Caenorhabditis elegans —the worm“ is a model …web.mit.edu › pweigele › www › 7.391 ›...

MASSACHUSETTS INSTITUTE OF TECHNOLOGY

Department of Biology31 Ames Street, Cambridge, MA

Molecular Biology Techniques

IAP 2007Course 7.391

Jan 8-12, 16-19, & 2212:30 PM - 4:30 PM

Building 68-2303 U credits

Prepared & Taught by

MANDANA SASSANFAR, Ph.D.&

PETER WEIGELE, Ph.D.

Funded by the Howard Hughes Medical Institute

Synopsis of the methods taught in this course:

Laboratory safety

Pipetting

Sterile techniques

Bacteriophage plating and propagation

Measurement of viral titer by serial dilution

Column chromatography: anion exchange and affinity based

CsCl density gradient ultracentrifugation

Plasmid and genomic DNA purification

Agaraose gel electrophoresis of DNA

SDS-polyacrylamide gel electrophoresis of proteins

Oligonucleotide design and polymerase chain reaction (PCR)

Gene cloning using PCR, restriction digest, and ligation

Analysis of DNA sequences: sequencing, restriction digests and database searching

Transmission electron microscopy (TEM)

IAP 2007 Biology 7.391 2

TABLE OF CONTENTS

Synopsis of methods......................................................................................................................................iSummary.......................................................................................................................................................iiAbout the course instuctors.............................................................................................................................Laboratory safety............................................................................................................................................Techniques .....................................................................................................................................................Oveview of laboratory and experimental schedule.....................................................................................iiiIntroduction and backround..........................................................................................................................1Day 1: Concentration and purification of freshwater phage communities.....................................................Day 2: Isolation of phages on bacterial hosts.................................................................................................Day 3: Determining phage titers.....................................................................................................................Day 4:Large scale purification of phages.......................................................................................................Day 5:..............................................................................................................................................................Day 6:..............................................................................................................................................................Day 7:..............................................................................................................................................................Day 8:..............................................................................................................................................................Day 9:..............................................................................................................................................................Day 10:............................................................................................................................................................Appendix 1:.....................................................................................................................................................Appendix 2:.....................................................................................................................................................Appendix 3: Plasmid maps.............................................................................................................................Appendix 4: Reading a Scientific Paper.........................................................................................................Tables..............................................................................................................................................................Acknowledgements.........................................................................................................................................Finding out More!...........................................................................................................................................


Summary

In this short, but intense, two week laboratory course, we will learn and use a collection of laboratory techniques to accomplish a single research goal: the isolation, characterization and molecular dissection of a virus (which you will isolate). The techniqes learned in this course will provide a repertoire of methods you will be able to use in any lab practicing traditional microbiology.

You will begin by concentrating whole virus communities out of water samples using anion exchange chromotography. Different bacterial strains will be incubated together with these virus concentrates on the suface bacterial medium solidified with agar in a Petri dish. If any of the bacteria are susceptible to the viruses in the concentrate, a clear spot (plaque) caused by a zone of killing by the virus will be seen. The viruses in this plaque will be subsequently propagated in large liquid cultures and purified using a series of biochemical techniques. The proteins and DNA of these viruses will be extracted and examined by gel electrophoresis. The morphology of your virus will be observed directly using a transmission electron microscope. At this stage, your virus would be ready for genomic sequencing. However, due to time limitations, we will subsequently use gene sequences from viruses that have already been sequenced. You will learn how to go from raw sequence data to annotated genome using a series of online tools that include identificaiton of open reading frames (protein coding sequences) and identification of known homologes in the sequence database.

A set of genes from our collection of aforementioned viruses whose genomes have been sequenced will be the target of PCR cloning. This same set of protocols could be used to clone a gene from the virus you isolated if you knew already the gene's nucleotide sequence. The genes will be first amplified from the genomic DNA templates using sequence specific oligonucleotide primers and the polymerase chain reaction. The resulting PCR product will have its ends cut with restriction enzymes and be ligated to a plasmid vector similarly cut to yield cohesive compatible (“sticky”) ends. This plasmid vector contains both promoter sequences to control the expression of inserted gene, as well as a antibiotic resistance gene that serves as a selectable marker ensuring that host bacterial cells maintain the plasmid through successive generations. The ligation mixture containing successful as well as failed ligation events will be used to transform competent bacterial cells to antibiotic resistance. Resulting transformants will be screened for plasmids that successfully contain the inserted gene. Plasmids that appear to have the insert will be confirmed by DNA sequencing.


About your instructors

Dr. Mandana Sassanfar- Mandana has been an instructor in the biology department at MIT since July 2002. In the summer, she directs a summer research program for undergraduates from other college, and organizes and teaches a workshop for AP biology and honors biology teachers from the Boston area. In the spring she teaches an undergraduate seminar and organizes an MIT field trip for high cshool students. In the fall she recruits students for the biology PhD program.

Mandana earned her B.S and M.S in Biochemistry from the University Pierre et Marie Curie in Paris (she has indeed a French accent). She earned her Ph.D. degree in biochemistry from Cornell University where she worked on DNA damage in E. coli. She really enjoyed leaving in Ithaca. She then came to Boston where she first completed postdoctoral work at the Harvard School of Public Health on DNA alkylation damage and DNA repair in yeast and human, and then in the Department of Molecular Biology at MGH where she worked on RNA aptamer selection. She then did a 4-year stint in a start up biotech company in Cambridge selecting for new bacterial drug targets associated with protein syntesis, before returning to academia, first at Harvard and then at MIT.

Dr. Peter Weigele- Peter is a Research Scientist in the laboratory of Prof. Jonathan King. The King Laboratory's main focus is protein folding and experiments using the P22 tailspike protein (a phage protein) and the crystallins (components of the eye lens involved in transparency and cataract) provide researchers insights into how the linear amino acid sequence of a protein governs its three-dimensional shape. The King lab also has projects aimed at determining the structure of a phage in the act of injecting its DNA as well understanding the physiology of cyanobacteria (bacteria which can do oxygenic photosynthesis) infected by bacteriophage.

Peter started his scientific career doing undergraduate research in a fruit fly lab at the State University of New York at Albany. After graduation and a two year stint as a laboratory technician, he went to graduate school at the University of Utah. In 2001, he completed his doctoral dissertation on the morphogenesis of viral capsids under the mentorship of Prof. Sherwood Casjens. Peter joined the Department of Biology at MIT in January, 2002, as a post-doctoral associate. Currently, he is Research Scientist and Microscope Manager for the Biological TEM Users Group. In addition to his research, Peter volunteers at the Edgerton Center through the activities of the Biological Energy Interest Group (BEInG) which he helped form in 2004. The BEInG has developed an algal fuel cell as a low-cost platform for research and education in bioengineering for sustainability at the undergraduate level.


WELCOME to 2007 IAP

The Labs will be held daily from 12:30 PM to 4:30 PM in room 68-246

Please arrive on time (as early as 12:15 PM if possible). We will begin at 12:30 PM each day with an introduction and discussion of the agenda for the afternoon.

You will be working in teams of 3.

Each session will include:

Introduction to the afternoon's experiments

Setting up for the experiments

Reviewing the previous day's experiments

Analyzing the data obtained from the previous day's experiments

Preparing for next day's experiments; e.g., inoculating overnight cultures and properly putting

away/storing reagents and strains overnight.

LABORATORY SAFETY RULES

ABSOLUTELY NO EATING OR DRINKING IN THE LAB!

Wear a lab coat at all time in the lab. Do not wear open-toe shoes

Wear gloves when handling chemicals

Dispose of all bacterial culture and contaminated liquids in 10% bleach.

Rinse all flasks and beakers with water before putting in the wash

Seal used agar plates with parafilm and dispose in biohazard autoclavable orange bags

Dispose of all tips, and sharps in appropriate red containers

Keep benches clean and free of personal belongings at all time

Wipe bench with 70% ethanol before and after each experiments.

Wash hands with soap or alcohol-based hand sanitizers

Dispose of all pipettes and reagents in appropriate containers.

Keep written records of any observation and any deviation from protocols.

Record type of equipment used (name, brand, model) and name of supplier.

Avoid contamination of the plates and bacterial cultures by working under sterile conditions

Store all plates, phage stocks and phage dilution at 4ºC


TECHNIQUESOverview

This 2-week class will introduce you to some basic laboratory skills such as keeping a laboratory notebook, preparation of reagents and media, lab safety, how to correctly dispose of chemicals and lab etiquette (cleaning up after yourself ) as well as basic laboratory techniques for handling bacteria, DNA and proteins.

You will be working with four species of bacteria (E.coli, Vibrio, Corrynebacterium, and Salmonella) and an unknown mixture of aquatic phages that you will concentrate from water samples collected from the Charles River at the MIT boat house as well as the MWRA Deer Island sewage treatment facility. We will use microbiology, sterile techniques, ion-exchange chromatography, SDS-PAGE, DNA restriction analysis, DNA sequencing, electron microscopy, and bioinformatics tools to grow, purify, and characterize the phages found in these samples. We will also use PCR to amplify and clone a specific phage gene into a protein expression vector.

