Canine Erlichiosis Clinical Hematological Serological and Molecular Aspects

8/2/2019 Canine Erlichiosis Clinical Hematological Serological and Molecular Aspects

1/5


2/5

767Canine ehrlichiosis: clinical, hematological, serological and molecular aspects.

Cincia Rural, v.38, n.3, mai-jun, 2008.

and PCR. The detection of the E. canis morulae isuncommon except during the acute phase of theinfection (HIBBLER et al., 1986). The direct detection

of E. canis is difficult even though the samples are positive through serology (OLIVEIRA et al., 2000). Theserological detection of anti- E. canis antibodies may be performed by Indirect Fluorescent Antibody Test(IFAT) or Dot-ELISA (CADMAN et al., 1994). IFAT isthe serological assay most widely used for thediagnosis of canine ehrlichiosis (WANER et al., 2001).Improvements in molecular biology techniques haveled to the development of DNA detection of E. canisfor the diagnosis of ehrlichiosis. The DNAamplification through PCR has provided a moresensitive, specific and reliable direct diagnosis

(IQBAL et al., 1994).This study compared the direct detectionmethods of E. canis (blood smears and nested PCR)and serological tests (Dot-ELISA and IndirectImmunofluorescent Antibody Test - IFAT), andanalyzed clinical and hematological signs of dogssuspected of ehrlichiosis. The aim of this study was todemonstrate the most suitable test for the diagnosis of different E. canis stages of infection.

MATERIALS AND METHODS

Animals - Thirty dogs were selected at theVeterinary Teaching Hospital, UNESP, Jaboticabal, SP,according to their clinical signs (apathy, anorexia,fever, petechial and ecchymotic hemorrhages,lymphadenopathy, splenomegaly, paleness mucousmembranes and/or uveitis) or hematological findings(anemia, leukopenia and/or thrombocytopenia) in anacute or chronic disease stage. Blood samples werecollected for hematology and nPCR, and serum sampleswere tested for E. canis antibodies by IFAT and Dot-ELISA. Positive controls were obtained from an E. canisexperimentally-infected dog and negative controlsobtained from the same dog before the infection.

Serology - IFAT was used to detect E. canisIgG antibodies. The technique was performedaccording to the manufacturers recommendations(VMRD , Inc.). Sera were diluted 1:20 in saline solutionand the used conjugate was a rabbit IgG anti-dog IgG,diluted according to the manufacturersrecommendations (Sigma ). Scores were attributed tofluorescence intensity in the analyzed sera: negative (-), positive (+), and highly positive (++). Sera were alsotested by Dot-ELISA using Immunocomb BIOGALkit in order to detect anti- E.canis IgG antibodies.

nPCR assay - DNA was extracted withQIAamp DNA Blood Mini Kit (Qiagen), according to

the manufacturers recommendations. The Ehrlichiagenus amplification was performed using ECC (5-GAACGAACGCTGGCGGCAAGC-3) and ECB (5-

CGTATTACCGCGGCTGCTGGCA -3) primers, and HE3(5 - TATAGGTACCGTCATTATCTTCCCTAT -3) andECAN (5- CAATTATTTATAGCCTCTGGCTATAGGA-3) primers were used to amplify the E. canis 16S rRNAgene (WEN et al., 1997; MURPHY et al., 1998). Reaction(50 L) contained 5 L of template DNA in 5 L PCR buffer 10X (100mM Tris-HCl, pH 9.0, 500mM KCl),0.2mM each dNTP, 2.5mM MgCl2, 1pmol each primer,1.25U of Taq DNA polymerase and it was performed asdescribed previously (MURPHY et al., 1998). The nPCR assay used the same reaction conditions as the firstamplification, but specie-specific primers were used and

1 L from the initial PCR was used as template. Thesensitivity of the nPCR reaction was analyzed from an E. canis -infected DH82 with 100% rickettsemia diluted10-fold in distillated water.

The chi-square test ( x2) was used in order to compare IFAT, Dot-ELISA and nPCR.

RESULTS

According to the clinical data from 30 dogs,the most frequently observed clinical signs were apathy(60.7%), anorexia (56.7%), pale mucous membrane(43.3%), fever (43.3%), lymphadenopathy (43.3%),hepatomegaly and/or splenomegaly (43.3%),hemorrhages (petechial and epistaxis) (33.3%) anduveitis (40%). Direct detection of the intracytoplasmatic

E. canis morulae in blood smears was possible in onlyone (3.3%) out of the 30 samples examined.

In the IFAT, 19 (63.3%) sera showed positivetiter for E. canis , while 11 (36.6%) were negative. ByDot-ELISA, 21 (70%) sera presented titers higher than1:20, considered as positive, while 9 (30%) werenegative. No significant difference was observed whencomparing IFAT, Dot-ELISA and nested PCR results(Table 1).

