MOLECULAR AND CELLULAR BIOLOGY, Aug. 2005, p. 6521–6532 Vol. 25, No. 150270-7306/05/$08.00�0 doi:10.1128/MCB.25.15.6521–6532.2005Copyright © 2005, American Society for Microbiology. All Rights Reserved.

A Novel Splice Variant of Interleukin-1 Receptor (IL-1R)-AssociatedKinase 1 Plays a Negative Regulatory Role in Toll/IL-1R-Induced

Inflammatory Signaling†Navin Rao, Steven Nguyen, Karen Ngo, and Wai-Ping Fung-Leung*

Johnson and Johnson Pharmaceutical Research and Development, San Diego, California

Received 1 December 2004/Returned for modification 3 February 2005/Accepted 6 May 2005

The interleukin-1 (IL-1) receptor-associated kinase 1 (IRAK1) is a member of the IRAK kinase family thatplays a pivotal role in the Toll/IL-1 receptor (TIR) family signaling cascade. We have identified a novel splicevariant, IRAK1c, which lacks a region encoded by exon 11 of the IRAK1 gene. IRAK1c expression wasconfirmed by both RNA and protein detection. Although both IRAK1 and IRAK1c are expressed in most tissuestested, IRAK1c is the predominant form of IRAK1 expressed in the brain. Unlike IRAK1, IRAK1c lacks kinaseactivity and cannot be phosphorylated by IRAK4. However, IRAK1c retains the ability to strongly interact withIRAK2, MyD88, Tollip, and TRAF6. Overexpression of IRAK1c suppressed NF-�B activation and blockedIL-1�-induced IL-6 as well as lipopolysaccharide- and CpG-induced tumor necrosis factor alpha production inmultiple cellular systems. Mechanistically, we provide evidence that IRAK1c functions as a dominant negativeby failing to be phosphorylated by IRAK4, thus remaining associated with Tollip and blocking NF-�Bactivation. The presence of a regulated, alternative splice variant of IRAK1 that functions as a kinase-dead,dominant-negative protein adds further complexity to the variety of mechanisms that regulate TIR signalingand the subsequent inflammatory response.

The Toll/interleukin-1 (IL-1) receptor (TIR) family, consist-ing of the Toll receptors, the IL-1 receptor and the IL-18receptor, plays a crucial role in innate immunity (1). The TIRfamily of proteins is defined by the presence of an intracellularTIR domain that is required for signal transduction upon re-ceptor activation. After ligand activation, TIR family membersform multimeric receptor complexes and via cytoplasmic TIRdomains recruit adapter proteins such as MyD88, TIRAP (TIRdomain-containing adapter protein), and TRIF (TIR domain-containing adapter inducing � interferon) (24). This results inthe sequential activation of a conserved signaling module thatincludes the IL-1 receptor-associated kinases (IRAKs) andTRAF6, followed by activation of nuclear factor-�B (NF-�B),p38 kinase, and c-Jun N-terminal kinase (JNK), eventuallyleading to gene transcription and induction of an inflammatoryresponse (1).

The IRAK family of serine-threonine kinases consists offour members: IRAK1, IRAK2, IRAKM, and IRAK4 (1, 6).Despite significant structural homology between family mem-bers, they also have distinct functional roles in signal transduc-tion. Both IRAK1 and IRAK4 exhibit kinase activity, whileIRAKM and IRAK2 lack this activity (6). IRAKM functions asan induced negative regulator (13), and IRAK2 appears to bepartially redundant for IRAK1 (21). Both human and mouseIRAK4 deficiency results in nonresponsiveness to a broadpanel of TIR family ligands (19, 22). Although the importanceof kinase activity remains controversial, IRAK1 deficiency re-

sults in a partial defect in TIR activation, with substantialdecreases in IL-1, IL-18, and lipopolysaccharide (LPS) respon-siveness (11, 12).

Upon ligand activation of TIR family members, IRAK4 andIRAK1 are recruited to the receptor complex (1). At the re-ceptor, IRAK1 associates with Tollip, MyD88, and TRAF6,and phosphorylation by IRAK4 triggers IRAK1 autophosphor-ylation (10, 15, 17). IRAK1 hyperphosphorylation results indisassociation from Tollip and release from the receptor-MyD88 complex (2, 10). This leads to the formation of a newprotein complex consisting of hyperphosphorylated IRAK1and TRAF6, a prerequisite for TRAF6-mediated NF-�B acti-vation and induction of an inflammatory response (14).

TIR signal transduction is regulated by multiple mechanismsto prevent tissue damage that arises from sustained inflamma-tion. IRAK1 is one of the most receptor-proximal kinases andthus is regulated by multiple mechanisms. IRAKM is an in-duced regulator that is proposed to block IRAK4 activationand subsequent IRAK1 phosphorylation (13). IRAK1 hyper-phosphorylation results in a decrease in protein stability, pro-viding a potential mechanism to regulate IRAK1 activity (27).Alternative splicing is another mechanism by which a singlegene can generate multiple, functionally distinct protein prod-ucts. A splice variant of a key adapter protein in the TIRpathway, MyD88, can regulate signaling by serving as a dom-inant negative (8). Furthermore, several IRAK1 splice variantshave been described in both humans and mice. IRAK1b, asplice variant found in humans, lacks 90 bp arising from the useof an alternative 5� acceptor splice site in exon 12 of the gene(9). IRAK1b lacks kinase activity and exhibits a prolongedhalf-life (9). IRAK1s, a splice variant found in the mouse, isgenerated by a novel splice acceptor site in exon 12 of themurine gene resulting in a frameshift and generation of a

* Corresponding author. Mailing address: Johnson and JohnsonPharmaceutical Research and Development, 3210 Merryfield Row,San Diego, CA 92121. Phone: (858) 450-2016. Fax: (858) 450-2081.E-mail: wleung@prdus.jnj.com.

† Supplemental material for this article may be found at http://mcb.asm.org/.

6521

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

premature stop codon (28). Although IRAK1s is kinase dead,it constitutively activated the NF�B and JNK pathway.

Here, we report the identification of a novel IRAK1 splicevariant, IRAK1c, which lacks a region encoded by exon 11 ofthe gene. IRAK1c can be detected in different tissues and celllines and is the exclusive form of IRAK1 expressed in brain.IRAK1c lacks kinase activity and potently suppresses activa-tion by both IL-1� and Toll receptor ligands. IRAK1c can berecruited to the IL-1 receptor upon activation, but IRAK1c isnot phosphorylated by IRAK4 and thus cannot disassociatefrom the adapter proteins MyD88 and Tollip, resulting in ablock in NF-�B activation and cytokine production. Further-more, unlike IRAK1 or the point mutant IRAK1-KD (whereKD indicates a kinase-dead point mutation), IRAK1c is unableto reconstitute the IL-1�-driven IL-6 production in IRAK1�/�

fibroblasts. The identification of an inducible, dominant-nega-tive splice variant of IRAK1 highlights a novel mechanism bywhich TIR receptor signaling and the inflammatory responsecan be regulated.

MATERIALS AND METHODS

Biological reagents and cell culture. Human and murine IL-1�, granulocyte-macrophage colony-stimulating factor and IL-4 were obtained from R & DSystems, and LPS was from Sigma. Human embryonic kidney cells (293), humanmonocytes (THP-1), and human osteosarcoma cells (G292) were obtained fromthe American Type Culture Collection. IRAK1�/� and wild-type murine embry-onic fibroblasts were maintained as previously described (12). 293 cells weremaintained in Dulbecco’s modified Eagle’s medium containing 10% fetal calfserum, 20 mM HEPES, 1 mM sodium pyruvate, 1 mM nonessential amino acids,100 U of penicillin per ml, and 100 U of streptomycin per ml (HyClone). THP-1cells were maintained in endotoxin-free RPMI (Sigma) medium containing 10%endotoxin-free fetal calf serum (Invitrogen) and endotoxin-free penicillin-strep-tomycin (Sigma). G292 cells were maintained in McCoy’s medium containing10% fetal calf serum and penicillin-streptomycin (HyClone). Monocytes werepurified to 99% purity from peripheral human blood using CD14 microbeads andseparated on an Auto Macs (Miltenyi Biotech) instrument. Monocyte-deriveddendritic cells were prepared as previously described (23) by culturing in thepresence of granulocyte-macrophage colony-stimulating factor and IL-4 in en-dotoxin-free medium and reagents.

