensively

in the IC group. Scale bar: 200 µm. ............................................................................... 97

Figure 5-21. Immunohistochemistry of SOX9 and RUNX2 expression after

implantation. SOX9 expression was maintained in the upper zone of the CH group and

RUNX2 expression was limited to the deep zone. Instead, trace SOX9 expression and

extensive RUNX2 were seen in the IC group. Scale bar: 200 µm. ............................... 98

Figure 5-22. Biochemical analyses of implanted discs. GAG content of CH group

recovered whereas that of IC group deteriorated post-implantation. COL contents were

similar. ........................................................................................................................... 99

Figure 5-23. Gene expression analyses of implanted discs. Expression of cartilage

maintenance (SOX9, ACAN, COL2A1, COL9A1, COL11A1) and chondrocyte

terminal differentiation (COL10A1, RUNX2) markers persisted in the CH group but

xiii

not the IC group post-implantation. All gene expressions (2-∆Ct) are normalized to

GAPDH. ........................................................................................................................ 99

Figure 5-24. Immunohistochemistry stains of iNOS and Arg-1. iNOS+ and Arg-1+

cells were seen in IC discs where endochondral ossification was occurring, with greater

Arg-1 expression. Superficial zone chondrocytes in the CH discs expressed Arg-1 but

not iNOS. Scale bar: 200 µm.. ..................................................................................... 100

Figure 5-25. Histology of IH discs post-implantation. Extensive endochondral

ossification with bone formation and marrow infiltration from all sides of the tissue.

Scale bar: 200 µm. ....................................................................................................... 101

Figure 5-26. µCT analyses of the IH disc after implantation. (Top) Reconstructed µCT

images of the IH disc after implantation, in comparison with the CH and IC discs. The

implanted IH disc was mineralized everywhere. Scale bar: 1 mm. (Bottom) The IH

discs exhibited higher mineral density (not significant) and mineral volume than the

CH and IC discs. .......................................................................................................... 101

xiv

Acknowledgments

First and foremost, I would like to thank my advisor Gordana Vunjak-Novakovic

for her unfailing support of my current and future plans, and for guiding me through the

difficult periods. Her optimism and passion for her work are truly inspiring

I would further like to thank past and present members of the Laboratory for Stem

Cells and Tissue Engineering: Yiyong, for his encouragement, mentorship and assistance

with the conduct of all my studies; Jon and David, for the conversations and being

mainstays in the osteochondral team; Sarindr, for helping to shape my projects; Sue, for

ensuring that we have what we need; Aonnicha, for her diligence; Bohao, Diogo, Zen,

Jenny, Hesam, Tim, Stephen, Olaia, Ying, Holly, Jinho, Kacey, Keith, Sara, Nina,

Supansa, Ben, Ale, George and Amandine for their friendship and help along the way.

My gratitude also goes to the members of my thesis committee: Kara Spiller, for

being my first mentor in lab and her continuous guidance; Edward Guo, for his

invaluable collaborative effort; Clark Hung and Warren Grayson, whose pioneering work

on osteochondral tissue engineering inspired my projects, for their feedback.

This work would also not have been possible without the full scholarship from the

Agency for Science, Technology and Research (A*STAR Singapore). I am grateful for

my sureties, and all the mentors and administrators of A*STAR.

I am also grateful for my collaborators and friends at Columbia: Bin and Sam, for

their help with µCT scanning and analyses; Milos, Emily, Eben, Andrea, Jen, Arthur,

Mike, and Sau Yin, for making graduate school more enjoyable; Redeemer Presbyterian

Church, for teaching me God’s words and helping me to find my worth in Jesus.

I would also like to thank my friends in Singapore who helped reinvigorate me

every time I went home: Karen, Shona, Joanna, and Sarah for sharing in the precious

weddings (with Kenneth and baby Talia, Steve, Wayne); Malvin, Ben, XinKai, Clemens,

Joseph, Zhi Wei (and baby Gabrielle), Cheng Hui, Norbert and Eugene for being the

most enduring group of buddies; Peiyi, Nicole (and baby Zachary), Jaehee, Sharon,

Jayce, Kawa, Lionel, Yan Chuan, Alex, Jon, Katrina, Jingwei, Hong Li, and Yisin for

their friendship since the Illinois years; Yuming (and baby Edward), Jasmin, Simeon, and

the Sapporo group, for staying in touch all these years

Finally, I thank the loving support of my parents, my brother (and Desmond), my

god-parents, my god-siblings and the love of my life, Susie. All the work in the world

would not mean a thing without your generous and self-giving love.

xv

To God be the glory, for the things He has done.

1

Chapter 1

Background

1.1 Cartilage Development

During development, the primordial limb bud consists of an uninterrupted

mesenchymal pre-chondrogenic condensed mesenchymal structure [1-3]. Cell

aggregation is mediated by morphogenetic factors such as transforming growth factor

beta (TGF-β) and adhesion factors such as fibronectin and type I collagen. Cell-to-cell

interactions mediated by adhesion molecules such as N-cadherin in turn upregulates the

expression of chondrogenic genes such as SOX-9 and boundary proteins such as tenascin

(Fig. 1-1). The condensed mesenchymal cells continue to proliferate prior to

differentiation into chondroblasts [1].

Progression to differentiation phase is mediated by downregulation of genes

controlling cell-to-cell binding and proliferation, and upregulation of bone morphogenetic

proteins (e.g. BMP-2, BMP-4). Exposure of BMP-2 to chondroprogenitor cells enables

chondroblast differentiation, bypassing a condensation phase. BMP activity is

antagonized by Noggin, which provides negative feedback and enables joint formation

between skeletal elements. As the mesenchymal cells differentiate into chondroblasts,

they deposit extracellular matrix rich in type II collagen and glycosaminoglycan

(GAG)[1].

2

Figure 1-1. A summary of major genes associated with the stages of mesenchymal condensation during

cartilage development: Initiate, Set Boundary, Proliferate, Adhere, Grow, and Differentiate. TGF-β

mediates condensation, driving the expression of Sox-9 during early chondrogenesis. BMPs mediate overt

chondroblast differentiation and is regulated by Noggin for joint formation between skeletal elements.

Adapted from Hall et al [1].

Figure 1-2. Schematic diagram of joint formation. Interzone appears and forms within an uninterrupted

condensed mesenchymal structure, and cavitation within the interzone gives rise to the joint capsule.

Adapted from Pacifici et al [2].

3

Interzone cells forming the synovial joints appear in the cartilaginous anlage and

cavitation within the interzone gives rise to the joint capsule (Fig. 1-2). Subsequently, the

differentiation of proliferating chondroblasts into chondrocytes and hypertrophic

chondrocytes is regulated by signaling pathways involving Indian hedgehog (Ihh), which

induces the expression of parathyroid hormone related peptide (PTHrP) that provides

negative feedback to regulate Ihh activity[1, 3].

Thus, the developing cartilage comprises zones with morphologically distinct

chondrocytes including the permanent (resting) zone, and the transient (proliferating, pre-

hypertrophic and hypertrophic) zones. Hypertrophic chondrocytes trigger vascular

invasion, and deposits mineral to create a bone template (Fig. 1-3). Osteoblasts remodel

the template with osteoclasts into mature bone. This process of endochondral ossification

is used in the growth plate, and drives bone elongation during skeletal development. The

mature articular cartilage consists of a superficial layer, a radial layer, and a calcified

layer which bridges it with the subchondral bone (Fig. 1-3) [3].

Figure 1-3. Histology of a developing (a) and a mature articular cartilage (b) of the tibial plateau in 2-weeks

(a) and 3-months (b) old mice. (a) The developing articular cartilage is characterized by zones with

morphologically distinct chondrocytes: resting, proliferating, pre-hypertrophic, and hypertrophic. (b) The

mature articular cartilage has a calcified interface layer bridging the subchondral bone to the cartilage

comprising superficial, transition and radial layers. Adapted from Iwamoto et al [3].

4

1.2 Clinical Problem

The articular cartilage is essential for joint function and quality of life. It lines

bone ends in the synovial joints, provides lubrication, and cushions impacts. However, it

is also avascular and has a limited capacity to regenerate upon skeletal maturation. Once

damaged, recovery of structure and function is difficult and degeneration with age and

injury is common. Osteoarthritis is a degenerative joint disease affecting 33.6% of people

above 65 years old in the U.S. characterized by progressive loss of the articular cartilage

and underlying bony changes, causing movement limitation in 80% of patients [4, 5].

Full-thickness chondral lesion (grade III, IV) is a common articular cartilage

injury [6]. Current treatment approaches include debridement and lavage, marrow

stimulation techniques such as microfracture, cell-based therapies such as autologous

chondrocyte implantation (ACI), and osteochondral autografts and allografts [7-9].

Depending on the size of the lesion, a treatment algorithm has been proposed [10].

Although microfracture is a common procedure for smaller sized chondral

lesions, it is not restorative and often results in the formation of fibrocartilage with

inferior mechanical properties [11, 12]. Although ACI is a clinically approved procedure

currently marketed by Vericel as Carticel, it does not consistently promote hyaline

cartilage repair [9, 13]. Furthermore, the periosteal flap that overlays the injected

chondrocytes and supports cartilage formation is prone to arthrofibrosis and hypertrophy

[9, 14]. Long-term follow ups on survivors of microfracture and ACI found no

significant difference in clinical scores between the treatment groups. Importantly, 57%

5

of patients who received ACI and 48% of patients treated with microfracture displayed

radiographic evidence of early osteoarthritis at 15 years post procedure [15]. Thus, the

risk of treatment failure necessitates the development of other treatment modalities.

Figure 1-4. Treatment algorithm for cartilage lesions. MFX: Microfracture, OATS: Osteochondral

autograph transfer, OCA: Osteochondral allografting. ACI: Autologous chondrocyte implantation. Adapted

from Cole et al.

Although osteochondral autografts transfer can be restorative, the use of

autografts is limited in their availability, size, shape, and donor site morbidity. The use of

allografts permits repair of larger lesions but requires sourcing from cadavers and

immunosuppression. The shortcomings of current treatment approaches have motivated

new treatment modalities in the form of living cartilage replacements grown from cells

by tissue engineering [16]. In particular, the use of chondrocytes and mesenchymal stem

cells (MSCs) for cartilage tissue engineering (TE) has been widely investigated.

6

1.3 Cartilage Tissue Engineering and Its Challenges

1.3.1 Chondrocytes-Based Methods

In cartilage TE, scaffolding materials such as agarose, alginate, polyglycolic acid

(PGA), poly-L-lactic acid (PLLA), type I and II collagens have been used with

chondrocytes to great effect [17-20]. As well as trophic factors such as TGF-β,

deformational loading enhanced cartilage formation from chondrocytes in vitro to

achieve properties approximating those of native tissues [21, 22].

Figure 1-5. Schematics of NeoCart production and implantation. Adapted from Crawford et al [23].

The clinical relevance of cartilage TE is exemplified by NeoCart, a tissue

engineered cartilage implant grown in vitro by seeding autologous chondrocytes in type I

collagen scaffolds and culturing in a bioreactor (Fig. 1-4). Studies in a porcine model

7

demonstrated hyaline-like cartilage repair of full-thickness femoral cartilage defects with

NeoCart [23]. Preclinical success motivated clinical Phase I and II trials showing the

safety and efficacy of NeoCart for the repair of full-thickness cartilage injuries [23, 24].

Still, the use of chondrocytes has its limitations. It is well documented that

chondrocytes have a limited proliferative ability in vitro and are prone to de-

differentiation with prolonged culture [19]. Furthermore, articular cartilage needs to be

harvested from another non-load bearing site, which could result in donor site morbidity

and other complications.

1.3.2 Engineering Cartilage from MSCs

Mesenchymal stem cells (MSCs) are an attractive alternative cell source that can

be harvested from a variety of tissues. Despite source-dependent variability, they can

readily proliferate and differentiate into multiple skeletal lineages in vitro [25, 26].

However, attempts to use scaffolding materials to engineer cartilage from MSC have only

found limited success. Particularly, MSCs seeded in agarose formed cartilage tissues with

subnormal properties when held in direct comparisons with chondrocytes [27, 28].

Still, long-term culture with TGF-β supplementation, deformational loading,

osmotic loading and enzymatic treatment have been shown to improve properties of

cartilage grown from MSCs [27-30]. The incorporation of native glycosaminoglycans

such as hyaluronic acid and chondroitin sulfate by into hydrogels also enhanced

chondrogenesis [31-33]. Scaffolds with architecture mimicking that of native cartilage

8

matrix, such as interlocking woven polycaprolactone (PCL), also supported cartilage

formation from MSCs to result in large anatomically shaped joint surface [34]. To

enhance cartilage formation, these scaffolds can also be modified to deliver bioactive

cues via incorporation of native molecules such as N-cadherin or viral vectors to drive

endogenous TGF-β expression [35, 36].

1.3.3 Self-Assembly Methods

Tissue engineering relies on biological principles to recapitulate tissue formation

in vitro with physiologic likeness. Not surprisingly, biomimetic methods have been

shown to enhance cartilage formation from MSCs by recapitulating some aspects of the

native microenvironment. Developmental studies highlighting the importance of

mesenchymal condensation have motivated self-assembly methods to engineer cartilage

without scaffolding material in vitro. In the earliest examples of self-assembly culture,

chondrocytes seeded in culture inserts deposited cartilaginous matrix and formed hyaline

cartilage discs over time under chondrogenic induction [37, 38].

Similarly, self-assembly methods have also been adapted successfully to grow

cartilage from MSCs. In pellet culture, MSCs aggregate and deposit cartilaginous matrix

to form spheres following induction with TGF-β supplementation. This process

recapitulates the cellular and molecular events during chondrogenesis [39, 40]. Our

laboratory recently showed that pellets turned into free-forming cartilage tissues with

physiologic likeness (Fig. 1-5A) [41]. The pellets formed condensed mesenchymal bodies

resembling the prechondrogenic mesenchyme, and they could be fused prior to the onset

9

of boundary proteins to form large, functional and stratified articular cartilage on

decellularized bone following prolonged chondrogenic induction. In disc culture,

multiple layers of MSCs deposit cartilaginous matrix to form discs when compacted (Fig.

1-5B) [42, 43]. Interestingly, comparative studies provide some evidence that disc culture

results in better hyaline cartilage formation from MSCs than pellet culture [42, 43].

Figure 1-6. Self-assembling MSCs in chondrogenic culture form cartilage layers in osteochondral

constructs. (A) MSCs differentiated in membrane culture form stratified cartilage on CPP scaffold. (B)

MSCs differentiated in pellet culture and fused to form stratified cartilage on decellularized bone. Adapted

from Lee et al and Bhumiratana et al.

10

1.3.4 Stability of Engineered Cartilage In vivo

Despite recent advances in materials and methods, cartilage tissues engineered

from MSCs lack stability in vivo. During ectopic implantation, cartilage tissues grown

from MSCs undergo endochondral ossification. This is characterized by extensive

mineralization of the cartilaginous matrix, and the formation of mature bone around a

bone marrow cavity.

Figure 1-7. Histology of implanted cartilage tissues formed from chondrocytes (top row) and BMSCs

(bottom row). Stains for proteoglycans (Alcian blue) (A and F), calcium (alizarin red/fast green) (B and

G), type II collagen (C and H), type X collagen (D and I), and type I collagen (E and J) are shown.

Cartilage tissues formed from chondrocytes do not undergo endochondral ossification. In contrast, cartilage

tissues formed form BMSCs undergo endochondral ossification. Adapted from Pelttari et al [44].

Interestingly, a study on the in vivo outcomes of cartilage tissues grown from

MSCs found that the spontaneous expression of type X collagen by MSCs after

prolonged chondrogenic induction correlated with endochondral ossification (Fig. 1-5).

This suggests that endochondral ossification is mediated by spontaneous differentiation

of MSCs into hypertrophic chondrocytes during in vitro chondrogenesis. Instead,

11

chondrocytes did not express type X collagen and cartilage tissues grown from

chondrocytes are stable in vivo [44]. Interestingly, the proneness of cartilage formed from

MSCs to undergo endochondral ossification has motivated a new strategy to repair bone

defect using a cartilage template formed from MSCs [45-48]. However, more effective

strategies are needed to that ensure that cartilage grown from MSC can be maintained for

lasting cartilage repair [49, 50].

12

Chapter 2

Goals, Rationale and Approach

2.1 Goals

Although there is a need to engineer cartilage replacements from adult stem cells,

current methods do not adequately address existing challenges. Scaffolding methods used

successfully with chondrocytes have found limited success when used with MSCs. While

self-assembly methods have been shown to form stratified and functional cartilage from

MSCs, culture parameters are not well defined and the in vivo outcomes of cartilage

tissues grown using different methods have not been investigated. Further, recapitulation

of a mature articular cartilage phenotype has not been achieved, presumably due in part

to the failure of isotropic culture to recapitulate spatiotemporal aspects of native cartilage

development. As the in vivo outcomes of engineered cartilage tissues ultimately

determine the experimental success, there is also a need for a convenient model that

evaluates the tissues in a physiologically relevant way.

The goal of this dissertation is to establish an ectopic implantation model for

studying the development of osteochondral tissues in vivo, regulate the in vitro

development of cartilage engineered from hMSCs, and study the in vivo maturation of

engineered cartilage via ectopic implantation.

13

2.1 Hypothesis

The proposed hypothesis is that ectopic implantation is useful for studying

maturation of osteochondral tissues in vivo, and recapitulation of physiological

development can result in the formation of cartilage from hMSCs with native-likeness in

vitro and in vivo. Specifically, subcutaneous implantation in a mouse can recapitulate

endochondral ossification associated with native development. Cartilage disc formation

from self-assembling hMSCs can be controlled by the ECM coating of the membrane and

the culture regimen to resemble the native articular cartilage. The stability and

organization of cartilage discs can be improved by implementing a spatiotemporally

regulated regimen that induces superficial zone maintenance and deep zone maturation.

2.3 Overall Approach and Specific Aims

The overall investigational approach was to develop a method for engineering

stable and organized cartilage from self-assembling hMSCs, and study the in vivo

outcomes of native and engineered cartilage subcutaneously in a mouse. To achieve that,

the research in this dissertation is divided into three coordinated aims: (i) establish an in

vivo model by studying juvenile bovine osteochondral tissues in the subcutaneous

environment of a mouse and showing that ectopic implantation recapitulates native

endochondral ossification (Aim 1), (ii) develop a robust method for engineering

physiologic cartilage discs from self-assembling hMSCs by regulating the ECM coating

and culture regimen (Aim 2), and (iii) improve the organization and stability of cartilage

discs by implementing spatiotemporal control during induction in vitro (Aim 3).

14

Aim 1: Investigate subcutaneous implantation in mice as an ectopic model for

studying osteochondral tissues in vivo

Rationale

Subcutaneous implantation has been used to study the in vivo maturation of

standalone cartilage and bone tissues. Chondrocytes form cartilage that resists

endochondral ossification whereas hMSCs form cartilage that undergo endochondral

ossification into an ossicle engrafting hematopoietic cells. However, it is unclear whether

the ectopic process recapitulates native endochondral ossification. During skeletal

development, endochondral ossification occurs at the cartilage-bone interface and the

endochondral bone is remodeled into trabecular bone containing marrow. This aim

investigated the directionality and dynamics of endochondral ossification in juvenile

osteochondral tissues during subcutaneous implantation, highlighting similarities and

differences between the ectopic and native processes.

Approach

Age-matched juvenile osteochondral tissue slices were harvested from bovine

femoral condyles and implanted subcutaneously in immunocompromised mice.

Explanted tissues following different lengths of implantation were analyzed

histomorphometrically and radiographically, and compared with native adult tissues.

Cartilage and bone turnover, including changes in bone parameters, were examined. The

involvements of vascularization, osteoclastogenesis, and inflammation were also

investigated and correlated with tissue turnover to propose a mechanism.