MicrobiologyYou will learn how to concentrate and isolate novel phages from water samples, how to maintain and

store bacterial strains, how to streak for single colonies on agar plates, inoculate liquid cultures with single bacterial colonies -all under sterile conditions-, how to plate phage samples on bacterial host, how to perform a plaque assay, how to prepare sterile solutions, how to determine the pfu ( plaque forming unit) of a phage stock, and how to store phages for long periods of times. You will also pour your own agar plates and prepare buffers from stock solutions.

Protein and DNA analysisAfter preparing large quantities of the phage you will estimate how many types of proteins are

present in the phage capsids by preparing an SDS polyacrylamide gel and using it to separate the proteins of the capsid by size. You will stain and destain the gel and analyze the results.

You will also isolate phage DNA from a single phage strain, digest the DNA with various restriction enzymes and view the results on an agarose gel. You will use the results to determine the diversity of the phage population and to estimate the size of the phage genome. You will learn how to visualize the molecules of proteins or DNA, and how to record and analyze you data.

PCR and cloningYou will be given the sequence of a phage gene and learn how to design primers to clone the gene

into a given vector. You will first amplify the desired gene sequence by PCR using those primers, purify the PCR fragment, digest it with restriction enzyme and clone it into a vector by ligation and bacterial transformation. You will then again use PCR, this time to verify that you have the right size insert in the vector.

BioinformaticsYou will also learn some basic bioinfomatics and sequence data analysis. These tool will help you in

the correct design of oligonucleotide primers for PCR, verification of DNA sequences, and database homology searching.


LABORATORY SCHEDULE

NOTE: It takes at least 4 to 5 days to start from a water sample to isolate, purify and amplify enough phages for further characterization. Therefore most of the first week will be spent doing microbiology, and isolating enough phages for the second week’s experiments. We will also do a protein purification and a PCR cloning in the first week. The second week will mostly focus on the characterization of the phages that you isolated and amplified the first week.

Note: Several experiments will take place simultaneously. The color code allows you to follow one experiment across several days.

The green color code is for bacterial culture. It is somewhat related to the purple-coded experiments in that you need to use fresh cultures of bacteria whenever needed and therefore must make sure to remember to set up overnights cultures every day before you leave.

Day 1: Safety guidelines Lab tour Overview of the course How to keep a notebook Weigh DE-52 cellulose and mix with water sample, set up column, pack cellulose into

column, wash, let stand in cold overnight Aseptic techniques Inoculate overnight liquid cultures form bacterial plates (4 strains in total). Re-streak

bacteria on solid medium (agar plate) for single colonies

Day 2: Elute phages of Column and collect fractions Determine protein concentration of fractions by the Bradford assay Pool fractions containing phages together Plate phages on each bacterial strain using low salt LB and top agar PCR part I. Oligonucleotide primer design for cloning Inoculate overnight liquid cultures from single bacterial colonies

Day 3: Look for the presence of plaques on Bacterial lawn. Record number and shape Purify phages from well-isolated single plaques (using a sterile Pasteur pipette). Treat

with chloroform, let sit in cold room for couple hours Prepare 10-fold serial dilutions tubes for phage titering Plate phage dilutions 103, 104,105 and 106 using top agar and O/N bacterial cultures.

Incubate overnight at 30 ºC PCR part 2: Set up the PCR reactions Set up overnight cultures from single bacterial colonies

Day 4: Record number of phage plaques for the various dilutions and strains Pick 2 to 4 well isolated plaques from the high dilution plates and place in 1 ml of phage

buffer; add a few drops of chloroform, mix and let sit in cold for a few hours to elute phage.

PCR: Analysis of PCR products by agarose gel electrophoresis Set up overnight cultures of bacterial hosts (for large scale preparation of virus)


Day 5: at 9 AM: set up 1/50 or 1/100 dilutions in LB of overnight bacterial culture and incubate

at 37ºC with vigorous shaking. Monitor growth at OD600. using a spectrophotometer and disposable cuvettes.

When OD600 of liquid cultures reaches between 0.25 and 0.3, infect cultures with phages eluted from the plaques.

PCR part 3: Digest PCR products, ligate into vector, transform competent E. coli cells, plate and incubate O/N

When the bacterial culture clears (most of the bacteria have been infected and lysed), add chloroform, mix, and centrifuge. Collect supernatant. Add solid NaCl and PEG. Incubate in cold room for at least 30 minutes (or until ready to set up the CsCl gradient ultracentrifugation).

(Monday PM:) This will be done by the instructors Centrifuge PEG solution to pellet and collect phage Resuspend phage in buffer and add solid CsCl. Set up ultracentrifugation over night

Day 6: Plate out serial dilutions of each phages on all 4 strains of bacteria hosts (plaque assay) Collect phage bands from O/N CsCl equilibrium gradient tubes. Set up dialysis casettes. Change dialysis buffer twice (in the morning) Pick transformants and set up 1.5 ml liquid cultures. DNA Mini prep transformants and set up digest to verify size of insert

Day 7: Collect concentrated and purified phage particles from dialysis casettes. Analyse restriction digets by agarose gel electrophoresis. Submit positives for sequencing Isolate phage DNA from purified phage particles Record results of plaque assay and determine host specificity

Day 8: Digest Phage DNA with restriction enzymes Analyse restriction digest by agarose gel electrophoresis Take picture of agarose gel Prepare SDS-polyacrylamide gel, run protein gel of phage particles, stain with Coomassie

blue Day 9:

Destain and scan protein gel BIOINFORMATICS: identifying DNA sequences, findings ORFs, Determining

restriction map, sequence homology search HOMEWORK: Analyze sequence of cloned gene and prepare oral presentation

Day 10: Data Analysis Oral presentations Clean up Electron microscopy Course evaluation


BACKGROUND AND INTRODUCTION

Viruses are acellular organisms. Yet they are alive: they can reproduce inside a host, and they evolve. Viruses are categorized based on their host (bacteria, plants, human), their genome ( RNA, DNA single stranded, double- stranded), the shape of their capsid, and the presence of absence of a tail and filaments (as observed by Electron Microscopy (EM)).

Viruses that infect bacteria are called bacteriophages (or phage). Their genome is composed of DNA. Like all other viruses they can only be seen with an electron microscope. They are made of a protective protein capsid that enclose their genome, and a tail or pod that mediates host recognition, attachment and injection of the genome into the bacterial host cell. For some bacteriophages such as lambda, the receptor on the surface of the host’s cell is known (the maltose transporter). For many other phages, the manner in which they recognize and attach to their host is still unknown.

Some phages contain a lipid membrane. These phages were more difficult to discover because they are sensitive to chloroform which is typically used in phage purification.

Phages are ubiquitous organisms. They are the smallest and most abundant biological entities on the planet. The total number of phages in a water sample can be estimated by epifluorescence microscopy or by transmission electron microscopy (TEM) (the phages in the water sample must first be concentrated).

Results of epifluorescence measurements suggest that coastal ocean and freshwater bodies can contain up to 108 viruses per ml. This indicates that phages are at least 10 fold more abundant than bacteria and are indeed the most abundant organism in the biosphere with a global estimate of 1030 total phage particles

Figure 1. Electron micrographs of some bacteriophages (from Dennis Kunkel).

www.mun.ca/biology/scarr/MGA2-10-24.jpg

Figure 2. Schematic diagram of a generic contractile-tailed phage infecting a cell.


http://www.mun.ca/biology/scarr/MGA2-10-24.jpg

Figure 3. Electron micrographs of phages collected from the Charles River using anion exchange chromatography.


Because of their sheer numbers and their ubiquitous distribution, phages play an important part in cycling of biological material, horizontal gene transfer, and defining microbial community composition.

They also impact various industries: Phages of Lactobacillus are a serious problem for the dairy industry. Biotechnology industry:

a) phage and filamentous phage M13 have been used as recombinant DNA cloning vectorsb) Phages proteins are a very important source of enzymes for molecular biology-

T4 DNA ligase is used in genetic engineering. T7 RNA polymerase is used to drive mRNA synthesis during protein expression in E. coli DE3 strains (hosts for pET vectors).

c) Phage display is a very powerful technology for the evolution and selection of novelproteins, antibodies, and binding sequences.

Medical applications:a) Phage typing- Since many phages have a very restricted host recognition, they can be used to

rapidly identify a strain of bacteria (e.g. Staphylococcus); b) Anti-bacterials- Phages kill their bacterial host by lysis and could be used to prevent or treat

infections. Treating infections with phages, or “phage therapy,” was used during the Stalin era to combat wound infections. With the emergence of antibiotic resistance and the alarming increase in Methicillin and possibly Vancomycin resistance among Staphylococcus aureus strains, the idea of using phages to control bacterial infections is receiving renewed attention. However most of the research on phage therapy is still conducted in labs in Eastern Europe.