The following antibodies were used: anti-FLAG tag and mouse monoclonalanti-actin (Sigma); anti-myc tag (Covance); anti-Tollip mouse monoclonal(Alexis); rabbit polyclonal anti-IRAK1, mouse monoclonal anti-TRAF6, rabbitpolyclonal anti-IL-1R, rabbit polyclonal anti-I�B�, and rabbit polyclonal anti-p-cJUN (Santa Cruz Biotechnology); rabbit polyclonal IRAK4 (Upstate Biotech-nology); and rabbit polyclonal anti-IRAK1 as previously described (12).

RNA and RT-PCR. Human tissue RNA and cDNA were from BD Biosciences.RNA from tissue culture cells was extracted using RNeasy (QIAGEN) accordingto the manufacturer’s instructions including a DNase digestion (QIAGEN).cDNA was prepared using Superscript II (Invitrogen). Reverse transcription-PCR (RT-PCR) primers were designed to specifically recognize the IRAK1splice variant by bridging exons 10 and 12. The specific forward primers forIRAK1c (GACCAAGTATCTGGTGTACGAGAG) and IRAK1 (GACCAAGTATCTGAAAGACCTGGTG) were used with a common reverse primer (TCAGCTCTGAAATTCATCACTTTC) from a 26-cycle RT-PCR. Control ampli-fication primers for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) werefrom Promega. PCR products were separated on agarose gels and visualizedafter ethidium bromide staining.

Expression constructs and stable transfection. cDNAs were amplified using aGC-Rich PCRx system (Invitrogen). Amplification primers for IRAK1, IRAK2,IRAK4, TRAF6, MyD88, and Tollip were derived from the GenBank database.Myc, hemagglutinin (HA), and FLAG tags were introduced by PCR, and codingsequences were cloned into pCDNA3.1 or pFASTBac (Invitrogen). Purifiedrecombinant HIS-IRAK4 for in vitro kinase assays was made using insect Sf9cells and purified using affinity chromatography. Kinase-inactive IRAK1 andIRAK1c clones were generated by PCR containing the point mutation K239S.Glutathione transferase (GST)-IRAK1 exon 11 was generated by PCR subclon-ing into pGEX4T3, and GST protein was purified using glutathione beads (Am-ersham) after a 6-h induction with IPTG (isopropyl-�-D-thiogalactopyranoside).

For retroviral vectors, coding sequences were cloned into MscvPuro (BD Bio-sciences), and retrovirus was produced in the provided 293 packaging cell line.Stable transfectants of G292, THP-1, and IRAK1�/� fibroblasts cells were de-rived by continuous selection in puromycin (Sigma), with tagged protein expres-sion verified by immunoblotting and intracellular staining.

Immunoprecipitation and immunoblotting. Cells were untreated or treatedwith IL-1� and either lysed in a Triton-containing lysis buffer (0.5% TritonX-100, 50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM NaF, 1 mM Na3VO4, 20 �Maprotinin, 1 mM phenylmethylsulfonyl fluoride [PMSF]) or a sodium dodecylsulfate (SDS)-containing RIPA lysis buffer (1% TX-100, 0.5% deoxycholate,0.1% SDS, 50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM NaF, 1 mM Na3VO4, 20�M aprotinin, 1 mM PMSF). Lysates were clarified by centrifugation at 14,000� g for 10 min at 4°C. For immunoprecipitations, cell extracts were incubatedwith 5 �g of antibody for 2 h, followed by a 1-h incubation with 20 �l of proteinG-Sepharose beads (Amersham Biosciences). After incubation, the beads werewashed four times with lysis buffer, separated by SDS-polyacrylamide gel elec-trophoresis (SDS-PAGE), transferred to Immobilon-P membranes (Millipore),and analyzed by immunoblotting as previously described (20).

In vitro kinase assay. Cell lysis and immunoprecipitations were done in kinaselysis buffer (50 mM HEPES, pH 7.9, 20 mM MgCl2, 1% TX-100, 1 mM NaF, 1mM Na3VO4, 20 mM gylcerol-2-phosphate, 5 mM p-nitrophenyl-phosphate, 1mM dithiothreitol, 1 mM PMSF). Immunoprecipitates were incubated in kinasebuffer (20 mM Tris, pH 7.5, 20 mM MgCl2, 1 mM EDTA, 1 mM Na3VO4, 20 mMgylcerol-2-phosphate, 20 mM p-nitrophenyl-phosphate, 25 nM IRAK4, 1 mMdithiothreitol, 2 �g of maltose binding protein [MBP] substrate, 20 �M ATP, and10 �Ci of [32-P]ATP) for 20 min at 32°C. For GST substrate reactions, 3 �g ofeach GST substrate was included. Reactions were stopped by the addition of 3�SDS-PAGE sample buffer. Samples were subjected to SDS-PAGE and trans-ferred to Immobilon-P membranes, and the proteins were visualized and quan-tified by autoradiography using a Typhoon 8600 Variable Mode Imager (Amer-sham Biosciences).

Reporter gene assays and cytokine ELISAs. For the NF-�B reporter assay, 293or G292 cells were seeded in 24-well plates and transfected with the indicatedreporter and expression plasmid using Fugene-6 (Roche). pHTS-NF-�B-lucif-erase plasmid was used to measure NF-�B-dependent gene activation (BiomyxTechnology). The cells were lysed in Glo lysis buffer and analyzed using theBright Glo Luciferase assay system (Promega). For detection of secreted tumornecrosis factor alpha (TNF-�) and IL-6 protein, THP-1 cells (1 � 104 cells/well),G292 cells (3 � 104 cells/well) or murine fibroblasts (1 � 104 cells/well) wereincubated overnight in 96-well plates and stimulated for 4 h with LPS or for 6 hwith IL-1� as indicated. For TLR9 stimulations, cells were stimulated with 1 �MGpC control (gggggACGATCGTCggggg) or the CpG 2216 stimulatory oligode-oxynucleotide (gggggAGCATGCTggggg) synthesized by GenBase (uppercaseand lowercase letters indicate phosphodiester-linked and phosphorothioate-linked nucleotides, respectively). Supernatants were collected and analyzed forTNF-� or IL-6 using enzyme-linked immunosorbent assay (ELISA) kits (R&DSystems).

RESULTS

IRAK1c is widely expressed and the exclusive form ofIRAK1 in the brain. In the course of studying the expression ofIRAK1 in human cell lines and tissues, we cloned a novelIRAK1 splice variant from a human spleen cDNA library.Sequence analyses indicated that this splice variant lacked all237 bp comprising exon 11 of the IRAK1 gene (Fig. 1A; seealso Fig. S1 in the supplemental material). Unlike two otherdescribed IRAK1 splice variants, IRAK1b and IRAK1s (9, 28),the IRAK1c splice variant does not result in a frameshift orpremature termination of the translated protein (Fig. 1A).IRAK1c was also cloned, and the sequence was verified fromhuman peripheral blood mononuclear cells as well as fromJurkat, THP-1, and HeLa cell cDNA libraries (data notshown). The existence of IRAK1c as a bona fide transcript wassupported by the presence of IRAK1c sequences among thereported human IRAK1 expressed sequence tag (EST) clones.Two of these EST clones (BG1719188 and BG423016) wereobtained, and the sequence was verified to be IRAK1c and not

6522 RAO ET AL. MOL. CELL. BIOL.

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

IRAK1, IRAK1b, or IRAK1s (data not shown). Furthermore,a full-length mRNA sequence (BC014963) corresponding toIRAK1c was also identified in the NCBI database.

To further analyze the expression profile of IRAK1c, wedesigned PCR primers spanning the junctions of exons 10 and11 that would recognize wild-type IRAK1 cDNA and primersthat span the junctions of exons 10 and 12 that would specifi-cally amplify IRAK1c cDNA. The specificity of these PCRprimers was validated using cDNA prepared from 293 cellstransfected with IRAK1 or IRAK1c expression vectors (datanot shown). Using these primers, we further characterized the

expression profile of IRAK1c in a variety of human tissues andcell lines (Fig. 1B). IRAK1c was widely expressed in bothlymphoid and nonlymphoid tissues and cell lines, includinglymph node, spleen, heart, brain, and liver. Interestingly,IRAK1c was the predominant form of IRAK1 detected in thebrain sample (Fig. 1B, lane 6).

