BOECHERA SPARSIFLORA BOECHERA PULCHRA, AND
Transcript of BOECHERA SPARSIFLORA BOECHERA PULCHRA, AND
GENE EXPRESSION ANALYSIS OF HEAT-SHOCK PROTEINS IN
BOECHERA SPARSIFLORA, BOECHERA PULCHRA, AND
BOECHERA DEPAUPERATA WHEN EXPOSED TO
VARIOUS DEGREES OF HEAT STRESS
______________
A Thesis
Presented to the
Faculty of
San Diego State University
______________
In Partial Fulfillment
of the Requirements for the Degree
Master of Science in Biology
with a Concentration in
Molecular Biology
______________
by
Gillian Mary Halter
Summer 2012
iii
Copyright © 2012
by
Gillian Mary Halter
All Rights Reserved
iv
ABSTRACT OF THE THESIS
Gene Expression Analysis of Heat-Shock Proteins in Boechera sparsiflora, Boechera pulchra, and Boechera depauperata when
Exposed to Various Degrees of Heat Stress by
Gillian Mary Halter Master of Science in Biology with a Concentration in Molecular
Biology San Diego State University, 2012
Plants are frequently subjected to heat stress, and this stress is known to negatively
impact plant growth and agronomic yield. High temperature stress induces the heat shock proteins (HSPs). HSPs are molecular chaperones that aid other proteins so that they can function normally in stressful conditions. They assist other proteins with folding and prevent irreversible aggregation. This molecular machinery is vital for an organism to maintain homeostasis. It has been demonstrated that HSPs are expressed at higher levels in plants as they are exposed to higher levels of heat stress. The Boechera species are all found in California but have different distributions. B. sparsiflora is coastal, B. pulchra is a desert species, and B. depauperata is found in the mountains. Previous studies have found that the Boechera species vary in thermotolerance. The goal of this study is to examine the gene expression patterns of HSP genes in B. sparsiflora, B. pulchra, and B. depauperata. In order to more fully understand the role of the HSPs in thermotolerance I examined, with QPCR, the gene expression patterns of key genes and HSPs. The crucial genes that were examined include: HSFA3, HSP101, HSP20 I, HSP18.2 I, HSP17.7 II, HSP17.6 II, HSP21 CP, and RuBisCO activase. I generated gene expression profiles for these genes in A. thaliana and in the three Boechera species. I analyzed these results in light of previous studies demonstrating that each of these species have different levels of organismal thermotolerance. Here I present evidence that the Boechera species do not upregulate HSPs during heat stress to the same extent as A. thaliana. This suggests that Boechera has other mechanisms that provide thermotolerance.
v
TABLE OF CONTENTS
PAGE
ABSTRACT ............................................................................................................................. iv
LIST OF TABLES .................................................................................................................. vii
LIST OF FIGURES ............................................................................................................... viii
CHAPTER
INTRODUCTION .................................................................................................................... 1 Thermotolerance is Important in Our Warming World ...................................................... 1 The Cellular Response to Heat Stress ................................................................................. 1 Types of Heat Shock Proteins ............................................................................................. 3 Plant Heat Shock Proteins ................................................................................................... 3 Study Species ...................................................................................................................... 4 Genes Examined in This Study ........................................................................................... 5
MATERIAL AND METHODS ................................................................................................ 8 Growth of Plants ................................................................................................................. 8 Heat Shock Experiments ..................................................................................................... 8 RNA Isolations .................................................................................................................. 10 cDNA Production .............................................................................................................. 10 QPCR Primer Design ........................................................................................................ 14
B. sparsiflora ............................................................................................................... 16 B. pulchra .................................................................................................................... 16 B. depauperata ............................................................................................................ 16
QPCR Experimental Design ............................................................................................. 17 Reference Gene Analysis .................................................................................................. 18