Despite the fact that phages are the most ubiquitous and numerous organism on earth, relatively little is known about the diversity, distribution, and dynamics of phages in natural envirionments!

The focus of this IAP course is two fold:1) Attempt to isolate and characterize new species of phages from local ponds and rivers2) Clone a phage gene by PCR and confirm the recombinant clone by sequencing it.

In the process, you will learn many of the basic laboratory techniques and bioinformatics tools currently used in many biological research labs.


DAY 1

1) Concentrate of phage communities by ion exchange chromatography (Adapted from a protocol developed by Roger Hendrix at the University of Pittsburgh)

Overview: This is a method for concentrating and purifying whole communities of bacteriophages from environmental freshwater sources. The method can be used on 1 to 100 L of water sample. The main steps are:

• collect water and pump through coarse filtration• bind phage by adding DEAE-cellulose to water, stirring, and letting settle out• decant excess water• transfer anion exchange resin to column• wash column and elute phage from the DEAE-cellulose with high salt • further purify phage by CsCl equilibrium density gradient ultracentrifugation

Each group will receive a 4-liter environmental water sample of their choice: Charles River, Spy Pond, or final effluent from the Deer Island Wastewater Treatment Facility (yum!).

Materials:4 L of water sample in a large beaker or flask4 grams of Whatman DE-52 (DEAE-cellulose anion exchange resin) (1 g per liter)Column wash buffer (10 mM Tris HCl, pH 7.5, 5 mM MgCl2, 25 mM NaCl) kept at 4 ºC Column elute buffer (Column wash buffer containing 0.5 M NaCl) kept at 4 ºCLuer stopcock and fittingsChromatography column (BioRad)Small glass tubes and holder Ice BucketsLarge beakerMagnetic stir plate and stir bar

Binding phage and packing the column: Add 1g of DEAE-cellulose (Whatman DE-52) per liter of river water. Keep at 4°C by incubating the

flask in an ice bucket or by working in the cold room. Add a magnetic Stir bar, and stir gently and continuously for 30 minutes on a magnetic stir plate. The phage particles will bind to the DEAE-cellulose resin. Turn on the stir plate and let the resin settle. (note: you can also stir manually every 10-15 minutes for one hour)

Let the DEAE-cellulose settle out by gravity. (takes 20-30 min). Decant as much of the water as you can by siphoning or pouring out the water. If necessary resuspend

the DEAE-cellulose in the remaining water and transfer the slurry to a smaller container, such as a beaker. Allow to settle again, and decant water (Remove enough water to still maintain a free-flowing slurry).

Set up a small column fitted with a stopcock at the bottom (Bio-Rad Econocolumn) on a stand. Place a funnel or reservoir at the top and a beaker or flask under the column to collect buffer.

Pour the DEAE-cellulose slurry into the column. Open stopcock to drain out water and to pack the resin into the column.

Close the stopcock once the top of the liquid reaches 2-3 cm above the resin. Remove funnel and replace with a cap attached to a small flexible tubing.

Place the free end of the tubing into a bottle of column wash buffer kept on the shelf so that it is higher than the column. The higher the buffer, the higher the pressure and the faster the flow.


Open the stopcock. The buffer will siphon down and drip onto the top of the column bed. Do not allow the top of the column to go dry. There should always be several millimeters of water on top of the resin.

Allow 4 to 5 column volumes of buffer to flow through the column. (you need to determine the volume of your column)

Close the stopcock. Remove tubing from wash buffer and hold up to drain into column. Store column into cold room until ready to elute (next day)

Inoculate bacterial cultures Obtain 4 plates each containing one type of bacteria. Label the plates (on the bottom) with your

initials. These plates are now yours and should not be contaminated. Always store plates upside down and parafilmed.

Distribute 1.5 ml of sterile LB into four 18 mm sterile glass tubes. Use a long sterile tooth pick to transfer one individual bacterial colonie into each tube. Label each

tube with the name of the bacterial strain ( E. coli, CRB5, Vibrio, Salmonella). (Always use tape or sticky dots. Do not write directly on the tube)

Place the tubes in the roller drum in the warm room, Always balance the tubes. Turn ON the roller.


DAY 2

(#1 Continued)Elute phage:

Open stopcock and let buffer drain until there is just one mm of buffer at the top of the resin. Close stopcock. Remove cap and add gently about one ml of elution buffer with a Pasteur pipette to

avoid disturbing the top of the resin. Place back the cap and place the end of the tubing into the elution buffer (this buffer contain high salt which detaches [elutes] the phage particles from the resin).

Remove waste beaker from under column and place glass tube holder under column. Open stopcock and start eluting phages. Make sure that the elution buffer is siphoned into the tubing

by vacuum and that the resin does not go dry. Collect 1.5 ml fractions into the glass tubes.

Determine relative protein concentration Determine protein concentration with the Bradford assay (Bio-Rad reagents). The Bradford assay is a

colorimetric assay which measures the binding of a dye (Coomassie blue) to protein at low pH. Binding is measured spectrophotometrically observing absorbance at 595 nm. NOTE: If the water sample has tannins or other colored compounds, they may interfere with the protein assay. However the bulk of these colored compounds typically elute with the phages and can be used as a rough indication of where the phages are.

You will need a 96-well plate, buffer, Bradford reagent, a protein solution for the standard curve (BSA), and 160 µl of each column fraction to be tested

Add 160 µl of sample to the microtiter plate, add 40 µl of Bradford reagent and allow 5 minutes for color change to fully develop.

Compare the fraction samples to the BSA standard curve to determine the location of the protein peak Pool the fractions that contain proteins together into a sterile 30 ml centrifuge tube. Label the tube

with your initials, sample name and date. Store tube in the refrigerator!

2) Screen concentrates for phages infecting selected bacterial hostsIn order to better characterize the phages from the water samples, we first need to grow and

amplify the phage on its host cells. This requires us to identify a proper bacterial host that the phage can infect and replicate in. Since we are working with novel phages we can try to grow the phages on known bacterial strains or from a bacterial strain that was isolated from the Charles River (Corynebacteria aquaticum).

Your choice of potential hosts:Esherichia coli C122Esherischia coli BL21Salmonella anatumSalmonella typhimuriumVibrio splendidusVibrio harveyii ssp B-392Corynebacterium aquaticum ssp. CRB5Corynebacterium aquaticum ssp. CRB7Ralstonia eutropha H16


Materials:Top agarLB plates that have been kept at room temperature or 30ºC for several hoursMicrowaveHeat block at 48 ºCSmall sterile glass tubesPhage solutionOvernight liquid culture of BacteriaPipetman and sterile tips

Melt the soft top agar in the microwave. Distribute 3 ml aliquots in glass sterile test tubes and incubate in a heat block set at 48 ºC. (each team

will need 4 tubes). Retrieve the overnight bacterial culture from the warm room. Retrieve your phage sample from the

refrigerator Label 4 sterile test tubes with the name of the bacterial host ( E. coli, CRB5, Vibrio, sal). Add 300 µl of bacterial stain into the corresponding tube. Add 100 µl of the phage concentrate into

each tube. Let sit for 10 minutes at 30ºc (use a small heat block). Label 4 LB agar plates with your initials, date and bacterial strain (label the bottom of the plates) To plate each sample, add 3 ml of top agar into the glass tube containing the bacteria and phage

concentrate and immediately pour the tube onto the corresponding LB agar plate. Rotate plate gently to spread the agar evenly. Let sit for 10 minutes to allow for the agar to solidify and then incubate upside down at 30ºC over night.


DAY 3

(#2 continued) Retrieve plates from warm room. Record the number of plaques on the bacterial lawn. Try to

determine how many different phage types you may have on the plate by carefully looking at the shape and size of the plaque, its relative transparency, and the edges of the plaque. How many different type of plaques to do see? Record your observations and describe the plaques morphology. You may take a picture of the plaques with a digital camera.

3) Isolate phage from single plaquesTo characterize a particular phage (protein components, DNA restriction pattern, DNA sequence, etc..) it is imperative that we work with a homogenous phage sample containing only one type of phage (pure strain). A plaque on a bacterial lawn is the result of several successive cycles of infection and lysis of neighboring bacterial cells by the progeny of a single phage and contains identical phage particles. Therefore before scaling up the production of the phages we need to purify and amplify phages from a single isolated plaque.

Label 3 small plastic microfuge tubes with the bacterial strains and your initials. Add 500 µl of phage buffer to each tube and keep on ice Choose a well-isolated healthy-looking plaque on the plate. Use a sterile glass Pasteur pipette with a small bulb at the end to pluck the plaque out by suction. Expel the plaque into the buffer. Siphon up the buffer up and down several times if necessary. Add 3 drops of chloroform, close the cap. Hold the tube between the index and thumb and invert

back and forth to mix the chloroform. Avoid violent shaking or vortexing. It could damage the phage tail and the phage will not be infective anymore.