Transfection of 293 cells with expression vectors encodingmyc-tagged IRAK1c followed by immunoprecipitation with an-ti-IRAK1 and anti-myc tag antibodies revealed that the splicevariant was expressed as a protein of approximately 68 kDa(Fig. 1C, top panel). To confirm the expression of IRAK1c atthe protein level, we analyzed lysates obtained from two inde-pendent human brain samples. When compared to 293 cellstransfected with IRAK1c, lysate prepared from whole brainexhibited strong expression of IRAK1c with minute or unde-tectable IRAK1 expression (Fig. 1C, bottom panel). In con-trast, the monocytic human cell line THP-1 predominantlyexpressed IRAK1 with minimal IRAK1c detected. Taken to-gether, these results indicate that IRAK1c is an alternativelyspliced variant of IRAK1 that is broadly expressed in manytissues and is the major form of IRAK1 expressed in the brain.

IRAK1c lacks kinase activity and cannot be phosphorylatedby IRAK4. Exon 11 of the IRAK1 gene (Fig. 1A), which ismissing in IRAK1c, encodes a 79-amino-acid region corre-sponding to the C terminus of the kinase domain (see Fig. S1in the supplemental material). To directly determine whetherIRAK1c retained kinase activity, 293 cells were transfectedwith expression vectors encoding various myc-tagged IRAK1proteins including a K239S kinase-dead IRAK1 point mutant(IRAK1-KD), IRAK1c, a K239S kinase-dead IRAK1c pointmutant (IRAK1c-KD), or the empty vector. An in vitro kinaseassay was performed with the anti-myc immunoprecipitatesfrom transfected cell lysates using myelin basic protein as asubstrate. IRAK1 overexpressed in 293 cells was constitutivelyactive, as seen by autophosphorylation as well as phosphory-lation of the MBP substrate (Fig. 2A, lane 1). In contrast,IRAK1c exhibited no kinase activity, as did the two kinase-dead point mutants IRAK1-KD and IRAK1c-KD. These dataindicated that the region encoded by exon 11 of the IRAK1gene, which is absent in IRAK1c, is required for kinase activity.

Upon TIR activation, IRAK1 becomes phosphorylated onmultiple residues, resulting in a pronounced change in molec-ular weight as visualized by immunoblot analyses (14). IRAK4is required to initiate the inflammatory response upon TIRactivation and has been shown to phosphorylate and activateIRAK1 (15, 22). This leads to IRAK1 autophosphorylationresulting in hyperphosphorylated IRAK1 (14).

Based upon recent reports of the sequential activation ofIRAK1 (14), we wanted to test whether IRAK4 could mediatethe initial phosphorylation of IRAK1c. To test this, we per-formed in vitro kinase assays using immunoprecipitates fromcells transfected with IRAK1, IRAK1-KD, IRAK1c, andIRAK1c-KD expression vectors that were incubated in thepresence of recombinant purified IRAK4 (Fig. 2B). Whenthese immunoprecipitates were incubated with recombinantIRAK4, we were able to detect a phosphorylated band thatcorresponded to IRAK1-KD (Fig. 2B, lane 2). Interestingly,neither IRAK1c nor IRAK1c-KD showed any phosphorylationin the presence of IRAK4 (Fig. 2B, lane 3 and 4). Based uponthese data, we hypothesized that the IRAK1c splice variant is

FIG. 1. Alternative splicing of IRAK1 and expression of the variantIRAK1c. (A) IRAK1c generated from alternative splicing of theIRAK1 gene and the encoded protein lacking all 237 bp (amino acids435 to 514) of exon 11 (filled box) in the C-terminal region of thekinase domain are illustrated. (B) IRAK1 and IRAK1c were amplifiedby RT-PCR from the indicated human tissues and cell lines as de-scribed in Materials and Methods. GAPDH amplification was used asa control. (C) 293 cells were transfected with 0.25 �g of myc-IRAK1cor vector control, and lysates were prepared 48 h posttransfection. Atotal of 100 �g of lysate was immunoprecipitated with anti-myc andanti-IRAK1 antibodies and immunoblotted with an anti-IRAK1 anti-body (top panel). Endogenous expression of IRAK1c protein wasdetected in two independent human brain lysate samples, THP-1 celllysate as well as IRAK1c-transfected 293 cell lysate, by anti-IRAK1immunoblot analyses of total protein extracts (bottom panel).

VOL. 25, 2005 IRAK1c BLOCKS IL-1R-INDUCED INFLAMMATION 6523

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

not phosphorylated by IRAK4 and thus is unable to becomefully activated.

It remains possible that this finding could be due to theinability of IRAK1c to associate with IRAK4. To address thishypothesis, we tested the ability of IRAK4 to associate with thevarious IRAK1 proteins in this assay. A second set of anti-mycimmunoprecipitates, which were subjected to an in vitro kinaseassay in the presence of recombinant IRAK4, were washedwith lysis buffer and immunoblotted with an anit-IRAK4 anti-body. When the IRAK4 associated with IRAK1 (Fig. 2C, toppanel) was quantified and corrected for IRAK1 protein expres-sion (Fig. 2C, middle panel), we found that both IRAK1 andIRAK1-KD had similar levels of association with IRAK4 (Fig.

2C, bottom panel). However, both IRAK1c and IRAK1c-KDshowed a 45% decrease in association with IRAK4. Since ac-tivated IRAK1 is targeted for degradation (27), IRAK1 ex-pressed in 293 cells, which is kinase active, exhibits a pro-nounced gel shift and lower protein levels when compared toIRAK1-KD, IRAK1c, and IRAK1c-KD (Fig. 2C, middlepanel).

Although the known IRAK4 phosphorylation sites inIRAK1 are not contained in the 79-amino-acid stretch com-prising the missing exon 11 in IRAK1c (14), we wanted to testthis experimentally. We generated a GST fusion protein con-sisting of exon 11 (GST-ex11) and subjected it to an in vitrokinase assay with recombinant human IRAK4. Although

FIG. 2. IRAK1c is kinase dead and cannot be phosphorylated by IRAK4. (A) The indicated myc-IRAK1 constructs were transfected into 293cells, and proteins were immunoprecipitated with anti-myc antibody from 400 �g of lysate and subjected to an in vitro kinase assay as described.The upper panel shows IRAK1 autophosphorylation (pIRAK1), and the lower panel depicts phosphorylation of an MBP substrate. (B) Two setsof anti-myc immunoprecipitates from the transfected cell lysates shown in panel A were subjected to an in vitro kinase assay in the presence ofrecombinant IRAK4. One set of immunoprecipitates was analyzed by autoradiography. (C) The second set was washed with lysis buffer andimmunoblotted with an anti-IRAK4 antibody (top panel). Expression of transfected IRAK-1 protein was verified by anti-myc immunoblotting ofwhole-cell lysate (middle panel). The associated IRAK4 (top) was quantified by densitometry, and association was corrected for IRAK1 proteinexpression (middle panel). (D) A GST fusion protein (GST-ex11) consisting of the missing exon 11 of IRAK1c was used as a substrate in an invitro kinase assay using recombinant IRAK4 kinase. WT, wild type; KD, IRAK1-KD; c, IRAK1c; c-KD, IRAK1c-KD.

6524 RAO ET AL. MOL. CELL. BIOL.

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

IRAK4 was able to mediate robust phosphorylation of a MBPsubstrate, no phosphorylation was detected with a GST controlprotein or GST-ex11 (Fig. 2D). These data suggested that themissing exon 11 of IRAK1c did not contain a previously un-described IRAK4 phosphorylation site.

IRAK1c strongly associates with TIR family signaling pro-teins. Previous studies have demonstrated that IRAK1 formshomodimers as well as heterodimers with other IRAK familymembers (25). To test whether IRAK1c could form a ho-modimer with IRAK1 or a heterodimer with IRAK2, 293 cellswere transfected with HA-tagged IRAK1c and myc-taggedIRAK1 or IRAK2. Immunoblot analyses of coimmunoprecipi-tated proteins revealed that IRAK1c formed homodimers withIRAK1 as well as heterodimers with IRAK2 (Fig. 3A).

