Cancer Genetics for Primary Care Sara Levene Registered Genetic Counsellor.
-
date post
20-Dec-2015 -
Category
Documents
-
view
218 -
download
0
Transcript of Cancer Genetics for Primary Care Sara Levene Registered Genetic Counsellor.
Proportion of cancer that is inherited
Inherited susceptibility to cancer:‘genetic’Single genes
Family history of cancer:‘familial’?multi-factorial origins
No family history of Cancer: ‘sporadic’?multi-factorial origins
Population risk:Breast cancer 1:10Ovarian cancer 1:100Colorectal cancer 1:25 - 35
Sporadic cancer
hormonesviruses chemicals
radiationSpontaneous mutations
2 normal genes1 normal gene1 mutated gene 2 mutated genes
cancer
1 normal gene1 mutated gene 2 mutated genes cancer
Inherited cancer
hormonesviruses chemicals
radiationSpontaneous mutations
Inherited Mutations and Cancer
• Inherited mutations relating to cancer do not cause cancer
• Mutations are often found in genes that are ‘tumour suppressors’
• Mutations mean that protection from cancer is lost or reduced
• Mutations lead to increased susceptibility to certain types of cancer
Autosomal dominant inheritance
mother father
child child
Each child has 50:50 chance of inheriting the altered gene.
Cancer GenesMendelian Inheritance (AD)
• In the last 10 years several genes relating to specific cancer syndromes have been identified
• There are more cancer genes waiting to be ‘discovered’
• It is difficult to locate the exact mutation in a cancer gene for a particular family
Cancer GenesMulti-factorial Inheritance
• More recently the search for other AD genes has led to the discovery of some ‘lower risk’ genes eg. CHEK2 – found in ~2% cases ca br– est doubles risk of ca br
• ? Liability/threshold model with several similar genes (+ env factors)
• This research is not yet applicable to clinical practice
Genetic Testing
• Technically difficult• Can only be offered to high risk families• Can only search small number of high risk
dominant genes• Can take more than a year to search for the
mutation in a family• Often cannot locate the mutation for a
family (?unknown genes)
Searching for the faulty genecgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt
a
Genetic Testing
• First test in family always done on person who has had the cancer (mutation search test)
• If no living affected relatives available – cannot offer genetic test for family
• If a mutation is found predictive testing can be offered to at-risk relatives: – If relative doesn’t carry familial mutation they are not
at increased risk of cancer (still at population risk)
– If a person does carry the familial mutation they are at increased risk of developing cancer
High RiskCancer risks associated with
BRCA1 and BRCA2
Breast and ovarian cancer
• Breast cancer risk ~80%• Ovarian cancer risk ~45%• Increased risk of second
primary for women who have already had breast cancer
Other cancers
• Prostate cancer • Male breast cancer • Pancreatic cancer • Colorectal cancer
• Stomach cancer
Recent NICE Guidelines on Familial Breast Cancer
• Women at or near population risk are cared for in primary care.
• Women at moderate risk are cared for in secondary care.
• Women at high risk are cared for in tertiary care.
Breast cancer case study 1
Ca breast, diag 70yDied 85y
Brain tumour, died 67y ? Prev breast cancer in 40s?
68y
Breast cancer case study 1
Ca breast, diag 70yDied 85y
Brain tumour, died 67y No record of prev ca br
68y
Can this patient now be reassured?
Population riskScreening and management
• National breast screening from 50y• Breast awareness• Reassure patient:
– For most women, increasing age is the greatest risk factor.– The great majority of women with a family history of breast cancer do not fall into a high-risk category and do not develop breast cancer.
Breast cancer case study 2
Ca breast, diag 52y
20y
Ca breast, diag 54y Patient is requesting screening and is considering prophylactic mastectomies.
What is her level of risk?
What is appropriate management of her risk?
Patient is also interested in genetic testing. Can this be offered?
Moderate risk Referral to secondary care
Female breast cancers
• One 1st degree relative diagnosed before age 40
• Two 1st degree relatives (or one 1st
degree relative and one 2nd degree relative) diagnosed after average age 50
Moderate riskScreening and management
• Annual breast surveillance from age 40 – 50y
• National Breast Screening from 50y.
• ?Chemoprevention studies
• Breast awareness
Ca breastDiag 32y
Ca breastDied 40y
Breast cancer case study 3
What can we offer this family?