Let sit for at least 20 minutes to allow the phage to diffuse out of the agar and for the chloroform to settle at the bottom of the tube.

Microcentrifuge for 10 sec. Transfer the supernatant to a new labeled tube. This is your purified phage stock originating from a single plaque and corresponding to a single phage strain. Give your phage a name.

The chloroform is used to kill the bacterial cells and complete lysis. It does not destroy most virus particles unless they are filamentous phages or contain a lipid membrane.

You can use small aliquots of this stock to view under the microscope or for PCR analysis, or to propagate the phage and produce more phage.

4) Determine titer of phage stockTo make a large scale preparation of your phage you need to first know accurately how

many infective phage particles or plaque forming units (pfu) there are per ml of phage stock. In other words you need to determine the pfu of your phage stock. This is important because the initial ratio of bacterial cell to phage or multiplicity of infection (MOI) is very important for a successful large-scale phage preparation.

Note: you always need to know the proper bacterial host for your phage. So from now on you have to keep track of what phages you are working with and on what bacteria they grow. Similarly you need to always


properly label all tubes and plates with the name of the bacterial strains, the date, your initials, and any other pertinent information (dilution fold, phage strain ..)

Material: For each phage stock you want to titer you will need:

6 small sterile glass test tubes (for 10 fold serial dilution up to 1,000,000 fold or 106) 3 tubes of 3 ml melted top agar (in heat block)3 LB plates (labeled with the phage stock, date, your initial and the fold dilution) 3 sterile glass tubes (labeled with phage stock and dilution) P 1000 pipettmanP 200 pipettmanSterile tipsVortexer

Add 900 µl of sterile phage buffer into 6 sterile glass tubes labeled 101 to 106 to indicate the fold dilution. (you can use the same tip).

Add 100 µl of phage stock into tube # 1 ( 101 fold dilution) ( use sterile tips) Vortex. Change tip. Transfer 100 µl from the 101 dilution tube to the next tube ( 102 fold dilution) Vortex, change tip and repeat until you transfer 100 µl from tube 105 to 106.

10-fold serial dilutions

Add 100 µl of an overnight culture of the host bacteria into 4 new tubes labeled 103, 104, 105 and 106 (use same tip)

And 100 µl of the 103 fold phage dilution to the 100 µl bacteria in tube labeled 103. Mix gently. Repeat the procedure for the 104 ,105 and 106 fold dilutions Let sit for 10 minutes to allow the phage to adsorb to the bacterial cell. Plate the mixtures on labeled LB plates with 3 ml of top agar as described in section 2 Incubate the plates upside down in the warm room overnight.


5) Amplify a phage gene by PCRThe Polymerase Chain Reaction (PCR) is used to make millions of copies of a template DNA sequence in just a couple of hours. Kary Mullis of Cetus Corporation, received the Nobel Prize for developing this revolutionary DNA amplification technique.

A PCR reaction contains DNA to be amplified (in our case the source of DNA will be from single plaques or our large

phage prep)- this is the the template Short DNA primers (oligonucleotides) which bind to complementary sequences on the template

DNA The 4 deoxy nucleotide (dNTPs) which are the building blocks of DNA (dATP, dTTP, dGTP,

dCTP) used by the polymerase to synthesize the complementary strand on the template DNA DNA polymerase; Taq DNA polymerase isolated from organisms living in hot springs is heat

resistant (30 minutes at 95 °C) and works best at 72 °C.

The steps of the PCR reaction: Denaturation- DNA is heated to 95° C to separate the two DNA strands of the DNA template

= melting step. Annealing- The reaction is cooled to a temperature (which can vary from 37 to 70 ºC

depending length and base composition of the primers) where the two DNA primers can anneal or bind to their complementary sequences on the DNA template.

Elongation- The temperature is raised to 72 °C, the temperature optimum for synthesis of DNA by the thermostable DNA polymerase (this step also known as “extension”)

These three steps are cycled, typically 25-30 times, to make billions of copies of the DNA sequence that lies between the two DNA primers- shown schematically on the next page.

Set up PCR reaction• Each of you will be assigned a gene to clone (12 genes alltogether)• Obtain your forward and reverse primers, as well as your template DNA

from the TAs• Keep all components and mixtures on wet ice• Add enzyme last, mix up and down with a pipette set to 45 µl• Be careful not to warm tube with fingertips, nor introduce bubbles while mixing

50 µl PCR reaction(calculate your volume of water and add first)5 µl buffer (10X stock)2 µl dNTP mix2 µl forward primer2 µl reverse primer20 ng of phage gDNA template1 µl of Pfu turbo(H2O to make 50 µl total)

Mix the reaction components and add to a hot PCR block. Use the program “7_391” on the thermocycler.


PCR reaction

Downloaded January 6, 2007 from http://commons.wikimedia.org/wiki/Image:Pcr.png


http://commons.wikimedia.org/wiki/Image:Pcr.png

DAY 4

(#4- Titer phage stock, continued) Retrieve plates from warm room. Count the plaques for each dilution and record the number in the table below. Determine the titer of the phage stock in pfu/ml.

Dilution

fold10 3 10 4 10 5 10 6

# of plaques in

100 µl of 10 1

# of

PFU/ ml

Phage

______

Phage

_______

Phage

_______

Phage

______

6) Scale up phage lysateIn order to have enough material for protein gels, DNA extraction, electron microscopy,

sequencing, or to distribute to your friends or family you need to prepare a large-scale culture of bacteria and infect them with phages in the appropriate ratio (1 phage for every 10 to 100 bacteria). It is therefore very important to infect with a phage that was isolated from a single plaque to insure strain purity. It is also essential to accurately determine the titer of the phage.

There are two ways to obtain large amount of phages. The bacterial cells can be infected with phages in liquid culture or grown on agar plate using top agar to plate the infected cells.We will use the liquid culture method because you need less material (agar is expensive) and it is easier to scale up to large volumes. However if the phage forms small plaques and grow slow or can lysogenize the bacteria it is easier to get the right conditions with the LB agar plate method.

Start an overnight culture of the host bacteria in 5 ml of liquid LB right before leaving for the day: use a long sterile wooden stick to pick a single bacterial colony from a plate and inoculate the liquid LB. Cap the tube and incubate at 30ºC overnight (at least 8 hours) in a roller to provide aeration.

Transfer 250 ml of sterile LB into a 1-liter baffled sterile flask and keep at 30ºC. Use a sterile glass Pasteur pipette to siphon up 3 to 5 plaques from a plate. Expel the plaques into a microfuge tube containing1 ml of phage buffer. Add a few drop of

chloroform. Mix well and let sit in the cold to allow for the phages to diffuse out of the agar. Label the tube so that you know what it is. It is best to transfer the phages into a new tube (but can wait until the next day):

THIS SECTION CONTINUES ON DAY 5 in the AM!


7) Analyze PCR products by agarose gel electrophoresis:

1. Prepare 50 ml of 1% agarose in 1X TAE.Weigh 1 g of agarose per 100 ml of TAEAdd to an Erlenmeyer flaskMicrowave 1.5 to 2 minutes to completely dissolve the agarose. Use thick protective gloves to remove the flask from the oven. Swirl around to mix. Avoid creating bubbles while mixing. If the agarose is fully dissolved the solution should be clear. Let stand on the bench while you are taping the tray.

2. Insert the gel tray side ways in the chamber to seal the side. Insert the comb.

3. When the agarose solution is around 55°C, add 10 µl of SYBR safe solution, mix gently and pour the solution into the tray until it reaches 3/4 of the teeth height. Make sure the tray is on a flat surface. Let solidify for at least 15 minutes. The solidified gel will be white and solid to the touch. Set the tray correctly in the electrophoresis chamber by takignit out of the chamber and turning it 90 ºC. Pour 1X TAE buffer in the chamber until all the wells are covered.

4. Add 6 µl of 5X DNA loading dye into each PCR tube. Mix briefly and centrifuge.

All samples will be loaded on the same gel. We will run duplicate gels. Load 8 µl of Mw standards ( 1 Kb and 100 bp ladders) in the end lanes. Load the positive control on the second well from the left. Load 20 µl of each sample into the wells starting with the negative control.

5. Close the lid. Connect with leads to the power source. Turn on the power and set the voltage at 90 V. Run for 35 minutes.

6. Turn the power supply off. Disconnect the leads. Take the tray out. Hold the open sides of the tray to prevent the gel from slipping away. Put the gel on the UV box.

7. Turn the UV light on. Set the camera on top of the box and squeeze trigger. Pull out picture and let develop for 45 seconds before peeling apart the print.