Next, we wanted to examine if there were any biochemicaldifferences in the associations with other signaling proteins inthis pathway. In TIR signaling, IRAK1 is preassociated withTollip in the cytosol (2). Activation of TIRs recruits theIRAK1-Tollip complex to the receptor, resulting in associationwith the MyD88 adapter protein. IRAK1 also associates withTRAF6, a key molecule in this pathway that activates JNK andNF-�B (4). Myc-tagged IRAK1 proteins were expressed aloneor with FLAG-tagged MyD88, Tollip, and TRAF6 in 293 cells.FLAG-tagged proteins were immunoprecipitated, separatedby SDS-PAGE, and immunoblotted with anti-myc antibody todetect coimmunoprecipitated IRAK1 proteins (Fig. 3B). Aspreviously reported (15), IRAK1 expressed in 293 cells is au-tophosphorylated and rapidly degraded (Fig. 3B, third panel).Due to this lower level of IRAK1 protein expression, a shortexposure indicated that kinase-dead IRAK1 associatedstrongly with the adapter proteins MyD88 and Tollip, as well asTRAF6, compared to wild-type IRAK1 (Fig. 3B, top panel).However, a longer exposure revealed that IRAK1, expressed atlower levels in these cells, did indeed associate with MyD88,Tollip, and TRAF6 (second panel). Interestingly, IRAK1c wasfound to behave similarly to IRAK1-KD and strongly associ-ated with MyD88, Tollip, and TRAF6 (Fig. 3B, compare lanes4 to 6 with lanes 7 to 10). Tollip is the adapter protein that ispreassociated with IRAK1 and is responsible for recruitingIRAK1 from the cytosol to the receptor (2). The ability ofIRAK1c to strongly associate with Tollip suggested thatIRAK1c is recruited to the receptor complex upon ligand ac-tivation. It also indicated that the missing exon 11-encodedregion in IRAK1c does not perturb the association of IRAK1with MyD88, Tollip, and TRAF6.

IRAK1c is recruited to the IL-1R and associates with en-dogenous MyD88, Tollip and TRAF6 after TIR activation.Although our previous experiment suggested IRAK1c can berecruited to the IL-1R, we wanted to experimentally test thishypothesis. To examine ligand-induced receptor association,we used G292 cells, a human osteosarcoma cell line that isstrongly IL-1� responsive. To study the effects of IRAK1c, wegenerated stable G292 cell lines overexpressing myc-IRAK1,myc-IRAK1-KD, or myc-IRAK1c by retroviral transduction.Cells were either left unstimulated or stimulated with IL-1�,and lysates were prepared. Immunoprecipitation of IL-1R fol-lowed by anti-myc immunoblotting revealed that IRAK1 wasrecruited to the receptor in an activation-dependent manner(Fig. 4A). As previously reported, IRAK1-KD associated with

the receptor in a manner similar to IRAK1 (10), and IRAK1cwas also recruited to the IL-1R upon treatment with IL-1�.

Previous studies have demonstrated that Tollip associateswith IRAK1 in the cytosol and, upon TIR activation, recruitsIRAK1 to the membrane (2). Subsequent IRAK1 phosphory-lation and autophosphorylation result in disassociation fromTollip and activation of downstream pathways through TRAF6(14). Our overexpression data in 293 cells indicated that theIRAK1c splice variant had the ability to associate with Tollip,MyD88, and TRAF6 (Fig. 3B) yet lacked kinase activity andthe ability to be phosphorylated by IRAK4 (Fig. 2). Basedupon our data and the recent model proposed by Kollewe et al.(14), we hypothesized that IRAK1c might function as a natu-rally occurring, kinase-dead IRAK1 protein that is unable todisengage from Tollip and activate downstream pathwaysthrough TRAF6. To test whether this is the mechanism bywhich IRAK1c functions as a negative regulator, we used IL-1-responsive G292 cells. Anti-Tollip immunoprecipitates wereseparated by SDS-PAGE and immunoblotted with anti-mycantibody to visualize associated IRAK1, IRAK1-KD, orIRAK1c (Fig. 4B). As previously reported (2, 14), IRAK1 isassociated with Tollip prior to activation (lane 1). Upon acti-vation with IL-1�, IRAK1 becomes phosphorylated, exhibitskinase activity (data not shown), and undergoes a shift inmolecular weight (Fig. 4A, lane 2, bottom panel). Concomi-tantly, IRAK1 no longer associates with Tollip (Fig. 4B, lane 2,upper panel). Both IRAK1-KD and the IRAK1c splice variantassociate with Tollip in unstimulated cells (Fig. 4B, lanes 3 and5, top panel). However, this association remains even afterIL-1� stimulation (Fig. 4B, lanes 4 and 6, top panel). Similarresults were obtained using THP-1 cells transfected with vari-ous IRAK1 expression constructs and stimulated with LPS(data not shown). These data suggested that IRAK1c wasunable to disengage from the IL-1R complex.

Since our overexpression studies in 293 cells had indicatedthat IRAK1c could associate with MyD88 and TRAF6, we alsotested the ability of IRAK1c to associate with these key pro-teins in this activation-driven cellular system. Anti-myc immu-noprecipitates were immunoblotted with either an anti-MyD88or an anti-TRAF6 antibody (Fig. 4C). Like wild-type IRAK1,both IRAK1-KD and IRAK1c associated with MyD88 andTRAF6, supporting previous data that the lack of IRAK1-KDand IRAK1c kinase activity does not affect association withMyD88 and TRAF6 at the receptor complex (10). Based uponthese results, we hypothesized that because IRAK1c cannot bephosphorylated by IRAK4 and lacks kinase activity, it there-fore cannot disengage from the receptor complex containingTollip, MyD88, and TRAF6 and thus would fail to activatedownstream signaling that results in NF-�B activation.

IRAK1c expression blocks NF-�B activation. To initially testthe effect of IRAK1c on TIR signaling, we used a luciferasereporter to assay NF-�B activation in 293 cells triggered by theinflammatory cytokine IL-1�. To confirm the validity of theassay, a MyD88 expression vector was transfected resulting inhigh levels of NF-�B activation, even in the absence of IL-1�stimulation (Fig. 5A). Transfection of IRAK1 or IRAK1-KDin 293 cells activated a NF-�B-luciferase reporter, and thisactivity was enhanced upon IL-1� stimulation (Fig. 5A). Theseresults are consistent with previous reports (16) and suggestthat kinase activity of IRAK1 may not be crucial for activation

VOL. 25, 2005 IRAK1c BLOCKS IL-1R-INDUCED INFLAMMATION 6525

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

of downstream signaling pathways such as NF-�B. However,no NF-�B-luciferase activity was detected in IRAK1c-trans-fected cells (Fig. 5A); furthermore, NF-�B activity induced byIL-1� treatment was suppressed by IRAK1c overexpression.

Similar effects were observed with the IRAK1c-KD-trans-fected cells. This negative effect of IRAK1c was dose depen-dent, as demonstrated in transfection studies with a titration ofIRAK1c (Fig. 5C). To ensure that these observed effects were

FIG. 3. IRAK1c forms dimers with IRAK1 and IRAK2 and associates with MyD88, Tollip, and TRAF6. (A) 293 cells were transfected with1 �g of the indicated myc-tagged plasmids and either cotransfected with a vector control or HA-IRAK1c. Lysates prepared in TX-100 lysis buffer48 h posttransfection were subjected to anti-myc immunoprecipitation followed by anti-HA immunoblot analysis (top panel). Whole-cell lysateswere also immunoblotted with anti-myc (middle panel) and anti-HA (bottom panel) antibodies. (B) 293 cells were transfected with 3 �g of theindicated FLAG-tagged MyD88, Tollip, and TRAF6 plasmids and 3 �g of the indicated myc-tagged IRAK1 plasmids. Lysates prepared in TX-100lysis buffer 48 h posttransfection were subjected to anti-FLAG immunoprecipitation followed by anti-myc immunoblot analysis (top and secondpanels). Whole cell lysates were also immunoblotted with anti-myc (third panel) and anti-FLAG (bottom panel) antibodies to confirm proteinexpression.