Nested PCR po si tive samples weredemonstrated by the amplification of a 398bp fragmentfrom 16S rRNA gene of E. canis (Figure 1). This PCR system was able to detect E. canis DNA with anequivalent rickettsemia of 1x10-34%. Among 30 samples,this fragment was observed in 16 (53.3%) while 14(46.6%) were negative. Only two samples were co-negative by nPCR, Dot-ELISA and IFAT. The other 28samples were positive for detection of E. canis in atleast one test.

The tests results from these 28 positive dogswere analyzed with clinical (Table 2) and hematologicalsigns (Table 3). The positive sample by direct detection


3/5

768 Nakaghi et al .


of intracytoplasmatic E. canis morulae in blood smearswas also IFAT and nPCR positive, but Dot-ELISAnegative.

DISCUSSION

Canine ehrlichiosis is an infectious diseasewith a high incidence. E. canis can be detected for ashort period of time in monocytes but they cannot befound during subclinical and chronic stages of infection. Even so, the search for morulae in circulatingmonocytes is still the routine diagnostic method for ehrlichiosis (MOREIRA et al., 2005) but in most casesunrewarding. The diagnostic is, in some cases, acombination of clinical and hematological signs

(COHN, 2003), but this signs may be confusing andvariable (WANER et al., 2001).The clinical signs most frequently observed

in the dogs suspected to be infected with E. caniswere also noted by other authors in natural (HARRUSet al., 1999; OLIVEIRA et al., 2000) and in experimentalinfections (CASTRO et al., 2004).

No statistical difference was observed whencomparing between IFAT and Dot-ELISA results.Previous studies demonstrated a higher sensitivity of Dot-ELISA when compared to IFAT, although both

methods are qualitatively efficient in detecting anti- E. canis antibodies (CADMAN et al., 1994; OLIVEIRA etal., 2000; HARRUS et al., 2002). The Israeli isolate, usedin Dot-ELISA, was 0.54% different from the Oklahomastrain used in IFAT (KEYSARY et al., 1996). Besidesthe high sensitivity, Dot-ELISA is a rapid techniqueand easy to be used in clinical routine for the diagnosisof ehrlichia. Conflicting results between IFAT, ELISAand Western blot were observed in low-titer serumsamples, and these results may reflect enhanced IFATsensitivity and poor IFAT specificity associated withcross-reactivity among Ehrlichia spp (OCONNOR,et al, 2006).

Nested PCR was used to detect E. canisDNA in the dogs blood samples. The test detected53.3% positive samples, showing that E. canis iscommon in Jaboticabal region. Similar results werefound in dogs blood samples tested by PCR todetected E. canis , E. chaffeensis, Anaplasma platys,

A. phagocytophilum and Neorickettsia risticii in thesame region (DAGNONE et al., 2006). The nPCR sensitivity was evaluated and it could detect E. canisDNA until an equivalent rickettsemia of one infectedmonocyte in 1036 cells. The high sensitivity of thePCR to detect E. canis was already shown (McBRIDE

Figure 1 - E. canis DNA detection through nested PCR in blood samples collected from 30 suspected dogs examined at theVeterinary Teaching Hospital, UNESP, Jaboticabal, SP, Brazil. Observe the 398bp fragment of E. canis DNA. Lane1, 100bp ladder; lane 2, negative control; lane 3, positive control; and lanes 4 to 19, 16 blood samples shown froma total of 30 dogs.

Table 1 - Association between Dot-ELISA, nPCR and IFAT* results from 28 dogs suspected to be infected with Ehrlichia canis andexamined at the Veterinary Teaching Hospital, UNESP, Jaboticabal, SP, Brazil.

TOTAL

IFAT Positive (%) n = 19 IFAT Negative (%) n = 11 n = 30Dot- nPCR Dot- nPCR

ELISA Positive Negative ELISA Positive NegativePositive 8 (42.1) 10 (52.6) Positive 1 (9.1) 2 (18.1) 21 (70) Negative 1 (5.27) 0 Negative 6 (54.5) 2 (18.1) 9 (30)Total 9 (30) 10 (33.3) TOTAL 7 (23.3) 4 (13.4) 30 (100)

*IFAT Imunofluorescent Antibody Test.


4/5

769Canine ehrlichiosis: clinical, hematological, serological and molecular aspects.


et al., 1996; WEN et al., 1997), however, none of thestudies correlate DNA detection with rickettsemia.

