By drawing a picture describe the flow of genetic information from DNA to a protein.

35
By drawing a picture describe the flow of genetic information from DNA to a protein.

Transcript of By drawing a picture describe the flow of genetic information from DNA to a protein.

Page 1: By drawing a picture describe the flow of genetic information from DNA to a protein.

By drawing a picture describe the flow of genetic information from DNA to a protein.

Page 2: By drawing a picture describe the flow of genetic information from DNA to a protein.

What is the function of RNA?

Page 3: By drawing a picture describe the flow of genetic information from DNA to a protein.

Transfers or relays genetic information

Page 4: By drawing a picture describe the flow of genetic information from DNA to a protein.

What is the product of transcription?

Page 5: By drawing a picture describe the flow of genetic information from DNA to a protein.

mRNA

Page 6: By drawing a picture describe the flow of genetic information from DNA to a protein.

Where in the cell does transcription take place?

Page 7: By drawing a picture describe the flow of genetic information from DNA to a protein.

Nucleus

Page 8: By drawing a picture describe the flow of genetic information from DNA to a protein.

What is the product of translation?

Page 9: By drawing a picture describe the flow of genetic information from DNA to a protein.

A protein

Page 10: By drawing a picture describe the flow of genetic information from DNA to a protein.

Where in the cell does translation take place?

Page 11: By drawing a picture describe the flow of genetic information from DNA to a protein.

At the ribosome

Page 12: By drawing a picture describe the flow of genetic information from DNA to a protein.

True or false: During transcription, mRNA is being

synthesized from both sides (both backbones) of DNA.

Page 13: By drawing a picture describe the flow of genetic information from DNA to a protein.

False: mRNA is a complement to only one side of DNA

Page 14: By drawing a picture describe the flow of genetic information from DNA to a protein.

What determines which amino acid is brought to the ribosome during translation?

Page 15: By drawing a picture describe the flow of genetic information from DNA to a protein.

The mRNA codon – use your codon chart.

Remember 1 codon = 1 amino acid!

Page 16: By drawing a picture describe the flow of genetic information from DNA to a protein.

What bring the amino acids to the ribosome during translation?

Page 17: By drawing a picture describe the flow of genetic information from DNA to a protein.

tRNA

Page 18: By drawing a picture describe the flow of genetic information from DNA to a protein.

Given the DNA sequence find the mRNA sequence and the amino acid sequence:

TACGGACAC

Page 19: By drawing a picture describe the flow of genetic information from DNA to a protein.

DNA: TACGGACACmRNA: AUGCCUGUGA.A.: Met-Pro-Val

Page 20: By drawing a picture describe the flow of genetic information from DNA to a protein.

Removing a nucleotide from a DNA sequence is called ____________ mutation.

Page 21: By drawing a picture describe the flow of genetic information from DNA to a protein.

Frameshift (deletion)

Page 22: By drawing a picture describe the flow of genetic information from DNA to a protein.

What mutation is shown below:

ATTGGCTATCCGATTGGGTATCCG

Page 23: By drawing a picture describe the flow of genetic information from DNA to a protein.

Point mutation (also called substitution)

Page 24: By drawing a picture describe the flow of genetic information from DNA to a protein.

What is the major problem that could result from a mutation?

Page 25: By drawing a picture describe the flow of genetic information from DNA to a protein.

An abnormal protein

Page 26: By drawing a picture describe the flow of genetic information from DNA to a protein.

If a mutation does not cause a change in the amino acid sequence it is called a:

Page 27: By drawing a picture describe the flow of genetic information from DNA to a protein.

Silent mutation

Page 28: By drawing a picture describe the flow of genetic information from DNA to a protein.

Name 1 benefit of genetic engineering.

Page 29: By drawing a picture describe the flow of genetic information from DNA to a protein.

• helps to determine paternity• identify a carrier of a particular

gene • solve a crime

Page 30: By drawing a picture describe the flow of genetic information from DNA to a protein.

What process or technique is used to help researchers analyze a person’s DNA and compare the sequence to other organisms?

Page 31: By drawing a picture describe the flow of genetic information from DNA to a protein.

Gel electrophoresis

Page 32: By drawing a picture describe the flow of genetic information from DNA to a protein.

What is the term used to describe which genes are turned “off and on” in order to synthesis necessary proteins for the organism?

Page 33: By drawing a picture describe the flow of genetic information from DNA to a protein.

Gene expression

Page 34: By drawing a picture describe the flow of genetic information from DNA to a protein.

When cloning a mouse, how many mice does the process require?

Page 35: By drawing a picture describe the flow of genetic information from DNA to a protein.

3 – A donor somatic cell (the cell being cloned), a donor egg cell and a surrogate.

The nucleus is removed from the donor egg cell and the somatic cell nucleus is implanted in the surrogate.