If you get a decent band from your PCR reaction, clean up the reaction using the qiagen PCR cleanup kit. This product removes nucleotides, primers, enzymes, and small fragments of DNA. Additionally, the buffer is replaced by 10 mM Tris, pH 8, making the DNA easy to add to subsequent enzymatic reactions, such as restriction digests.

Then, quantitate your DNA on the spectrophotometer: A280 x 50 x dilution factor = [DNA] in µg/ml


DAY 5

(#6 Large scale prep, continued)In the morning: (~10 AM)

Transfer 4 ml of the overnight into 250 ml of pre-warmed LB (50 fold dilution) and incubate in a shaker at 30 ºC.

Monitor the growth of the bacteria at OD600 every 30 minutes by transferring 1 ml of the culture into a plastic cuvette and recording the OD in the spectrophotometer (use sterile pipette).

Retrieve the tube containing the phage plaques from the refrigerator and centrifuge the tube for 30 sec to pellet the agar and the bacterial debris and transfer the supernatant into a new tube. Add one or 2 drops of chloroform and store at 4 ºC until needed.

As soon as the bacteria reach an OD600 between 0.25 and 0.3 (1 to 3 hours) add the phages at a MOI of 0.1 to 0.01. The bacterial culture should have a density of ~ 108 cells per ml. To reach an MOI of 0.01 we need to infect the bacteria with about 106 phages per ml or with about 2 X 108 phages for a 200 ml culture. From the results of day 4 we know how many phages are in a plaque. Therefore we can calculate how many microliters of the phage suspension we need to add to the flask to reach an MOI of 0.01. (typically 2 to 4 plaques will provide enough phages to infect 250 ml of the bacterial culture)

Continue the incubation at 30ºC with shaking until the OD600 drops (the LB becomes clear). This indicates that most of the bacteria have been infected and lysed releasing phages.

Add 5 ml of chloroform, swirl around, let sit for 5 minutes so that the chloroform settles down at the bottom.

Transfer the supernatant into a large centrifuge tube. Be careful NOT to transfer any of the chloroform

Centrifuge at 5000 to 8000 rpm for 10 to 15 minutes to pellet the cells and debris Transfer the supernatant into a new centrifuge tube. Add 7.3 g of NaCl (0.5 M) and 25 g of PEG 8000

(10% w/v). Swirl to dissolve and incubate at 4 ºC for at least one hour.

#8 Digest and ligate PCR product with plasmid vectorIn this step you will ligate the PCR product with a plasmid vector containing an inducible promoter

upstream of the cloning site. This will allow you to subsequently express the protein encoded by the DNA sequence you have amplified and cloned into the plasmid. In the first part of this step, you will cut both the PCR product and the plasmid with restriction enzymes to generate «sticky» or compatible cohesive ends. These compatible ends are the substrates of the ligase in the second part of this section. The DNA ligase will join compatible ends (ends which share 4 bp of complementary sequence).

Digestion, (50 µl volume)To a tube add in the following order(calculate µl H2O added to make 50 µl total, and add first)5µl buffer1 µl BSA1 µg DNA10 U of each restriction enzyme.

Note: You will perform digests of the inserts and the plasmid separately. The enzymes you will use will depend on the sequence of your primers. See appendix eight for the enzymes needed to digest your PCR product and your plasmid. The appendices have plasmid maps showing where the inserts will be ligated into.


For today’s cloning, you will be using two enzymes, NdeI and BamHI, that use different restriction buffers. Therefore, you will digest in stages. Add NdeI and NEBuffer2 and let digest for 1 hour. Add NaCl from a 5M stock to bring the final concentration in the reaction up to 150 mM. Now add BamHI.

Remove endonuclease and small DNA fragmentsUse the Qiagen PCR cleanup kit to remove the restriction enzymes and small cleavage products from

the digestions. Follow the instructions in the kit. Assume 80% recovery of material for calculating DNA concentration in the ligation step.

LigationTo a tube add in the following order:Calculate how many µl H2O, if any, to make 20 µl total150 ng digested plasmid 200 ng digested PCR product10 µl T4 “Quick” ligase buffer1µl T4 “Quick” ligase

• add enzyme and mix gently• incubate at room temperature for 5 minutes• place on ice

9) Transform E. coli with ligation mixtureIn this step, you will transform chemically competent E. coli cells with your ligation mixture. The

cells have been treated with CaCl2. While on ice, changes to the membranes of the cells (in a process that is poorly understood), allow the cells to take up exogenously added DNA. In your ligation mixture will be a range of products. Only circular, covalently closed DNA molecules bearing an resistance gene will transform your cells to antibiotic resistance. This means that both vectors that have ligated their ends (single cuts and self-ligations) as well as vectors that have obtained an insert will transform your cells.

• add 5 µl of ligation mixture to a falcon 2059 tube and place on ice• add 100 µl of competent DH5a cells and mix gently by swirling• leave on ice for 30 minutes• heat shock cells by placing tube in 42°C water bath. Do not agitate• place cells on ice for 2 minutes• add 900 µl of prewarmed LB plus 0.8% glucose• let recover at 37°C with shaking for 30 to 60 minutes• plate on prewarmed LB agar plus ampicillin• incubate overnight at 37°C


Monday January 15 (holiday)

#10 Purify phage by PEG precipitation and CsCl gradient centrifugation Centrifuge the PEG solution at 10 000 rpm for 20 minutes. Discard the supernatant and resuspend the pellet in 5 ml of cold phage buffer. You can pipette the

buffer up and down to help resuspend the pellet but avoid creating bubbles. Transfer the resuspended phage particles into a 10 ml sterile screw cap glass tube.

This is your large-scale purification of phage particles. You should have enough to do many experiments and characterize the phage. However this preparation is not pure enough and contains many bacterial contaminants that came down during the PEG precipitation. To obtain a very pure sample of phage particles the sample will be subjected to CsCl equilibrium density ultra centrifugation (see appendix) to yield a very pure and highly concentrated phage stock stable for a long time.

Purify phages by equilibrium density ultracentrifugation. Weight Xg of CsCl. Transfer 9 ml of the phage suspension to a 15 ml screw cap tube. Add the CsCl. Mix gently until all in solution. Weigh the centrifuge tube. IT IS VERY IMPORTANT TO HAVE PERFECTLY BALANCED

TUBES. Transfer to ultracentrifuge tube. Heat seal top of the tube Place tubes in Beckman SW60 fixed-angle rotor Pace rotor in ultracentrifuge. Close door and start vacuum. Set up speed at max RPM for at least 16 hours.

(#9 ligation transformation, continued)Pick transformants for overnight cultures

Add 1.5 ml of Super Broth plus ampicillin (100 µg/ml) to 13 mm test tubes Use a sterile toothpick to pick a colony Drop pick into broth Shake overnight at 37°C


DAY 6

(#10 CsCl purification, continued)During the run the CsCl solutions even out into a roughly linear density gradient and the phages band

around a density of 1.5. Unlike the case of a homogeneous phage stock, where one sees a single sharp phage band, in this case we see a diffuse area of light-scattering material, sometimes punctuated with one or more faint sharp bands. We collect a broad section of the gradient, encompassing most of the phage, by puncturing the side of the tube with a hypodermic syringe.

Harvest and dialyze CsCl purified phage particlesCollect the phages by puncturing the side of the centrifuge tube, just below the phage band, with an

18 or 20 gauge hypodermic needle. Carefully draw up the band into the syringe by slowly pulling out the plunger and sweeping the needle tip back and forth across the diameter of the tube.

Using the same needle and syringe, transfer the phage/CsCl mixture into a dialysis cassette, attach the flotation buoy, and immerse in 2L of phage buffer with a stir bar in the cold room. Change the dialysis buffer just before you leave for the day. Retrieve the dialyzed material the next day using a fresh needle and syringe. Transfer to a sterile glass screw capped tube.

#11 Screen transformants for correct insert• retrieve plasmids by mini-prepping overnight cultures• digest with enzyme that cuts insert• use empty vector as a control• run digest on agarose gels with size standard


DAY 7

12) Extract DNA from purified phage particles:This protocol is designed to be done in 1.5ml microfuge tubesFor comparisons, you will purify the DNA from both the PEG precipitate and the CsCl purification

To each microfuge tube add:400 µl purified phage particles25 µl 10% SDS 50 µl 1 M Tris-Hcl pH 8.025 µl 0.5M EDTA, pH 8.0

Cap the tube and mix well by inverting the tube back and forth Incubate in a heat block set at 70°C for 20 min to break down the phage particle Add 500 µl phenol:chloroform:isoamyl alcohol (25:24:1) (available commercially) UNDER THE

HOOD Mix well by holding the tube between index and thumb and shake for 2 minutes Place tube in microfuge and spin for 2 min at top speed Using a P1000 pipette Transfer carefully the top aqueous layer to a clean labeled tube. Discard the

phenol phase in the proper organic waste. If needed repeat the phenol:chloroform:isoamyl alcohol step.

