C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein...
-
Upload
josephine-elliott -
Category
Documents
-
view
216 -
download
1
Transcript of C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein...
![Page 1: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/1.jpg)
COURSE OVERVIEW ANDGENOTYPES AND PHENOTYPES
HUMAN GENETICSGENETICS 202
Jon BernsteinDepartment of Pediatrics
September 29th, 2015
![Page 2: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/2.jpg)
Introductions
Course Director:◦ Jon Bernstein ([email protected])
Teaching Assistants:◦ Ryan Gallagher [email protected]◦ Kayla Hamilton [email protected]◦ Paige Qin [email protected]◦ Paula Trepman [email protected]◦ Grace Xiong [email protected]
![Page 3: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/3.jpg)
Welcome to Genetics 202, Human Genetics
Outline for lecture◦ The role of genetics in medicine◦ The opportunity before us◦ Course Introduction
Goals Course structure Requirements
◦ First thoughts on genetic testing◦ Introduction to the pedigree
![Page 4: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/4.jpg)
Learning how to help patients
Why do people go to see the doctor◦ Someone told them to go, not sure◦ Something is wrong - injured, feeling pain, feeling sick, tired,
disabled◦Worried, concerned
Why am I feeling the way I do? (Diagnosis) Want to know what will happen to them and their family (Prognosis) Can anything be done to help me? (Management)
![Page 5: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/5.jpg)
A clinical case
3 year old girl with whose paternal grandfather died suddenly at age 25 of a ruptured aorta. She has clinical signs of a connective tissue disorder. Her mother would like to know if she is at risk.
Genetic testing of 8 genes associated with a predisposition to aneurysm identifies a genetic change in the gene MYH11 ◦ c.2733G>A, p. Val911Val◦ Novel (never seen before)
![Page 6: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/6.jpg)
What is genetics
Genotype -> Phenotype
New Clinical Genetics 2eAndrew Read and Dian DonnaiISBN: 9781904842804© Scion Publishing Ltd, 2011
Eye color, hair color
Height
Blood Pressure
Diabetes
Aneurysm
![Page 7: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/7.jpg)
Course Goals - General
Genetic information is one of many types of information a physician may be called upon to:◦ Acquire, interpret, act upon and communicate
Other examples◦ Height, weight, blood counts, electrolytes, physical exam
findings, radiologic images
![Page 8: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/8.jpg)
The phenotype we are interested in is health
The many states of health and disease can be viewed as phenotypic manifestations of an individual’s genetic information and their environment.◦ In general, genetic information is not the sole
determinant of any specific phenotype or attribute of health
![Page 9: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/9.jpg)
http://homepages.strath.ac.uk/~dfs99109/BB310/MGlect5.html
Genetic and Environmental Contributions
Genetic Influence + Environmental Influence = Phenotype
![Page 10: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/10.jpg)
Classes of Genetic Variation
Structural Variant (SV) Small insertion or deletion (indel) Single nucleotide variant (SNV)
Nature Reviews Genetics 12, 363-376 (May 2011)
ACTGATCCGACTGATAACCCGACTGCG
ACTGATCCG
ACTGGTCCG
![Page 11: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/11.jpg)
The Environment
Everything else◦Altitude◦Weather◦Pollution◦Nutrition◦ Infectious disease◦Trauma
Stanford University
![Page 12: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/12.jpg)
Genetics from a Medical Education Perspective
Phenotype
Assessing the patient(Physical Exam, Lab Tests, Imaging, Pathology, Physiologic studies)
The medical historyGenetic testing and
family history
Learned in Pre-clinical curriculumClinical CurriculumResidency, Fellowship….
Learned in Pre-clinical curriculum (mostly fall quarter) and occasionally thereafter.
Learned in Pre-clinical curriculumClinical CurriculumResidency, Fellowship….
Genotype
Environment
![Page 13: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/13.jpg)
Survival of Genetic Knowledge Post USMLE Step 1
Frac
tion
of K
now
ledg
e Re
tain
ed
Time (Years)
0
50
100
Graph adapted from www.medscape.com, note that this graph does not depict actual data on retention of knowledge.