6526 RAO ET AL. MOL. CELL. BIOL.

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

not cell line specific, the same experiment was repeated usingG292 cells, an osteosarcoma cell line that is highly IL-1 re-sponsive. Unlike 293 cells (data not shown), G292 cells arefully competent and respond to IL-1� stimulation by producingproinflammatory cytokines like IL-6. In G292 cells, IRAK1calso functioned as a potent negative regulator that blockedIL-1�-induced NF-�B activation in a dose-dependent manner(Fig. 5C). Interestingly, when we compared the ability ofIRAK1, IRAK1-KD, IRAK1c, and IRAK1c-KD to modulateNF-�B-luciferase activity in G292 cells, we found that an IL-1-responsive cell line like G292 did not behave like 293 cells.Unlike the 293 cell system, overexpression of IRAK1 orIRAK1-KD did not result in NF-�B activation in the absenceof IL-1 stimulation (Fig. 5A and B). Upon IL-1 stimulation,G292 cells transfected with IRAK1 showed enhanced NF-�Bactivity, but those transfected with IRAK1-KD did not show anoverall increase compared to vector-transfected cells (Fig. 5B).These results suggested that the role of IRAK1 andIRAK1-KD can vary depending on the cell type used. How-ever, in the case of IRAK1c, both cell types indicated that thedistinct functional role of IRAK1c as a negative regulator isnot merely due to the lack of kinase activity.

To determine if IRAK1c blocked the activation of the down-

stream effector TRAF6, we coexpressed TRAF6 with IRAK1cin 293 cells. Overexpression of TRAF6 attenuated the inhibi-tory effect of IRAK1c on NF-�B activation in a dose-depen-dent manner (Fig. 5D). These data suggested that IRAK1cfunctioned as an inhibitor of TIR signaling upstream ofTRAF6 and did not affect signaling events downstream ofTRAF6.

IRAK1c blocks IL-1�-induced NF-�B and MAPK activa-tion. Our previous findings using transfected 293 or G292 cellsand a NF-�B-luciferase assay (Fig. 5A to D) suggested thatIRAK1c blocked NF-�B activation. In order to specificallyexamine signaling events upstream of NF-�B activation, westimulated IRAK1�/� murine embryonic fibroblasts that hadbeen reconstituted with IRAK1, IRAK1-KD, and IRAK1c andprepared lysates directly in sample buffer. Immunoblot analysiswith an anti-I�B� antibody indicated that while both IRAK1and IRAK1-KD could activate the NF-�B pathway as demon-strated by I�B� degradation, IRAK1c-reconstituted cells ex-hibited a block in this pathway (Fig. 5E, top panel). Similarresults were obtained when we examined the mitogen-acti-vated protein kinase (MAPK) pathway by assaying JNK acti-vation using a phospho-specific antibody to the JNK substratecJUN. While IRAK1 and IRAK1-KD cells stimulated with

FIG. 4. IRAK1c associates with the IL-1 receptor and binds to Tollip, MyD88, and TRAF6 upon IL-1� stimulation. G292 stable transfectantsexpressing myc-IRAK1, myc-IRAK1-KD or myc-IRAK1c were either unstimulated or stimulated with 5 ng/ml of IL-1� for 3 min. (A) Cell lysateswere prepared in TX-100 buffer, and 1,000 �g of lysate was subjected to anti-IL-1R immunoprecipitations followed by anti-myc immunoblotting(top panel). Whole-cell lysates were also immunoblotted with anti-myc (bottom panel) and anti-IL-1R (middle panel) antibodies to confirm proteinexpression. (B) Lysates from G292 cells were prepared as described for panel A. Lysates were subjected to anti-Tollip immunoprecipitationsfollowed by anti-myc immunoblotting (top panel). Whole-cell lysates were also immunoblotted with anti-Tollip (bottom panel). (C) Lysates frompanel B were subjected to anti-myc immunoprecipitations followed by anti-TRAF6 (top panel) and anti-MyD88 (third panel) immunoblotting.Whole-cell lysates were also immunoblotted with anti-TRAF6 (second panel) and anti-MyD88 (bottom panel).

VOL. 25, 2005 IRAK1c BLOCKS IL-1R-INDUCED INFLAMMATION 6527

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

IL-1� showed robust p-cJUN, IRAK1c cells showed a dramaticblock in cJUN phosphorylation (Fig. 5E, middle panel). To-gether, these data indicated that cells expressing IRAK1ccould not activate the NF-�B or MAPK pathways, suggestingthat IRAK1c might function as an inhibitor of TIR receptor-triggered inflammation.

IRAK1c blocks IL-1� and LPS-induced IL-6 and TNF-�production. The most potent biological effect triggered uponTIR receptor activation and signaling through IRAK1 is therelease of mediators of the inflammatory response such as IL-6and TNF-� (1). To study the effects of IRAK1c on cytokineproduction, we tested the ability of IRAK1c to block the pro-duction of inflammatory cytokines. 293 cells, although com-monly used to study the early biochemical events of TIR re-ceptor and IRAK signal transduction, are not TIR responsive.Extensive analysis of 293 cells indicated that IL-1� stimulation

of 293 cells did not lead to the production of inflammatorycytokines such as TNF-� or IL-6 or chemokines such as IL-8(data not shown). However, G292 cells are sensitive to TIRreceptor stimulation and produce both cytokines and chemo-kines upon IL-1� treatment. Using the stably transduced G292cell lines, we examined the ability of IRAK1, IRAK1-KD, andIRAK1c to modulate production of the proinflammatory cyto-kine IL-6 upon IL-1� stimulation. Overexpression of IRAK1resulted in a statistically significant increase in IL-6 production(Fig. 6A). Consistent with our NF-�B-luciferase data (Fig. 5B),IRAK1-KD overexpression did not enhance IL-6 production(Fig. 6A). Furthermore, IRAK1c functioned as an inhibitorthat significantly decreased IL-6 production when compared tovector-transduced cells (P 0.05).

Since IRAK1 functions as a signaling molecule downstreamof all TIR family members, we also wanted to test the ability of

FIG. 5. IRAK1c inhibits IL-1�-induced NF-�B activation. (A) 293 cells were transfected with 250 ng of the indicated myc-IRAK1 andFLAG-MyD88 plasmids and 1 �g of pHTS-NF-�B-luciferase plasmid. Cells were nonstimulated (�) or stimulated (�) with IL-1� (5 ng/ml) for12 h, and cell extracts were analyzed for luciferase activity in replicates of four. The means and standard deviations are plotted. (B) G292 cells weretransfected with the indicated myc-IRAK1 constructs and 2 �g of pHTS-NF-�B-luciferase plasmid. Cells were nonstimulated (�) or stimulated(�) with IL-1� (5 ng/ml) for 12 h, and cell extracts were analyzed for luciferase activity in replicates of five. (C) 293 cells (solid line) or G292 cells(dashed line) were transfected with increasing amounts of myc-IRAK1c, and NF-�B-luciferase activity was analyzed as described above. Percentactivation compared to vector-transfected cells was calculated and plotted. (D) G292 cells were transfected with 250 ng of myc-IRAK1c and theindicated amounts of FLAG-TRAF6 plasmid. Cells were stimulated and analyzed as described above. (E) IRAK1�/� fibroblasts reconstituted withIRAK1, IRAK1-KD, and IRAK1c were stimulated with 5 ng/ml of IL-1� for 30 min. Whole-cell lysates were prepared directly in sample bufferand subjected to immunoblot analysis with anti-I�B� (top panel), p-cJUN (middle panel), and anti-actin antibodies (bottom panel).

6528 RAO ET AL. MOL. CELL. BIOL.

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

IRAK1c to modulate Toll-like receptor (TLR) signaling. Wetherefore generated stably transduced cell lines using THP-1monocytic cells to study the effect of IRAK1c in TLR signaling(6). Upon TLR4 stimulation with LPS, THP-1 cells secrete theinflammatory mediator TNF-� (Fig. 6B); TNF-� production issignificantly decreased in THP-1 cells that overexpress myc-IRAK1c. This effect was also observed in THP-1 cells overex-pressing an HA-tagged or untagged IRAK1c (data not shown).Similar results were obtained when THP-1 cells were stimu-lated with the TLR9 ligand, CpG (Fig. 6C). These data indi-cated that the IRAK1c splice variant not only blocked NF-�Bactivation but also significantly decreased production of in-flammatory cytokines like TNF-� upon activation of severalTIR family members. Consistent with our findings using G292cells, IRAK1 enhanced LPS- and CpG-induced TNF-� pro-duction, while IRAK1-KD showed no change compared tovector-transfected cells (Fig. 6 B and C).

