By drawing a picture describe the flow of genetic information from DNA to a protein.
-
Upload
vincent-todd -
Category
Documents
-
view
225 -
download
2
Transcript of By drawing a picture describe the flow of genetic information from DNA to a protein.
![Page 1: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/1.jpg)
By drawing a picture describe the flow of genetic information from DNA to a protein.
![Page 2: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/2.jpg)
What is the function of RNA?
![Page 3: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/3.jpg)
Transfers or relays genetic information
![Page 4: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/4.jpg)
What is the product of transcription?
![Page 5: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/5.jpg)
mRNA
![Page 6: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/6.jpg)
Where in the cell does transcription take place?
![Page 7: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/7.jpg)
Nucleus
![Page 8: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/8.jpg)
What is the product of translation?
![Page 9: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/9.jpg)
A protein
![Page 10: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/10.jpg)
Where in the cell does translation take place?
![Page 11: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/11.jpg)
At the ribosome
![Page 12: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/12.jpg)
True or false: During transcription, mRNA is being
synthesized from both sides (both backbones) of DNA.
![Page 13: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/13.jpg)
False: mRNA is a complement to only one side of DNA
![Page 14: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/14.jpg)
What determines which amino acid is brought to the ribosome during translation?
![Page 15: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/15.jpg)
The mRNA codon – use your codon chart.
Remember 1 codon = 1 amino acid!
![Page 16: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/16.jpg)
What bring the amino acids to the ribosome during translation?
![Page 17: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/17.jpg)
tRNA
![Page 18: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/18.jpg)
Given the DNA sequence find the mRNA sequence and the amino acid sequence:
TACGGACAC
![Page 19: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/19.jpg)
DNA: TACGGACACmRNA: AUGCCUGUGA.A.: Met-Pro-Val
![Page 20: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/20.jpg)
Removing a nucleotide from a DNA sequence is called ____________ mutation.
![Page 21: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/21.jpg)
Frameshift (deletion)
![Page 22: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/22.jpg)
What mutation is shown below:
ATTGGCTATCCGATTGGGTATCCG
![Page 23: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/23.jpg)
Point mutation (also called substitution)
![Page 24: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/24.jpg)
What is the major problem that could result from a mutation?
![Page 25: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/25.jpg)
An abnormal protein
![Page 26: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/26.jpg)
If a mutation does not cause a change in the amino acid sequence it is called a:
![Page 27: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/27.jpg)
Silent mutation
![Page 28: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/28.jpg)
Name 1 benefit of genetic engineering.
![Page 29: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/29.jpg)
• helps to determine paternity• identify a carrier of a particular
gene • solve a crime
![Page 30: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/30.jpg)
What process or technique is used to help researchers analyze a person’s DNA and compare the sequence to other organisms?
![Page 31: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/31.jpg)
Gel electrophoresis
![Page 32: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/32.jpg)
What is the term used to describe which genes are turned “off and on” in order to synthesis necessary proteins for the organism?
![Page 33: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/33.jpg)
Gene expression
![Page 34: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/34.jpg)
When cloning a mouse, how many mice does the process require?
![Page 35: By drawing a picture describe the flow of genetic information from DNA to a protein.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f2c5503460f94c473ca/html5/thumbnails/35.jpg)
3 – A donor somatic cell (the cell being cloned), a donor egg cell and a surrogate.
The nucleus is removed from the donor egg cell and the somatic cell nucleus is implanted in the surrogate.