RESULTS ............................................................................................................................... 23 HSFA3 .............................................................................................................................. 26 HSP101 ............................................................................................................................. 26 HSP20 I ............................................................................................................................. 28 HSP18.2 I .......................................................................................................................... 28
vi
HSP17.7 II ......................................................................................................................... 30 HSP17.6 II ......................................................................................................................... 31 HSP21 CP ......................................................................................................................... 32 RuBisCO Activase ............................................................................................................ 33
DISCUSSION ......................................................................................................................... 39 FUTURE DIRECTIONS ........................................................................................................ 45 REFERENCES ....................................................................................................................... 47
vii
LIST OF TABLES
PAGE
Table 1. A. thaliana Specific Genes Chosen for qRT-PCR Experiments, with TAIR Gene Identifier and Cellular Location .......................................................................... 6
Table 2. Eppendorf MasterCycler Gradient Thermal Cycler Protocol ................................... 14 Table 3. Arabidopsis Thaliana Specific Primers for qRT-PCR Experiments for each
Gene of Interest with Amplicon Size (bp) and Average Amplification Efficiency + SD ........................................................................................................... 15
Table 4. qPCR Protocol Used for BioRad IQ5 ThermaCycler ............................................... 17 Table 5. A. thaliana RNA Concentrations, Ratio of the Absorbance at 260 nm and
280 nm, and Ratio of the Absorbance at 260 nm and 230 nm .................................... 23 Table 6. B. sparsiflora RNA Concentrations, Ratio of the Absorbance at 260 nm and
280 nm, and Ratio of the Absorbance at 260 nm and 230 nm .................................... 24 Table 7. B. pulchra RNA Concentrations, Ratio of the Absorbance at 260 nm and
280 nm, and Ratio of the Absorbance at 260 nm and 230 nm .................................... 24 Table 8. B. depauperata RNA Concentrations, Ratio of the Absorbance at 260 nm
and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm ............................. 25 Table 9. HSFA3 Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ..................... 27 Table 10. HSP101 Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ................. 28 Table 11. HSP20 I Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ................. 30 Table 12. HSP18.2 I Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures .............. 32 Table 13. HSP17.7 II Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ............. 33 Table 14. HSP17.6 II Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ............. 35 Table 15. HSP21 CP Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures .............. 36 Table 16. RuBisCO Activase Mean Fold Changes (ΔΔCt) ± SEM for Select
Temperatures ............................................................................................................... 38
viii
LIST OF FIGURES
PAGE
Figure 1. The role of HSPs in the cell. ...................................................................................... 2 Figure 2. Diagram of heat-shock experiments, showing both basal and acquired
heat-shock experiments. ................................................................................................ 9 Figure 3. Schematic of experimental process. .......................................................................... 9 Figure 4. BioAnalyzer results for A. thaliana RNA- basal heat-shock treatments. ................ 11 Figure 5. BioAnalyzer results for A. thaliana and B. depauperata RNA- acquired
heat-shock treatments. ................................................................................................. 11 Figure 6. BioAnalyzer results for B. depauperata RNA- basal heat-shock treatments. ......... 12 Figure 7. BioAnalyzer results for B. sparsiflora RNA- basal heat-shock treatments. ............ 12 Figure 8. BioAnalyzer results for B. sparsiflora and B. pulchra RNA- acquired