Many authors already described thesuperior sensitivity and specificity of PCR indiagnosing ehrlichiosis when compared to serology(IQBAL et al, 1994; WEN et al., 1997) because serologycannot distinguish current infection from either exposure without the establishment of infection or previous infection (IQBAL et al., 1994), and titersremained high for an additional period of more than 11

months (HARRUS et al., 1998). However, when wecompare direct and indirect methods to detect E. canis ,a greater number of serological positive samples wereobserved in relation to nPCR. Occurrence of positiveserology and negative nPCR samples may be anindication of the carrier state or treatment of the animals, because dogs with anti- E. canis antibodies may notcarry the parasite. Negative nPCR results may also beexplained by the capacity of this parasite to hide insplenic macrophages (HARRUS et al., 1998).

Among the 30 examined animals, 28 dogswere positive in at least one test, thus we conclude

that they were infected or previously exposed to E. canis . The sample presenting E. canis morulae wasIFAT and nPCR positive, therefore, this dog was in anacute stage of infection.

An important percentage of pancitopenicor anemic dogs were serologically positive and nPCR negative. Pancitopenia, anemia and leukopenia werealready described in acute and chronic stages (CASTROet al., 2004). Serology positive and nPCR negativeanimals are at a chronic stage when cells are reduced

due to bone marrow damage and E. canis is in thetissue and, therefore, they are not nPCR detectable. Allanimals with leukocytosis were nPCR positive, and 50%were also serologically positive. These animals could be in acute stage of infection, because leukocytosismay occur in the first 2 or 3 weeks due to bone marrowhyperplasia.

Serology and nPCR are the most suitabletests to confirm the diagnosis of canine ehrlichiosis,however it should be always treated as a complementarydata to clinical and hematological evaluation. For the best interpretation of laboratory results, it is importantto consider the stage of infection and the limitations of

Table 2 - Association between clinical signs and IFAT*, Dot-ELISA and nPCR results from naturally E. canis infected dogs examined at theVeterinary Teaching Hospital, UNESP, Jaboticabal, SP, Brazil.

SerologyIFAT (%) Dot-ELISA (%)

nPCR (%)Clinical signs (total)

Positive Negative Positive Negative Positive Negative

Apathy (18) 12 (66.6) 6 (33.3) 13 (72.2) 5 (27.7) 11 (61.1) 7 (38.8)Inappetency (16) 10 (62.5) 6 (37.5) 12 (75) 4 (75) 11 (68.7) 5 (31.2)Hipertermia (12) 9 (75) 3 (25) 10 (83.3) 2 (16.1) 8 (66.6) 4 (33.3)Pale mucous membrane (13) 8 (61.5) 5 (38.4) 10 (76.9) 3 (23) 7 (53.8) 6 (46.1)Hemorrhage (8) 8 (100) 0 (0) 8 (100) 0 (0) 3 (37.5) 5 (62.5)Lymphadenopathy (12) 9 (75) 3 (25) 9 (75) 3 (25) 10 (83.3) 2 (16.7)Splenomegaly (12) 9 (75) 3 (25) 10 (83.3) 2 (16.1) 11 (91.6) 1 (8.3)Uveitis (12) 6 (50) 6 (50) 8 (66.6) 4 (33.3) 9 (75) 3 (25)

* IFAT Imunofluorescent Antibody Test.

Table 3 - Association between hematological signs and IFAT, Dot-ELISA and nPCR results from naturally E. canis infected dogs examinedat the Veterinary Teaching Hospital, UNESP, Jaboticabal, SP, Brazil.

Serology

IFAT (%) Dot- ELISA (%)nPCR (%)

Hematological signs

Positive Negative Positive Negative Positive Negative

Pancitopenia (n=8) 5 (62.5) 3 (37.5) 6 (75) 2 (25) 3 (37.5) 5 (62.5)Thrombocytopenia and anemia (n=13) 7 (53.8) 6 (46.1) 9 (69.2) 4 (30.7) 10 (76.9) 3 (23)Leukocitosis (n=4) 2 (50) 2 (50) 2 (50) 2 (50) 4 (100) 0 (0)

* IFAT Imunofluorescent Antibody Test.


5/5

770 Nakaghi et al .


these tests. In acute phase, nPCR can detect E. canisDNA earlier than the serological tests are able todetermine the presence of anti- E. canis antibodies.

Additionally, DNA cross-reaction is uncommon innPCR, while false positives can occur in serology, dueto cross-reaction with other ehrlichial species or to persistent antibodies titers post-treatment. However, alarge number of serological positive and nPCR negativesamples suggest that serology is the most appropriatetest for the diagnosis of E. canis natural infection indogs, especially in the chronic stage, when E. canis israre in circulating blood.