![Page 14: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/14.jpg)
Actual Survival of Genetic Knowlege
Genet Med. 2009 May;11(5):365-70.
The average third year medical student scored less than 50% on a test of essential genetics skills
![Page 15: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/15.jpg)
Acquiring, assessing, acting upon information
3 year old girl with whose paternal grandfather died suddenly at age 25 of a ruptured aorta. She has clinical signs of a connective tissue disorder. Her mother would like to know if she is at risk.
Genetic testing of 8 genes associated with a predisposition to aneurysm identifies a genetic change in the gene MYH11 ◦ c.2733G>A, p. Val911Val◦ Novel (never seen before)
![Page 16: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/16.jpg)
Course Goals - Knowledge
Principles of human genetics as they are applicable to medicine How genetic tests work
◦ Cytogenetics, Molecular Genetics
How genetic information is currently utilized in the practice of medicine in diverse specialties◦ Cardiovascular genetics, Reproductive genetics, Cancer genetics,
Biochemical genetics, Rare diseases Ethical issues surrounding genetic testing
![Page 17: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/17.jpg)
Course Goals - SkillsCreate and interpret pedigrees◦ Assess genetic risk
Use electronic resources to locate and interpret genetic information
Select genetic testsAssess the significance of genetic variantsEffectively communicate genetic informationNavigate ethical challenges related to genetic medicine
![Page 18: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/18.jpg)
Course Goals - Outcomes
Outcomes◦ Be prepared for USMLE step 1◦ Pass the course◦ Become an outstanding physician
![Page 19: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/19.jpg)
Course Structure
Short Videos, Lectures, Readings(Introduce knowledge and skills)
Problem Sets
Small Group Sessions
Patient Education WorkshopPatient Visit
Mid-Quarter and End of Quarter Review
(Practice skills, apply knowledge)Examples from:
CardiologyOncologyNeurologyObstetricsMedical GeneticsPsychiatry
![Page 20: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/20.jpg)
Resources - Syllabus◦ Content summary / Course reader
Cytogenetics Single gene disorders and molecular genetics Cancer Genetics Biochemical Genetics Pharmacogenetics Next-generation sequencing Topics in quantitative genetics Multifactorial inheritance Non-Mendelian Inheritance including Epigenetics Clinical medical genetics Reproductive genetics The microbiome Linkage and association studies Electronic resources for clinical genetics Cell and gene therapy Ethical issues in medical genetics
Syllabus (Available on Coursework as PDF)◦ Course schedule and
policies◦ Session pages
Session goals, key words and learning objectives
Required and recommended readings
![Page 21: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/21.jpg)
Resources - Navigating the syllabus
![Page 22: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/22.jpg)
Resources - Coursework
Syllabus◦ Readings
Short videosTA Review MaterialsSupplementary Materials
![Page 23: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/23.jpg)
Resources - Textbook
Textbook◦New Clinical
Genetics 3rd Edition, Donnai and Read, 2015. Optional
![Page 24: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/24.jpg)
Course Requirements Lectures
◦ Fundamentals, current applications, emerging applications 10 short videos on methods, pedigree interpretation and chromosome anomalies
3 Problem Sets (15%)◦ 5% towards final grade for each problem set; score >70% for credit
Additional practice questions will be available on Coursework
5 Small group sessions (20%)◦ Credit towards final grade for participation
Final Exam (65%)◦ Must score 70% or higher to pass
![Page 25: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/25.jpg)
Problem Sets
3 problem sets◦ Covering lecture material ◦ Preparation for small group sessions◦ Available through Coursework
1) Problem Set #1, Available 10/6, due 10/14 at 11:59pm. 2) Problem Set #2, Available 10/15, due 11/2 at 11:59pm. 3) Problem Set #3, Available 11/3, due 11/16 at 11:59pm.