Incubate the tube on ice Add 50 µl of 3M NaOAc (pH 5.2) and mix until there is only one homogenous phase (no visible little

wavy lines) Incubate on ice for 5 min Add 2 volumes (~ 900 µl) of 100% ice-cold EtOH (kept in the freezer) and mix back and forth until

wavy lines go away. A large cottony ball containing the DNA should appear Flame the end of a glass Pasteur pipette to close the opening Spool up the white DNA ball on the closed Pasteur pipette Immerse the spooled DNA into a microfuge tube containing 70% EtOH, swirl around or up and down

to wash away the salt. Let DNA air dry on Pasteur pipette on the bench for ~ 15 minutes by placing the end of the Pasteur

pipette into a tube holder point up! The DNA will switch from white to transparent as it dries. Immerse Pasteur pipette into 200 µl TE; the DNA will dissolve into the TE (you may have to scrape a

little to get it all off the pipette)

ET VOILA!!

Store the Purified DNA in the refrigerator. Determine the concentration of the DNA solution by taking an OD260 measurement.

An OD260 of 1 is equivalent to 50 µg/ml of DNA


DAY 8

13) Enzyme restriction analysis of phage DNAThis is a very useful step to estimate roughly the size of the genome. It is also a very good

exercise to discuss the separation of DNA fragments in an electric field. In addition unless two phages are identical they will probably yield different DNA restriction patterns. Therefore enzyme restriction analysis is a quick method to look at genome diversity and determine if two phages isolated independently are from the same strain or not.

Digestion with restriction enzymes :Choose 2 or 3 restriction enzymes that are known to cut well and are cheap (EcoR I, BamH I, Hind

III). These enzymes are all recognizing 6-base palindromes (six cutters). The probability that a specific 6 bases sequence is found randomly is 1 in every 46 bases.

To set up a digest: For each DNA/enzyme pair label a microfuge tube with the restriction enzyme and the phage (and

date and initials) The DNA digest will be done in a total volume of 25 µl in a 1.5 ml microfuge tube

Add to a tube on ice:19 µl of sterile water3 µl of DNA sample2.5 µl of 10X buffer (specific for each restriction enzyme)0.5 µl of enzymeIncubate in a heat block at 37 ºC for one to 3 hours .

Add 3 µl of 10X loading dye to each tube Keep in freezer until ready to use

Agarose gel electrophoresis:1. Prepare 50 ml of a 1% agarose in TAE:

Weigh 0.5g of agarose and pour into a 250 ml Erlenmeyer flask. Add 50 ml of 1 X TAE (note that the TAE stock is 10X) Mix well and heat in microwave oven on Hi for 1 to 2 min. Use plastic holder to take the flask out and Swirl around. Avoid making air bubbles. Microwave again if necessary to dissolve all the agarose but avoid boiling the solution. While the melted agarose is cooling place the gel tray in the electrophoresis chamber at right angle to

form a seal between the tray and the chamber. Insert a 12-teeth comb into the end of the tray. Add 10 µl of 0.5 mg/ml ethidium bromide to the melted agarose, swirl around and pour into the tray.

(WEAR GLOVES! DISCARD EtBr contaminated tips into special container.) Let agarose solidify. Remove the tray, turn it 90 º and replace it in the chamber. Add 1X TAE to cover the gel (about 200 ml)

2. Loading the gel Vortex DNA sample for a few second and centrifuge for a few second. Load 15 µl of each sample into the well Load 10 µl of each Mw standards ( DNA cut with Hind III, 100 bp ladder and 1 kb ladder)


Slide cover on and connect leads to power supply. Make sure the positive lead is toward the end of the gel since the DNA is negatively charged and will be moving toward the anode.

Set voltage at 100 V and run for 45 min to1 hour. Disconnect leads Place gel on UV box and turn UV light on Take Polaroid picture for record (Use yellow filter if necessary).

Data analysis Prepare a MW standard curve by measuring the distance of migration from the well to each band in

the MW standard lanes. Plot a curve with the molecular weight ( # of base pairs) on the X axis and the distance of migration

on the y axis. Count and record the number of bands for each enzyme digest of the phage DNA Estimate the size of each of each band using the Mw standard curve Estimate the size of the phage genome for each enzyme digest by adding the sizes (in bp) of all the

bands in the lane. Compare the results with the different enzymes. Are they different? Why? What would be the best

approximation of the size of the phage genome. Are the 3 phages from the same strain? Are they related? How can you tell? The phage stock may have contained some residual bacteria and the DNA prep may be contaminated

with bacterial DNA. How can you be sure that the bands you see come from phage DNA and not bacterial DNA?

What would be a proper control?

14) Resolve phage particle proteins by SDS-PAGEThe phage particles contains several type of proteins.The proteins of the head: The head holds the phage genome and is the largest component of the phage particle. There are several hundreds to several thousand copies of the head proteins per phage particles and those will be the most abundant and prominent band on the gel.The tail proteins and the portal proteins which play a major role in host recognition and attachment. Those are present in smaller amounts

The portal proteins are the most interesting to study as they define host specificity and which bacteria can be infected, and play an essential role in the movement of the DNA from the head into the bacterial cell during infection and during the packaging of the DNA into the head of new phage particles. Together with the terminases (a complex of phage proteins that hydrolyze ATP and can cut DNA after packaging), the portal proteins form a molecular motor that pulls the DNA into the capsid during virus assembly.

It has been shown that the host specificity of a phage can be switched by switching tails. The first step toward characterization of the capsid proteins is to run a simple 12% SDS polyacrylamide gel and observe the number and size of the protein bands. The phage preparation should be free of bacteria as much as possible or many of the protein bands will be coming from bacterial proteins.

The large scale production of phage described in step 5) yields a pure enough phage preparation for this analysis. There is no need to lyse cells or to remove debris. The phage particles can be directly loaded onto and SDS-PAGE gel after boiling the particles in protein sample buffer containing SDS and DTT.

MATERIAL FOR SDS-PAGE AND STAINING

SDS running buffer for SDS-PAGE (10X stock solution)IAP 2007 Biology 7.391 29

3X Protein sample buffer (also called loading buffer or cracking buffer) 30 % acrylamide-bis solution (30: 0.8) TEMED Fresh10% Ammonium persulfate (we will use frozen aliquots of 10% APS for one time use) bottom buffer (1.5 M Tris HCl pH 8.8, 10% SDS) Top buffer (0.5 M Tris HCl pH 6.8, 10% SDS) 0.1% SDS (to layer on top of bottom gel) Transfer pipette Distilled water Coomassie blue Staining solution Destaining solution Protein Molecular weight markers (Broad range from BioRad) Ice bucket Pipetteman and tips for 10 µl to 500 µl Small glass tubes 1.5 ml microfuge tubes Table top microcentrifuge (for up to 12 000 g) Power supply, clamps and leads Electrophoresis chamber for minigels (BioRad mini-protean 3 electrophoresis cell) Set of clean dry glass plates (Long and short) Casting chamber Heat block with thermometer to boil samples

NOTE: acrylamide does not polymerize well or evenly when exposed to air. A layer of 0.1% SDS solution, carefully applied to the top of the freshly poured monomer, will allow for complete polymerization of the gel up to the polymer/liquid interface. Some folks use water saturated butanol or isopropanol for this step, but we avoid their use as they tend to “scar” the plastics typically used in commercial acrylamide gel setups.


To Prepare a 12% SDS-polyacrylamide gel using the BioRad casting system:

Set up glass plates Take a short back plate and a long front plate (with integrated spacers). The glass plates should be

CLEAN and dry! Align carefully and clamp together in casting frame. Insert comb between plates and label the plate 1 cm blow the teeth. Remove comb Set casting frame on casting stand to seal the bottom.


Prepare 5 ml of 12% acrylamide gel • components include water, lower buffer, acrylamide, and catalysts• degass in a sidearm flask (optional)

WEAR GLOVES when handling acrylamide!

% gel H2O 30% acrylamide bis Buffer/SDS__________________________________________________________________

5 2.9 ml 0.8 ml 1.3 ml (Stacking)

10 2 ml 1.7 ml 1.3 ml (separating)

12 1.7 ml 2 ml 1.3 ml (separating)

Degas briefly by hooking a vaccum tube to the side arm flask and capping the top of the flask.

Then, add 25 µl of 10 % APS and 3 µl of TEMED (smells very bad)

Mix immediately (but gently) by swirling around to avoid bubbles and pour quickly (but carefully) between the plates using a disposable plastic transfer pipette until the solution reaches the line 1 cm below the teeth. Add immediately a THIN layer of 0.1% SDS (1 mm) with a new disposable pipette and let polymerize (45 minutes).