15

Aim 2: Develop a robust self-assembly method for making cartilage discs from

hMSCs and evaluate the in vitro and in vivo outcomes

Rationale

Pellet culture of hMSCs recapitulates mesenchymal condensation and serves as a

convenient method for studying chondrogenesis in vitro. However, pellet culture tends to

from fibrocartilaginous tissues that lack stratification of the native articular cartilage and

are prone to endochondral ossification in vivo. Recent studies showed that disc culture

promotes stratified hyaline cartilage formation from self-assembling hMSCs. Still, the

effects of important culture parameters are not well understood, and culture regimens

remain poorly defined. This aim investigated the effects of ECM coating and seeding

density on disc formation from self-assembling hMSCs, compared the composition and

organization of discs and pellets in vitro and in vivo, and established the effects of

prolonged chondrogenic induction on maturation of cartilage discs in vivo.

Approach:

To induce disc formation, hMSCs were compacted in transwell inserts on

membranes with or without ECM coating at different seeding densities. The ability of the

self-assembling hMSCs to form discs and the properties of the discs formed under

different conditions were assessed. Discs and pellets were evaluated for compositional

and organizational differences in vitro and in vivo. The effects of prolonged chondrogenic

induction on maturation of cartilage discs in vivo were studied by culturing discs for

different lengths of time prior to implantation.

16

Aim 3: Improve the organization and stability of cartilage discs by implementing

spatiotemporal regulation during induction

Rationale

Cartilage development is regulated by complex crosstalk among multiple

signaling pathways and across different tissue zones. This results in cartilage

maintenance in the superficial zone, proliferation of chondrocytes in the middle zone and

hypertrophic maturation of chondrocytes leading to mineralization in the deep zone.

However, current methods to grow cartilage in vitro rely on isotropic culture which fails

to recapitulate spatiotemporal gradients present natively. Consequently, cartilage

engineered from hMSCs was prone to turnover and failed to retain organization

resembling the native articular cartilage upon implantation. This aim investigated the

effects of spatiotemporal regulation in vitro on the function, organization and stability of

cartilage engineered from hMSCs, and showed that spatiotemporal regulation in vitro

recapitulated some aspects of native development and promoted physiologic likeness.

Approach

Cartilage discs were formed in transwell inserts by compacting multiple layers of

hMSCs and maintained in isotropic culture or dual compartment culture. Concurrent

maintenance of hyaline cartilage and deep zone mineralization were induced via selective

application of key trophic factors in the dual compartment culture. Discs formed under

spatiotemporal regulation were evaluated in vitro and in vivo, and compared with control

discs formed in isotropic culture.

17

Chapter 3

Subcutaneous implantation in mice as an ectopic model

for studying osteochondral tissues in vivo

3.1 Abstract

Subcutaneous implantation in a mouse can be used to investigate tissue

maturation in vivo. Here, we demonstrate that this simple model can recapitulate

endochondral ossification associated with native skeletal development. By histological

and µCT analysis, we investigated morphological changes of immature bovine

osteochondral tissues over the course of subcutaneous implantation in

immunocompromised mice for up to 10 weeks. We observed multiple similarities

between the ectopic process and native endochondral ossification: (i) permanent cartilage

retention in the upper zones, (ii) progressive loss of transient cartilage accompanied by

bone formation at the interface, and (iii) remodeling of nascent endochondral bone into

mature cancellous bone. Importantly, these processes were mediated by

osteoclastogenesis and vascularization, and modulated by inflammation. Taken together,

these findings advance our understanding of how the simple ectopic model can be used to

study phenotypic changes associated with endochondral ossification of native and

engineered osteochondral tissues in vivo.

18

3.2 Introduction

The articular cartilage consists of a superficial zone that forms permanent

cartilage and a transient deep zone originating from the developing epiphysis that

undergoes endochondral ossification prior to skeletal maturity [2]. During endochondral

ossification, chondrocytes at the cartilage-bone interface stop proliferating, differentiate

and hypertrophy before calcifying [51]. Subsequently, the calcified cartilage forms a

template for bone formation by osteoprogenitors [52]. To develop a model for

understanding the in vivo maturation of osteochondral tissues, we were interested if

subcutaneous implantation in mouse can recapitulate endochondral ossification

associated with native skeletal development.

Subcutaneous implantation in a mouse is a model commonly used to evaluate

biocompatibility and tumorigenicity [53, 54], and also to study the in vivo fate of cells in

cartilage or bone [44, 55-57]. In this model, articular chondrocytes formed stable

cartilage whereas growth plate chondrocytes underwent endochondral ossification [44,

49, 58, 59]. Instead, mesenchymal stem cells (MSC) formed fibrous tissue or underwent

endochondral ossification, depending on the extent of in vitro chondrogenic

differentiation [44, 50]. Interestingly, MSC formed cartilage that resembled a fracture

callus with prolonged chondrogenic differentiation, and underwent endochondral

ossification reminiscent of that seen during native long bone repair [45-47]. Such insights

have motivated new strategies in bone tissue engineering for healing long bone defects

[48].

19

Although subcutaneous implantations of cartilage and bone are well documented,

no study has yet investigated the ectopic fate of osteochondral tissue. We hypothesized

that subcutaneous implantation can cause phenotypic changes in immature osteochondral

tissues that recapitulate endochondral ossification associated with skeletal development.

Specifically, we investigated if the following developmental features can be

recapitulated: (i) the retention of permanent cartilage in the upper zone, (ii) the

progressive replacement of transient cartilage by bone at the interface, and (iii) the

remodeling of the nascent endochondral bone into mature cancellous bone.

To test our hypothesis, we studied the changes in juvenile bovine osteochondral

tissues implanted subcutaneously in immunocompromised mice for up to 10 weeks. By

analyzing morphological changes, we show that subcutaneous implantation in mouse can

indeed cause the replacement of cartilage by endochondral bone at the interface in

immature osteochondral tissues, in a process that recapitulates endochondral ossification

characterized by cartilage and bone turnover, and extensive endochondral bone

remodeling. Notably, we identified osteoclastogenesis and vascularization as important

mediators, similar to the hallmarks of native endochondral ossification. Changes in the

expression of inflammatory markers were also observed over time. We also noted some

interesting differences in the fate of cartilage implanted with and without subchondral

bone components. Thus, we propose that that the simple ectopic model can be used to

study endochondral ossification of native and engineered osteochondral tissues.

20

3.3 Materials and Methods

3.3.1 Sample Preparation

Juvenile bovine osteochondral explants (4 mm in diameter) were obtained from

the femoral condyles of 2 month old bovine calves (Green Village Packing Company) by

drilling and rinsing with sterile phosphate buffer solution (PBS). Excess subchondral

bone was trimmed from the explants so that the length of the explants (cartilage and bone

inclusive) was approximately 9 mm.

Explants were incubated in PBS with 2% antibiotic-antimycotic at 37˚C for an

hour to ensure sterility. Subsequently, two identical axial sections measuring 4 mm x

1mm x 9 mm were sectioned from each osteochondral cylinder (Fig. 4-1). Prior to

implantation, the sections were cultured for 2 days in high-glucose Dulbecco’s modified

Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1%

antibiotic-antimycotic. For histological comparison, osteochondral tissues from skeletally

mature cows (2 year old) were also obtained by slicing with a band saw.

For comparison between pre and post implantations, one section from each

explant was fixed in 10% formalin and kept for subsequent analysis while the other one

was rinsed in PBS just before implantation. To investigate the role of the subchondral

components, subchondral bone marrow was removed some osteochondral tissues by

sterile flushing as described previously, and cartilage explants were also prepared by

removing the whole subchondral bone [17].

21

3.3.2 Subcutaneous Implantation in SCID Mice

Animal study was done following an IACUC approved protocol at Columbia

University. Explants were implanted into subcutaneous pouches of female SCID mice

aged 8-10 weeks (Jackson Laboratory). Two incisions were prepared on the backs of the

mice, and a blunt forceps was used to create a pocket in the subcutaneous space inserting

the explant sections. After implantation, wounds were closed with two sutures and mice

were monitored daily. No signs of discomfort were observed following surgery in any of

the experimental animals throughout the study. Samples were explanted at 4 weeks and

10 weeks, fixed in 10% formalin and analyzed. All animal experiments followed federal

guidelines and were conducted under a protocol approved by the Columbia University

Animal Care and Use Committee.

Figure 3-1. Experimental design. 4mm diameter cylindrical cores were harvested from juvenile (2 month

old) bovine femoral condyles and sectioned in the axial direction into 1mm slices. One slice from each core

was fixed for analysis and one slice was implanted subcutaneously in immunocompromised mouse for 4

weeks or 10 weeks.

22

3.3.3 Histologic Evaluation and Analysis

All samples were fixed in 10% formalin for 24 hours, and except for cartilage-

only samples, decalcified using Immunocal (Fisher Scientific). Subsequently, samples

were dehydrated in ethanol, embedded in paraffin and sectioned to 5 µm thick. Sections

were stained for (i) Hematoxylin and Eosin (H&E), (ii) Movat’s Pentachrome, (iii) Von

Kossa with Nuclear Fast Red, or (iv) tartrate resistant acid phosphatase (TRAP) with 1%

Alcian Blue (pH 1.0). All reagents unless otherwise specified were from Sigma, Aldrich.

Immunohistochemical analyses were performed using the following antibodies:

type X collagen (Abcam, U.S.A.), PDGF-BB (Abcam), and CD31 (BD Pharmingen,

U.S.A.). Dilutions of antibodies were prepared as recommended by manufacturers

(1/1000 for type X collagen, 1/100 for PDGF-BB and CD31, and 1/500 for iNOS and

Arginase-1). Antigen retrieval was performed with pronase E and hyaluronidase

treatment for type X collagen, and 10 mM citrate buffer (pH 6.0) for all other markers.

Sections were blocked with serum in PBS and incubated with primary antibody solution

overnight at 4 ˚C. Immunobinding was detected with biotinylated secondary antibodies

using the Vectastain ABC kit and sections were counterstained with hematoxylin (Vector

Laboratories). All images were acquired using an Olympus FSX-100 microscope. To

quantitatively compare staining, corresponding images were balanced and analyzed using

ImageJ (National Institutes of Health). TRAP and PDGF-BB stains were deconvoluted

using an ImageJ plugin, set to a threshold, and positively stained cells were counted as

particles (Fig. 3-2).

23

Figure 3-2. Image processing method for quantitatively comparing histological stains. Images of

immunostains were (A) deconvoluted using an ImageJ plugin to isolate the color of interest, (B)

thresholded to identify the cells and (C) cells were counted. Representative deconvoluted images and

particle counts are shown for the TRAP (A-C) and a PDGF-BB (D) stains.

3.3.4 Micro CT imaging (μCT) and morphological analysis

All samples were fixed in 10% formalin for 24 hours at room temperature.

Following fixation, the samples were rinsed in PBS. High-resolution three-dimensional

(3D) images were obtained for each sample using a VivaCT 40 system (SCANCO

Medical AG). The grayscale images were binarized using a global thresholding

technique. Standard morphological parameters such as the bone volume fraction (BVF)

and bone mineral density (BMD) were measured for each sample using the standard

morphological analysis software on the VivaCT 40 system. To obtain axial profiles of the

BVF and BMD, 200 µm thick segments were evaluated across the entire axial length of

the tissue samples (Fig. 3-3).

24

Figure 3-3. Method to determine spatial profiles of MD and BVF in the subchondral bone. MD and BVF of

200-µm segments were determined by manual contouring of each segment. Results were plotted with

respect to the length of the subchondral bone from bottom to top.

3.3.5 Individual Trabecular Segmentation (ITS)-based morphological analyses

A complete volumetric decomposition technique was applied to segment the

trabecular bone network into individual trabecular plates and rods, as in our previous

studies [18, 19]. Briefly, the surface and curve skeleton of the trabecular bone

microstructure were first extracted through an iterative thinning process, while preserving

the topology and morphology of the original microstructure. Then, the entire skeleton

was decomposed into individual plate and rod skeletons, with each skeletal voxel

uniquely identified as either a plate or a rod, based on digital topological classification,

using an iterative reconstruction method.

25

The plate- and rod-specific morphological parameters of the trabeculae were

measured as follows. Plate and rod tissue fraction (pBV/BV and rBV/BV) were

calculated as the total volume of plate and rod bone volume divided by the total bone

volume. The number of plates and rods was quantified by the corresponding number

densities (pTb.N and rTb.N, mm−1). The average size of plates and rods was quantified as

the plate and rod thicknesses (pTb.Th and rTb.Th, mm), plate surface area (pTb.S, mm2),

and rod length (rTb.L, mm). The intactness of the trabecular network was characterized

by the plate–plate, plate–rod, and rod–rod junction density (P-P, P-R, and R-R Junc.D,

mm−3), calculated as the total number of junctions between trabecular plates or rods per

unit volume.

3.3.6 Statistical Analysis

The results of quantitative μCT analysis and semi-quantitative image analysis

were presented as a mean ± SEM (n=4). Statistical analysis was performed with Prism

(GraphPad, U.S.A.) using the Student t-test with the Holm-Sidak correction for multiple

comparisons, one-way ANOVA with Tukey post hoc analysis, or two way ANOVA with

Bonferroni post hoc analysis (α=0.05). The p-values were reported for statistically

significant differences between the groups.

26

3.4 Results

3.4.1 Juvenile osteochondral tissues undergo endochondral ossification during ectopic

implantation

Native juvenile osteochondral tissues were harvested from bovine femoral

condyles and implanted subcutaneously in immunocompromised mice for 4 weeks and

10 weeks (Fig. 3-1). Following implantation, the osteochondral tissues displayed

cartilage retention in the upper zone and endochondral bone formation in the deep zone,

in continuity with the pre-existing subchondral bone (Fig. 3-4). The replacement of

cartilage by bone at the interface progressed axially towards the articular surface.

Figure 3-4. Representative H&E stains of osteochondral sections at day 0, and after 4 weeks and 10 weeks

of subcutaneous implantation, and of a skeletally mature cow (2 year old). Articular cartilage and

subchondral bone are denoted as AC and SB. Deep zone cartilage was replaced by endochondral bone at

the interface. Trabeculation was nascent in the subchondral bone at 4 weeks and well established at 10

weeks. Scale bar: 200 µm.

27

There was no significant change in the total length of the graft, suggesting a lack

of interstitial cartilage growth during the implantation (Fig. 3-5). Most endochondral

bone formation occurred over the first 4 weeks of implantation, by which time the

cartilage length decreased and the bone length increased by approximately 1.2 mm each.

In comparison, the corresponding change in the cartilage length (decrease) and bone

length (increase) were 2 mm each over the total of 10 weeks of implantation (Fig. 3-5).

Figure 3-5. Changes in tissue length and composition. (Top) Representative photographs of whole tissue

sections at day 0, after 4 weeks and 10 weeks of implantation. Scale bar: 1 mm. (Bottom) Length of

cartilage determined from representative histologies, and length of bone determined by µCT analysis,

showing osteochondral tissue composition before and after implantation. Cartilage length decreased and

bone length increased apparently by 4 weeks, and significantly at 10 weeks, respectively (n=4).

28

Morphological analysis revealed that hypertrophic chondrocytes were initially

abundant at the interface, but their presence was markedly reduced by 4 weeks following

implantation and was barely visible after 10 weeks of implantation. Similarly, the

expression of type X collagen at the interface was observed at day 0 and after 4 weeks

but attenuated after 10 weeks of implantation (Fig. 3-6).

Figure 3-6. Representative type X collagen stains of osteochondral sections at day 0, after 4 weeks and 10

weeks of implantation. Hypertrophic chondrocytes (indicated by red arrowheads) were observed initially at

the interface, but diminished over time. Scale bar: 200 µm.

Using osteochondral tissue explanted from a skeletally mature animals (2 year old

cows) as a benchmark, we found that ectopic implantation did not progress to the extent

of native skeletal maturity. The final cartilage thickness (~4 mm) did not reach that of a

fully mature native articular cartilage (~2 mm), suggesting ectopic implantation

recapitulated the early but not the final stages of endochondral ossification reminiscent of

native skeletal development. High turnover of cartilage and bone over the first 4 weeks

29

was followed by bone remodeling between 4 weeks and 10 weeks of implantation. Bone

trabeculation was nascent after 4 weeks of implantation, progressing throughout the

mature subchondral region, as evidenced at the 10-week time point by cancellous bone

interspersed with fatty marrow spaces (Fig. 3-4).

3.4.2 Ectopic endochondral ossification recapitulates tissue properties of juvenile

subchondral bone

The newly formed endochondral bone and subchondral bone were further

investigated by the Movat’s pentachrome staining (Fig. 3-7) and quantitative μCT

imaging (Fig. 3-8), to reveal differences in bone architecture in the subchondral region.

Figure 3-7. Representative Movat’s pentachrome stains of osteochondral tissues at day 0, and after 4 weeks

and 10 weeks of implantation. Scale bar: 200 µm.

30

Figure 3-8. Representative µCT images of osteochondral tissues at day 0, and after 4 weeks and 10 weeks

of implantation. Scale bar: 1mm.

To quantify these differences, 200 μm segments of the subchondral bone at

different time points were analyzed lengthwise by µCT. Bone in the deeper subchondral

region that has been remodeled exhibited higher mineral density (MD) in the range of

700 – 800 HA/cm3 whereas bone closer to the interface had a lower MD in the range of

550 – 700 HA/cm3 (Fig. 3-9). Interestingly, the newly formed endochondral bone at the

interface seen at 4 weeks and 10 weeks following implantation displayed similar MD

profiles to those of the native bone. Also, the MD of subchondral bone in the deeper

region that originated from the pre-existing subchondral bone increased significantly at

10 weeks.

Conversely, the deeper subchondral region exhibited a lower bone volume

fraction (BVF = 0.1 – 0.2) relative to the interface (BVF = 0.2 – 0.3). Although the BVF

profiles were similar, the newly formed endochondral bone at the interface had BVF

values below those measured for the initial native bone (BVF= 0.4 – 0.55) (Fig. 3-9).

31

Figure 3-9. Spatial profiles of the mineral density (MD) and bone volume fraction (BVF) of the

subchondral bone at day 0, after 4 weeks and 10 weeks of implantation. The 4 weeks group is shown in a

lighter shade for ease of comparison between day 0 and 10 weeks. Newly formed bone at the interface

exhibited higher BVF and lower MD than native bone, whereas the bone in the deeper region exhibited

significantly higher MD and lower BVF after remodeling (*p<0.05; **p<0.01; n=4).

In addition to standard morphological analysis, ITS-based analysis highlighted

key differences between the subchondral bone before and after ectopic implantation.

Whereas plates (shown in green) were initially predominant, rods (shown in red) were

vastly more abundant at 10 weeks due to extensive bone remodeling (Fig. 3-10).

32

Figure 3-10. Visualization of plates (green) and rods (red) identified from µCT images of osteochondral

tissues at day 0 and 10 weeks. Plates were predominant at day 0, whereas rods where predominant at 10

weeks

Figure 3-11. ITS-based analysis showed significant decrease in the plate volume and density, increase in

the rod volume and density, and increase in the rod-rod junction density (****p<0.001; n=4).

33

This was documented by the decreasing bone volume fraction of plates (pBV/BV

= 0.76 to 0.22) and increasing volume fractions of rods (rBV/BV = 0.24 to 0.78).

Similarly, the density of plates decreased from 3.79 mm-1 to 2.24 mm-1 while the

density of rods increased from 3.32 to 4.17 mm-1 (Fig. 3-11). Besides substantial

decrease in the density of junctions between plates and between plates and rods (P-P and

P-R), the junction density between rods (R-R) also increased (from 16 to 62 mm-1).

Consistently, the plate surface area (pTb.S) and the trabecular thickness (pTb.Th and

rTb.Th) also decreased, whereas the rod length (rTb.l) increased.

3.4.3 Osteoclastogenesis and vascularization mediate ectopic endochondral ossification

TRAP staining revealed a vast presence of TRAP+ cells after 4 weeks of

implantation that was attenuated by 10 weeks (Fig. 3-12). Comparing multiple regions

across multiple samples, the number of TRAP+ cells in the subchondral bone decreased

significantly by more than 70% from 4 weeks to 10 weeks following implantation (Fig.

3-13). As mononuclear TRAP+ cells (pre-osteoclasts) form larger multinuclear cells

(osteoclasts) during osteoclastogenesis, we counterstained TRAP with DAPI and

compared pseudo-colored stains to detect increased presence of large multinuclear

osteoclasts [60]. Corresponding to the greater number of TRAP+ cells, the TRAP-stained

areas that are indicative of the osteoclast maturation were significantly larger at 4 weeks

than at 10 weeks following implantation (Fig. 3-13). Notably, the numbers of large

TRAP+ cells at the interface were also higher at the 4-week than 10-week time point.

