By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs...
-
date post
21-Dec-2015 -
Category
Documents
-
view
218 -
download
1
Transcript of By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs...
![Page 1: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/1.jpg)
By: Brittany DuncanMentors:
Janet Sinsheimer PhD (UCLA)Mary Sehl M.D.(UCLA)
DNA repair SNPs Associated with Breast
Cancer
![Page 2: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/2.jpg)
What We Aim to Do
To ultimately determine: What SNP and Environmental factors
contribute to breast cancer Whether a combination of SNPs acting
independently might be significant SNP-SNP interactions associated with
breast cancer
![Page 3: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/3.jpg)
Why is this Important?
Medical: Determining SNP associations with Breast
Cancer would: Help predict and prevent future cases
Bioinformatics: Comparing two analysis techniques will:
Help to create generalized method for analyzing future SNP interactions
![Page 4: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/4.jpg)
SNP-Single Nucleotide Polymorphism
www.dnalandmarks.com/.../marker_systems_snp.html
•A single nucleotide change at one particular locus
•Must be present in at least 1% of the population
•Can result in genotypic and phenotypic effects
ACCGTTGTGACCTGCAGTGGAAACAGTATGA
ACCATTGTGACATGCAGTGGAAACAGTGTGA
![Page 5: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/5.jpg)
Mechanisms of DNA Repair
NER = nucleotide-excision repair, BER = base-excision repair, MMR = mismatch repair, DSBR =double strand break repair, DRCCD = damage recognition cell cycle delay response, NHEJ = non-homologous end-joining HR = Homologous Recombination
![Page 6: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/6.jpg)
DSBR pathway
DSBR pathway Double stranded break repair pathway
One mechanism responsible for the repair and maintenance of the integrity of DNA
BRCA1 and 2 key elements in this pathway
Vulnerability to breast cancer may be due to an individual’s capability in repairing damaged DNA
![Page 7: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/7.jpg)
Steps to Success
Recreate data found in previous paper
Implement Cordell and Clayton: Stepwise regression method
Write up results and Create tables
Future Direction: Compare results to Lasso method
![Page 8: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/8.jpg)
UCLA Cancer Registry
UCLA familial cancer registry Participants may have cancer or not but must
meet these criteria: Be 18 yrs or older Two family members with a same type of
cancer or related cancers Or must have a family history of cancer
susceptibility Mutation in BRCA1 or BRCA2 gene
http://www.registry.mednet.ucla.edu/
![Page 9: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/9.jpg)
Preliminary Work
Case/control study 399 Caucasian (unrelated) women were chosen
for study 104 SNPs in 17 genes of the DSBR pathway were
chosen Logistic regression analysis conducted on each SNP
to determine associations with breast cancer Adjusted models to include covariates
Findings 12 significant SNPs
![Page 10: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/10.jpg)
Confirming Data:The Process
![Page 11: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/11.jpg)
First Step: Defining Variables
Genotype. Frequency DV DVG – G 199 +0 +0A – G 143 +1 +1A – A 19 +2 +1
Additive• A allele confers risk in having breast cancer and
A-A even more soDominant• A allele confers risk in having breast cancer
regardless of number of copies
Example of SNP rs16889040 on RAD21 gene, Chromosome 5
Additive Dominant
![Page 12: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/12.jpg)
Coefficients: Estimate Std. Error z value Pr(>|z|) (Intercept) -1.42388 0.72444 -1.965 0.049358 age 0.04464 0.01305 3.419 0.000628 brca1 0.49067 0.39063 1.256 0.209079 brca2 -0.11683 0.49631 -0.235 0.813896 EDUCATION1 0.08139 0.33849 0.240 0.809976 EDUCATION2 0.28671 0.34757 0.825 0.409424 Ashkenazi_status -0.68789 0.28608 -2.405 0.016192 SNP -0.76382 0.27855 -2.742 0.006104
Logit(Y) = B0 + B1X1 ….+ Bn Xn
Example output from Logistic Regression Dominant Model rs16889040
Education
![Page 13: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/13.jpg)
MRE11A
NBS1 RAD50
ATM
BRCA1
XRCC6 XRCC5
DNA-PK
XRCC4LIG4
ZNF350
BRIP1
RAD51
BRCA2
RAD54L
RAD52
XRCC2
XRCC3
TP53
Double-Strand Break
Repaired DNA
Non-Homologous End Joining
H2AX
H2AX
RAD21
Homologous Recombination
![Page 14: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/14.jpg)
Cordell and Clayton Method:Stepwise Logistic Regression
![Page 15: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/15.jpg)
Stepwise Logistic Regression:
Stepwise logistic regression Cordell and Clayton Method used 8 genes that had significant SNPs in
them Ran forward regression analysis on each gene
Performed LRT and from test found p-value
![Page 16: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/16.jpg)
Cumulative Effects
Cumulative Effects: SNPs in model but act independently
Findings: No Accumulation of SNPS were
found significant
![Page 17: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/17.jpg)
Interactive Effects
Multiplicative effects- interaction between SNPs
Findings: RAD21 Gene interesting but not enough information to be
considered significant SNPd: SNPf SNPd: SNPg SNPf: SNPg
Three way interaction was found to be not significant
SNPd = rs16888927
SNPf = rs16888997
SNPg = rs16889040
![Page 18: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/18.jpg)
SNP Interactions
SNPs OR(eβ) p-value .