Once the bottom gel has polymerized pour out the layer of SDS by tilting the plate and rinse with distilled water. Let drain. Prepare 5 ml of stacking gel (in a side arm flask) using the stacking bufferDegas brieflyAdd 25 µl of 10% APS and 5 µl of TEMEDSwirl gentlyPour with a plastic transfer pipette until the top of the short plate. Insert the comb and let polymerize for ~ 30 minutesRemove combRinse wells with running bufferSet up gel in electrophoresis chamber as outlined below.Add 1 X SDS running buffer until the buffer reaches half way past the short plate. Do not overfill tank.


Prepare protein samples Pipette 5 µl of the phage concentrate into a microfuge tube Add 45 µl of 1 X SDS lysis buffer (contains SDS and b-mercaptoethanol), close the tube tightly, mix

by vortexing for 3 sec Place tube into heat block set at 100ºC for 2 minutes Vortex for several seconds and Centrifuge for one or 2 sec just to bring down the condensation

Load, run, and stain the gel Place the loading guide on top the gel Using a pipetman and a small tip load 25 µl of each sample into the well starting with the second well

( maximum sample volume is 44 µl) Load Mw markers (Broad range) in the first and last well Connect the leads and Run at 180 Volts for 30 to 45 minutes When the blue dye reaches the bottom shut down the power supply Wear gloves Remove the chamber from the tank and empty out the buffer into the sink Open the clamps and take out the plates. Take the plates apart by gently prying them open. transfer the gel into a plastic container with lid Add Coomassie Blue staining solution Set on a shaker for 1 hour RINSE all parts of the electrophoresis apparatus with distilled water and set aside to dry. WASH plate and store dry Transfer the gel into a different plastic container and add enough destaining solution ( in this case

distilled water) just to cover the gel. Add a crumpled kimwipe, close the lid and place on a platform shaker


DAY 9

(#14 continued) Transfer the gel into a new plastic container containing distilled water. Record the results

Take a photographMeasure the distance of each band from the top of the gelDetermine the Mw of each band based on the Mw standard curveEstimate the size of the gene for each protein

Dry the gel:You can dry the protein gel between two sheets and cellophane and keep the gel for a long time.

Material:Plexiglas sheet and a Plexiglas frame.Clamps5 % glycerolCellophane sheets

Place the Plexiglas sheet flat on the bench. Wet the cellophane in 5 % glycerol and lay down on the Plexiglas. Make sure that there are NO

bubbles between the cellophane and the Plexiglas. Lay down the SDS gel on top of the cellophane (no bubbles) Wet another cellophane in 5% glycerol and lay down on top of gel. Get rid of the bubbles. You can

roll a pipette on top of the cellophane to chase away the bubbles. Lay the Plexiglas frame on top of the 2 nd cellophane and clamp the two Plexiglas together with

black clamps. Set up the system to stand on the clamps overnight. The gel should be dry the next day.


DAY 10Cleanup!

Data analysis and summary

Electron Microscopy


Appendix 1: Basic microbiological techniques

Starting up E. coli cultures1. Streak for single colonies. (This has been done for you several days in advance, and can be done up to 2 weeks in advance, depending on how colonies survive on LB plate.)

It is important to start a liquid culture from a single colony growing on an agar plate to insure that the population of cells is genetically homogenous. Therefore it is important to know how to obtain a single colony.

Retrieve a permanent agar stab from your strain collection and prepare the work area by wiping the lab bench surface with ethanol. Set up a Bunsen burner. Label the back of a fresh LB agar plate with the name of the strain and the date. Using a sterile toothpick or a sterilized loop, transfer a glob of agar with bacteria from the stab onto the labeled LB-agar plate. Immediately close the stab and wrap it in parafilm to prevent contamination and drying out. (At your school, access to the permanent stabs should be limited to teachers that are familiar with sterile techniques, and every precaution should be taken to avoid contamination of the permanent stabs)

Spread the glob onto one side of the plate by going back and forth with quick light strokes (see diagram below). Using a new toothpick, turn the plate 90 º and streak across the lines. Turn the plate again and repeat the streaking with a new sterile toothpick. Incubate the plate overnight at 37º C. The second or third set of streaks should produce single colonies that have risen from single cells. Wrap the plate in parafilm and store it in the refrigerator (4 ºC). You can use colonies from the plate to inoculate liquid cultures for up to 2 weeks, depending on the strain.

STREAKING FOR SINGLE COLONIES

First streak second streak Third Streak

2. Start an overnight liquid culture.Pick out an isolated homogeneous colony from the plate using a long sterile wooden stick or sterile loop and

inoculate 2 to 3 ml of liquid LB in a sterile 15 ml capped glass tube. Incubate overnight at 37 ºC in a shaking water bath. The culture should reach the late log phase-stationary phase in 8 to 10 hours.

3. Set up exponentially growing liquid cultureIt is important to work with exponentially growing cells because they are actively dividing and are a homogenous

and metabolically active population. To start a bacterial culture, inoculate a flask containing 20 ml of pre-warmed (37° C) liquid LB with 200 µl of the fresh overnight (a 1:100 dilution). Incubate the flask at 37ºC with vigorous shaking, checking the OD600 of the culture one hour after inoculation and every 30 minutes thereafter. The culture should reach the mid exponential growth phase in 3 to 4 hours (OD550 between 0.8 and 1).

Putative bacterial host strain can be isolated by inoculating a water sample taken on solid casein-peptone-starch medium (CPS medium) or LB medium. And incubated at 25 ad 37 ºC.


Appendix 2: Useful stuff

Material Safety Data Sheets (MSDS):http://msds.ehs.cornell.edu/msdssrch.asp

MIT Environmental Health and Safetyhttp://web.mit.edu/environment/ehs/about_ehs.html

National Center for Biotechnology Information (NCBI):http://www.ncbi.nlm.nih.gov

New England Biolabs:http://www.neb.com

Beckman rotor calculator and run-time converter for ultracentrifugation (java scripts):http://beckman.com/resourcecenter/labresources/centrifuges/rotorcalc.asphttp://www.beckman.com/resourcecenter/labresources/centrifuges/runtimecon.asp

Novagen, makers of the pET vectors:http://www.novagen.com

The Protein Databank:http://www.pdb.org

Current Protocols- online pdf files of just about any protocol! Accessed through MIT Libraries:http://www3.interscience.wiley.com/browse/?type=CURRENT_PROTOCOL

Bacteriophage Ecology Grouphttp://www.mansfield.ohio-state.edu/~sabedon/bgnws021.htm

Electron microscopy of viruseshttp://www.mwrn.com/microscopy/electron/virology.aspx

Phage Therapy- Stalin's forgotten Curewww.intralytix.com/sciencemag.htm

Extremely useful books and resources:Current Protocols in Molecular Biology (aka The Red Books) Ausubel et al. editorsGuide to Molecular Cloning, Sambrook et al. (aka Maniatis)The Merk Index (good for MW and other properties of compounds)Sigma-Aldrich catalog (also good for MWs)The New England Biolabs (the appendices have a wealth of useful info)CRC Handbook of Chemistry and PhysicsSalmonella and E. coli, Neidhardt ed. (aka The Bible)


http://www.intralytix.com/sciencemag.htm

http://www.mwrn.com/microscopy/electron/virology.aspx

http://www.mansfield.ohio-state.edu/~sabedon/bgnws021.htm

http://www.novagen.com/

http://beckman.com/resourcecenter/labresources/centrifuges/rotorcalc.asp

http://www.neb.com/

http://web.mit.edu/environment/ehs/about_ehs.html

http://msds.ehs.cornell.edu/msdssrch.asp

Appendix 3: Lists of materials

At each bench: Heat block with holes large enough to hold small glass test tubes Bunsen burner and lighter Scissors and Parafilm ( to seal of agar plates) Gloves Ice bucket Disposable BioRad columns and tubing One stand with clamp Microcentrifuge Sterile Pasteur pipettes (to pluck out plaques, to spool DNA) and small bulb Long sterile wood picks ( to inoculate LB with bacteria, to streak for single colonies) 20, 200 µl and 1000 µl pipetmans Bulb or automatic pipetter Sterile Tips of P20, P200 and P1000 Labeling tape (color coded) Marker (color coded) Kimwipes EtOH in squirt bottle Waste bins for solid waste ( tips), NO SHARPS 1.5 ml and 500 µl eppendorfs PCR tubes Sterile glass pipettes ( 5 ml and 10 ml) Plastic Bins for used glass pippettes One full Rack of small sterile glass test tubes (for titering and serila dilution) One rack of small sterile glass test tubes Empty tube racks One gel box for DNA agarose gel

At the back of the room: Common equipment Spectophotometer and Disposable cuvettes Film to take gel pictures, UV box and hand held camera Sterile 250 ml and 1 liter flasks Platfrom shake PCR machine

Chemical Hood: For EtBr waste (solide waste) Phenol/Chrolorform liquid waste Acrylamide solid waste

Reagents:100 ml sterile liquid LBSterile distilled waterTop agarLB platesPhage bufferPhage elution buffer