Since IRAK1 can homodimerize, the preceding experimentsare performed in the presence of endogenous IRAK1. In orderto obtain a clear understanding of the functional role ofIRAK1c, we decided to use murine embryonic fibroblasts de-rived from wild-type and IRAK1�/� mice (KO). Using KOcells reconstituted with IRAK1, IRAK1-KD, and IRAK1c, weexamined the role of the various IRAK1 proteins by assaying

IL-1�-induced IL-6. The genetic ablation of IRAK1 (KO) re-sults in a significant decrease in IL-1�-induced IL-6 whencompared to control wild-type cells (Fig. 6D). Reconstitutionof the KO cells with either IRAK1 or IRAK1-KD rescues thisdefect, suggesting that kinase activity itself is not required forthe role of IRAK1. However, reconstitution of these cells withIRAK1c did not rescue the defect in IL-6 production. Thesedata suggested that although IRAK1c, like a point mutantIRAK1 (IRAK1-KD), lacks kinase activity, the missing 79amino acids comprising exon 11 play a pivotal role in thefunction of IRAK1.

IRAK1c expression can be induced in human macrophagesand dendritic cells. Previous studies of TIR family signalingmolecules have indicated that expression of regulatory proteinscan be induced. A negative regulator of the IRAK kinasefamily, IRAKM, is specifically induced in macrophages uponLPS stimulation (13). A splice variant of the adapter proteinMyD88 was also induced by LPS treatment in human mono-cytes (7). To test whether IRAK1c is inducible, we purifiedmonocytes and prepared dendritic cells from peripheral hu-man blood. Cells were then stimulated with LPS, and RNA wasprepared for RT-PCR analyses of IRAK1 versus IRAK1c ex-pression. Although dendritic cells express lower levels ofIRAK1 when compared to macrophages, both macrophages

FIG. 6. IRAK1c inhibits IL-1�-induced IL-6 in G292 and reconstituted IRAK1�/� cells and LPS- and CpG-induced TNF-� secretion in THP-1cells. (A) G292 cells expressing the indicated myc-IRAK1 constructs were generated by retroviral transfection and either left unstimulated (�) orwere stimulated (�) with 1 ng/ml of IL-1� for 6 h. Supernatants were analyzed for IL-6 by ELISA. The mean values and standard deviations offive replicates are plotted, and statistical significance was calculated based upon vector control values using a Student t test; an asterisk indicatesa P value of 0.05. (B) The indicated THP-1-transfected cells were stimulated with 50 ng/ml of LPS for 4 h. TNF-� secretion was measured byELISA and reported as described above. (C) The indicated THP-1-transfected cells were stimulated with 1 �M GpC control (unfilled bar) andstimulatory CpG oligodeoxynucleotides (filled bars) for 6 h. TNF-� secretion was measured by ELISA and reported as above. (D) IRAK1�/�

murine embryonic fibroblasts (KO) or stable cell lines reconstituted with IRAK1, IRAK1-KD (KO-KD), or IRAK1c (KO-1c) were stimulatedtogether with wild-type (WT) cells using 1 ng/ml of IL-1� for 6 h. IL-6 secretion was measured by ELISA and reported as above. MEF, murineembryonic fibroblast.

VOL. 25, 2005 IRAK1c BLOCKS IL-1R-INDUCED INFLAMMATION 6529

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

and dendritic cells exhibited inducible expression of IRAK1cupon LPS stimulation (Fig. 7A). As has been previously re-ported, we also observed a slight decrease in IRAK1 expres-sion upon LPS stimulation in macrophages (29). In order toconfirm that these RNA changes were reflected by changes inprotein levels, lysates were prepared from monocytes and den-dritic cells stimulated for 12 h with LPS. IRAK1 immunoblotanalysis indicated that IRAK1 protein is degraded upon acti-vation, while IRAK1c protein is induced in both monocytesand dendritic cells (Fig. 7B). These data suggest that, togetherwith inducible regulators like IRAKM, the splice variantIRAK1c can function as a regulator to suppress or fine-tunesignaling downstream of TIRs.

DISCUSSION

The receptor-proximal IRAK family members, IRAK1 andIRAK4, are known to play a pivotal role in inflammation me-diated by IL-1/IL-18/TLR ligands (1, 6). Due to the impor-tance of these kinases in both the initiation and perpetuationof the inflammatory response, multiple mechanisms exist toregulate their functions. In this study, we report the identifi-cation of a novel IRAK1 splice variant, IRAK1c. IRAK1cexpression, at both the RNA and protein levels, was confirmedin normal human tissues, primary cells, and cell lines. Thepresence of IRAK1c as a bona fide expressed transcript wassupported by the existence of multiple IRAK1 ESTs and afull-length human mRNA clone, which were reported to beIRAK1 clones but whose sequences actually correspond toIRAK1c (data not shown). The IRAK1c expression profile isdistinct from IRAK1, in that it is inducible in human mono-cytes and dendritic cells upon inflammatory stimuli such asLPS. Furthermore, IRAK1c is the predominant form ofIRAK1 in the brain, suggesting that it might play a specificfunctional role in the central nervous system. In our studies, wedemonstrate that IRAK1c functions as a dominant-negativeprotein in TIR-mediated signaling and inflammation. IRAKM,another member of the IRAK family, is known to be a negativemodulator and is induced specifically in hematopoietic cells(13, 25). IRAK1c may function similarly to IRAKM but exertsa more general regulatory role in many cell types, includingthose of the hematopoietic lineage. Specifically in the brain,

IRAK1c is the major IRAK1 isoform and potentially plays aprotective role by modulating inflammatory responses. Sincethe brain is known to be an immune-privileged site, it remainsof interest to determine if IRAK1c is also preferentially ex-pressed in other immune-privileged sites such as the anteriorchamber of the eye and the placenta.

Unlike two other reported IRAK1 splice variants that utilizethe alternative splice acceptor sites of exon 12 (9, 28), theIRAK1c transcript that we identified and characterized lacks aregion of 79 amino acids that are encoded by exon 11. How-ever, this splicing does not cause any frameshift changes in theregion encoded by the downstream exons 12, 13, and 14. Themissing portion of IRAK1c is in the C-terminal region of theIRAK1 kinase domain. This region is highly enriched withcharged amino acid residues and could potentially form anaccessible binding interface. Although all of these IRAK1 vari-ants lack kinase activity (9, 28), IRAK1c is distinct from theother variants in that it functions as an inhibitor of TIR-in-duced inflammation. Similar differential roles of splice variantshave also been recently reported for murine IRAK2 (5).

In order to functionally characterize IRAK1c, we trans-fected IRAK1c in multiple cellular systems and studied theresulting effects on different TIR ligand-mediated signalingevents and inflammatory cytokine induction. The 293 humanembryonic kidney epithelial cell line is a convenient systemutilized by many research groups to study the early biochemicalevents of TIR signal transduction. Using 293 cells transfectedwith a NF-�B-luciferase reporter, we showed that IRAK1c hada distinct inhibitory effect on NF-�B activation compared toIRAK1 and the kinase-dead point mutant IRAK1-KD. How-ever, 293 cells are poorly responsive to TIR ligands and do notproduce proinflammatory cytokines. We therefore turned tothree other cell types that are competent in responding to TIRligands. Using IL-1�-stimulated G292 osteosarcoma cells andLPS- or CpG-stimulated THP-1 monocytic cells, we observedthat IRAK1c expression significantly suppressed NF-�B acti-vation and the induction of inflammatory cytokines such asIL-6 and TNF-�. The dominant-negative effect of IRAK1c wasupstream of TRAF6 as it could be rescued by TRAF6 overex-pression. Furthermore, we generated fibroblast cell lines fromIRAK1�/� mice and wild-type controls. IRAK1�/� fibroblastsare defective in IL-1-induced IL-6 production (12). Transfec-tion of IRAK1�/� cells with IRAK1 or IRAK1-KD could re-constitute the IL-1 response of these cells with activation ofNF-�B and MAPK pathways and induction of IL-6. However,the splice variant IRAK1c could not rescue this defect, eitherin signaling or in cytokine production. These findings suggestthat the naturally occurring IRAK1c splice variant, which lacks79 amino acids and has no kinase activity, functions as aninhibitory protein and is distinct from the kinase-dead pointmutant IRAK1-KD or an IRAK1 whole kinase domain dele-tion mutant that has been reported to behave similarly toIRAK1-KD (10). This result indicates that the lack of kinaseactivity alone is not the key factor for the negative regulatoryrole of IRAK1c. Other functional roles are apparently missingin the IRAK1c splice variant due to the deletion of the 79-amino-acid region.