ACKNOWLEDGEMENTS

We would like to thank the Fundao de Amparo Pesquisa do Estado de So Paulo FAPESP (02/13562-2) andCoordenao de Aperfeioamento de Pessoal de Nvel Superior (CAPES) for financial support. We also thank Rosane Oliveirafor the helpful technical assistance.

REFERENCES

CADMAN, H.F. et al. Comparison of the dot-blot enzymelinked immunoassay with immunofluorescence for detectingantibodies to Ehrlich ia canis . Vet Rec, v.135, p.362, 1994.

CASTRO, M.B. et al. Experimental acute canine monocyticehrlichiosis: clinicopathological and immunopathologicalfindings. Vet Parasitol, v.119, p.73-86, 2004.

COHN, L.A. Ehrlichiosis and related infections.Vet ClinNorth Am: Small Anim Pract, v.33, n.4, p.863-884, 2003.

COSTA, J.O. et al. Ehrlichia canis infection in dog in BeloHorizonte, Brazil.Arq Esc Vet UFMG, v.25, p.199-200, 1973.

DAGNONE A.S. et al. Ehrlichiosis in anemic, thrombocytopenic,or tick-infested dogs from a hospital population in South Brazil.Vet Parasitol, v.117, p.285-290, 2003.

DAGNONE, A.S. et al. Phylogenetic analysis of Anaplasmataceae agents DNA detected in dog blood sampleswith intracellular inclusions from Jaboticabal SP and CampoGrande MS. In: SIMPSIO LATINO-AMERICANO DERICKETTSIOSES, 2., 2006, Ribeiro Preto, Brasil.AnaisRibeiro Preto: CBPV, 2006. p.378.

HARRUS, S. et al. Amplification of ehrlichial DNA from dogs34 months after infection with Eh rl ichi a ca ni s . J ClinMicrobiol, v.36, n.1, p.73-76, 1998.

HARRUS, S. et al. Recent advances in determining the pa thogenesis of canine monocytic ehrl ichiosis .J ClinMicrobiol, v.37, n.9, p.2745-2749, 1999.

HARRUS, S. et al. Comparison of three enzyme-linkedimmunosorbant assays with the indirect immunofluorescentantibody test for the diagnosis of canine infection with Ehrlichia

cani s . Vet Microbiol, v.86, p.361-368, 2002.

HIBLLER, C.E. et al. Rickettsial infections in dogs part II:Ehrlichiosis and infectious cyclic trombocytopenia.CompCont Educ Pract Vet, v.8, p.106-113, 1986.

IQBAL, Z. et al. Comparison of PCR with other tests for earlydiagnosis of canine ehrlichiosis.J Clin Microbiol, v.32, n.7, p.1 658-16 62, 1994.

KEYSARY, A. et al. The first isolation, in vitro propagation,

and genetic characterization of Ehrlichia canis in Israel. VetParasitol, v.62, p.331-340, 1996.

McBRIDE, J.W. et al. PCR detection of acute Ehrlichia canisinfection in dogs.J Vet Diagn Invest, v.8, p.441-447, 1996.

MOREIRA, S.M. et al. Detection of Ehrlichia canis in bonemarrow aspirates of experimentally infected dogs.CiencRural, v.35, n.4, p.958-960, 2005.

MURPHY, G.L. et al. A molecular and serolog ic survey of Ehrlichia canis , E. chaffeensis and E. ewingii in dogs and ticksfrom Oklahoma. Vet Parasitol, v.79, p.325-339, 1998.

OCONNOR, T.P. et al. Comparison of an indirectimmunofluorescence assay, western blot analysis, and acommercially available ELISA for detection of Ehrlichia canisantibodies in canine sera.Am J Vet Res, v.67, n.2, 206-210,2006.

OLIVEIRA, D. et al. Ehrlichia canis antibodies detection byDot- ELISA in naturally infected dogs.Rev Bras ParasitolVet, v.9, n.1, p.1-5, 2000.

WANER, T. et al. Significance of serological testing for ehrlichial diseases in dogs with special emphasis on the diagnosisof canine monocytic ehrlichiosis caused by Ehrl ichia canis .Vet Parasitol, v.95, p.1-15, 2001.

WEN, B. et al. Comparison of nested PCR withimmunofluorescent-antibody assay for detection of Ehrlichia

ca ni s infection in dogs treated with doxycycline.ClinMicrobiol, v.35, n.7, p.1852-1855, 1997.

Canine Erlichiosis Clinical Hematological Serological and Molecular Aspects

Documents

Transcript of Canine Erlichiosis Clinical Hematological Serological and Molecular Aspects