Taken together, these data suggest the early osteoclastogenesis mediated greater cartilage

resorption and bone turnover after 4 weeks than after 10 weeks of implantation.

34

Figure 3-12. Representative stains of TRAP with Alcian Blue of osteochondral sections at day 0, and after

4 weeks and 10 weeks of implantation. Magnified images with pseudo-colored nuclear counterstains

(DAPI) are shown in the right panels. TRAP+ cells were more abundant at 4 weeks than at 10 weeks

following implantation. Large, multi-nuclear TRAP+ cells (indicated by red arrowheads) seen at 4 weeks

indicate the presence of mature osteoclasts mediating cartilage resorption and bone remodeling. Scale bars:

200 µm (main images) and 100 µm (magnified images).

Figure 3-13. Quantitative analysis of TRAP stains. The number of TRAP+ cells and average stain area of

TRAP+ cells were significantly higher at 4 weeks than at 10 weeks following implantation (n=4).

35

We also determined that TRAP+ cells expressed PDGF-BB, in agreement with a

previous study highlighting that preosteoclasts secrete PDGF-BB and thereby promote

vascularization [61]. Similar to the TRAP staining, large numbers of PDGF-BB+ cells

were detected at 4 weeks and only few at 10 weeks (Fig. 3-14, 3-16).

Figure 3-14. Representative PDGF-BB stains of osteochondral sections at day 0, and after 4 weeks and 10

weeks following implantation. Magnified images are shown in the right panels. PDGF+ cells were seen at 4

weeks and 10 weeks following implantation, and were more abundant at 4 weeks. Scale bars: 200 µm

(main images) and 100 µm (magnified images).

Correspondingly, CD-31 staining for endothelial cells revealed vascular lumens

seen after 4 weeks but not after 10 weeks of implantation (Fig. 3-15, 3-16). Therefore,

osteoclastogenesis seems to couple bone turnover to bone vascularization via PDGF-BB

secretion, and mediate the early progression of endochondral ossification.

Figure 3-15. Representative CD-31 stains of osteochondral sections at 4 weeks and 10 weeks. Vascular

lumens (indicated by red arrowheads) were seen at 4 weeks but not 10 weeks following implantation. Scale

bar: 100 µm.

36

Figure 3-16. Quantitation of PDGF-BB and CD-31 stains. The numbers of PDGF-BB+ cells and CD-31+

area were significantly greater at 4 weeks than at 10 weeks (n=4).

3.4.4 Host cells populate the subchondral space and drive endochondral ossification

To decouple the roles of host and graft cells, similar implantation studies were

conducted with osteochondral tissues stripped of marrow cells in the subchondral bone

prior to implantation, and using cartilage-only tissues. Earlier comparisons revealed that

pre-implanted tissues had residual graft-derived marrow cells in the subchondral bone,

and it was unclear if these cells or the host cells were driving endochondral ossification.

Thus, the cells were completely removed from the subchondral bone using saline buffer

and the implantation outcomes were evaluated. Prior to implantation, it was evident that

the cells, except for osteocytes, were not present in the subchondral bone. The vacant

subchondral bone was infiltrated by the host cells over 4 weeks of implantation (Fig. 3-

17A). In line with the other data, endochondral ossification was apparent as the

replacement of cartilage by bone progressed from the interface (Fig. 3-17B). Bone length

at 4 weeks increased and cartilage length decreased by a similar amount (Fig. 3-17C).

Notably, the cartilage-only tissues did not undergo endochondral ossification.

Instead, the deep zone hypertrophic chondrocytes at day 0 mineralized to form distinct

zone of calcified cartilage at 4 weeks without visible bone formation (Fig. 3-17D). Our

37

results suggest that host cells populate the subchondral space and drive endochondral

ossification, and confirm that native cartilage is resistant to endochondral ossification

during ectopic implantation despite deep zone mineralization.

Figure 3-17. Host cells populate the subchondral bone and drive endochondral ossification. (A)

Representative H&E stains of osteochondral sections at day 0 and at 4 weeks following implantation.

Sections were stripped of bone marrow (BM) cells in the subchondral bone prior to implantation by sterile

rinsing. Magnified images are shown in the right panels. The subchondral bone was densely populated with

cells at 4 weeks, indicating host involvement. Scale bar: 200 µm. (B) Representative µCT images of

osteochondral sections at day 0 and at 4 weeks following implantation showing new endochondral bone

formation and subchondral bone remodeling. (C) The lengths of cartilage (determined from representative

histologies) and bone (determined by µCT analysis) showing osteochondral tissue composition before and

after implantations. Cartilage length decreased and bone length increased markedly by 4 weeks following

implantation (n=4). (D) Implantation outcomes of cartilage-only grafts. H&E and Von Kossa stains at day 0

and after 4 weeks of implantation. Hypertrophic chondrocytes mineralized during implantation without

visible endochondral bone formation. Scale bar: 200 µm.

3.4.5 Macrophages selectively regulate cartilage and bone turnover

To investigate the role of inflammation on ectopic endochondral ossification, we

stained samples at 4 weeks and 10 weeks for markers associated with classically (M1)

38

and alternatively (M2) activated macrophages, inducible nitric oxide synthase (iNOS)

and arginase 1 (Arg-1). Corresponding to the greater turnover and number of TRAP+

cell, both iNOS+ and Arg-1+ cells were more prevalent at 4 weeks than at 10 weeks. In

particular, iNOS+ cells were seen extensively in the subchondral bone region at 4 weeks

but not at 10 weeks. Arg-1+ cells were also extensive at 4 weeks, especially near the

interface where deep zone cartilage was being replaced by endochondral bone. In the

subchondral region, Arg-1+ cells lined the surface the trabecular bone.

Figure 3-18. Macrophages selectively regulate cartilage and bone turnover. (Left) Cells expressing

classically activated (M1) marker iNOS were observed extensively at the interface as well as in the

subchondral bone region at 4 weeks. At 10 weeks, the presence of iNOS+ cells persisted near the interface

but attenuated in the subchondral bone. (Right) Cells expressing alternatively activated (M2) marker Arg-1

were observed extensively at 4 weeks, especially at the interface. At 10 weeks, Arg-1+ cells were abundant

near the interface and lined the newly formed endochondral bone in the subchondral region.

39

To quantify the comparison, cells were counted as particles in binarized images of

representative frames. Correspondingly, there were slightly more iNOS+ cells than Arg-

1+ cells at 4 weeks. Instead, there were more Arg-1+ cells than iNOS+ cells at 10 weeks.

Figure 3-19. Semi-quantitative analyses of iNOS and Arg-1 immunohistochemistry. Particles were counted

using multiple representative frames of binarized images. There were slightly more iNOS+ cells than Arg-

1+ cells at 4 weeks, albeit not significantly. In contrast, there were more Arg-1+ cells than iNOS+ cells at

10 weeks.

3.5 Discussion

While several studies investigated the fate of cells in cartilage or bone during

ectopic implantation, the present study is the first to look at phenotypic changes in

immature osteochondral tissues over the course of subcutaneous implantation. Motivated

by the findings from developmental studies, we hypothesized that subcutaneous

implantation in mouse can recapitulate endochondral ossification associated with native

skeletal development. The results we obtained support our hypothesis, as immature

osteochondral tissues underwent endochondral ossification reminiscent of that seen

during skeletal development and characterized by the progressive loss of cartilage and

concomitant endochondral bone formation at the cartilage-bone interface. Cartilage

40

retention was evident in the upper zone whereas all cartilage turnover occurred at the

interface and progressed axially towards the surface. Instead, previous studies reported

that ectopic implantation of callus-like cartilage formed from MSC resulted in bone

formation at the surface and cartilage loss that progressed into the bulk of the tissue.

We also noted several interesting differences between the ectopic and the native

processes. Despite the steady progression of endochondral ossification, there was no

increase in the graft size, suggesting a lack of interstitial cartilage growth. During skeletal

development, cartilage thickens as chondrocytes proliferate and deposit matrix prior to

terminal differentiation. This process is regulated by the signaling crosstalk between

multiple pathways such as bone morphogenetic protein (BMP) and Wingless (Wnt), and

signaling feedback such as that between parathyroid hormone-related peptide (PTHrP)

and Indian Hedgehog (Ihh) [51, 52]. In ectopic environment, the lack of trophic factor

gradients might have disrupted signaling crosstalk and feedback between the multiple

pathways that are necessary for cartilage growth.

Similarly, the osteochondral tissue could have been subjected to supranormal

oxygen tension in the vascularized subcutaneous environment across different cartilage

zones, which in turn could have disrupted cartilage growth. In addition, the extent of

endochondral ossification was also limited as its progression attenuated after 10 weeks of

subcutaneous implantation. Notably, the diminished presence of hypertrophic

chondrocytes, as indicated by cell morphology and type X collagen expression, at the

interface with prolonged implantation suggests that terminal differentiation of

41

chondrocytes was inhibited in the absence of native gradients of trophic factors.

Consequently, the final cartilage thickness did not reach that of mature native tissue. As

mice are known to reach skeletal maturity around 5 months of age, it is unlikely that the

skeletal maturity of the host affected morphogenesis of osteochondral grafts [62].

There were also similarities and differences in bone turnover between the native

and ectopic processes. Morphological comparisons (by μCT imaging and analysis)

revealed that the new endochondral bone exhibited similar BVF and MD profiles as the

native juvenile subchondral bone after bone remodeling. Just like the initial subchondral

bone, endochondral bone at the interface had a higher BVF and a lower MD than

cancellous bone in the deeper subchondral regions. These similarities suggest that

endochondral bone formed during ectopic endochondral ossification was also

progressively remodeled into mature cancellous bone.

Still, there were important differences in the quality of the cancellous bone and

the composition of the marrow within the trabeculae. ITS-based analysis revealed that

unlike the initial subchondral bone that was mostly composed of plates, the remodeled

bone following subcutaneous implantation was mostly composed of rods. The prevalence

of rods is reminiscent of osteoporosis and indicative of pathological bone remodeling. As

mechanical loading affects bone maturation, it is likely that the lack of physiologic

loading resulted in adverse bone remodeling and the formation of cancellous bone of

subnormal properties [63]. Trabecular bone microstructure and mechanical properties

vary among different skeletal sites [64-66]. We confirmed in our earlier studies such

42

differences in trabecular plate-rod microstructures among different anatomic locations,

and found their dependence on local mechanical environment [67]. In addition, the

marrow that filled the spaces between the trabeculae during later stages of implantation

was fatty and not hematopoietic. Because adipocytes limit hematopoiesis and cause fatty

marrow formation, it is likely that the access of cells from the adipocyte-rich hypodermis

enabled fatty marrow formation and inhibited hematopoiesis [68, 69].

Besides morphological comparisons, we also identified osteoclastogenesis and

vascularization as important mediators of ectopic endochondral ossification. Initial

progression of endochondral ossification was characterized by a vast presence of

mononuclear pre-osteoclasts and mature multinuclear osteoclasts. TRAP staining was

evident at 4 weeks throughout the subchondral bone, particularly at the interface where

cartilage was resorbed and endochondral bone was formed. Concomitantly,

vascularization was evident at site of bone formation. Attenuation of endochondral

ossification at 10 weeks post-implantation correlated with the diminished presence of

pre-osteoclasts, osteoclasts and vasculature. Motivated by recent studies showing that

PDGF-BB couples bone formation and angiogenesis, we studied PDGF-BB expression

and found that the results mirrored those of TRAP staining [61, 70]. Our data suggest that

PDGF-BB mediated early endochondral ossification during ectopic implantation by

coupling osteoclastogenesis with vascularization.

By stripping osteochondral tissues of the subchondral bone marrow and

comparing their implantation outcome with that of intact osteochondral tissues, we found

43

that cells populated the subchondral space to drive endochondral ossification with or

without pre-existing bone marrow. Interestingly, we also implanted cartilage-only tissues

and found that they did not undergo endochondral ossification but instead mineralized in

the deep zone. This suggests that the subchondral bone was necessary for the recruitment

of hematopoietic and vascular cells in the ectopic environment to initiate endochondral

ossification via a mineralized cartilage template. Recent developmental studies using

tamoxifen-inducible genetic recombination and in situ hybridization challenged the

paradigm that hypertrophic chondrocytes undergo apoptosis during endochondral

ossification, by showing that they can become osteoblasts via transdifferentiation [71,

72]. Still, based on the findings from this study, we propose that the host cells populate

the subchondral space and potentiate ectopic endochondral ossification as there has been

no evidence that chondrocytes or osteocytes are capable of transdifferentiating into cells

of hematopoietic or vascular origin.

To investigate the role of inflammation, we stained for markers associated with

different macrophage phenotypes. Macrophages are broadly classified into classically

activated (M1) and alternatively activated (M2) phenotypes [73]. M1 macrophages kill

intracellular pathogens by converting arginine into nitric oxide (NO) via iNOS. Instead,

M2 macrophages inhibit NO production by converting arginine into ornithine, a precursor

of hydroxyproline and polyamines [74-76]. Thus, M2 macrophages are associated with

repair and implicated in the wound healing response [74, 76, 77] However, the effects of

iNOS and Arg-1 on bone and cartilage turnover are not clear. Whereas one study found

that NO autoregulate osteoclastogenesis mediated by receptor activator of nuclear factor

44

kappa-B (NFκB) ligand (RANK-L), another study found that bone resorption mediated

by NFκB is dependent on IL-1 induction and activation of iNOS [78, 79]. In this study,

we found that extensive presence of iNOS+ cells at the interface and subchondral region

correlated with high bone and cartilage turnover at 4 weeks, as well as the extensive

presence of TRAP+ osteoclasts. Previous studies reported that high NO production due to

Arg-1 knockdown resulted in enhanced osteoclast differentiation, which suggests that

Arg-1 is a negative regulator of osteoclast differentiation and bone resorption. Addition

of recombinant Arg-1 was also shown to abolish RANK-L mediated osteoclast

differentiation [80]. In our study, we found a slightly greater presence of Arg-1+ cells

than iNOS+ cells at 10 weeks. Arg-1+ cells populated the interface and lined the newly

formed bone in the subchondral region. This could be indicative of anabolic activity and

negative regulation of bone resorption following early tissue turnover [74]. This also

agrees well with M1 to M2 transition which is characteristic of bone healing during

fracture repair [81]. Interestingly, osteoclasts reciprocally suppress the immune response

via crosstalk with T-cells [82]. Although the mice used for this study were

immunocompromised, it is likely that autoregulation occurred reciprocally between

macrophages and osteoclasts as both the presence of iNOS+ and Arg-1+ cells attenuated

by 10 weeks, similar to TRAP+ osteoclasts.

Despite showing the usefulness of the ectopic model for investigating

development of juvenile osteochondral tissues, the present study has limitations. For

example, we did not study the expression of other characteristic markers associated with

endochondral ossification such as MMP-13. Despite borrowing mechanistic evidence

45

from native developmental studies, we showed only correlation but not causality, which

would require rigorous gain and loss of function experiments. This is true for establishing

the importance of osteoclastogenesis, vascularization and inflammation associated with

differential macrophage response. Although the lack of transdifferentiation evidence

suggests that host cells populate the subchondral bone and potentiate ectopic

endochondral ossification, we did not track cell lineages and thus could not accurately

define the contribution of host and graft cells towards phenotypic changes.

Future studies could help gain insights into the mechanism of ectopic

endochondral ossification. For example, the reversibility of the adverse subchondral bone

remodeling can be probed by administering the mice with bisphosphonates. In situ

hybridization could clarify the origin and fate of different cell types during ectopic

endochondral ossification of osteochondral tissues. With further mechanistic

understanding, the utility of this model can also be extended towards the evaluation of

tissue-engineered osteochondral tissues in vivo prior to their orthotopic implantation in

large animal models.

3.6 Conclusion

This study shows that subcutaneous implantation of osteochondral tissues in a

mouse recapitulates endochondral ossification resembling that occurring during native

skeletal development. We observed the cartilage retention in the upper zone, and the

formation of endochondral bone progressing from the cartilage/bone interface towards

the cartilage surface. We show that the endochondral bone remodeled into mature

46

cancellous bone resembling the native subchondral bone. However, we also noted

several important differences between the ectopic and native processes, which could be

attributed to the inability of the ectopic process to recapitulate the native trophic and

mechanical factors. The lack of physiologic stimuli likely disrupted chondrocyte

differentiation and bone maturation.

Figure 3-20. Summary of ectopic implantation outcomes. Schematics illustrating that osteochondral tissues

comprising articular cartilage (AC) and subchondral bone (SB) with or without bone marrow (BM)

underwent endochondral ossification (EO) characterized by the replacement of cartilage by bone at the

interface. Instead, full-thickness cartilage mineralized in the deep zone but did not undergo EO.

47

3.7 Future Work

Transient cartilage in juvenile osteochondral tissues can undergo ectopic

endochondral ossification during subcutaneous implantation in mice. Thus, the

subcutaneous implantation model could be used to evaluate the in vivo stability and

maturation state of the engineered cartilage or osteochondral tissue.

In the subsequent chapters, studies summarized in Aim 2 (Chapter 4) and Aim 3

(Chapter 5) will utilize subcutaneous implantation to assess the in vivo outcomes of

cartilage tissues engineered from self-assembling hMSCs.

48

Chapter 4

Evaluation of cartilage discs grown from self-

assembling MSCs in vitro and in vivo

4.1 Abstract

Methods of cartilage formation by self-assembly of human mesenchymal stem

cells (MSCs) recapitulate important cellular events during mesenchymal condensation

that precedes native cartilage development. Here, we show that the cartilaginous

extracellular matrix (ECM) coating and the cell seeding density are important

determinants of functional cartilage disc formation by self-assembling hMSCs. Type I

collagen, expressed in the prechondrogenic mesenchyme, enabled disc formation and

enhanced early chondrogenesis. High cell seeding density improved tissue properties but

resulted in less frequent disc formation. Comparing the discs and the pellets, we

identified previously unreported compositional and organizational differences in vitro

and in vivo. Further, we found that prolonged chondrogenic induction of the discs in vitro

expedited endochondral ossification in vivo. These results demonstrate that the in vitro

and in vivo outcomes of cartilage formation by self-assembling MSCs can be modulated

by the control of culture parameters. Insights gained from this study could motivate new

directions for engineering cartilage and bone via a cartilage template from self-

assembling MSCs.

49

4.2 Introduction

The articular cartilage has limited capability for intrinsic healing due to its

avascular nature. Current approaches to treat focal cartilage lesions include autograft,

mosaicplasty and autologous chondrocyte implantation [7, 8]. However, these methods

are limited by donor site morbidity and the proliferative ability of chondrocytes. Thus,

there is an ongoing effort towards developing stem cell-based therapies for cartilage

regeneration [16].

In cartilage tissue engineering (TE), scaffolding materials have been successfully

used for cultivation and delivery of chondrocytes. However, scaffolding methods have

resulted in subnormal cartilage formation by MSCs – the most attractive cell source for

clinical application [27]. In contrast, self-assembly of MSCs recapitulated mesenchymal

condensation that precedes joint development, and enhanced the in vitro chondrogenesis

of MSCs [39-42].

In pellet culture, cells form spherical aggregates that deposit matrix and grow

over time [5, 6]. In disc culture, multiple layers of cells deposit matrix and form a disc

that grows in thickness over time [8, 9]. Cartilage formed in pellet culture of self-

assembling MSCs lacks physiological stratification and is not well suited for cartilage

repair due to its tendency to undergo endochondral ossification in vivo [3, 10, 11]. While

the pellet culture has been well established, the exact conditions for cartilage disc culture

are not known [37, 42]. In some cases, MSCs could not form discs due to the forces

50

associated with self-assembly (Table 4-1). It remains to be determined how the

conditions of MSC self-assembly in vitro affect cartilage fate in vivo.

Table 4-1. Summary of studies on disc culture of self-assembling chondrocytes or MSCs for in vitro

cartilage formation. In some cases, MSCs failed to form discs.

Cell Type Source

Density

(× 106/

mm2)

Insert

Type Substrate

Disc

Formation

(Yes/ No)

Thickness

(mm) Ref.