TAE for agarose gel10X DNA sample bufferSDS running buffer3X SDS sample bufferPEG 8000, NaClPhenol-chloroform isoamylalcohol (25:24:1)3 M Na Aceteate pH 5.2PCR mix

For 12 students ( 4 groups of 3)Microcentrifuges (at least 2)Vortexer ( 4)RegrigeratorFreezerPipetmans for 1 ml, 200 µl and 20 µl ( 12 of each)Sterile TipsBeakers (4 liters and 1 liters)FlasksErlenmeyers to grow bacterial culturesStands for column chromatography ( 4)Kimwipes (4)Sterile Glass pipettes in canistersAutomatic Pipeters and bulbsPlatform Shaker and roller drums to use in the 37ªC roomPCR machine ( 1 or 2)Power supplies and lidsBoxes and trays for agarose gel electrophoresisStands for column chromatographyHeat blocks for small glass tubes (melted top agar)Heat blocks for eppendorfsThermometersSmall sterile capped 13 mm glass tubes in racks ( for serial dilutions)Large sterile capped 18 mm glass tubes in racks( for overnight cultures)Microwave to melt top agar, agarose and LB-agar)Balance to weigh gram quantitiesParafilmScissorsTape, timers,Sterile ddwaterSterile long wood picks in beakersFunnelsGraduate cylindersIce bucketsMagnetic stir plates (4) and stir bars (4 large)


Appendix 4: Uranyl acetate solution for negative stain TEM

Uranyl acetate (UA) solution is used to stain the specimen spotted onto the copper grids. Generally, either a 1% or a 2% UA solution is used for staining1. The solution should be made fresh from solid uranyl acetate every two to three weeks and stored at room temperature, in the dark to avoid precipitation. Uranyl acetate crystallizes when exposed to light and also when left standing for long periods of time. Do not use the solution if you observe precipitation. UA solution also requires overnight agitation to fully dissolve.

For 10 mL of a 1% uranyl acetate solution:1. Mass out 0.1g solid uranyl acetate2. Weigh out solid UA in the weigh room and pour solid UA into a fresh 15 mL conical tube3. Fill tube containing the UA up to 10 mL mark with distilled water4. Label tube with name, date and contents5. Cover tube and cap with aluminum foil to keep out light6. Agitate tube gently overnight on rocker7. Store UA solution at room temperature with minimal light exposure


Appendix 5: Recipees

5 M NaCl: (Mw= 58.44) 292.2 g/l

1 M Tris HCl buffer (pH 7.5, etc..) 121.1 g/l of Tris base. Add HCl to pH

1 M MgCl2: 203 g/l

3 M NaAcetate pH 5.2: 24. 6 g in 100 ml

10X TAE:48.4 g Tris Base11.42 ml Acetic Acid20 ml 0.5 M EDTApH to 8.5

5X SDS Running Buffer:15.1 g Tris Base72 g Glyicne5 g SDS add water to 1 literFilter

(Resolution) lower gel buffer:187 g Tris base pH to 8.8 with HCl4 g SDSAdd water to 1 literFilter

Upper (stacking) gel buffer:60.5 g Tris Base pH 6.8 with HCl4 g SDSAdd water to 1 literFilter

3X SDS protein sample buffer18.8 ml Tris pH 6.86 g SDS15 ml b-mercaptoethanol30 ml glyceroladd water to 100 ml


10 X DNA sample buffer2 g of Ficol 4002 ml of 0.5M EDTA pH 8.00.1 g SDS0.25 % Bromophenol Blue0.25% Xylene CyanolAdd water to 10 ml

Phage Column wash buffer10 ml Tris HCl pH 7.5 (40 ml of 1 M stock)5 mM Mg Cl2 (20 ml of 1 M stock)25 mM NaCl (20 ml of 5 M stock)

Water to 4 liters

Phage column elution buffer10 mM Tris HCl pH 7.5 (10 ml of 1 M stock)5 mM MgCl2 (5 ml of 1 M stock)0.5 M NaCl (100 ml of 5 M stock)

Water to 1 liter


APPENDIX 6:Vector maps and info

pFLAG: a C-terminal epitope-tagging expression vector (under control of Ptac)


pET15b: an N-terminal his-tagging expression vector


pET21b: a C-terminal his-tagging expression vector


Appendix 7: Estimation of DNA concentration, yield, and purityDNA concentration can be estimated by adjusting the A260 measurement for turbidity (measured by absorbance at A320), multiplying by the dilution factor, and using the relationship that an A260 of 1.0 = 50µg/ml pure DNA.

Concentration (µg/ml) = (A260 reading – A320 reading) × dilution factor × 50µg/ml

Total yield is obtained by multiplying the DNA concentration by the final total purified sample volume.

DNA Yield (µg) = DNA Concentration × Total Sample Volume (ml)

A260/A280 ratio can be used as an estimate of DNA purity [with a number of important limitations (Wilfinger, Mackey and Chanczynski, 1997; Glasel, 1997; Manchester, 1995)]. An A260/A280 ratio between 1.7 and 2.0 is generally accepted as representative of a high-quality DNA sample. The ratio can be calculated after subtracting the non-nucleic acid absorbance at A320.

DNA Purity (A260/A280) = (A260 reading – A320 reading) ÷ (A280 reading – A320 reading)

Note that the spectrophotometer is most accurate when measurements are between 0.1–1.0.


Appendix 8: Oligonucleotides for PCR cloning

Gene/Primer Vector Ins Fwd RS Ins Rev RS Vect Fwd RS Vect Rev RS Primer SequenceE15_stermF pFLAG NdeI (4) NdeI (4) GACGATGCATATGCCAGCAGAACCAAAAGCE15_stermR pFLAG XmaI (4) XmaI (4) GTAGAGACCCGGGTCATTCTTCACCACCTGCCE15_ltermF pFLAG NdeI (4) NdeI (4) GACGATGCATATGACAGCCGCAGCCATATCGACGE15_ltermR pFLAG XmaI (4) XmaI (4) GTAGAGACCCGGGTTATTTCCACGGGTCATATTCTGTGACCE15_4F pFLAG NdeI (4) NdeI (4) GACGATGCATATGGCGGAAACCGAAAAAGAGCGCE15_4R pFLAG XmaI (4) XmaI (4) GTAGAGACCCGGGTCATTGCTGCGGTGCTCCTGCE15_15F pFLAG AseI (3) NdeI (2) GACGATGATTAATGCCAGTTGTACCTACAGTTAACGE15_15R pFLAG SalI (3) XhoI (2) GTAGAGAGTCGACTTATTCAACCCTCACGACAATAGCE15_16F pFLAG NdeI (4) NdeI (4) GACGATGCATATGGCTGATGTATTTTCACTGGCE15_16R pFLAG XmaI (4) XmaI (4) GTAGAGACCCGGGTTATGGATTCCTCAGGAAGCACGE15_17F pFLAG AseI (3) NdeI (2) GACGATGATTAATGAAACAGGCATGTGTTGAAGCE15_17R pFLAG SalI (3) XhoI (2) GTAGAGAGTCGACTCATTGTCCTACCGCCTTTCClacZF pFLAG AseI (3) NdeI (4) GACGATGATTAATGACCATGATTACGGATTCACTGGlacZR pFLAG BspEI (3) XmaI (4) GTAGAGATCCGGATTATTTTTGACACCAGACCSyn5_53F pET21b NdeI (4) NdeI (4) GACGATGCATATGGCTCTTATTGTTGATCCSyn5_53R pET21b SacI (4) SacI (4) TAAGCGGAGCTCGGGTTGGAGTAGTTACGCSyn5_54F pET21b NdeI (2) NdeI (2) GACGATGCATATGTCATTCAACATTAGTAATAACGSyn5_54R pET21b BamHI (2+S) BamHI (2+S) GTAGAGAGGATCCACGGGGTTGTTGTACTGTCGSyn5_58F pET21b NdeI (2) NdeI (2) GACGATGCATATGTCTGCTACTACTTCTAACGSyn5_58R pET21b BamHI (2+S) BamHI (2+S) GTAGAGAGGATCCGCGAGGGTGCGGACGATGAATGCAGCSyn9_41F pET15b XhoI (2) XhoI (2) GTCTAACTCGAGATTCTATTTGTATTGTCGGSyn9_41R pET15b BamHI (2+S) BamHI (2+S) GTAGAGAGGATCCTCAATTTTCATAATAGTCAGATCGSyn9_42F pET15b NdeI (2) NdeI (2) GACGATGCATATGAAAATTGAAAGTGTTGCSyn9_42R pET15b BamHI (2+S) BamHI (2+S) GTAGAGAGGATCCTTATTCAGCAGACCCATAGATTTCG

Caenorhabditis elegans —the worm“ is a model …web.mit.edu › pweigele › www › 7.391 ›...

Documents

Transcript of Caenorhabditis elegans —the worm“ is a model …web.mit.edu › pweigele › www › 7.391 ›...