Given the negative regulatory role of the IRAK1c splicevariant, we attempted to dissect the mechanism by which itfunctioned. We showed that IRAK1c could dimerize with

FIG. 7. IRAK1c is upregulated upon LPS treatment of human den-dritic cells and monocytes. Human monocytes and dendritic cells wereprepared from whole blood as described. (A) Cells were either un-stimulated or stimulated with 100 ng/ml of LPS for 6 h. RNA wasprepared, and IRAK1 cDNA was amplified as described in Materialsand Methods. GAPDH amplification was used as a control. (B) Hu-man monocytes and dendritic cells were stimulated for 16 h with 100ng/ml of LPS, and cell lysates were prepared. Whole-cell lysates weresubjected to anti-IRAK1 and anti-actin immunoblot analysis. DCs,dendritic cells.

6530 RAO ET AL. MOL. CELL. BIOL.

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

IRAK1 or IRAK2. IRAK1c associated with Tollip in restingcells and was recruited to the receptor complex upon activa-tion. IRAK1c interacted with MyD88 and the key NF-�B-activating protein TRAF6 but had a decreased association withIRAK4. Furthermore, IRAK1c is not phosphorylated byIRAK4. More importantly, IRAK1c cannot terminate its asso-ciation with Tollip at the receptor complex. Since the kinase-dead point mutant IRAK1-KD had similar defects in disen-gaging from Tollip yet did not block NF-�B activation orcytokine induction, it seems that the prolonged Tollip associ-ation cannot fully explain the distinct dominant-negative effectobserved for IRAK1c but not for IRAK1-KD. It remains pos-sible that other unidentified signaling proteins may interactwith IRAK1 via exon 11, which is missing in IRAK1c. Alter-natively, loss of the charged exon 11 might mask binding sitesin IRAK1c and prevent formation of an optimal protein com-plex at the receptor. We therefore hypothesize that a change inthe formation of a receptor complex mediated by IRAK1ccould account for the functional defects observed upon expres-sion of IRAK1c.

One key event upon IRAK1 recruitment to the receptorcomplex is the phosphorylation of IRAK1 by IRAK4 (1). Ourstudies indicated that while both IRAK1 and IRAK1-KDcould serve as substrates for recombinant human IRAK4,IRAK1c could not be phosphorylated by IRAK4. This could bedue to a loss of IRAK4 phosphorylation sites that are locatedin the region missing in IRAK1c. This possibility was excludedsince this region expressed as a recombinant protein did notserve as a substrate for IRAK4. However, it is still possible thatthe lack of this region destabilizes the conformation of theIRAK1c kinase domain and thus masks the IRAK4 Thr209phosphorylation site. Furthermore, the decreased IRAK1 andIRAK4 association that we observed may also contribute tothis defect. In conclusion, the striking feature of IRAK1c thatwe identified is that it can no longer be phosphorylated byIRAK4.

Previous reports have indicated that IRAK1 forms ho-modimers and heterodimers with other IRAK family memberssuch as IRAK2 (25). IRAK1 dimers are associated with theadapter protein Tollip in the cytosol at resting state (2, 10).Upon activation, Tollip-IRAK1 is recruited to the TIR recep-tor complex and interacts with the key adapter protein MyD88and the NF-�B-activating protein TRAF6 (10). At the recep-tor, IRAK1 dimers are phosphorylated at Thr209 by IRAK4,resulting in a conformational change of the kinase domain(14). This leads to phosphorylation of Thr387 in the activationloop of IRAK1 and triggers autophosphorylation on severalresidues in the ProST region located between the death do-main and kinase domain (14). When IRAK1 is hyperphospho-rylated, it disassociates from the receptor protein complex ofMyD88 and Tollip (3, 10). IRAK1 continues to associate withTRAF6, eventually triggering activation of the NF-�B path-way. Based on our biochemical studies, we proposed a modelto explain the mechanism by which IRAK1c exerts its domi-nant-negative effects on TIR signaling (Fig. 8). In resting cells,IRAK1c dimerizes with IRAK1 or IRAK2 and associates withTollip. Upon TIR activation, IRAK1c is recruited to the re-ceptor complex and interacts with MyD88 and TRAF6 in amanner similar to IRAK1 and IRAK1-KD. However, unlikeIRAK1, IRAK1c cannot be phosphorylated by IRAK4 and

does not have kinase activity to undergo autophosphorylation.Furthermore, IRAK1c does not terminate its association withTollip at the receptor complex, a prerequisite for further acti-vation of the downstream NF-�B and MAPK signaling cas-cades. Due to the functional defects of IRAK1c, it eventuallyleads to shutdown of TIR-mediated signaling and a decrease ininflammatory mediator production.

The hypothesis that cells could selectively deplete IRAK1and replace it with a functionally defective IRAK1c is sup-ported by our findings that both human macrophages andmyeloid-derived dendritic cells showed a decrease in IRAK1and a concurrent increase in IRAK1c message upon TIR ac-tivation. This strategy of regulated expression of splicing iso-forms to produce either functional or defective protein kinaseprovides an elegant mechanism to attenuate activation signalsemanating from a receptor-proximal kinase, a function mostoften performed by a protein phosphatase. As yet, no phos-phatase has been described that dephosphorylates IRAK1 orIRAK4. Interestingly, a splice variant of p38�, another keykinase in the inflammatory pathway, was recently reported todown-regulate the NF�B pathway (26).

Our studies have highlighted that alternative splicing is oneof the mechanisms utilized in cells to regulate the proinflam-matory signaling cascade triggered by TIRs. The key adapter

FIG. 8. A model of IRAK1c regulation of inflammation. Upon TIRactivation by the appropriate ligand, the Tollip-IRAK1 complex isrecruited to the TIR receptor at the membrane and interacts withMyD88 and TRAF6. IRAK4 phosphorylates IRAK1 (1) resulting inIRAK1 autophosphorylation and activation (2). IRAK1 then disen-gages from the receptor complex of MyD88 and Tollip (3) but remainsassociated with TRAF6, resulting in activation of the NF-�B pathwayand production of proinflammatory cytokines (4). The splice variantIRAK1c cannot be phosphorylated by IRAK4, does not undergo au-tophosphorylation, and thus does not activate downstream signalingevents.

VOL. 25, 2005 IRAK1c BLOCKS IL-1R-INDUCED INFLAMMATION 6531

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

protein in TIR signaling, MyD88, has been reported to gener-ate an alternative splice variant, MyD88s, which negativelyregulated NF-�B activation (8). Expression of splice variantsseems to be a strategy used by the IRAK family to regulateTIR response. Two splice variants of IRAK1 have been re-ported, although endogenous protein expression of these vari-ants has yet to be demonstrated (9, 28). Furthermore, a recentpaper reported four alternatively spliced variants of the murineIRAK2 gene (5). Interestingly, splice variants of the IRAKfamily seem to be species specific, probably reflecting a mech-anism established late in evolution. All IRAK2 splice variantsare found only in the mouse (5). IRAK1s is only found in themouse, while IRAK1b is found both in mouse and human (9,28). To date, we have been unable to clone an IRAK1c splicevariant from mouse tissues or cell lines. These differences insplice variants between mouse and humans, together withother differences in expression of TLRs themselves, suggestthat multiple differences in the TLR system, including bothreceptors and signaling molecules, contribute to the differ-ences observed between the innate immune systems of miceand humans (18).

ACKNOWLEDGMENTS

We thank Dan Belajic for purifying GST-ex11. We also thank LyNguyen, Ping Ling, Niall O’Donnell, Miguel San Juan, and Lars Karls-son for helpful discussions.

REFERENCES

1. Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nat. Rev.Immunol. 4:499–511.

2. Burns, K., J. Clatworthy, L. Martin, F. Martinon, C. Plumpton, B. Masch-era, A. Lewis, K. Ray, J. Tschopp, and F. Volpe. 2000. Tollip, a new com-ponent of the IL-1RI pathway, links IRAK to the IL-1 receptor. Nat. CellBiol. 2:346–351.