![Page 26: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/26.jpg)
Small group sessions
Small group sessions◦ Team based clinical problem solving
Cytogenetics Single gene disorders and molecular genetics (with short feature) Cancer genetics (with short feature) Biochemical genetics (with short feature)
◦ Informatics resources for clinical genetics◦ Workshop on patient education◦ Ethical issues in genetic and genomic testing
![Page 27: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/27.jpg)
Small Group Sessions Class divided into five rooms
◦ LK203/204, LK205/206, LK208, LK209, LK304/305 Students in each room are assigned to a group
◦ A, B, C, D See syllabus for room and group assignments
**Alternate time for non-MD, non-Master’s of Medicine Students for case based small group sessions. ◦ 8:30-9:20a in LK203/204◦ If you are a non-MD, non-Master’s of Medicine
student and have a conflict with the alternate small group session time, please contact the course director.
![Page 28: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/28.jpg)
Small Group Sessions
For the first small group session on 10/1 it will be helpful to have viewed the cytogenetics lecture and read the corresponding section in the reader
For the 10/6 session on electronic resources: Can bring your iPad/Tablet or laptop
The preceding problem set will be preparatory for the remaining case based sessions.
![Page 29: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/29.jpg)
Final Exam
December 9th 9:30a-12:30pm◦ LK120 and LK130
Electronic exam on Coursework◦ Open book and open note
Questions are similar in content to problem sets and small group session cases
Material drawn from lectures, readings, problem sets and small group sessions
![Page 30: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/30.jpg)
Final Exam
Open access to resources, so will test ◦Understanding of key concepts ◦ Ability to apply knowledge to clinical problems ◦ Ability to utilize electronic resources
![Page 31: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/31.jpg)
Office Hours Upcoming dates and adjustments to schedule will be posted on Coursework
homepage
TA Office Hours:◦ To be announced◦ See Coursework for updates
Course Director Office Hours:◦ Wednesday at 2:30p in the LKSC Café beginning on October 7th.
(Will start at 2pm on October 14th only)◦ See Coursework for updates
![Page 32: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/32.jpg)
Course evaluation
We want to know how the course is going and how it can be improved.
End of quarter evaluationsTAs and Course Director welcome comments
![Page 33: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/33.jpg)
Future Teaching Assistants
If you are interested in being a TA next year or have questions about this opportunity please let us know during the quarter.
![Page 34: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/34.jpg)
The Human Genome
46 Chromosomes2 copies of 20-25,000
genes2 x 3 billion base pairs
Athena Cherry, Stanford Cytogenetics Laboratory
![Page 35: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/35.jpg)
The Clinical Genome
New Clinical Genetics 2eAndrew Read and Dian DonnaiISBN: 9781904842804© Scion Publishing Ltd, 2011
![Page 36: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/36.jpg)
What you see in the genome depends on where, how and sometimes when you look
The results of genetic testing have different meanings in different contexts◦ Type of tissue tested◦ Method used to examine genetic material
Genetic tests, like other medical tests are imperfect◦ Must be ordered appropriately and
interpreted skillfully
![Page 37: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/37.jpg)
Clinical case
18 year old young woman with a long, complicated medical history.◦ At age 4 began to tire easily and was found to have anemia◦ Progressive decrease in bone marrow function
Loss of RBC, WBC and Platelets
◦ Required Stem Cell Transplantation
![Page 38: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/38.jpg)
A clinical case (cont.)
18 year old young woman with a long, complicated medical history.◦At age 6 was noted to be shorter than her
classmates Normal growth hormone, thyroid levels Eats a healthy diet, good nutrition
![Page 39: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/39.jpg)
A clinical case (cont.)
18 year old young woman with a long, complicated medical history.◦At age 13 noted to have blueness to lips and changes
to the finger nails associated with chronic hypoxemia.◦Blood oxygen saturation 81%; Requires oxygen therapy
![Page 40: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/40.jpg)
A clinical case (cont.)
http://www.genereviews.org
18 year old young woman with a long, complicated medical history.◦ At age 14 is seen by a
dermatologist Nails show evidence of ridging White streaks in a reticulated
pattern on her bilateral buccal mucosa
Unusual rash on body
![Page 41: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/41.jpg)
http://www.wheelessonline.com
A clinical case (cont.)
