· PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that...

13

Transcript of · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that...

Page 1: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 2: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 3: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 4: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 5: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 6: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 7: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 8: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 9: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 10: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 11: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 12: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon
Page 13: · PDF filecomplex C is associated with release of U4 ... rial action Of multiple factors that act at the ... (Fig. 2). The central loop Of U5 snRNA interacts with exon

Ryan Exon Portfolio

Ryan Exon Portfolio

Exon-Mobile Drilling Guide

Exon-Mobile Drilling Guide

Hepatocellular Carcinoma - Exon Publications

Hepatocellular Carcinoma - Exon Publications

Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR.

Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR.

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.

Complex Fractions - · PDF fileComplex Fractions -

Complex Fractions - · PDF fileComplex Fractions -

Yoon et al, Supplementary Fig. 1 - images.nature.com · 13 14 92 88 24 25 25 30 2 2 7 7 93 93 56 56 98 98 % exon inclusion A A uR A HeLa U2 snRNA poly A+ RNA Merge ... Supplementary

Yoon et al, Supplementary Fig. 1 - images.nature.com · 13 14 92 88 24 25 25 30 2 2 7 7 93 93 56 56 98 98 % exon inclusion A A uR A HeLa U2 snRNA poly A+ RNA Merge ... Supplementary

Rfa Exon Dairy

Rfa Exon Dairy

Desastre Exon Valdez.

Desastre Exon Valdez.

CRISPR/Cas9-mediated genome editing induces exon skipping ... · HeLa cells can cause skipping of exon 3, exon 4, or exons 3, 4, and 5 [18]. We also detected infrequent exon skipping

CRISPR/Cas9-mediated genome editing induces exon skipping ... · HeLa cells can cause skipping of exon 3, exon 4, or exons 3, 4, and 5 [18]. We also detected infrequent exon skipping

Exon Mobil Mock Case

Exon Mobil Mock Case

Supporting Information - PNAS · Supporting Information Aoki et al. 10.1073/pnas.1204638109 Fig. S1. Applicability of antisense-mediated exon skipping targeting each exon and exon

Supporting Information - PNAS · Supporting Information Aoki et al. 10.1073/pnas.1204638109 Fig. S1. Applicability of antisense-mediated exon skipping targeting each exon and exon

Multiple roles for U6 snRNA in the splicing pathwaygenesdev.cshlp.org/content/4/12b/2264.full.pdfMultiple roles for U6 snRNA in the splicing pathway Hiten D. Madhani,* Remy Botdonne

Multiple roles for U6 snRNA in the splicing pathwaygenesdev.cshlp.org/content/4/12b/2264.full.pdfMultiple roles for U6 snRNA in the splicing pathway Hiten D. Madhani,* Remy Botdonne

DSP1 and DSP4 act synergistically in snRNA 3' end ... · 6/21/2019  · 48 dsp1-1 dsp4-1 double mutants exhibit complete male sterility and reduced pre-snRNA 49 transcription and

DSP1 and DSP4 act synergistically in snRNA 3' end ... · 6/21/2019  · 48 dsp1-1 dsp4-1 double mutants exhibit complete male sterility and reduced pre-snRNA 49 transcription and

Structural basis for snRNA recognition by the double-WD40 ...genesdev.cshlp.org › content › 30 › 21 › 2391.full.pdf · Structural basis for snRNA recognition by the double-WD40

Structural basis for snRNA recognition by the double-WD40 ...genesdev.cshlp.org › content › 30 › 21 › 2391.full.pdf · Structural basis for snRNA recognition by the double-WD40

Posters final - Home - The Exon Singers The Exon Singers · SATURDAY 2 AUGUST, 7.30pm FESTIVAL FINALE GLORIA Baroque masterpieces include Bach's Jesu, meine Freude with he Exon Vivaldi's

Posters final - Home - The Exon Singers The Exon Singers · SATURDAY 2 AUGUST, 7.30pm FESTIVAL FINALE GLORIA Baroque masterpieces include Bach's Jesu, meine Freude with he Exon Vivaldi's

Limited complementarity between U1 snRNA and a retroviral 5 ...

Limited complementarity between U1 snRNA and a retroviral 5 ...

Endogenous U2·U5·U6 snRNA complexes in S. pombe … · Endogenous U2·U5·U6 snRNA complexes in S. pombe are intron lariat € Material Supplemental € ... Downloaded from rnajournal.cshlp.org

Endogenous U2·U5·U6 snRNA complexes in S. pombe … · Endogenous U2·U5·U6 snRNA complexes in S. pombe are intron lariat € Material Supplemental € ... Downloaded from rnajournal.cshlp.org

EXON - exeter.ox.ac.uk

EXON - exeter.ox.ac.uk

PowerPoint Presentation · Retinoblastoma WT QRX-421 Exon 12 Exon 13 Exon 14 Exon 12 Exon 14 In-frame Exon 11 Exon 14 Out of-frame No AON QRX-421 Exon 12 Exon 13 Exon 14 Erwin van

PowerPoint Presentation · Retinoblastoma WT QRX-421 Exon 12 Exon 13 Exon 14 Exon 12 Exon 14 In-frame Exon 11 Exon 14 Out of-frame No AON QRX-421 Exon 12 Exon 13 Exon 14 Erwin van