Considering prophylactic mastecomies
Ca breastDiag 32yBlood taken for BRCA1/2 testing
Ca breastDied 40y
Breast cancer case study 3
Recommend screening
Recommend screening
Ca breastDiag 32yBRCA1/2 testing on-going
Ca breastDied 40y
Breast cancer case study 3
Ca breastDiag 35y
Ca breastDiag 32yBRCA1 mutation found
Ca breastDied 40y
Breast cancer case study 3
Ca breastDiag 35y
Ca breastDiag 32yBRCA1 mutation found
Ca breastDied 40y
Breast cancer case study 3
Ca breastDiag 35yBRCA1 mutationcarrier
N
BRCA1 mutationcarrier
High risk Referral to secondary care, then tertiary care• Two 1st degree relatives (OR one 1st degree relative
and one 2nd degree relative) with breast cancer, av age <50
• Three or more 1st or 2nd degree relatives with breast cancer at any age
• One 1st degree male relative with breast cancer at any age
• One 1st degree relative with bilateral breast cancer where 1st primary diagnosed <50
• One 1st or 2nd degree relative with ovarian cancer at any age and one 1st or 2nd degree relative with breast cancer at any age
High riskScreening and management
• 30-39y: may be eligible for annual mammograms
• 40-49y: annual mammograms• >50y: NBSP, plus may be eligible for
additional screening• Refer to genetics to discuss genetic testing• ?MRI screening in the future• ?Prophylactic surgery• ?Ovarian screening
Breast cancer case study 4
Ca breast, diag 51yDied 53y
Ca breast, diag 41y
Ca ?type
What should we do for this family?
Breast cancer case study 4
Ca breast, diag 51yDied 53y
Ca breast, diag 41y
Ca ovary, died 48y
Breast & ovarian screening
Breast cancer case study 4
Ca breast, diag 51yDied 53y
Ca breast, diag 41yBlood taken for BRCA1/2 testing
Ca ovary, died 48y
Breast & ovarian screening
Breast cancer case study 4
Ca breast, diag 51yDied 53y
Ca breast, diag 41yBRCA1/2 testedNo mutations found
Ca ovary, died 48y
Considering surgery
Other factors to consider:• Paternal history:
two or more breast cancers on father’s side of family
• Unusual cancers:Bilateral breast cancerMale breast cancerOvarian cancerSarcoma <45yGlioma or childhood adrenal cortical carcinomaComplicated patterns of multiple cancers at young age
• Jewish ancestryWomen with Jewish ancestry are around 5–10 times
more likely to carry BRCA1 or BRCA2 mutations than women in non-Jewish populations.
FAPFamilial Adenomatous
Polyposis
• 100% affected by 35y• Hundreds/thousands of
polyps in colon• Mutation on APC gene• Accounts for <1% colon
cancers• Other cancer risks:
duodenal, gastric
• Up to 80% lifetime risk • Less than 10 polyps
found• At least 5 genes found• Accounts for up to 5%
of colon cancers• Other cancer risks:
endometrial, ovarian, gastric
HNPCCHereditary Non-Polyposis
Colon Cancer
CRC FH Risk categorisationLow riskOne FDR with CRC at > 45(No screening required, bowel awareness)
Low-Moderate riskTwo FDRs with CRC at average age > 60.Screening: One colonoscopy at 35y-40y and one at 55y
High-Moderate riskOne FDR with CRC <45, or three older FDRs i.e. >50.Screening: Begins at 45 or 5yrs prior to youngest diagnosis (not prior to 35). Repeat 5yrly to 75y.
What is High Risk?
• A known polyposis syndrome e.g. FAPBe sure to ask if there is any history of polyposis in the family.
• HNPCC (Amsterdam positive families).
– At least 3 of HNPCC related cancers (CRC, endometrium, ovarian, small bowel, ureter or renal pelvis)
– One should be a FDR of the other two– At least two successive generations affected– At least one cancer diagnosed < 50 years
HNPCC• Colonoscopies from 25y, continuing 2 yearly to 75y• ?Endometrial/ovarian screening annually from 35y (research)
FAP• Colonoscopies annually from teens (or younger depending on
family history)• Prophylactic colectomy offered• ?Upper GI screening annually (research)
High risk screening/management
Summary
• Most cancer is not due to dominant, high-risk genes.• Most patients with a family history of cancer can be
reassured and possibly referred for screening. • For most patients with a family history of cancer, current
genetic testing is not helpful and is not available. • Patients with a high risk of cancer due to family history
can have screening, and genetic testing may be available.• Patients who inherit a mutation in a high risk gene have a
high risk of developing cancer themselves.
Take-home messages• Young diagnoses of cancer (<45y) may be
significant• Three or more cases of the same / related types of
cancer, in one family (even if older ages) may be significant
• Genetic testing may or may not be available / informative for a given family
• Genetic testing must start with a living affected relative
• Screening may be available