Chondrocytes Bovine

MCC joint

0.050 Millicell

PTFE

Type II

Collagen

Yes - [37]

Bovine

MCC joint

0.016 Millicell

PTFE

Type II

Collagen

Yes 0.3 [38]

Bovine

MCC joint

0.160 - CPP Yes 0.94 [83]

Sheep

MCC joint

0.160 - CPP Yes 0.5 [84]

Bovine

hock joint

0.067 Millicell

PTFE

Type II

Collagen

Yes 0.45 [85]

Bovine

MCC joint

0.033 Millicell

PTFE

Type II

Collagen

Yes - [86]

Bovine

distal femur

0.172 - Agarose Yes 0.15 [87]

Bovine

distal femur

0.289 - Agarose Yes 0.8 [88]

Human

femoral

cartilage

0.006 Millicell

PTFE

Type I/

Type II

Collagen

Yes 0.15 [89]

Human

articular

cartilage

0.102 - Agarose Yes 0.6 [90]

MSCs Human BM 0.015 Corning

PC

None Yes 0.8 [42]

Porcine

BM

0.392 Millicell

PET

None Yes 1.3 [91]

Human BM 0.015 Corning

PC

None No - [46]

Sheep BM 0.033 Millicell

PTFE

Type IV

Collagen

/CPP

Yes 0.5 [43]

Equine

cord blood

0.033 Millicell Fibronectin Yes 0.1 [92]

Human BM 0.102 - Agarose No - [90]

51

We hypothesized that (i) the membrane ECM coating and (ii) the cell seeding

density determine functional disc formation in vitro. To this end, we investigated if the

control of these two parameters would enable reliable formation of cartilage discs by self-

assembling MSCs. Further, we asked whether the in vivo fate of cartilage can be

modulated by the self-assembly regimen (disc versus pellet) and the length of in vitro

culture.

To test the hypotheses, we analyzed gene expression, biochemical, mechanical

and morphological changes of self-assembling human MSCs (hMSCs) in membrane

inserts with or without ECM coating, following chondrogenic induction at different cell

seeding densities. Further, we compared the composition and organization of the discs

and pellets in vitro and in vivo. Finally, we investigated the in vivo fate of discs cultured

under different durations in vitro. Overall, the study was designed to clarify the effects of

in vitro culture parameters on the in vitro properties and in vivo fate of cartilage formed

by self-assembling hMSCs.

4.3 Materials and Methods

4.3.1 Cell source and preparation

Fresh bone marrow aspirates were obtained from Cambrex and processed as in

our previous studies [41]. Bone-marrow–derived hMSCs were isolated and expanded to

the fifth passage in high glucose DMEM containing 10% fetal bovine serum, 1% Pen-

Strep and 1 ng/mL of fibroblast growth factor-2 (FGF-2). All reagents were from Life

Technologies, unless specified otherwise. At P5, hMSCs were seeded for experiments.

52

4.3.2 Cell seeding and differentiation

For chondrogenic differentiation, serum-free chondrogenic media consisting of

high glucose DMEM, ITS+ supplement (BD Biosciences), 5 mM L-proline, HEPES,

sodium pyruvate, dexamethasone, 50 μM ascorbic acid (Sigma Aldrich) and 10 ng/mL

transforming growth factor beta-3 (TGF-β3) (PeproTech) was used. All reagents were

from Life Technologies, unless otherwise specified.

For disc formation, 6.5 mm diameter transwell inserts with polycarbonate

membranes were used (Corning). To each transwell, 50 µL of vehicle (1mM acetic acid

with ethanol), 1.5 mg/mL type I collagen (BD Biosciences) or type II collagen (Elastin

Products) was added and the transwells were air dried overnight. Transwells were seeded

with hMSCs, loaded in 24-well plates, and centrifuged at 200g for 5 minutes. The next

day, chondrogenic media was added so that every transwell was fully submerged.

Medium was changed every 2 days for up to 6 weeks.

Figure 4-1. Self-assembly methods for cartilage formation by hMSCs. (A) Top, disc culture: hMSCs were

seeded in transwell inserts coated with vehicle control (Veh), type I collagen (Col1), or type II collagen

(Col2); Veh group failed to form discs. Bottom, pellet culture: hMSCs were seeded in round-bottom wells

and formed spherical aggregates. (B) Representative images of hyaline discs formed in coated transwells

are shown.

53

For pellet formation, 0.25×106 hMSCs were seeded in a low-attachment round-

bottomed 96-well plate (Fisher Scientific), and the plates were centrifuged at 200g for 5

minutes. Medium was changed twice a week for up to 6 weeks. For implantation studies,

pellets were cultured for up to 10 weeks prior to implantation.

4.3.3 Subcutaneous Implantation in SCID Mice

For implantation studies, discs were cultured for 6 weeks, 8 weeks, or 10 weeks,

and pellets were cultured for 10 weeks prior to implantation. All animal experiments

followed federal guidelines and were conducted under a protocol approved by the

Columbia University Animal Care and Use Committee. Tissues were implanted into

subcutaneous pouches of 8-10 week old female SCID mice (Jackson Laboratory). Two

incisions were made on the back of each mice, and a blunt forceps was used to create a

pocket in the subcutaneous space into which the tissue samples were inserted. After

implantation, the skin was closed with two sutures, and mice were monitored daily. No

signs of discomfort were observed following surgery in any of the animals throughout the

study. Samples were explanted at 4 weeks and analyzed.

4.3.4 Histology and Immunohistochemistry

For histology, samples were fixed in 10% formalin for 24 hours, decalcified with

Immunocal (Fisher Scientific), dehydrated in ethanol, embedded in paraffin, and

sectioned to 5 µm. Sections were stained for (i) Hematoxylin and Eosin (H&E), (ii)

Alcian Blue with Nuclear Fast Red, (iii) Picosirius Red, and (iv) Movat’s pentachrome.

All reagents were from Sigma Aldrich, unless otherwise specified.

54

Immunohistochemistry was performed using the following antibodies: type I collagen,

type II collagen, type X collagen, lubricin, and osteopontin (Abcam, U.S.A). Sections

were processed according to manufacturer’s instructions. Immunobinding was detected

with biotinylated secondary antibodies using the Vectastain ABC kit (Vector

Laboratories). Images were acquired using an Olympus FSX-100 microscope (Olympus).

4.3.5 Mechanical testing

The compressive Young’s modulus of the cartilage was measured on samples

submerged in PBS using unconfined compression as described by a previous stud, with

some modifications [41]. From the tissue samples (n=4 per group), 3mm diameter discs

were cored using a biopsy punch. The disc thickness was measured by the position of

tissue contact to that of the platform. To achieve a very low strain rate, the cylindrical

constructs were compressed at a rate of 100 nm/s (∼0.02% strain per second) for up to

2,000 s, and the compressive load was measured.

Instead of determining the Young’s modulus by establishing equilibrium stress

values at different strains, the discs were loaded continuously at a very low strain rate and

the transient stress was measured at every increment. The transient stress was plotted

against strain at every increment, generating a stress-strain curve with 2000 data points

for each measurement. This enabled the identification of the elastic range during

compression loading from which the ramp modulus was calculated as the gradient of the

linear slope (20-30% strain). Full thickness cartilage discs were obtained from the tibial

plateau of 2-month old calves (Green Village Packing) to serve as a reference.

55

Due to the presence of interstitial fluid pressure, the articular cartilage exhibits a

stress-relaxation response and the Young’s modulus (approximately 0.5 MPa) determined

from equilibrium stress is ideal for assessing the structure function of the engineered

cartilage following fluid exudation [93]. However, the equilibrium response is not

physiological as it only occurs after hours of static loading. For this reason, investigators

have also studied the dynamic modulus of the articular cartilage to better understand its

mechanical response under physiological loading conditions. Displacement controlled

studies found that the dynamic moduli of the bovine articular cartilage at 1 Hz under

strain amplitudes of 0.5, 1, and 2.5% were 13, 20, and 37 MPa [94-96]. Similarly, a load

controlled study found that the incremental dynamic modulus at 0.1 Hz increased from

14.6 MPa at zero applied stress to 48.2 MPa at 4 MPa of applied stress [97]. Thus,

interstitial fluid pressurization in the articular cartilage results in a frequency and load

dependent mechanical response under cyclical loading at physiological frequencies

In our measurement, the ramp loading rate is similar to the first leg of a sawtooth

cyclical loading profile with an amplitude of 10% and a frequency of 0.0005 Hz.

Although this rate is sub-physiological (0.01 – 2 Hz), we tested for interstitial fluid

pressurization and found that the ramp modulus at 0.02%/s was approximately 2.7 times

that of the equilibrium modulus. Thus, there was significant interstitial fluid

pressurization. Still, this enabled us to compare the mechanical response of the

engineered and native cartilage. The biochemical composition of the engineered cartilage

correlated with the ramp modulus. Also, the ramp modulus of the engineered cartilage

was significantly lower but in the same order of magnitude as the native cartilage.

56

4.3.6 Biochemical analysis

DNA, sulfated glycosaminoglycan (GAG), and collagen (COL) contents were

measured as previously described (2). All reagents unless otherwise specified were from

Sigma Aldrich. Briefly, the samples (n = 4) were blotted dry and weighed. Subsequently,

the samples were digested in 0.5 mL proteinase K solution at 60 °C. With the sample

digests, the DNA content was determined using the Molecular Probes Picogreen assay

(Life Technologies). The GAG content of the sample digests was determined using the

1,9-dimethylmethylene blue (DMMB) dye calorimetric assay with chondroitin-6-sulfate

as a standard. The remaining sample digests were hydrolyzed at in 6 N hydrochloric acid

overnight and the hydroxyproline content, assumed to be 10% of the total collagen

content, was determined.

4.3.4 Gene expression analysis

Samples (n=4 per group) were crushed with pestles and homogenized by mixing

in the TRIzol reagent. RNA was extracted according to the manufacturer’s instructions

using the TRIzol method. The quantity of RNA was measured on the Nanodrop ND1000

(Fisher Scientific). Following treatment with DNase I removal kit, cDNA synthesis was

performed using the Applied Biosystems High Capacity kit according to the

manufacturer’s instructions. Quantitative RT-PCR analysis was done using 20 ng cDNA

per reaction and the Applied Biosystems SYBR® Green PCR Master Mix. All primers

(Table 4-2) were synthesized by Life Technologies. The expression of target genes was

normalized to the housekeeping gene GAPDH (2-∆Ct) and calculated from the mean CT

values of technical duplicates for each sample. All reagents were from Life Technologies.

57

Table 4-2. List of primers used for qPCR.

Gene Forward Sequence Reverse Sequence

ACAN CCCCTGCTATTTCATCGACCC GACACACGGCTCCACTTGAT

COL2A1 AGACTTGCGTCTACCCCAATC GCAGGCGTAGGAAGGTCATC

COL1A1 GATCTGCGTCTGCGACAAC GGCAGTTCTTGGTCTCGTCA

C4ST CATCTACTGCTACGTGCCCA CTTCAGGTAGCTGCCCACTC

C6ST CTCGGAGCAGTTCGAGAAGTG CGCCAGTTTGTAGCCGAAGA

COL10A1 CATAAAAGGCCCACTACCCAAC ACCTTGCTCTCCTCTTACTGC

MATN3 TCTCCCGGATAATCGACACTC CAAGGGTGTGATTCGACCCA

CHM1 CTGGATCACGAAGGAATCTGT ACCATGCCCAAGATACGGG

SOX9 AGCGAACGCACATCAAGAC CTGTAGGCGATCTGTTGGGG

RUNX2 CCGTCTTCACAAATCCTCCCC CCCGAGGTCCATCTACTGTAAC

4.3.8 Micro CT imaging (μCT) and standard morphological analysis

For µCT, samples (n=4 per group) were fixed in 10% formalin for 24 hours at

room temperature, rinsed briefly, and kept in PBS. 3D high-resolution images were

obtained for each sample using a VivaCT 40 system (SCANCO Medical AG). The

grayscale images were binarized using a global threshold. Standard morphological

parameters such as mineral volume (BV) and mineral density (MD) were evaluated for

each sample using the standard morphological analysis software on the VivaCT 40

system.

4.3.9 Statistical Analysis

All quantitative results are presented as mean ± SEM (n=4 per data point).

Statistical analysis was performed with Prism (GraphPad), using the Student t-test or one-

way ANOVA with Tukey’s post hoc test. Significant differences are denoted as *(p <

0.05), ** (p < 0.01) and *** (p < 0.001).

58

4.4 Results

4.4.1 Morphological analysis of cartilage discs and pellets

Type I collagen and type II collagen are important fibrillar collagens that are

expressed during different stages of chondrogenesis [98, 99]. Multiple layers of hMSCs

were seeded on transwell membrane inserts coated with type I collagen (Col1), type II

collagen (Col2), or vehicle (Veh), and allowed to self-assemble. Pellets were also formed

from self-assembling hMSCs in round-bottomed wells. (Fig. 4-1).

Following chondrogenic induction, the Col1 and Col2 groups formed 6.5mm

hyaline discs, but not the Veh group (Fig. 4-2). The lack of ECM coating in the Veh

group abrogated disc formation and resulted in condensation, yielding a hemispherical

tissue that resembled the pellet (Fig. 4-2). The Veh hemispheres and pellets exhibited rich

sulfated glycosaminoglycan (sGAG) deposition (shown by Alcian Blue) in the center

regions, and dense fibrillar structures (shown by PicoSirius Red) that was rich in type I

collagen at the surface of the tissues. In contrast, the Col1 and Col2 discs were stratified

and exhibited more homogenous deposition of sGAG and type II collagen. To highlight

the organizational differences, the tissues were stained for lubricin, the superficial zone

protein. Whereas lubricin lined the entire surface of the pellets, its expression on the discs

was limited to the top surface but not the bottom side in contact with the membrane.

Although resembling the pellets, the Veh hemispheres was lined with lubricin only at the

surface but not the bottom side in contact with the membrane (Fig. 4-4) Whole tissue

comparison between the Col1 and Col2 discs revealed an overall increase in the

deposition of sGAG and type II collagen with prolonged chondrogenic induction, from

59

day 17 to day 42. However, the deposition of ECM rich in sGAG and type II collagen

was only observed near membrane coated with Col1, not Col2. This was evident at both

time points evaluated following chondrogenic induction, with a partial recovery of ECM

deposition in the Col2 discs seen at day 42 (Fig. 4-3).

Figure 4-3. Histology of Col1, Col2, vehicle control and pellet. Poor ECM deposition in the deep zone was

seen in Col2 discs. Vehicle control condensed into a hemisphere. Type I collagen rich fibrillar structure

formed at the surface of the pellet and vehicle control. Discs exhibited more uniform type II collagen and

GAG distribution whereas GAG was visibly denser at the center of the pellet. Scale bar: 200 µm.

60

Figure 4-4. Histology of Col1 and Col2 discs after 17 days and 42 days of chondrogenic induction.

Although both groups formed stratified discs that grew in thickness and deposited ECM over time, less

ECM was observed in the deep zone of Col2 discs. Scale bar: 200 µm.

Figure 4-5. Histology comparing lubricin stains. Lubricin was expressed at the entire pellet surface but only

at the top surface of the discs. Scale bar: 50 µm.

Using Col1 as the choice coating, the effects of cell seeding density on tissue

morphology was evaluated. Increasing cell seeding density from 0.5×106 to 1 ×106 per

well increased the disc thickness without causing appreciable changes in tissue

morphology (Fig. 4-5).

Figure 4-6. H&E stains show that Col1 discs seeded at 1.0×106 were thicker than those seeded at 0.5×106.

Scale bar: 200 µm.

61

To investigate the prevalence of type I collagen during chondrogenesis of self-

assembling hMSCs, pellets were stained for type I collagen at different time points

following chondrogenic induction. Type I collagen was expressed in early condensed

mesenchymal bodies, and reduced to the perichondral margin over time (Fig. 4-6). This

confirms previous findings highlighting the importance of type I collagen for early

chondrogenesis during mesenchymal condensation.

Figure 4-7. Type I collagen stains of pellets at different time points after chondrogenic induction show

initial expression throughout the pellet, and reduction to the surface layer over time. Scale bar: 200 µm.

4.4.2 Compressive properties of cartilage discs

In agreement with the results of histological analysis, mechanical evaluation

revealed that the compressive modulus of Col1 discs (~280kPa) was significantly higher

than that of the Col2 discs (~170kPa), with little difference in tissue thickness. However,

neither group reached the level of native cartilage (~800kPa) (Fig. 4-7A). Consistent with

our previous findings, cartilage formed by self-assembling hMSCs achieved a

compressive modulus exceeding that of cartilage formed in scaffold culture by MSCs

reported in earlier studies [41]. Increasing the cell seeding density from 0.5×106 per well

(0.015×106 /cm2) to 1 ×106 per well (0.030×106 /cm2) tended to increase the thickness

(from 0.5 mm to 0.7 mm) and the compressive modulus (from 280 kPa to 400 kPa) of

Col1 discs (Fig. 4-7B). Comparing the stress-strain curves, the engineered and native

62

tissues exhibited similar profiles with toe and elastic regions. However, the toe region (0-

10% strain) associated with the native tissue was smaller than that of the engineered

tissue (0-15% strain). Also, yield points and subsequent escalations were seen in the

native tissues but not the engineered tissues which remained elastic through 40% strain

(Fig. 4-7C). These differences could be attributed to the maturity of the native cartilage

(adult bovine) used as a reference.

Figure 4-8. Mechanical and physical properties of discs formed by self-assembling hMSCs. (A) Young’s

modulus measured by unconfined compressive loading revealed that Col1 discs outperformed Col2 discs.

Increasing seeding density from 0.5×106 to 1.0×106 further improved Col1 discs. (B) Disc thicknesses were

comparable for the Col1 and Col2 discs; increasing seeding density increased the thickness of Col1 discs.

(C) Representative stress-strain curves. Engineered and native tissues exhibited similar profiles.

4.4.3 Disc formation under different culture conditions

In addition to the compressive modulus and thickness, the frequency of successful

disc formation was assessed. At 0.5×106 per well, the Col1 group formed disc in all cases

(100%; 12/12) but not the Col2 group (75%; 9/12). The Veh group failed to form discs in

all cases. Increasing cell seeding density to 1 ×106 per well resulted in less frequent disc

formation in the Col1 group (50%; 6/12) and almost no disc formation (8%; 1/12) in the

Col2 group (Table 4-3). Further increase to 1.5×106 per well almost abolished disc

63

formation (1 out of 12) in the Col1 group. Thus, Col1 enables more reliable formation of

cartilage discs with better mechanical properties, but only up to a critical seeding density.

Table 4-3. Comparison of the frequency of successful disc formation in different experimental groups. Col1

coating enabled the highest yield of disc formation, but this effect was abolished at high seeding density

(1.5×106 per well).

4.4.4 Biochemical analysis of cartilage discs and pellets

In agreement with the results of histological and mechanical evaluations,

biochemical analysis revealed compositional differences between the Col1 and Col2

groups. Both the sGAG and collagen (COL) contents, normalized to wet weight, were

higher in the Col1 group than the Col2 group and the differences reached significance at

day 42. Comparing the pellets with the discs, compositional differences in agreement

with histological analysis were also identified. Whereas the pellets had a higher sGAG

content, the discs had a higher COL content, and consequently a higher COL to sGAG

ratio. The higher COL content can be attributed to increased collagen productivity of

cells differentiated in the disc culture than in pellet culture, as indicated by COL content

normalized to DNA content (Fig. 4-8A).

64

Increasing the cells seeding density from 0.5×106 to 1 ×106 per well resulted in an

increase in the sGAG content (normalized to wet weight) of the Col1 group, but not the

COL content. Normalizing to DNA content, the similar sGAG/DNA ratios suggest that

the increase in sGAG content could be due to greater cellularity (Fig. 4-8B).

Figure 4-9. Biochemical quantification of glycosaminoglycan (GAG), collagen (COL) and cellular (DNA)

contents. (A) Comparisons of Col1 discs, Col2 discs and pellets after 17 days or 42 days of chondrogenic

induction. At day 42, pellets exhibited higher GAG and DNA contents (per wet weight) and discs exhibited

higher COL/DNA and COL/GAG ratios; Col1 discs had higher GAG and DNA contents than Col2 discs.