3. Burns, K., S. Janssens, B. Brissoni, N. Olivos, R. Beyaert, and J. Tschopp.2003. Inhibition of interleukin 1 receptor/Toll-like receptor signalingthrough the alternatively spliced, short form of MyD88 is due to its failure torecruit IRAK-4. J. Exp. Med. 197:263–268.

4. Cao, Z., J. Xiong, M. Takeuchi, T. Kurama, and D. V. Goeddel. 1996. TRAF6is a signal transducer for interleukin-1. Nature 383:443–446.

5. Hardy, M. P., and L. A. O’Neill. 2004. The murine IRAK2 gene encodes fouralternatively spliced isoforms, two of which are inhibitory. J. Biol. Chem.279:27699–27708.

6. Janssens, S., and R. Beyaert. 2003. Functional diversity and regulation ofdifferent interleukin-1 receptor-associated kinase (IRAK) family members.Mol. Cell 11:293–302.

7. Janssens, S., K. Burns, J. Tschopp, and R. Beyaert. 2002. Regulation ofinterleukin-1- and lipopolysaccharide-induced NF-kappaB activation by al-ternative splicing of MyD88. Curr. Biol. 12:467–471.

8. Janssens, S., K. Burns, E. Vercammen, J. Tschopp, and R. Beyaert. 2003.MyD88S, a splice variant of MyD88, differentially modulates NF-kappaB-and AP-1-dependent gene expression. FEBS Lett. 548:103–107.

9. Jensen, L. E., and A. S. Whitehead. 2001. IRAK1b, a novel alternative splicevariant of interleukin-1 receptor-associated kinase (IRAK), mediates inter-leukin-1 signaling and has prolonged stability. J. Biol. Chem. 276:29037–29044.

10. Jiang, Z., J. Ninomiya-Tsuji, Y. Qian, K. Matsumoto, and X. Li. 2002.Interleukin-1 (IL-1) receptor-associated kinase-dependent IL-1-induced sig-naling complexes phosphorylate TAK1 and TAB2 at the plasma membraneand activate TAK1 in the cytosol. Mol. Cell. Biol. 22:7158–7167.

11. Kanakaraj, P., K. Ngo, Y. Wu, A. Angulo, P. Ghazal, C. A. Harris, J. J.Siekierka, P. A. Peterson, and W. P. Fung-Leung. 1999. Defective interleukin(IL)-18-mediated natural killer and T helper cell type 1 responses in IL-1receptor-associated kinase (IRAK)-deficient mice. J. Exp. Med. 189:1129–1138.

12. Kanakaraj, P., P. H. Schafer, D. E. Cavender, Y. Wu, K. Ngo, P. F. Grealish,S. A. Wadsworth, P. A. Peterson, J. J. Siekierka, C. A. Harris, and W. P.Fung-Leung. 1998. Interleukin (IL)-1 receptor-associated kinase (IRAK)requirement for optimal induction of multiple IL-1 signaling pathways andIL-6 production. J. Exp. Med. 187:2073–2079.

13. Kobayashi, K., L. D. Hernandez, J. E. Galan, C. A. Janeway, Jr., R. Medzhi-tov, and R. A. Flavell. 2002. IRAK-M is a negative regulator of Toll-likereceptor signaling. Cell 110:191–202.

14. Kollewe, C., A. C. Mackensen, D. Neumann, J. Knop, P. Cao, S. Li, H.Wesche, and M. U. Martin. 2004. Sequential auto-phosphorylation steps inthe interleukin-1 receptor-associated kinase-1 (IRAK-1) regulate its avail-ability as an adapter in IL-1 signaling. J. Biol. Chem. 279:5227–5236.

15. Li, S., A. Strelow, E. J. Fontana, and H. Wesche. 2002. IRAK-4: a novelmember of the IRAK family with the properties of an IRAK-kinase. Proc.Natl. Acad. Sci. USA 99:5567–5572.

16. Li, X., M. Commane, Z. Jiang, and G. R. Stark. 2001. IL-1-induced NFkappaB and c-Jun N-terminal kinase (JNK) activation diverge at IL-1 receptor-associated kinase (IRAK). Proc. Natl. Acad. Sci. USA 98:4461–4465.

17. Lye, E., C. Mirtsos, N. Suzuki, S. Suzuki, and W. C. Yeh. 2004. The role ofinterleukin 1 receptor-associated kinase-4 (IRAK-4) kinase activity inIRAK-4-mediated signaling. J. Biol. Chem. 279:40653–40658.

18. Mestas, J., and C. C. Hughes. 2004. Of mice and not men: differencesbetween mouse and human immunology. J. Immunol. 172:2731–2738.

19. Picard, C., A. Puel, M. Bonnet, C. L. Ku, J. Bustamante, K. Yang, C.Soudais, S. Dupuis, J. Feinberg, C. Fieschi, C. Elbim, R. Hitchcock, D.Lammas, G. Davies, A. Al-Ghonaium, H. Al-Rayes, S. Al-Jumaah, S. Al-Hajjar, I. Z. Al-Mohsen, H. H. Frayha, R. Rucker, T. R. Hawn, A. Aderem,H. Tufenkeji, S. Haraguchi, N. K. Day, R. A. Good, M. A. Gougerot-Pocidalo,A. Ozinsky, and J. L. Casanova. 2003. Pyogenic bacterial infections in hu-mans with IRAK-4 deficiency. Science 299:2076–2079.

20. Rao, N., A. K. Ghosh, P. Zhou, P. Douillard, C. E. Andoniou, and H. Band.2002. An essential role of ubiquitination in Cbl-mediated negative regulationof the Src-family kinase Fyn. Signal Transduct. 2:29–39.

21. Rosati, O., and M. U. Martin. 2002. Identification and characterization ofmurine IRAK-2. Biochem. Biophys. Res. Commun. 297:52–58.

22. Suzuki, N., S. Suzuki, G. S. Duncan, D. G. Millar, T. Wada, C. Mirtsos, H.Takada, A. Wakeham, A. Itie, S. Li, J. M. Penninger, H. Wesche, P. S.Ohashi, T. W. Mak, and W. C. Yeh. 2002. Severe impairment of interleukin-1and Toll-like receptor signalling in mice lacking IRAK-4. Nature 416:750–756.

23. Vincent, M. S., D. S. Leslie, J. E. Gumperz, X. Xiong, E. P. Grant, and M. B.Brenner. 2002. CD1-dependent dendritic cell instruction. Nat. Immunol.3:1163–1168.

24. Vogel, S. N., K. A. Fitzgerald, and M. J. Fenton. 2003. TLRs: differentialadapter utilization by toll-like receptors mediates TLR-specific patterns ofgene expression. Mol. Interv. 3:466–477.

25. Wesche, H., X. Gao, X. Li, C. J. Kirschning, G. R. Stark, and Z. Cao. 1999.IRAK-M is a novel member of the Pelle/interleukin-1 receptor-associatedkinase (IRAK) family. J. Biol. Chem. 274:19403–19410.

26. Yagasaki, Y., T. Sudo, and H. Osada. 2004. Exip, a splicing variant ofp38alpha, participates in interleukin-1 receptor proximal complex and down-regulates NF-kappaB pathway. FEBS Lett. 575:136–140.

27. Yamin, T. T., and D. K. Miller. 1997. The interleukin-1 receptor-associatedkinase is degraded by proteasomes following its phosphorylation. J. Biol.Chem. 272:21540–21547.

28. Yanagisawa, K., K. Tago, M. Hayakawa, M. Ohki, H. Iwahana, and S.Tominaga. 2003. A novel splice variant of mouse interleukin-1-receptor-associated kinase-1 (IRAK-1) activates nuclear factor-kappaB (NF-kappaB)and c-Jun N-terminal kinase (JNK). Biochem. J. 370:159–166.

29. Yeo, S. J., J. G. Yoon, S. C. Hong, and A. K. Yi. 2003. CpG DNA induces selfand cross-hyporesponsiveness of RAW264.7 cells in response to CpG DNAand lipopolysaccharide: alterations in IL-1 receptor-associated kinase ex-pression. J. Immunol. 170:1052–1061.

6532 RAO ET AL. MOL. CELL. BIOL.

on Novem

ber 23, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from