18 year old young woman with long, complicated medical history.◦ At age 15 is seen by an
orthopedist Bilateral, severe avascular
necrosis of the hips
![Page 42: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/42.jpg)
You can or will soon be able to diagnose this condition
Relevant biology covered in Molecular FoundationsRelated informatics tools will be covered in first small
group session
You can or soon will be able to do what many providers did not – consider a genetic diagnosis then order and interpret appropriate genetic testing.
![Page 43: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/43.jpg)
Framing the problem – Genotype and Phenotype
Structural Variant (SV)
Single nucleotide variant (SNV)
Nature Reviews Genetics 12, 363-376 (May 2011)
ACTGATCCGACTGATAACCCGACTGCG
ACTGATCCG
ACTGGTCCG
Small insertion or deletion (indel)Seizures
Autism
Weight
HeightAnemia
Blood PressureCancer Deafness
Blindness
Eye color
![Page 44: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/44.jpg)
Course Learning Strategy
Focus on basic principles with clinical applications◦ Learn how to apply knowledge, develop skills◦Not practical/possible to learn all of genetics fact by fact
Acquire knowledge in a clinical context◦ Diverse clinical examples◦ Practice interpreting data, solving problems
![Page 45: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/45.jpg)
Clinical Case – The Value of the Pedigree
An eight year old boy, actively involved in team sports, tends to walk on his toes.
Does anyone else in the family walk differently?◦“Yes, we have some relatives who walk on their toes.”
“A cousin and a half brother of his.”
![Page 46: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/46.jpg)
Family Pedigree
= toe-walking
![Page 47: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/47.jpg)
Standard Pedigree Nomenclature
http://www.cancer.gov/cancertopics/pdq/genetics/risk-assessment-and-counseling/HealthProfessional/page3.
![Page 48: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/48.jpg)
Bro- ther
Niece
Sister
MotherFather
Grand- father
Grand- mother
Uncle
First cousin
Aunt
First cousin
Grand- father
Grand- mother
1 1
1 1
33
Nephew
Patient
Son
1
2
2 2 2 2
2
First, Second and Third Degree Relatives
Daughter
12 2
![Page 49: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/49.jpg)
Family Pedigree
= toe-walking
Dystrophin Deletion
Dystrophin Deletion
Dystrophin Deletion
![Page 50: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/50.jpg)
Summary of Key Points
Health characteristics result from a combination of genetic and environmental factors◦We need to be able to accurately describe genotype,
phenotype and establish associations between the twoIn this course we will apply knowledge of and skills
related to human genetics to clinical problemsThis is a moment of opportunity
![Page 51: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/51.jpg)
Summary of Key Points
Different types of genetics tests or ways of looking at the genome have different strengths and limitations
A pedigree is an efficient and effective way to record and communicate a family genetic health history
![Page 52: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/52.jpg)
Review Question
Which of the following constitute a form of genetic variation?◦A) Extra chromosome◦B) Missing chromosome◦C) Extra base pair◦D) Missing base pair◦E) Extra copy of a gene◦ F) Missing copy of a gene
![Page 53: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/53.jpg)
Review Question
Which of the following are phenotypes?◦A) Weight◦B) Number of chromosomes a patient has◦C) Asthma◦D) deltaF508 mutation in CFTR
![Page 54: C OURSE O VERVIEW AND G ENOTYPES AND P HENOTYPES H UMAN G ENETICS G ENETICS 202 Jon Bernstein Department of Pediatrics September 29 th, 2015.](https://reader035.fdocuments.us/reader035/viewer/2022070412/5697bf841a28abf838c870a1/html5/thumbnails/54.jpg)
Question for reflection
How can one prove that a particular genetic variant is related to a particular phenotype?