(B) Comparisons of Col1 discs at different seeding densities. Doubling seeding density from 0.5×106 to

1.0×106 increased GAG content (per wet weight) but not COL content.

4.4.5 Gene expression analysis of cartilage formed by self-assembling hMSCs

To further investigate differences identified by histological, mechanical and

biochemical analyses, the gene expression of important cartilage markers were analyzed.

In agreement with results at the phenotypic levels, the expression of important cartilage

markers (ACAN, COL2A1, C4ST, MAT3) was significantly higher in the Col1 group

than the Col2 group after 17 days of chondrogenic induction, but not after 42 days (Fig.

65

4-9). The early deficits in gene expression indicate that Col2 coating delayed the onset of

chondrogenesis by self-assembling hMSCs and resulted in poor long term ECM

deposition and mechanical properties.

Figure 4-10. Gene expression analysis. Data are shown for Col1 discs, Col2 discs and pellets after 17 days

or 42 days of chondrogenic induction (by quantitative real-time polymerase chain reaction, qPCR). Col2

discs displayed lower expression of chondrogenic markers at day 17 than Col1 discs. Pellets displayed

lower COL2A1/ACAN ratio and higher expression of COL1A1 than discs at day 42. All gene expressions,

unless otherwise stated, are normalized to GAPDH and expressed as 2-∆Ct.

Gene expression analysis also confirmed a cellular basis for compositional

differences between the discs and the pellets as the ratio of COL2A1 to ACAN

expression by cells differentiated in disc culture was higher than that in pellet culture.

Greater expressions of chondroitin sulfotransferases (C4ST and C6ST) by cells in pellet

culture also suggest increased GAG sulfation, which might have contributed to the higher

66

sGAG content. Furthermore, COL1A1 expression was significantly higher in the pellets

than in the discs, confirming the results of histological analysis which revealed dense

fibrillar structures rich in type I collagen at the surface of the pellets. However,

COL10A1 expression was similar among the different groups. This suggests that disc

culture does not prevent chondrocyte hypertrophy, despite promoting hyaline cartilage

formation (Fig. 4-9).

4.4.6 In vivo outcomes of subcutaneously implanted cartilage discs and pellets

Next, we investigated the effects of the culture regimen on the vivo fate of the

cartilage formed by self-assembling hMSCs in vitro. We implanted pellets, as well as

discs cultured for different durations in vitro, subcutaneously in SCID mice (Fig. 4-10).

Figure 4-11. Overview of implantations. Discs cultured for 6 weeks, 8 weeks or 10 weeks, and pellets

cultured for 10 weeks were implanted subcutaneously in mice. Tissues were explanted after 4 weeks.

After 4 weeks in vivo, μCT and histological analysis of the explanted tissues

revealed interesting morphological and compositional differences. As expected, the

pellets underwent endochondral ossification and μCT documented the formation of a

67

spherical shell of mineralized tissue. Movat’s pentachrome revealed an outer layer of

mature bone, under which marrow-like cells infiltrated into the extensively calcified

cartilage interior (Fig. 4-11). The discs also underwent endochondral ossification but

exhibited a remarkably different tissue organization (Fig. 4-11). Mature bone and

infiltrating marrow-like cells lined the bottom of the disc, and the calcified cartilage was

directly above the nascent bone. Residual cartilage was observed at the superficial zone.

Figure 4-12. Histological stains showed organization of discs after endochondral ossification. (Left) Discs

were more mineralized with length of culture and mature bone was seen in 10w4Q discs. Bone formed at

the bottom of the discs and the infiltrating marrow-like cells were observed. This layer was covered by

calcified cartilage, with traces of non-calcified cartilage at the surface. (Right) Whole tissue sections of

pellets after endochondral ossification. Bone formed at the surface, with infiltrating marrow-like cells

beneath gradually resorbing the calcified cartilage. Scale bar: 200 µm.

Furthermore, the rate of endochondral ossification in the discs increased with the

duration of in vitro chondrogenic induction. After 4 weeks in vivo, discs cultured for 10

weeks (10w4Q) exhibited greater mineral volume and density than discs cultured for 6

weeks or 8 weeks (6w4Q, 8w4Q) (Fig. 4-12). Movat’s pentachrome revealed distinct

68

mature bone formation only in the 10w4Q discs (Fig. 4-11). Interestingly, 6w4Q discs

were mineralized prevalently at the rim in contrast to the 8w4Q discs and the 10w4Q

discs that were progressively more mineralized in the center (Fig. 4-12). Collectively, the

results show that the culture regimen in vitro modulates endochondral ossification of

cartilage formed by self-assembling hMSCs in vivo.

Figure 4-13. µCT images and quantitative analysis. (Top) Representative images showing mineralization of

discs increased with length of culture. Whereas the discs formed a sheet of mineral, the pellet formed a

spherical shell. (Bottom) Quantitative µCT analysis. Mineral density and volume increased with the length

of culture; 10w4Q discs exhibited the greatest mineral density and bone volume.

4.5 Discussion

We investigated the effects of the ECM coating and the cell seeding density on

the in vitro properties of cartilage discs formed by self-assembling hMSCs. Type I

collagen enhanced chondrogenesis and promoted disc formation, whereas high cell

density improved tissue properties but resulted in less frequent disc formation. By

69

studying self-assembly regimens, we identified compositional and morphological

differences between the cartilage discs and pellets, during in vitro culture and following

in vivo implantation. We also showed that prolonged chondrogenic induction in vitro

expedited endochondral ossification of cartilage discs in vivo.

The importance of ECM for chondrogenic differentiation of MSCs has been

studied in vivo and in vitro. Developmental studies revealed interesting dynamics of

ECM formation as the prechondrogenic mesenchyme was enriched with type I collagen

whereas the mature cartilage was enriched with type II collagen [98, 99]. Although both

collagen types have been used for in vitro chondrogenic induction of MSCs, a recent

study found important differences between the early and late stage ECM during

chondrogenesis [100-102]. Early stage ECM was rich in type I collagen and other cell

binding proteins, and strongly induced chondrogenesis of MSCs. In contrast, late stage

ECM was rich in type II collagen, deficient in type I collagen and other cell binding

proteins, and resulted in poor chondrogenic induction of MSCs [102]. Due to alternative

splicing, mature chondrocytes synthesize type IIB pro-collagen that lacks a TGF-β

binding chordin-like domain [103]. Thus, it was proposed that type II collagen in ECM

produced during late chondrogenesis disrupted TGF-β mediated chondrogenesis.

Interestingly, we observed similar differences between the cartilage discs formed

on membranes coated with type I collagen (Col1) versus type II collagen (Col2). Col1

discs exhibited better tissue properties as revealed by biochemical, histological and

mechanical analyses. The poor ECM deposition and mechanical properties of Col2 discs

70

can be attributed to early deficits in the gene expression of cartilage markers. In

agreement with the developmental studies, we found uniform expression of type I

collagen within the first week of chondrogenic induction, which confirms its importance

during early chondrogenesis of hMSCs.

Furthermore, Col1 coating enabled disc formation most reproducibly. In contrast,

self-assembling hMSCs on uncoated membranes condensed and failed to form discs. Disc

formation on type II collagen was less frequent than on type I collagen. Although we

could not compare binding forces, our results suggest that type I collagen serves as a

better anchor for the self-assembling hMSCs to resist condensation forces. Cell seeding

density was shown to modulate cartilage formation by MSCs cultured in scaffold [28,

104]. Here, we showed that increasing the cell seeding density improved the compressive

modulus, sGAG content and thickness of the discs significantly. However, increasing the

cell seeding density also promoted condensation and yielded less frequent disc formation.

During mesenchymal condensation, MSCs undergo actomyosin contraction and

cytoskeletal rearrangement [105]. It is likely that the increased condensation forces at

high cell densities overcame the anchoring forces between the membrane ECM and the

attached cells.

Disc culture formed hyaline cartilage while pellet culture formed fibrocartilage

with more type I collagen. This outcome was attributed to the fibrogenic tensile forces

associated with the increase in surface area of the pellet, but not the disc which grew in

thickness [42]. Disc culture also enhanced collagen network maturity [106]. We

71

confirmed these findings and found that whereas pellet culture formed fibrocartilage with

dense type I collagen at the surface, and disc culture formed hyaline cartilage with

uniform deposition of sGAG and type II collagen. Furthermore, hMSCs differentiated in

disc culture expressed more COL2A1 relative to ACAN than in pellet culture.

Consequently, the discs exhibited a higher COL relative to sGAG content than the

pellets. Morphologically, the discs were stratified and resembled the articular cartilage,

with lubricin lining only the top surface.

Although cartilage pellets and discs formed from self-assembling hMSCs both

achieved structural integrity, other methods may be necessary to grow tissues for large-

scale therapeutic applications. One such method for forming large and anatomically

shaped cartilage is the fusion of pellets atop bone substrate that we demonstrated in our

previous study [7]. Foreseeably, larger discs could also be formed by inducing cartilage

formation from self-assembling hMSCs on a larger coated membranes. However, our

studies suggest that improving the thickness and mechanical property of the discs comes

at a cost of a lower yield of disc formation, necessitating the use of scaffolds for the

cultivation of larger tissue constructs.

Studies of pellets in vivo showed that insufficient in vitro conditioning resulted in

fibrous tissue formation, and that prolonged chondrogenic culture enabled endochondral

ossification [44, 50]. To the best of our knowledge, the in vivo fate of the cartilage discs

has not been studied. Thus, we assessed the in vivo implications of different culture

regimens and found that both the pellets and the discs underwent endochondral

72

ossification following prolonged chondrogenic induction, with remarkably different

outcomes. Endochondral ossification of the pellets resembled callus maturation during

long bone repair, whereby bone enveloped the pellet and cartilage loss progressed into

the bulk of the tissue. Instead, endochondral ossification of the discs resembled

epiphyseal cartilage maturation during skeletal development, whereby bone formed at the

bottom and cartilage loss progressed towards the surface [52].

Recent studies showed that hypertrophic induction following chondrogenic

induction advanced maturation of cartilage formed by hMSCs in vitro and enhanced

endochondral ossification in vivo [46, 107]. Here, we showed that prolonged

chondrogenic culture of cartilage discs formed by self-assembling hMSCs similarly

expedited endochondral ossification in vivo. After 4 weeks of implantation, discs cultured

for 10 weeks exhibited greater mineral volume and density than discs cultured for 6

weeks or 8 weeks. Interestingly, mineralization initiated at the rim. The normal

compressive force at the insert wall might have induced more rapid peripheral maturation

[108]. These results demonstrate that the in vitro culture regimen can modulate

endochondral ossification of cartilage formed by self-assembling hMSCs in vivo.

As the primary goal of the in vivo study was to evaluate cartilage stability, we

only evaluated the tissue outcomes after 4 weeks of ectopic implantation. However, it is

likely that the tissues would undergo further endochondral ossification with prolonged

implantation. A recent 8-week implantation study on the fate of chondrocytes terminally

differentiated from hMSCs found that chondrocytes released from lacunae during

73

endochondral ossification underwent a reversion of differentiation to become marrow

stromal cells within the ossicle [109]. With prolonged implantation, it is possible that

terminally differentiated chondrocytes in both the discs and the pellets could have

undergone a similar reversion, leading to the formation of bone and marrow stroma.

However, the presence of osteopontin and mineral indicated that during early

stages of ectopic implantation, the in vivo environment promoted terminal differentiation

of chondrocytes along a chondrogenic pathway. While a switch to osteogenic

differentiation would also have resulted in the deposition of osteopontin and mineral,

Movat’s pentachrome staining showed that the cells were residing in cartilage matrix, and

were unlikely to have undergone a reversion of chondrogenic differentiation.

During in vitro culture, we did not observe a significant decrease in DNA content

up to 6 weeks of chondrogenic differentiation in disc or pellet culture. This suggests that

there was no progressive loss of cells during chondrogenic induction. Likewise,

histological observations confirmed that the lacunae in the cartilage tissues remained well

nucleated after implantation, suggesting the persistence of viable chondrocytes. However,

prior studies suggest that terminal differentiation of chondrocytes can result in apoptosis

which mediates cartilage turnover [110, 111].

The long-term stability of control of cartilage formed from MSCs remains a

challenge [3, 16]. Recent studies found that modulation of Wnt signaling and hypoxia can

enhance the in vivo stability of cartilage formed by MSCs in pellet culture [112, 113].

74

Conceivably, trophic and biophysical stimuli can improve the disc culture and enable the

growth of a functional, organized and stable articular cartilage in vitro from MSCs. As

the articular cartilage is anisotropic, implementation of spatiotemporal control during in

vitro culture could recapitulate native gradients and further improve tissue organization

and stability [114].

4.6 Conclusion

This study shows that culture parameters affect the in vitro and in vivo outcomes

of cartilage formation by self-assembling hMSCs. Disc formation on a membrane could

not be achieved without ECM coating. Type I collagen, uniformly expressed in the

prechondrogenic mesenchyme, most frequently enabled disc formation and improved

long term tissue properties by enhancing early chondrogenesis. Increasing cell seeding

density improved tissue properties, but also increased the condensation burden and

resulted in less frequent disc formation. Disc culture formed stratified hyaline cartilage

with uniform deposition of GAG and type II collagen, and pellet culture formed

fibrocartilage callus with type I collagen at the surface.

Following ectopic implantation, endochondral ossification of the discs progressed

bottom up, resembling epiphyseal cartilage maturation. Instead, endochondral

ossification of the pellet progressed outside in, resembling callus maturation. Prolonged

chondrogenic induction in vitro expedited endochondral ossification of the discs in vivo,

starting at the rim. These results provide new directions for engineering cartilage and

bone via a cartilage template from hMSCs by self-assembly methods.

75

4.7 Future work

Despite establishing the important culture parameters for growing stratified and

functional cartilage discs from self-assembling hMSCs, the engineered cartilage still

lacks in vivo stability. Implementation of spatiotemporal regulation recapitulating

developmental aspects of native cartilage formation could enhance maturation of the

engineered cartilage in vitro. The next chapter (Chapter 5) will present findings on the

study summarized in Aim 3, seeking to address the importance of spatiotemporal

regulation.

76

Chapter 5

Spatiotemporal regulation during induction of self-

assembling hMSCs promotes organization and in vivo

stability of engineered cartilage

5.1 Abstract

Standard isotropic culture fails to recapitulate the spatiotemporal gradients present

during native development. Cartilage grown from human mesenchymal stem cells

(hMSCs) is poorly organized and unstable in vivo. In this study, cartilage with

physiologic organization and in vivo stability was grown in vitro from self-assembling

hMSCs by implementing spatiotemporal regulation during induction. Self-assembling

hMSCs formed cartilage discs in transwell inserts following isotropic chondrogenic

induction to set up a dual compartment culture. Following a switch in the basal

compartment to a hypertrophic regimen, the cartilage discs underwent progressive deep

zone hypertrophy and mineralization. Concurrent chondrogenic induction in the apical

compartment enabled the maintenance of functional hyaline cartilage. Cartilage formed

under spatiotemporal regulation in vitro resisted endochondral ossification and remained

organized following subcutaneous implantation in immunocompromised mice, whereas

the isotropic control groups underwent endochondral ossification. Spatiotemporal

regulation during induction in vitro potentiated the maturation of self-assembling hMSCs

into stable and organized cartilage resembling the native articular cartilage.

77

5.2 Introduction

Functional tissues generated in vitro from a patient’s cells could provide

biological substitutes for the tissues lost or damaged due to old age and injury [115]. Our

growing understanding of developmental biology has guided tissue engineering

approaches to better regulate stem cell differentiation and tissue formation [40, 46, 116].

The articular cartilage has a limited regenerative ability due to its avascular nature

[111]. Current approaches to repair focal cartilage lesions include autograft, mosaicplasty

and autologous chondrocyte implantation [7, 8, 117]. However, these methods are limited

by donor site morbidity. Thus, there is an ongoing effort towards developing stem cell-

based therapies, particularly with mesenchymal stem cells (MSCs) – the most attractive

cell source for clinical application [27]. Our group and others have shown that self-

assembly methods recapitulated mesenchymal condensation and enhanced

chondrogenesis of MSCs in vitro [41, 43, 87].

Still, standard isotropic culture fails to recapitulate the spatiotemporal gradients

present during native development [27, 40, 42, 90]. Cartilage formed from MSCs is

poorly organized and prone to endochondral ossification in vivo [44, 46]. Instead, the

native articular cartilage is organized and comprises the superficial zone which develops

into permanent cartilage, and the deep zone which mineralizes to form calcified cartilage

[3]. We hypothesized that the implementation of spatiotemporal regulation during

induction of self-assembling hMSCs in vitro can potentiate the formation of functional

cartilage with physiologic organization and in vivo stability. Specifically, we investigated

78

whether a spatiotemporally regulated induction regimen can i) generate hyaline cartilage

discs with physiologic organization from self-assembling hMSCs, ii) induce deep zone

hypertrophy and mineralization to guide cartilage maturation, and iii) enable the cartilage

discs to remain stable and organized in vivo.

To this end, we compacted human MSCs (hMSCs) on coated transwell

membranes by centrifugation, and allowed the cells to differentiate under chondrogenic

induction. At 3 weeks, we switched induction in the basal compartment to a hypertrophic

regimen in the experimental group, and maintained isotropic chondrogenic or

hypertrophic regimens in the control groups. After 10 weeks, all groups were implanted

ectopically in immunocompromised mice to evaluate their stability in vivo.

Through extensive quantitative and morphological analysis, we showed that the

implementation of spatiotemporal regulation during induction of self-assembling hMSCs

in vitro resulted in the formation of cartilage discs with physiologic stratification and

deep zone mineralization. Cartilage discs formed under spatiotemporal regulation resisted

endochondral ossification following subcutaneous implantation, and retained zonal

organization with a nascent tidemark. Thus, mimicry of native spatiotemporal gradients

can be achieved in vitro to enhance the organization and stability of cartilage tissues

formed by self-assembling MSCs.

79

5.3 Methods

5.3.1 Cell source and preparation

Fresh bone marrow aspirates were obtained from Cambrex and processed as in

our previous studies [41]. Bone-marrow–derived hMSCs isolated were expanded to the

fifth passage (P5) in high glucose DMEM containing 10% fetal bovine serum, 1% Pen-

Strep and 1 ng/mL of fibroblast growth factor-2 (FGF-2) (Life Technologies).

5.3.2 Disc Formation

Type I collagen (Corning) was diluted to 1.5 mg/mL in ethanol and used to coat

the polycarbonate membrane (0.4 µm pore size) of 96-well HTS Transwell inserts

(Corning). The inserts were air dried overnight and rinsed with PBS. Multiple layers of

hMSCs (250,000/ well) were seeded into the inserts and compacted by centrifugation

(200 g, 5 minutes). Seeded inserts were assembled with the reservoir plates, each filled

with 20 mL of chondrogenic media. Media in the inserts were carefully topped up 3 hours

postcentrifugation (200 µL/ well). Tissues were incubated in a controlled humidified

chamber (37 °C, 5 vol% CO2) and media were replaced every other day. Samples were

fixed in 10 vol% formalin for histological and analysis or snap frozen and stored at – 80

˚C prior to gene expression and biochemical analyses.

5.3.3 Induction Regimens

Chondrogenic medium comprises high glucose DMEM with 10 ng/mL TGF-β3,

100 nM dexamethasone, 50 μM ascorbic acid-2 phosphate, 100 μM sodium pyruvate, 5

μg/mL proline, 1% insulin, transferrin, sodium selenite mix (ITS+), and 1% penicillin–

80

streptomycin (P/S). Hypertrophic medium comprises high glucose DMEM with 50

ng/mL T4, 5 mM β-glycerophosphate, 1 nM dexamethasone, 50 μM ascorbic acid-2

phosphate, 100 μM sodium pyruvate, 5 μg/mL proline, 1% ITS+, and 1% P/S.

Figure 5-1. Schematic of the induction regimens. hMSCs seeded in coated transwells were cultured under

isotropic chondrogenic induction for 3 weeks. After 3 weeks, induction in the basal compartment was

switched to a hypertrophic regimen to set up a dual compartment culture. Isotropic chondrogenic or

hypertrophic regimens were maintained in control groups. All tissues were cultured for up to 10 weeks.