SNPd: SNPf 1.81212 0.090404
SNPd: SNPg 1.76986 0.096392
SNPf: SNPg 1.78383 0.090659
Using p-value threshold of 0.05
![Page 19: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/19.jpg)
Special Thanks
To my amazing mentors at UCLA: Janet Sinsheimer PhD, Biostatistics lab Mary Sehl M.D., Dr. Sinsheimer’s lab UCLA
For making the SoCalBSI program possible: The wonderful mentors at California State Los Angeles
Dr. Momand , Dr. Warter Perez, Dr. Sharp, Dr. Johnston, Mr. Johnston, Dr. Huebach, Dr. Krilowicz
Program Coordinator Ronnie Cheng
Funding: American Society of Clinical Oncology – Mary Sehl National Science Foundation - SOCALBSI National Institute of Health - SOCALBSI Economic and Workplace Development -SOCALBSI
![Page 20: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/20.jpg)
Question Slides
Recoding for Education
Why Use Education?
Why Only Caucasian Women?
LRT/Chi^2
NEHJ and HR
Multiple vs Independent
LRT Test
Three Way Interaction
OR
Lasso Method
![Page 21: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/21.jpg)
Recoding for Education Logistic Regression Education: 1-8 answers in a survey
1-3 highest education high school (control) 4-5 some college 6-8 higher education Educ1 Educ21-3 0 0 μ1 = μ + 0X α1 + 0Xα24-5 1 0 μ2 = μ + 1X α1 + 0X α26-8 0 1 μ3 = μ + 0X α1 + 1X α2
Coded in 0 and 1 transformation from linear to logistic Linear: Y = B0 + B1X1 ….+ Bn Xn
Logistic: ln[ pi/(1-pin) ] = B0 + B1X1 ….+ Bn Xn Y == {0,1} Essentially the log of the probability of the odds
Back
![Page 22: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/22.jpg)
Why Use Education as a Covariate?
Routinely include at least 1 socioeconomic covariate
Education: Not necessarily because statistically
interesting, but because other studies have repeatedly found significance
Back
![Page 23: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/23.jpg)
Why Only White Women?
Homogeneous Population In different populations (men and other
ethnicities), different genes may be involved Not enough sampling of any other group How data was found:
Registry Website and Questionnaire in English Location of UCLA Etc…
Back
![Page 24: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/24.jpg)
LRT
Roughly estimated as a chi-squared distribution
X2= 3.84 for 1 df
P-val = .05
http://www.union.edu/PUBLIC/BIODEPT/chi.html Back
![Page 25: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/25.jpg)
Cell cycle with NEHJ and HR
Alignment and ligation of termini at DSB
HR
http://www2.mrc-lmb.cam.ac.uk/personal/sl/Html/Graphics/CellCycle.gifLord, Garret, Ashworth Clin Cancer Res 2006; 12(15)
GC- use sister chromatid as template
SSA-homologous sequences aligned, residues no longer present are deleted Back
![Page 26: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/26.jpg)
Multiple vs. Acting Independently
Cumulative:
logit(P(Y)) = α + βTz +Ɣ1SNP1 + Ɣ2SNP2
Multiplicative:
logit(P(Y)) = α + βTz +Ɣ1SNP1 + Ɣ2SNP2 +Ɣ3SNP1*SNP2
Covariates
Independent
Combination of two
Back
![Page 27: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/27.jpg)
LRT Test
Equ: LRT= 2ln(L(HA)/L(H0) )
For a 1 df, 3.84 or higher corresponds to a p-value of 0.05 or lower
Alternative model fits the data better
Less than 3.84
Null model fits the data better
Testing for which model fits the data better
Back
![Page 28: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/28.jpg)
Three Way Interaction
logit(P(Y)) = α + βTz +SNPd + SNPf + SNPg +SNPd*SNPf*SNPg
Covariates
Back
![Page 29: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/29.jpg)
ODDS RATIO
Coded in 0 and 1 transformation from linear to logistic Linear: Y = B0 + B1X1 ….+ Bn Xn
Logistic: ln[ pi/(1-pin) ] = B0 + B1X1 ….+ Bn Xn
Y == {0,1}
Odds Ratio is eB because of Logistic Regression’s Transformed form
Back
![Page 30: By: Brittany Duncan Mentors: Janet Sinsheimer PhD (UCLA) Mary Sehl M.D.(UCLA) DNA repair SNPs Associated with Breast Cancer.](https://reader035.fdocuments.us/reader035/viewer/2022062421/56649d545503460f94a3122b/html5/thumbnails/30.jpg)
Lasso Penalized Regression
Exploratory method used when large amount of predictors and small amount of data
Penalizes model for having to many borderline significant predictors
F(θ) = 1/2Σi(yi - μ –Σj(xijβj))2 + λΣj| βj |
Least Squares Penalty Term
Back