After 3 weeks of chondrogenic induction in both compartments, induction in the

basal compartment (reservoir) was switched to a hypertrophic regimen in the

experimental (CH) group. Chondrogenic induction was maintained in both compartments

for the isotropic chondrogenic (IC) control group. Inductions in both compartments were

switched to hypertrophic regimens and maintained for the isotropic hypertrophic (IH)

control group. All groups were kept in culture for up to 10 weeks. Samples were taken at

different time points for gene expression (n=4), biochemical (n=4), histological (n=4),

µCT, and mechanical (n=4) analyses.

81

5.3.4 Subcutaneous Implantation

Discs cultured for 10 weeks were implanted into subcutaneous pouches of 8-10

week old female SCID mice (Jackson Laboratory). All animal experiments followed

federal guidelines and were conducted under a protocol approved by the Columbia

University Animal Care and Use Committee. Two incisions were made on the back of

each mice, and a blunt forceps was used to create a pocket in the subcutaneous space into

which the tissue samples were inserted. After implantation, the skin was closed with two

sutures, and mice were monitored daily. No signs of discomfort were observed following

surgery in any of the animals throughout the study. Samples were explanted at 4 weeks

for gene expression (n=4), biochemical (n=4), histological (n=4), µCT, and mechanical

(n=4) analyses.

5.3.5 Gene Expression Analysis

Samples were crushed with pestles and homogenized with the TRIzol reagent

(Life Technologies). RNA was extracted according to the TRIzol method. The quantity of

RNA was measured on the Nanodrop ND1000 (Fisher Scientific). Following treatment

with DNase I removal kit, cDNA was synthesized using the Applied Biosystems High

Capacity kit. Quantitative RT-PCR analysis was performed using 20 ng cDNA per

reaction and the Applied Biosystems SYBR® Green PCR Master Mix. The expression of

target genes was normalized to the housekeeping gene GAPDH, and calculated from the

mean Ct values of technical duplicates for each sample. All primers (Table 1) were

synthesized by Life Technologies.

82

Table 5-1. List of primers used for qPCR.

5.3.6 Histology and Immunohistochemistry

Samples were fixed in 10% formalin for 24 hours, and if necessary, decalcified

with Immunocal (Fisher Scientific). Following dehydration in ethanol series, samples

were embedded in paraffin and sectioned to 5 µm. Sections were stained for hematoxylin

and eosin (H&E), Alcian blue for GAG, Von Kossa for phosphates and Movat’s

pentrachrome. Samples were also stained immunohistochemically for lubricin,

osteopontin, PDGF-BB, cleaved caspase-3 (Cell Signaling Technology), SOX9, RUNX2,

type I, II and X collagen. All antibodies were from Abcam unless otherwise stated.

5.3.7 Image quantitation

For type X collagen and Von Kossa stains, images were balanced, binarized and

inverted using ImageJ (National Institutes of Health). Intensity profiles were established

across representative regions. To quantify composition, inverted images were thresholded

and the area stained was determined as a fraction of the total tissue area. For Movat’s

Gene Forward Sequence (5' to 3') Reverse Sequence (5' to 3')

ACAN CCCCTGCTATTTCATCGACCC GACACACGGCTCCACTTGAT

BMP2 ACCCGCTGTCTTCTAGCGT TTTCAGGCCGAACATGCTGAG

COL10A1 CATAAAAGGCCCACTACCCAAC ACCTTGCTCTCCTCTTACTGC

COL11A1 ACCCTCGCATTGACCTTCC TTTGTGCAAAATCCCGTTGTTT

COL2A1 AGACTTGCGTCTACCCCAATC GCAGGCGTAGGAAGGTCATC

COL9A1 GCCTTCCGGGCATTAAGGG GCAAACCGTTGGGACCTCTT

DKK1 ATAGCACCTTGGATGGGTATTCC CTGATGACCGGAGACAAACAG

GAPDH TGTTGCCATCAATGACCCCTT CTCCACGACGTACTCAGCG

IHH AACTCGCTGGCTATCTCGGT GCCCTCATAATGCAGGGACT

RUNX2 CCGTCTTCACAAATCCTCCCC CCCGAGGTCCATCTACTGTAAC

S100A1 GACCCTCATCAACGTGTTCCA CCACAAGCACCACATACTCCT

SOX9 AGCGAACGCACATCAAGAC CTGTAGGCGATCTGTTGGGG

SPP1 GTTTCGCAGACCTGACATCCA GCTTTCCATGTGTGAGGTGAT

83

pentachrome stains, images were segmented with the Color Deconvolution plugin,

binarized, inverted and thresholded to determine the stain areas of bone, cartilage, and

marrow.

5.3.8 Biochemical Analysis

Samples were blotted dry, weighed and digested in 0.5 mL proteinase K solution

at 60 °C. DNA and sulfated glycosaminoglycan (GAG) contents were measured from the

sample digests using the Molecular Probes Picogreen assay (Life Technologies) and the

1, 9-dimethylmethylene blue (DMMB) dye colorimetric assay respectively. The

remaining sample digests were then hydrolyzed at 110°C with 6N HCl. Hydroxyproline

content was determined from the hydrolysates and assumed to be 10% of the total

collagen content.

5.3.9 Mechanical Testing

As described in Chapter 4, the loading regimen for measuring the Young’s

modulus of the discs was adapted from a previous study with some modifications.

Samples (whole discs) submerged in PBS and tested with unconfined compression. Disc

thickness was measured by the position of tissue contact to that of the platen. The

cartilage discs were compressed at a very low strain rate (100 nm/s; ∼0.02% strain per

second) for up to 2,000 s, and the compressive load was measured. The ramp modulus

was calculated from the linear slope (20-30% strain) of the stress–strain curve. Based on

tests performed on native cartilage tissues, the ramp modulus at 0.02%/s is approximately

2.77 times that of the equilibrium modulus.

84

5.3.10 µCT Analysis

Samples were fixed in 10% formalin for 24 hours at room temperature and kept in

PBS. For each sample, 3D high-resolution images were obtained using a VivaCT 40

system (SCANCO Medical AG). Grayscale images were binarized using a global

threshold. Mineral volume and mineral density were evaluated using the standard

morphological analysis software on the VivaCT 40 system.

5.3.11 Statistical Analysis

All quantitative results are presented as mean ± SEM (n=4 per data point).

Pairwise comparisons were performed on results using multiway analysis of variance

(ANOVA) followed by Tukey’s post hoc test (Prism Software). Significant differences

are denoted as *(p < 0.05), ** (p < 0.01) and *** (p < 0.001).

85

5.4 Results

5.4.1 Hyaline Cartilage Formation and Deep Zone Mineralization

Both the IC and CH groups formed hyaline cartilage rich in sulfated

glycosaminoglycan (GAG). The CH group exhibited deep zone mineralization as

indicated by Von Kossa stains, starting at 6 weeks and progressing through 10 weeks

(Fig. 5-2). Alcian Blue stains confirmed maintenance of hyaline cartilage. In contrast,

the IH control group exhibited near complete loss of cartilage and mineralized

everywhere at the edge after 10 weeks (Fig. 5-3).

Figure 5-2. Histology showing deep mineralization in the CH group (Von Kossa), and maintenance of

hyaline cartilage in both groups (Alcian Blue). Scale bar: 200 µm.

Figure 5-3. Histology showing widespread loss of GAG (Movats) and peripheral mineralization (Von

Kossa) in the IH group at 10 weeks. Scale bar: 200 µm.

86

Similarly, transverse brightfield images of the whole discs revealed peripheral

deep zone mineralization at 6 weeks in the CH group and complete deep zone

mineralization by 10 weeks. Instead, the hyaline cartilage in the IC group remained

translucent.

Figure 5-4. Transverse brightfield images of whole cartilage discs at 6 weeks (top) and 10 weeks (bottom).

IC discs are shown on the left and CH discs are shown on the right.

At 10 weeks, both the IC and CH groups exhibited uniform type II collagen

deposition and no type I collagen deposition. As well as the Alcian Blue stains, these

results confirmed that hyaline cartilage with mature extracellular matrix was formed

despite the induction of deep zone mineralization in the CH group.

87

Figure 5-5. Histology confirming hyaline cartilage formation at 10 weeks. Uniform deposition of type II

collagen, but not type I collagen. Alcian Blue stains showed rich GAG deposition. Von Kossa stains

showed only the CH group was mineralized in the deep zone. Scale bar: 200 µm.

5.4.2 Biochemical and Mechanical Analysis

The DNA content of the CH group was lower at 6 weeks suggests the onset of

apoptosis with cartilage mineralization. Collagen contents, GAG and collagen

productivities (contents normalized to DNA) were similar between the groups at both 6

weeks and 10 weeks (Fig. 5-4). Interestingly, the decrease in DNA content of the CH

group at 6 weeks correlated with cleaved caspase-3 expression in the deep zone. This

suggests incipient deep zone apoptosis with the induction of mineralization. Furthermore,

the GAG content of the correlated the DNA content as determined by a correlation plot of

all data points. Thus, the slightly lower GAG content of the CH group can be attributed to

lower DNA content.

88

Figure 5-6. Biochemical analyses. Lower DNA content (6 weeks) and GAG content (10 weeks) in the CH

group. COL content, GAG and COL productivities (normalized to DNA) were similar.

Figure 5-7. Cleaved caspase-3 expression. Following deep zone hypertrophic induction, some apoptosis

was seen as 6 weeks with incipient mineralization in the deep zone. In contrast, no apoptosis was seen at 10

weeks, or in the isotropic control groups at both 6 weeks and 10 weeks. Scale bar: 200 µm.

89

Figure 5-8. Scatter plot showing correlation between GAG and DNA data of both IC and CH groups at 6

weeks and 10 weeks. Pearson correlation was determined to be 0.53.

Corresponding to the biochemical data, both groups exhibited similar mechanical

attributes. Although the compressive Young’s modulus and thickness of the CH group

was slightly lower, they are comparable to the IC group and the deficit can be attributed

to the difference in biochemical composition as elaborated (Fig. 5-5). In contrast to both

the IC and CH group, the GAG and COL contents of the IH group deteriorated

significantly (Fig. 5-6).

Figure 5-9. Mechanical analyses showing similar attributes. The compressive Young’s modulus and

thickness of the CH group was slightly lower.

90

Figure 5-10. Biochemical analyses. Significant, near complete loss of GAG in the IH group at 10 weeks.

5.4.3 Changes in Gene Expression

We assessed the gene expression of the IC and CH groups at different time points.

Correlating with the biochemical compositions, the expression of aggrecan (ACAN) and

type II collagen (COL2A1) were similar between the groups. Instead, the expression of

markers associated with chondrogenesis (SOX9, S100A), chondrocyte maturation

(COL9A1, COL11A1), and terminal differentiation (COL10A1, RUNX2, SPP1) were

significantly upregulated in the CH group from 6 weeks to 10 weeks (Fig. 5-7). Similarly,

the expression of trophic factors promoting cartilage maintenance (DKK1) and

maturation (IHH, BMP2) were also upregulated in the CH group.

In contrast, the expression of chondrogenic markers was abolished and terminal

maturation markers were upregulated in the IH group at 10 weeks (Fig. 5-8). This

correlated with the loss of hyaline cartilage matrix and extensive mineralization of the IH

discs as shown in histological and biochemical analyses.

91

Figure 5-11. Gene expression analyses of IC and CH groups at multiple time points. CH group showed

increased expression of cartilage homeostasis (SOX9, S100A1), chondrocyte maturation (COL9A1,

COL11A1), terminal differentiation (COL10A1, RUNX2, SPP), and trophic markers (DKK1, BMP2, IHH)

expression. Differences between groups reached significance at 10 weeks. ACAN and COL2A1

expressions were similar between groups. All gene expressions (2-∆∆Ct) are normalized to GAPDH and 2

week controls.

Figure 5-12. Gene expression analyses of CH, IC, and IH groups at 10 weeks. Cartilage maintenance

markers (ACAN, COL2A1, SOX9) were downregulated and terminal maturation marker (RUNX2) was

upregulated. All gene expressions (2-∆Ct) are normalized to GAPDH.

92

5.4.4 Induction of Deep Zone Hypertrophy

We stained for type X collagen expression and found enhanced deep zone

hypertrophy in the CH group, which correlated with deep zone mineralization (Fig. 2C).

Profiling the expression, we observed a sharp intensity peak in the deep zone of the CH

group, which increased without a change in relative position from 6 weeks to 10 weeks.

Instead, the expression in the IC group was more diffuse (Fig. 2D). Thus, the

implementation of spatiotemporal regulation potentiated deep zone chondrocyte terminal

differentiation.

Figure 5-13. Type X collagen immunohistochemical stains and inverted images. Red arrows indicate band

of hypertrophy. Scale bar: 200 µm.

Figure 5-14. Intensity profile of type X collagen stains showed distinct deep zone peaks in the CH group.

93

5.4.4 Cartilage Maintenance and Stability In vivo

We implanted all groups subcutaneously in immunocompromised mice to assess

cartilage maintenance in vivo (Fig. 5-9). After 4 weeks, the IC group underwent

endochondral ossification as marrow cells infiltrated into the nascent bone at the bottom

of the discs. Remarkably, the CH group resisted endochondral ossification, and exhibited

columnar chondrocytes and tidemark formation (Fig. 5-10).

Figure 5-15. Overview of implantation. Tissues cultured for 10 weeks were implanted for 4 weeks.

Movat’s pentachrome stains confirmed endochondral ossification in the IC group

but not the CH group. Von Kossa stains also indicated extensive cartilage mineralization

and bone formation in the IC group (Fig. 5-10). To quantify the comparison, the bone,

cartilage and marrow fractions were quantified by color segmentation of the pentachrome

stain images. Significant bone and marrow fractions were observed in the IC group but

not the CH group. Similarly, the Von Kossa stain images were quantified and profiled to

reveal a significantly larger fraction of mineralized tissue in the IC group and

maintenance of deep zone mineralization in the CH group.

94

Figure 5-16. Histology of IH and CH discs post- implantation. H&E, Movat’s pentachrome and Von Kossa

stains showed mature bone infiltrated with marrow cells at the bottom of the IC but not the CH discs.

Instead, the CH discs displayed columnar chondrocytes and tidemark formation. Scale bar: 200 µm.

Figure 5-17. Quantification of histological comparison. (Top) Segmentation and quantitation of Movat’s

pentachrome stains showed significant fractions of bone and marrow present in the IC but not the CH

group. (Bottom) Quantitation and profiling of Von Kossa stains showed greater and more extensive

mineralization in the IC group.

95

Corresponding to the histology, µCT analysis revealed greater mineral deposition

in the IC group than in the CH group. Reconstructed 3D images revealed a sheet of

mineral in the CH group, which suggests complete deep zone mineralization. Instead, the

IC group was mineralized across different depths. Quantification of the mineral volume

also showed significant changes in the IC group but not the CH group before and after the

implantation. The mineral density of the implanted IC group was also slightly higher than

that of the implanted CH group, possibly due to the emergence of mature lamellar bone

beneath the receding mineralized cartilage.

Figure 5-18. µCT analyses of the implanted IC and CH discs. (Left) Reconstructed µCT images showed

extensive mineral deposition in the IC group following implantation but not the CH group. (Right) The

increase in mineral volume was significantly greater in the IC group than the CH group post-implantation,

with a slightly greater mineral density.

5.4.5 Retention of Cartilage Markers and Zonal Organization.

To demonstrate the retention of cartilage phenotype by the CH group, gene

expression analysis, biochemical analysis and immunohistochemistry were further

performed on the implanted IC and CH discs.

96

Figure 5-19. Immunohistochemistry of implanted discs. IC group showed type I collagen deposition, loss of

type II collagen, faint lubricin expression in upper and lower aspects and extensive osteopontin expression.

CH group showed homogenous type II collagen deposition, superficial zone lubricin expression and deep

zone osteopontin expression. PDGF-BB stains revealed pre-osteoclasts/osteoclasts invading IC but not CH

discs.

97

The CH group remained type II collagen rich, and distinctly expressed lubricin in

the superficial zone and osteopontin in the deep zone. In contrast, the IC group exhibited

loss of type II collagen in the cartilage layer and deposition of type I collagen in the bone

layer. The IC group exhibited faint lubricin expression and extensively expressed

osteopontin. PDGF-BB staining revealed infiltration of preosteoclasts and multinuclear

osteoclasts into the bottom of the IC but not the CH discs (Fig. 4A). In addition to

osteopontin, type X collagen and alkaline phosphatase (ALP) were also expressed

extensively in the IC group and in the deep zone of the CH group. Furthermore, SOX9

and RUNX2 expressions were zonally delineated in the CH discs but not the IC discs

(Fig. S5).

Figure 5-20. Immunohistochemistry of type X collagen and ALP after implantation. (A) Strong type X

collagen expression was seen in the deep zone of the CH group and near the superficial zone of the IC

group that was undergoing endochondral ossification. (B) ALP was expressed in the deep zone of the CH

group and extensively in the IC group. Scale bar: 200 µm.

98

Figure 5-21. Immunohistochemistry of SOX9 and RUNX2 expression after implantation. SOX9 expression

was maintained in the upper zone of the CH group and RUNX2 expression was limited to the deep zone.

Instead, trace SOX9 expression and extensive RUNX2 were seen in the IC group. Scale bar: 200 µm.

Compositionally, GAG content recovered in the CH group but decreased in the IC

group (Fig. 4B). Correspondingly, the expression of genes associated with cartilage

maintenance (SOX9, ACAN, COL2A1, COL9A1 and COL11A1) and chondrocyte

terminal differentiation (COL10A1, RUNX2) persisted in the CH group following

implantation. In contrast, all cartilage maintenance markers were significantly

downregulated in the IC group.

99

Figure 5-22. Biochemical analyses of implanted discs. GAG content of CH group recovered whereas that of

IC group deteriorated post-implantation. COL contents were similar.

Figure 5-23. Gene expression analyses of implanted discs. Expression of cartilage maintenance (SOX9,

ACAN, COL2A1, COL9A1, COL11A1) and chondrocyte terminal differentiation (COL10A1, RUNX2)

markers persisted in the CH group but not the IC group post-implantation. All gene expressions (2-∆Ct) are

normalized to GAPDH.

5.4.6 Role of inflammation

To investigate the role of inflammation in modulating turnover, the tissues were

stained for markers associated with M1 and M2 macrophages, iNOS and Arg-1. Whereas

both iNOS+ cells and Arg-1+ cells were present in the deep zone of the IC discs where

endochondral ossification was taking place, no iNOS+ or Arg-1+ cells were observed in

100

the deep zone of the CH discs. Particularly, Arg-1 was expressed more intensely than

iNOS by cells populating the endochondral ossification region in the IC discs, suggesting

greater anabolic activity and bone formation following early cartilage turnover.

Interestingly, superficial zone chondrocytes in the CH discs expressed Arg-1 but not

iNOS.

Figure 5-24. Immunohistochemistry stains of iNOS and Arg-1. iNOS+ and Arg-1+ cells were seen in IC

discs where endochondral ossification was occurring, with greater Arg-1 expression. Superficial zone

chondrocytes in the CH discs expressed Arg-1 but not iNOS. Scale bar: 200 µm.

5.4.7 Endochondral Ossification following IH Induction

Following implantation, the IH group also underwent endochondral ossification.

However, unlike the IC and CH groups, bone formation and marrow infiltration occurred

all around the discs (Fig. 5-11).

Corresponding to the histology, µCT analysis revealed greater mineral deposition

in the IH group than in the IC and CH groups. Both the mineral density and mineral

101

volume were higher, albeit only the difference in mineral volume reached significance.

Reconstructed µCT images also indicated mineralization everywhere.

Figure 5-25. Histology of IH discs post-implantation. Extensive endochondral ossification with bone

formation and marrow infiltration from all sides of the tissue. Scale bar: 200 µm.

Figure 5-26. µCT analyses of the IH disc after implantation. (Top) Reconstructed µCT images of the IH

disc after implantation, in comparison with the CH and IC discs. The implanted IH disc was mineralized

everywhere. Scale bar: 1 mm. (Bottom) The IH discs exhibited higher mineral density (not significant) and

mineral volume than the CH and IC discs.

102

5.5 Discussion

Standard isotropic culture conditions fail to recapitulate native spatiotemporal

gradients, and tend to form poorly organized cartilage tissues that are prone to

endochondral ossification in vivo [44, 46]. Here, we implemented spatiotemporal

regulation during the induction of self-assembling hMSCs in vitro, and showed that it

potentiated the formation of physiologic cartilage discs with deep zone mineralization

and in vivo stability.

Tissue engineering approaches are increasingly guided by biological principles.

Mesenchymal condensation has been adapted into self-assembly methods to enhance

cartilage formation in vitro [41, 87]. TGF-β and thyroxine, potent effectors of cartilage

maintenance and chondrocyte terminal differentiation, have been used in chondrogenic

and hypertrophic induction regimens to guide MSC differentiation [39, 46, 90, 107, 118-

121]. Thus, we chose these two factors as culture supplements to implement

spatiotemporal regulation. Chondrogenesis of MSCs in vitro is defined by a temporal

sequence of cellular and molecular events [40]. We recently showed that isotropic

chondrogenic induction of hMSCs encapsulated in hydrogel formed cartilage with a

deficient core [114]. In other studies, isotropic hypertrophic induction of

chondrogenically differentiated hMSCs resulted in uncontrolled mineralization [46, 122].

Thus, spatiotemporal regulation poses a significant challenge in the quest to engineer

physiologic cartilage.

103

To enable compartmentalization and stepwise maturation, we switched deep zone

induction to a hypertrophic regimen at 3 weeks. The formation of cartilage discs isolated

the apical compartment from the basal compartment to set up a dual compartment culture.

This process recapitulates some aspects of the spatiotemporal gradient present during

native cartilage development. Following the switch, hyaline cartilage was maintained and

deep zone mineralization progressed through 10 weeks of culture.

Cartilage maintenance and maturation are governed by complex signaling

crosstalk involving multiple pathways and transcription factors [51, 123]. SOX9 and its

target S100A1 are required for chondrogenesis during limb development and postnatal

cartilage homeostasis [124, 125]. DKK1 is a canonical Wnt inhibitor that prevents

terminal differentiation [126]. On the contrary, BMP2 and IHH promote terminal

differentiation and the upregulation of RUNX2 [127]. Type II, IX and XI collagen are

indicative of mature articular chondrocytes whereas type X collagen and mineral binding

proteins such as osteopontin are indicative of hypertrophic chondrocytes [51]. In the

present study, spatiotemporal regulation in vitro potentiated the upregulation of these

genes associated with cartilage maintenance, matrix maturation and terminal

differentiation. As well as the increased type X collagen expression in the deep zone,

these data suggest that the increase in local terminal differentiation was concurrent with

overall cartilage maturation.

Interestingly, gene expressions at 6 weeks were not significantly different

between groups. This could be attributed to the heterogeneous differentiation states of the

104

cells during induction. At 6 weeks, the discs were mineralized at the rim which suggests

deep zone cells at the rim underwent terminal differentiation before cells in the middle.

At 10 weeks, the mineralization was complete and differences in gene expression of

relevant markers reached significance.

Notably, we showed that the cartilage discs formed under spatiotemporal

regulation in vitro were stable and remained organized during ectopic implantation in

mice. Instead, discs formed in isotropic cultures underwent uncontrolled mineralization

and endochondral ossification in vivo, in agreement with previous studies [44, 46]. The

stratification was evidenced by superficial zone expression of lubricin and deep zone

expression of osteopontin. We previously showed that self-assembling MSCs formed

cartilage with a superficial lubricin lining after 5 weeks of chondrogenic induction [41].

In the present study, zonal lubricin expression was observed after implantation. Despite

the heterogeneous differentiation states as indicated by patchy expressions, SOX9 was

generally expressed in the upper zone and RUNX2 in the deep zone. These indicated

zonal delineation of cartilage homeostasis and chondrocyte terminal differentiation.

Persistent expression of cartilage maintenance and maturation markers, and a recovery in

GAG content further confirmed the in vivo stability of the discs.

Probing the role of inflammation, we found that iNOS+ cells and Arg-1+ cells

populated deep zone of the IC discs where endochondral ossification was occurring. The

expression of Arg-1 was also visibly greater than iNOS. Whereas M1 macrophages

convert arginine into NO via iNOS to mount a “kill” response, M2 macrophages promote

105

“repair” as they convert arginine into ornithine, a precursor of polyamines, via Arg-1 [77,

81]. Similarly, in vivo studies of bone fracture repair reported a transition in macrophage

phenotype from M1 to M2 during endochondral ossification [81]. Thus, the greater

expression of Arg-1 suggests more anabolic activity leading to bone formation following

earlier cartilage turnover. Interestingly, we also observed Arg-1 expression in the

superficial zone of the CH discs. Although the function of Arg-1 in chondrocytes is

unknown, it could exert a chondroprotective effect by inhibiting NO production or

promoting cartilage matrix synthesis.

The native calcified cartilage bridges the articular cartilage and the subchondral

bone, and protects the articular cartilage by blocking vascular invasion and selectively

permitting the passage of small molecules from the subchondral bone [128]. A recent

study showed that engineered mineralized cartilage increased the interfacial shear

strength of osteochondral composites [122]. In this study, mineralized cartilage bore a

tidemark following implantation that the native calcified cartilage, and resisted

endochondral ossification. We determined that the mineral found in the calcified cartilage

formed from hMSCs is apatite, similar to that of the native cartilage, and established that

the mineral density increased during implantation prior to endochondral ossification

(unpublished observations). In the present study, deep zone mineralized cartilage discs

formed from hMSCs remained stable and organized in vivo. Interestingly, the mineralized

cartilage bore a tidemark following implantation and resembled the native calcified

cartilage. The lack of endochondral ossification in vivo could be attributed in part to the

chondroprotective effects of the engineered calcified cartilage.

106

5.6 Conclusion

This study provides evidence to support the hypothesis that organized and stable

cartilage with physiologic likeness can be grown in vitro from self-assembling hMSCs by

implementing spatiotemporal regulation during induction that recapitulates some aspects

of native development. Selective application of induction regimens in dual compartment

culture enabled the maintenance of hyaline cartilage and potentiated deep zone

mineralization.

For the first time to our knowledge, stratified cartilage grown in vitro from

hMSCs resisted endochondral ossification and retained zonal organization without loss of

cartilage markers expression in vivo. Conceivably, this method can be applied towards

engineering other tissues from self-assembling progenitor cells also patterned with

spatiotemporal gradients during native development.

107

5.7 Future work

Despite the encouraging results, we also acknowledge the limitations of this

study. Although we thoroughly investigated the approach with hMSCs from one donor,

future studies will evaluate the approach with MSCs from more donors and sources such

as the adipose and synovium. Furthermore, we could not clearly define underlying

mechanisms to explain the similarities in the organization and maturation profiles exist

between the engineered cartilage and the native articular cartilage. RNA in situ

hybridization could further clarify expression patterns, and gain-or-loss of function

experiment could provide causal explanations.

To achieve cartilage formation at a clinically relevant scale, the cartilage

thickness needs to be doubled. Towards that end, we could integrate our novel approach

with a method we developed to engineer large cartilage by fusing condensed

mesenchymal bodies on bone scaffolds [41]. Importantly, this approach locally regulated

but did not inhibit type X collagen expression. The incorporation of other factors such as

hypoxia and compressive loading could be necessary to inhibit spontaneous hypertrophy

and improve functional properties of the engineered cartilage [113]. Whether bona fide

articular cartilage can be formed from MSCs requires validation with well-defined

markers that distinguish between mature chondrocytes and MSCs [49]. Developmentally,

the articular cartilage is formed by outer interzone cells originating from the

chondrogenic mesoderm [129]. The use of pluripotent stem cells would also enable

unprecedented control as they can generate chondrocytes with distinct articular and

growth plate phenotypes [130].

108

References

1. Hall BK, Miyake T. All for one and one for all: condensations and the initiation

of skeletal development. Bioessays 2000; 22:138-147.

2. Pacifici M, Koyama E, Shibukawa Y, Wu C, Tamamura Y, Enomoto-Iwamoto M,

Iwamoto M. Cellular and molecular mechanisms of synovial joint and articular

cartilage formation. In Skeletal Development and Remodeling in Health, Disease,

and Aging. Volume 1068. Edited by Zaidi M; 2006; 74-86: Annals of the New

York Academy of Sciences].

3. Iwamoto M, Ohta Y, Larmour C, Enomoto-Iwamoto M. Toward regeneration of

articular cartilage. Birth Defects Res C Embryo 2013; 99:192-202.

4. Lawrence RC, Felson DT, Helmick CG, Arnold LM, Choi H, Deyo RA, Gabriel

S, Hirsch R, Hochberg MC, Hunder GG, et al. Estimates of the prevalence of

arthritis and other rheumatic conditions in the United States. Arthritis Rheum

2008; 58:26-35.

5. Guccione AA, Felson DT, Anderson JJ, Anthony JM, Zhang YQ, Wilson PWF,

Kellyhayes M, Wolf PA, Kreger BE, Kannel WB. THE EFFECTS OF SPECIFIC

MEDICAL CONDITIONS ON THE FUNCTIONAL LIMITATIONS OF

ELDERS IN THE FRAMINGHAM-STUDY. Am J Public Health 1994; 84:351-

358.

6. Curl WW, Krome J, Gordon ES, Rushing J, Smith BP, Poehling GG. Cartilage

injuries: A review of 31,516 knee arthroscopies. Arthroscopy: The Journal of

Arthroscopic & Related Surgery 1997; 13:456-460.

109

7. Hangody L, Kish G, Karpati Z, Szerb I, Udvarhelyi I. Arthroscopic autogenous

osteochondral mosaicplasty for the treatment of femoral condylar articular

defects. A preliminary report. Knee Surg Sports Traumatol Arthrosc 1997; 5:262-

267.

8. Brittberg M, Lindahl A, Nilsson A, Ohlsson C, Isaksson O, Peterson L. Treatment

of deep cartilage defects in the knee with autologous chondrocyte transplantation.

N Engl J Med 1994; 331:889-895.

9. Knutsen G, Engebretsen L, Ludvigsen TC, Drogset JO, Grontvedt T, Solheim E,

Strand T, Roberts S, Isaksen V, Johansen C. Autologous chondrocyte

implantation compared with microfracture in the knee - A randomized trial. J

Bone Joint Surg Am 2004; 86A:455-464.

10. Cole BJ, Pascual-Garrido C, Grumet RC. Surgical Management of Articular

Cartilage Defects in the Knee. J Bone Joint Surg Am 2009; 91a:1778-1790.

11. Akeson WH, Bugbee W, Chu C, Giurea A. Differences in mesenchymal tissue

repair. Clin Orthop Relat Res 2001:S124-S141.

12. Kreuz PC, Steinwachs MR, Erggelet C, Krause SJ, Konrad G, Uhl M, Sudkamp

N. Results after microfracture of full-thickness chondral defects in different

compartments in the knee. Osteoarthritis Cartilage 2006; 14:1119-1125.

13. Horas U, Pelinkovic D, Herr G, Aigner T, Schnettler R. Autologous chondrocyte

implantation and osteochondral cylinder transplantation in cartilage repair of the

knee joint - A prospective, comparative trial. J Bone Joint Surg Am 2003;

85A:185-192.

110

14. Micheli LJ, Browne JE, Erggelet C, Fu F, Mandelbaum B, Moseley JB,

Zurakowski D. Autologous chondrocyte implantation of the knee: Multicenter

experience and minimum 3-year follow-up. Clin J Sport Med 2001; 11:223-228.

15. Knutsen G, Drogset JO, Engebretsen L, Grontvedt T, Ludvigsen TC, Loken S,

Solheim E, Strand T, Johansen O. A Randomized Multicenter Trial Comparing

Autologous Chondrocyte Implantation with Microfracture: Long-Term Follow-up

at 14 to 15 Years. J Bone Joint Surg Am 2016; 98:1332-1339.

16. Tuan RS. Stemming cartilage degeneration: Adult mesenchymal stem cells as a

cell source for articular cartilage tissue engineering. Arthritis Rheum 2006;

54:3075-3078.

17. Freed LE, Marquis JC, Nohria A, Emmanual J, Mikos AG, Langer R.

NEOCARTILAGE FORMATION IN VITRO AND IN VIVO USING CELLS

CULTURED ON SYNTHETIC BIODEGRADABLE POLYMERS. J Biomed

Mater Res 1993; 27:11-23.

18. Vunjak-Novakovic G, Martin I, Obradovic B, Treppo S, Grodzinsky AJ, Langer

R, Freed LE. Bioreactor cultivation conditions modulate the composition and

mechanical properties of tissue-engineered cartilage. J Orthop Res 1999; 17:130-

138.

19. Benya PD, Shaffer JD. Dedifferentiated chondrocytes reexpress the differentiated

collagen phenotype when cultured in agarose gels. Cell 1982; 30:215-224.

20. Paige KT, Cima LG, Yaremchuk MJ, Schloo BL, Vacanti JP, Vacanti CA. De

novo cartilage generation using calcium alginate-chondrocyte constructs. Plast

Reconstr Surg 1996; 97:168-178.

111

21. Mauck RL, Soltz MA, Wang CCB, Wong DD, Chao PHG, Valhmu WB, Hung

CT, Ateshian GA. Functional tissue engineering of articular cartilage through

dynamic loading of chondrocyte-seeded agarose gels. J Biomech Eng T ASME

2000; 122:252-260.

22. Mauck RL, Nicoll SB, Seyhan SL, Ateshian GA, Hung CT. Synergistic action of

growth factors and dynamic loading for articular cartilage tissue engineering.

Tissue Eng 2003; 9:597-611.

23. Crawford DC, Heveran CM, Cannon WD, Foo LF, Potter HG. An Autologous

Cartilage Tissue Implant NeoCart for Treatment of Grade III Chondral Injury to

the Distal Femur Prospective Clinical Safety Trial at 2 Years. Am J Sports Med

2009; 37:1334-1343.

24. Crawford DC, DeBerardino TM, Williams RJ. NeoCart, an Autologous Cartilage

Tissue Implant, Compared with Microfracture for Treatment of Distal Femoral

Cartilage Lesions An FDA Phase-II Prospective, Randomized Clinical Trial After

Two Years. J Bone Joint Surg Am 2012; 94A:979-989.

25. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD,

Moorman MA, Simonetti DW, Craig S, Marshak DR. Multilineage potential of

adult human mesenchymal stem cells. Science 1999; 284:143-147.

26. Bianco P, Robey PG, Simmons PJ. Mesenchymal stem cells: Revisiting history,

concepts, and assays. Cell Stem Cell 2008; 2:313-319.

27. Mauck RL, Yuan X, Tuan RS. Chondrogenic differentiation and functional

maturation of bovine mesenchymal stem cells in long-term agarose culture.

Osteoarthritis Cartilage 2006; 14:179-189.

112

28. Huang AH, Stein A, Tuan RS, Mauck RL. Transient Exposure to Transforming

Growth Factor Beta 3 Improves the Mechanical Properties of Mesenchymal Stem

Cell–Laden Cartilage Constructs in a Density-Dependent Manner. Tissue Eng

Part A 2009; 15:3461-3472.

29. Sampat SR, Dermksian MV, Oungoulian SR, Winchester RJ, Bulinski JC,

Ateshian GA, Hung CT. Applied osmotic loading for promoting development of

engineered cartilage. J Biomech 2013; 46:2674-2681.

30. O'Connell GD, Nims RJ, Green J, Cigan AD, Ateshian GA, Hung CT. TIME

AND DOSE-DEPENDENT EFFECTS OF CHONDROITINASE ABC ON

GROWTH OF ENGINEERED CARTILAGE. Eur Cell Mater 2014; 27:312-320.

31. Suh JKF, Matthew HWT. Application of chitosan-based polysaccharide

biomaterials in cartilage tissue engineering: a review. Biomaterials 2000;

21:2589-2598.

32. Varghese S, Hwang NS, Canver AC, Theprungsirikul P, Lin DW, Elisseeff J.

Chondroitin sulfate based niches for chondrogenic differentiation of mesenchymal

stem cells. Matrix Biol 2008; 27:12-21.

33. Kim IL, Mauck RL, Burdick JA. Hydrogel design for cartilage tissue engineering:

A case study with hyaluronic acid. Biomaterials 2011; 32:8771-8782.

34. Moutos FT, Freed LE, Guilak F. A biomimetic three-dimensional woven

composite scaffold for functional tissue engineering of cartilage. Nat Mater 2007;

6:162-167.

113

35. Bian L, Guvendiren M, Mauck RL, Burdick JA. Hydrogels that mimic

developmentally relevant matrix and N-cadherin interactions enhance MSC

chondrogenesis. Proc Natl Acad Sci U S A 2013; 110:10117-10122.

36. Brunger JM, Huynh NPT, Guenther CM, Perez-Pinera P, Moutos FT, Sanchez-

Adams J, Gersbach CA, Guilak F. Scaffold-mediated lentiviral transduction for

functional tissue engineering of cartilage. Proc Natl Acad Sci U S A 2014;

111:E798-E806.

37. Kandel RA, Boyle J, Gibson G, Cruz T, Speagle M. In vitro formation of

mineralized cartilagenous tissue by articular chondrocytes. In Vitro Cell Dev Biol

- Animal 1997; 33:174-181.

38. Yu H, Grynpas M, Kandel RA. Composition of cartilagenous tissue with

mineralized and non-mineralized zones formed in vitro. Biomaterials 1997;

18:1425-1431.

39. Johnstone B, Hering TM, Caplan AI, Goldberg VM, Yoo JU. In Vitro

Chondrogenesis of Bone Marrow-Derived Mesenchymal Progenitor Cells. Exp

Cell Res 1998; 238:265-272.

40. Sekiya I, Vuoristo JT, Larson BL, Prockop DJ. In vitro cartilage formation by

human adult stem cells from bone marrow stroma defines the sequence of cellular

and molecular events during chondrogenesis. Proc Natl Acad Sci U S A 2002;

99:4397-4402.

41. Bhumiratana S, Eton RE, Oungoulian SR, Wan LQ, Ateshian GA, Vunjak-

Novakovic G. Large, stratified, and mechanically functional human cartilage

114

grown in vitro by mesenchymal condensation. Proc Natl Acad Sci U S A 2014;

111:6940-6945.

42. Murdoch AD, Grady LM, Ablett MP, Katopodi T, Meadows RS, Hardingham TE.

Chondrogenic Differentiation of Human Bone Marrow Stem Cells in Transwell

Cultures: Generation of Scaffold-Free Cartilage. Stem Cells 2007; 25:2786-2796.

43. Lee WD, Hurtig MB, Kandel RA, Stanford WL. Membrane Culture of Bone

Marrow Stromal Cells Yields Better Tissue Than Pellet Culture for Engineering

Cartilage-Bone Substitute Biphasic Constructs in a Two-Step Process. Tissue Eng

Part C 2011; 17:939-948.

44. Pelttari K, Winter A, Steck E, Goetzke K, Hennig T, Ochs BG, Aigner T, Richter

W. Premature induction of hypertrophy during in vitro chondrogenesis of human

mesenchymal stem cells correlates with calcification and vascular invasion after

ectopic transplantation in SCID mice. Arthritis Rheum 2006; 54:3254-3266.

45. Scotti C, Piccinini E, Takizawa H, Todorov A, Bourgine P, Papadimitropoulos A,

Barbero A, Manz MG, Martin I. Engineering of a functional bone organ through

endochondral ossification. Proc Natl Acad Sci U S A 2013; 110:3997-4002.

46. Scotti C, Tonnarelli B, Papadimitropoulos A, Scherberich A, Schaeren S,

Schauerte A, Lopez-Rios J, Zeller R, Barbero A, Martin I. Recapitulation of

endochondral bone formation using human adult mesenchymal stem cells as a

paradigm for developmental engineering. Proc Natl Acad Sci U S A 2010;

107:7251-7256.

115

47. Bahney CS, Hu DP, Taylor AJ, Ferro F, Britz HM, Hallgrimsson B, Johnstone B,

Miclau T, Marcucio RS. Stem Cell- Derived Endochondral Cartilage Stimulates

Bone Healing by Tissue Transformation. J Bone Miner Res 2014; 29:1269-1282.

48. Harada N, Watanabe Y, Sato K, Abe S, Yamanaka K, Sakai Y, Kaneko T,

Matsushita T. Bone regeneration in a massive rat femur defect through

endochondral ossification achieved with chondrogenically differentiated MSCs in

a degradable scaffold. Biomaterials 2014; 35:7800-7810.

49. Dell'Accio F, Cosimo De B, Luyten FP. Molecular markers predictive of the

capacity of expanded human articular chondrocytes to form stable cartilage in

vivo. Arthritis Rheum 2001; 44:1608-1619.

50. De Bari C, Dell'Accio F, Luyten FP. Failure of in vitro-differentiated

mesenchymal stem cells from the synovial membrane to form ectopic stable

cartilage in vivo. Arthritis Rheum 2004; 50:142-150.

51. Goldring MB, Tsuchimochi K, Ijiri K. The control of chondrogenesis. J Cell

Biochem 2006; 97:33-44.

52. Kronenberg HM. Developmental regulation of the growth plate. Nature 2003;

423:332-336.

53. Hentze H, Soong PL, Wang ST, Phillips BW, Putti TC, Dunn NR. Teratoma

formation by human embryonic stem cells: Evaluation of essential parameters for

future safety studies. Stem Cell Res 2009; 2:198-210.

54. VandeVord PJ, Matthew HWT, DeSilva SP, Mayton L, Wu B, Wooley PH.

Evaluation of the biocompatibility of a chitosan scaffold in mice. J Biomed Mater

Res 2002; 59:585-590.

116

55. Haynesworth SE, Goshima J, Goldberg VM, Caplan AI. CHARACTERIZATION

OF CELLS WITH OSTEOGENIC POTENTIAL FROM HUMAN MARROW.

Bone 1992; 13:81-88.

56. Tsigkou O, Pomerantseva I, Spencer JA, Redondo PA, Hart AR, O'Doherty E,

Lin Y, Friedrich CC, Daheron L, Lin CP, et al. Engineered vascularized bone

grafts. Proc Natl Acad Sci U S A 2010; 107:3311-3316.

57. Reinisch A, Etchart N, Thomas D, Hofmann NA, Fruehwirth M, Sinha S, Chan

CK, Senarath-Yapa K, Seo E-Y, Wearda T, et al. Epigenetic and in vivo

comparison of diverse MSC sources reveals an endochondral signature for human

hematopoietic niche formation. Blood 2015; 125:249-260.

58. Lipman JM, McDevitt CA, Sokoloff L. XENOGRAFTS OF ARTICULAR

CHONDROCYTES IN THE NUDE-MOUSE. Calcif Tissue Int 1983; 35:767-

772.

59. Wright GC, Miller F, Sokoloff L. INDUCTION OF BONE BY XENOGRAFTS

OF RABBIT GROWTH PLATE CHONDROCYTES IN THE NUDE-MOUSE.

Calcif Tissue Int 1985; 37:250-256.

60. Blumer MJF, Hausott B, Schwarzer C, Hayman AR, Stempel J, Fritsch H. Role of

tartrate-resistant acid phosphatase (TRAP) in long bone development. Mech Dev

2012; 129:162-176.

61. Xie H, Cui Z, Wang L, Xia Z, Hu Y, Xian L, Li C, Xie L, Crane J, Wan M, et al.

PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with

osteogenesis. Nat Med 2014; 20:1270-1278.

117

62. Henderson JE, Gao C, Harvey EJ. Skeletal Phenotyping in Rodents: Tissue

Isolation and Manipulation. 2011.

63. Zaidi M. Skeletal remodeling in health and disease. Nat Med 2007; 13:791-801.

64. Amling M, Herden S, Posl M, Hahn M, Ritzel H, Delling G. Heterogeneity of the

skeleton: Comparison of the trabecular microarchitecture of the spine, the iliac

crest, the femur, and the calcaneus. J Bone Miner Res 1996; 11:36-45.

65. Hildebrand T, Laib A, Muller R, Dequeker J, Ruegsegger P. Direct three-

dimensional morphometric analysis of human cancellous bone: Microstructural

data from spine, femur, iliac crest, and calcaneus. J Bone Miner Res 1999;

14:1167-1174.

66. Lochmueller E-M, Matsuura M, Bauer J, Hitzl W, Link TM, Mueller R, Eckstein

F. Site-Specific Deterioration of Trabecular Bone Architecture in Men and

Women With Advancing Age. J Bone Miner Res 2008; 23:1964-1973.

67. Zhou B, Liu XS, Wang J, Lu XL, Fields AJ, Guo XE. Dependence of mechanical

properties of trabecular bone on plate-rod microstructure determined by

individual trabecula segmentation (ITS). J Biomech 2014; 47:702-708.

68. Naveiras O, Nardi V, Wenzel PL, Hauschka PV, Fahey F, Daley GQ. Bone-

marrow adipocytes as negative regulators of the haematopoietic

microenvironment. Nature 2009; 460:259-U124.

69. Torisawa Y-s, Spina CS, Mammoto T, Mammoto A, Weaver JC, Tat T, Collins

JJ, Ingber DE. Bone marrow-on-a-chip replicates hematopoietic niche physiology

in vitro. Nature Methods 2014; 11:663-+.

118

70. Kreja L, Brenner RE, Tautzenberger A, Liedert A, Friemert B, Ehrnthaller C,

Huber-Lang M, Ignatius A. Non-Resorbing Osteoclasts Induce Migration and

Osteogenic Differentiation of Mesenchymal Stem Cells. J Cell Biochem 2010;

109:347-355.

71. Yang L, Tsang KY, Tang HC, Chan D, Cheah KSE. Hypertrophic chondrocytes

can become osteoblasts and osteocytes in endochondral bone formation. Proc Natl

Acad Sci U S A 2014; 111:12097-12102.

72. Zhou X, von der Mark K, Henry S, Norton W, Adams H, de Crombrugghe B.

Chondrocytes Transdifferentiate into Osteoblasts in Endochondral Bone during

Development, Postnatal Growth and Fracture Healing in Mice. PLoS Genet 2014;

10.

73. Briken V, Mosser DM. Editorial: Switching on arginase in M2 macrophages. J

Leukocyte Biol 2011; 90:839-841.

74. Hoemann CD, Chen GP, Marchand C, Tran-Khanh N, Thibault M, Chevrier A,

Sun J, Shive MS, Fernandes MJG, Poubelle PE, et al. Scaffold-Guided

Subchondral Bone Repair Implication of Neutrophils and Alternatively Activated

Arginase-1+Macrophages. Am J Sports Med 2010; 38:1845-1856.

75. Loke P, Gallagher L, Nair MG, Zang X, Brombacher F, Mohrs M, Allison JP,

Allen JE. Alternative activation is an innate response to injury that requires

CD4(+) T cells to be sustained during chronic infection. J Immunol 2007;

179:3926-3936.

119

76. Stein M, Keshav S, Harris N, Gordon S. Interleukin-4 Potently Enhances Murine

Macrophage Mannose Receptor Activity - a Marker of Alternative Immunological

Macrophage Activation. J Exp Med 1992; 176:287-292.

77. Hesse M, Modolell M, La Flamme AC, Schito M, Fuentes JM, Cheever AW,

Pearce EJ, Wynn TA. Differential regulation of nitric oxide synthase-2 and

arginase-1 by type 1/type 2 cytokines in vivo: Granulomatous pathology is shaped

by the pattern of L-arginine metabolism. J Immunol 2001; 167:6533-6544.

78. van't Hof RJ, Armour KJ, Smith LM, Armour KE, Wei XQ, Liew FY, Ralston

SH. Requirement of the inducible nitric oxide synthase pathway for IL-1-induced

osteoclastic bone resorption. Proc Natl Acad Sci U S A 2000; 97:7993-7998.

79. Zheng H, Yu X, Collin-Osdoby P, Osdoby P. RANKL stimulates inducible nitric-

oxide synthase expression and nitric oxide production in developing osteoclasts -

An autocrine negative feedback mechanism triggered by RANKL-induced

interferon-beta via NF-kappa B that restrains osteoclastogenesis and bone

resorption. J Biol Chem 2006; 281:15809-15820.

80. Yeon JT, Choi SW, Kim SH. Arginase 1 is a negative regulator of osteoclast

differentiation. Amino Acids 2016; 48:559-565.

81. Schlundt C, El Khassawna T, Serra A, Dienelt A, Wendler S, Schell H, van

Rooijen N, Radbruch A, Lucius R, Hartmann S, et al. Macrophages in bone

fracture healing: Their essential role in endochondral ossification. Bone 2015.

82. An G, Acharya C, Feng XY, Wen K, Zhong MK, Zhang L, Munshi NC, Qiu LG,

Tai YT, Anderson KC. Osteoclasts promote immune suppressive

120

microenvironment in multiple myeloma: therapeutic implication. Blood 2016;

128:1590-1603.

83. Waldman SD, Grynpas MD, Pilliar RM, Kandel RA. Characterization of

cartilagenous tissue formed on calcium polyphosphate substrates in vitro. J

Biomed Mater Res 2002; 62:323-330.

84. Kandel RA, Grynpas M, Pilliar R, Lee J, Wang J, Waldman S, Zalzal P, Hurtig

M. Repair of osteochondral defects with biphasic cartilage-calcium polyphosphate

constructs in a Sheep model. Biomaterials 2006; 27:4120-4131.

85. Hayes AJ, Hall A, Brown L, Tubo R, Caterson B. Macromolecular Organization

and In Vitro Growth Characteristics of Scaffold-free Neocartilage Grafts. J

Histochem Cytochem 2007; 55:853-866.

86. Ahmed N, Gan L, Nagy A, Zheng J, Wang C, Kandel RA. Cartilage Tissue

Formation Using Redifferentiated Passaged Chondrocytes In Vitro. Tissue Eng

Part A 2008; 15:665-673.

87. Hu JC, Athanasiou KA. A Self-Assembling Process in Articular Cartilage Tissue

Engineering. Tissue Eng 2006; 12:969-979.

88. Ofek G, Revell CM, Hu JC, Allison DD, Grande-Allen KJ, Athanasiou KA.

Matrix Development in Self-Assembly of Articular Cartilage. PLoS ONE 2008;

3:e2795.

89. Rutgers M, Saris DB, Vonk LA, van Rijen MH, Akrum V, Langeveld D, van

Boxtel A, Dhert WJ, Creemers LB. Effect of Collagen Type I or Type II on

Chondrogenesis by Cultured Human Articular Chondrocytes. Tissue Eng Part A

2012; 19:59-65.

121

90. Murphy MK, Huey DJ, Hu JC, Athanasiou KA. TGF-β1, GDF-5, and BMP-2

Stimulation Induces Chondrogenesis in Expanded Human Articular Chondrocytes

and Marrow-Derived Stromal Cells. Stem Cells 2015; 33:762-773.

91. Elder SH, Cooley AJ, Borazjani A, Sowell BL, To H, Tran SC. Production of

Hyaline-like Cartilage by Bone Marrow Mesenchymal Stem Cells in a Self-

Assembly Model. Tissue Eng Part A 2009; 15:3025-3036.

92. Co C, Vickaryous MK, Koch TG. Membrane culture and reduced oxygen tension

enhances cartilage matrix formation from equine cord blood mesenchymal

stromal cells in vitro. Osteoarthritis Cartilage 2014; 22:472-480.

93. Armstrong CG, Lai WM, Mow VC. An Analysis of the Unconfined Compression

of Articular-Cartilage. J Biomech Eng T ASME 1984; 106:165-173.

94. Buschmann MD, Kim YJ, Wong M, Frank E, Hunziker EB, Grodzinsky AJ.

Stimulation of aggrecan synthesis in cartilage explants by cyclic loading is

localized to regions of high interstitial fluid flow. Arch Biochem Biophys 1999;

366:1-7.

95. Sah RLY, Kim YJ, Doong JYH, Grodzinsky AJ, Plaas AHK, Sandy JD.

Biosynthetic Response of Cartilage Explants to Dynamic Compression. J Orthop

Res 1989; 7:619-636.

96. Kim YJ, Bonassar LJ, Grodzinsky AJ. The Role of Cartilage Streaming Potential,

Fluid-Flow and Pressure in the Stimulation of Chondrocyte Biosynthesis during

Dynamic Compression. J Biomech 1995; 28:1055-1066.

122

97. Park S, Hung CT, Ateshian GA. Mechanical response of bovine articular cartilage

under dynamic unconfined compression loading at physiological stress levels.

Osteoarthritis Cartilage 2004; 12:65-73.

98. Von der Mark K, Von der Mark H. IMMUNOLOGICAL AND BIOCHEMICAL

STUDIES OF COLLAGEN TYPE TRANSITION DURING IN VITRO

CHONDROGENESIS OF CHICK LIMB MESODERMAL CELLS. J Cell Biol

1977; 73:736-747.

99. Von der Mark K. Immunological studies on collagen type transition in

chondrogenesis. Curr Top Dev Biol 1980; 14:199-225.

100. Nöth U, Rackwitz L, Heymer A, Weber M, Baumann B, Steinert A, Schütze N,

Jakob F, Eulert J. Chondrogenic differentiation of human mesenchymal stem cells

in collagen type I hydrogels. J Biomed Mater Res 2007; 83A:626-635.

101. Ragetly G, Griffon DJ, Chung YS. The effect of type II collagen coating of

chitosan fibrous scaffolds on mesenchymal stem cell adhesion and

chondrogenesis. Acta Biomater 2010; 6:3988-3997.

102. Cai R, Nakamoto T, Kawazoe N, Chen G. Influence of stepwise chondrogenesis-

mimicking 3D extracellular matrix on chondrogenic differentiation of

mesenchymal stem cells. Biomaterials 2015; 52:199-207.

103. Hynes RO. The Extracellular Matrix: Not Just Pretty Fibrils. Science 2009;

326:1216-1219.

104. Bornes T, Jomha N, Mulet-Sierra A, Adesida A. Optimal Seeding Densities for In

Vitro Chondrogenesis of Two and Three Dimensional-Isolated and Expanded

123

Bone Marrow-Derived Mesenchymal Stromal Stem Cells within a Porous

Collagen Scaffold. Tissue Eng Part C 2015.

105. Ray P, Chapman SC. Cytoskeletal Reorganization Drives Mesenchymal

Condensation and Regulates Downstream Molecular Signaling. PLoS ONE 2015;

10.

106. Murdoch AD, Hardingham TE, Eyre DR, Fernandes RJ. The Development of a

Mature Collagen Network in Cartilage from Human Bone Marrow Stem Cells in

Transwell Culture. Matrix Biol 2015.

107. Mueller MB, Tuan RS. Functional characterization of hypertrophy in

chondrogenesis of human mesenchymal stem cells. Arthritis Rheum 2008;

58:1377-1388.

108. Williams GM, Klisch SM, Sah RL. Bioengineering cartilage growth, maturation,

and form. Pediatr Res 2008; 63:527-534.

109. Serafini M, Sacchetti B, Pievani A, Redaelli D, Remoli C, Biondi A, Riminucci

M, Bianco P. Establishment of bone marrow and hematopoietic niches in vivo by

reversion of chondrocyte differentiation of human bone marrow stromal cells.

Stem Cell Res 2014; 12:659-672.

110. Gibson G. Active role of chondrocyte apoptosis in endochondral ossification.

Microsc Res Techniq 1998; 43:191-204.

111. Tew SR, Kwan APL, Hann A, Thomson BM, Archer CW. The reactions of

articular cartilage to experimental wounding - Role of apoptosis. Arthritis Rheum

2000; 43:215-225.

124

112. Narcisi R, Cleary MA, Brama PAJ, Hoogduijn MJ, Tüysüz N, ten Berge D, van

Osch GJVM. Long-Term Expansion, Enhanced Chondrogenic Potential, and

Suppression of Endochondral Ossification of Adult Human MSCs via WNT

Signaling Modulation. Stem Cell Rep 2015; 4:459-472.

113. Leijten J, Georgi N, Teixeira LM, van Blitterswijk CA, Post JN, Karperien M.

Metabolic programming of mesenchymal stromal cells by oxygen tension directs

chondrogenic cell fate. Proc Natl Acad Sci U S A 2014; 111:13954-13959.

114. Albro MB, Nims RJ, Durney KM, Cigan AD, Shim JJ, Vunjak-Novakovic G,

Hung CT, Ateshian GA. Heterogeneous engineered cartilage growth results from

gradients of media-supplemented active TGF-β and is ameliorated by the

alternative supplementation of latent TGF-β. Biomaterials 2016; 77:173-185.

115. Langer RS, Vacanti JP. Tissue engineering: The challenges ahead. Sci Am 1999;

280:86-89.

116. Nakao K, Morita R, Saji Y, Ishida K, Tomita Y, Ogawa M, Saitoh M, Tomooka

Y, Tsuji T. The development of a bioengineered organ germ method. Nature

Methods 2007; 4:227-230.

117. Odriscoll SW, Keeley FW, Salter RB. THE CHONDROGENIC POTENTIAL OF

FREE AUTOGENOUS PERIOSTEAL GRAFTS FOR BIOLOGICAL

RESURFACING OF MAJOR FULL-THICKNESS DEFECTS IN JOINT

SURFACES UNDER THE INFLUENCE OF CONTINUOUS PASSIVE

MOTION - AN EXPERIMENTAL INVESTIGATION IN THE RABBIT. J Bone

Joint Surg Am 1986; 68A:1017-1035.

125

118. Ballock RT, Heydemann A, Wakefield LM, Flanders KC, Roberts AB, Sporn

MB. TGF-beta 1 prevents hypertrophy of epiphyseal chondrocytes: regulation of

gene expression for cartilage matrix proteins and metalloproteases. Dev Biol

1993; 158:414-429.

119. Bassett JHD, Williams GR. The molecular actions of thyroid hormone in bone.

Trends Endocrinol Metab 2003; 14:356-364.

120. Okubo Y, Reddi AH. Thyroxine downregulates Sox9 and promotes chondrocyte

hypertrophy. Biochem Biophys Res Commun 2003; 306:186-190.

121. Mello MA, Tuan RS. Effects of TGF-beta 1 and triiodothyronine on cartilage

maturation: In vitro analysis using long-term high-density micromass cultures of

chick embryonic limb mesenchymal cells. J Orthop Res 2006; 24:2095-2105.

122. Lee WD, Hurtig MB, Pilliar RM, Stanford WL, Kandel RA. Engineering of

hyaline cartilage with a calcified zone using bone marrow stromal cells.

Osteoarthritis Cartilage 2015; 23:1307-1315.

123. DeLise AM, Fischer L, Tuan RS. Cellular interactions and signaling in cartilage

development. Osteoarthritis Cartilage 2000; 8:309-334.

124. Ikeda T, Kamekura S, Mabuchi A, Kou I, Seki S, Takato T, Nakamura K,

Kawaguchi H, Ikegawa S, Chung UI. The combination of SOX5, SOX6, and

SOX9 (the SOX trio) provides signals sufficient for induction of permanent

cartilage. Arthritis Rheum 2004; 50:3561-3573.

125. Henry SP, Liang S, Akdemir KC, de Crombrugghe B. The Postnatal Role of Sox9

in Cartilage. J Bone Miner Res 2012; 27:2511-2525.

126

126. Oh H, Chun CH, Chun JS. Dkk-1 expression in chondrocytes inhibits

experimental osteoarthritic cartilage destruction in mice. Arthritis Rheum 2012;

64:2568-2578.

127. Minina E, Kreschel C, Naski MC, Ornitz DM, Vortkamp A. Interaction of FGF,

lhh/Pthlh, and BMP signaling integrates chondrocyte proliferation and

hypertrophic differentiation. Dev Cell 2002; 3:439-449.

128. Hoemann CD, Lafantaisie-Favreau C-H, Lascau-Coman V, Chen G, Guzman-

Morales J. The Cartilage-Bone Interface. J Knee Surg 2012; 25:85-97.

129. Pacifici M, Koyama E, Iwamoto M. Mechanisms of synovial joint and articular

cartilage formation: Recent advances, but many lingering mysteries. Birth Defects

Res C Embryo 2005; 75:237-248.

130. Craft AM, Rockel JS, Nartiss Y, Kandel RA, Alman BA, Keller GM. Generation

of articular chondrocytes from human pluripotent stem cells. Nat Biotech 2015;

33:638-645.