heat-shock treatments. ................................................................................................. 13 Figure 9. BioAnalyzer results for B. pulchra RNA- basal heat-shock treatments. ................. 13 Figure 10. Relative expression of reference genes in A. thaliana .......................................... 19 Figure 11. Relative expression of reference genes in B. sparsiflora ...................................... 20 Figure 12. Relative expression of reference genes in B. pulchra ........................................... 21 Figure 13. Relative expression of reference genes in B. depauperata .................................... 22 Figure 14. Relative expression of HSFA3 in (A) A. thaliana and (B) B. depauperata. ......... 26 Figure 15. Relative expression of HSP101 in (A) A. thaliana and (B) B. depauperata. ........ 27 Figure 16. Relative expression of HSP20 I in (A) A. thaliana, (B) B. sparsiflora,
(C) B. pulchra, and (D) B. depauperata ..................................................................... 29 Figure 17. Relative expression of HSP18.2 in (A) A. thaliana, (B) B. sparsiflora,
(C) B. pulchra, and (D) B. depauperata ..................................................................... 31 Figure 18. Relative expression of HSP17.7 II in (A) A. thaliana, (B) B. sparsiflora,
(C) B. pulchra, and (D) B. depauperata.. ................................................................... 34 Figure 19. Relative expression of HSP17.6 II in (A) A. thaliana and
(B) B. depauperata ...................................................................................................... 35 Figure 20. Relative expression of HSP21 CP in (A) A. thaliana, (B) B. sparsiflora,
(C) B. pulchra, and (D) B. depauperata. .................................................................... 37 Figure 21. Relative expression of RuBisCO activase in (A) A. thaliana and
(B) B. depauperata ...................................................................................................... 38
1
INTRODUCTION
THERMOTOLERANCE IS IMPORTANT IN OUR WARMING WORLD
There are many types of stressors that organism encounter which can compromise
their ability to maintain homeostasis. The fitness of an organism depends on its ability to
survive and to procreate in its environment. Organisms are also in competition with each
other to obtain resources. Adding an unexpected factor to their habitat may compromise the
ability of the organism to perform other important routine functions. It is crucial for
organisms to develop and to pass on genes that will be useful to them and their progeny in a
variable environment. Therefore, the organisms that have the best mechanisms to deal with
unexpected or extreme conditions have a better chance of surviving as a species in general
[1]. One of the most relevant stressors in our current ecosystem is heat stress. The global
environment is currently dealing with an increase in climate temperatures [2]. Adaptation to
these changes is possible via the aid and rescue of Heat Shock Proteins (HSPs).
THE CELLULAR RESPONSE TO HEAT STRESS An essential coping mechanism for all organisms during heat shock is the expression
of HSPs. These proteins are molecular chaperones, that is they assist other proteins in
maintaining their proper 3-dimensional structure so that they are able to carry out their
normal role within the organism [3]. It is known that HSPs are chaperones, that is they assist
in protein folding [4] (see Figure 1). In vitro studies have shown that some HSPs prevent
irreversible aggregation due to heat stress [5]. This is critical for protein processes such as
plasma membrane transport, oligomeric assembly, and regulation of receptor activity [6].
HSPs may become more frequently expressed in many species as global warming continues.
It is important that scientists continue to study the mechanism behind the HSPs as well as
how these proteins relate to the thermotolerance ability of different species. Still, there is
much work to be done on the behavior and mechanisms of heat-shock proteins.
Protein aggregation is problematic for any organism while trying to maintain
homeostasis. There are also various ways in which organisms deal with proteins that have
2
Figure 1. The role of HSPs in the cell. Source: Tyedmers J, Mogk A, Bukau B: Cellular strategies for controlling protein aggregation. Nat Rev Mol Cell 2010, 11:777-788.
been folded into their nonnative state. Bacteria have inclusion bodies that accumulate the
misfolded proteins during stressful situations. They can then properly dispose of the proteins
or use the assistance of the HSP system to disaggregate the protein [7]. Yeast has two
methods for processing aggregated proteins. Soluble, ubiquitylated proteins are disposed of
in the juxtanuclear quality-control compartment (JUNQ) and insoluble, irreversibly
aggregated proteins are disposed of in the perivacuolar insoluble protein deposit (IPOD) [7].
Mammals have an inclusion body called an aggresome, which is not constitutively expressed
in the cell and is induced by other distressed proteins [8]. Usually, misfolded proteins are
ubiquitylated before being transported to the aggresome, but this is not always the case.
Mutations in this machinery have been linked to the cause of several human diseases
including Alzheimers, Parkinson’s, and cystic fibrosis [9]. Overall, the chaperone system is a
necessary and conserved method responsible for the reactivation of aggregated proteins [7].
HSPs have been found in all organisms from bacteria to humans. They are an essential aid to
many plant species as well.
OligomerDimer
sHSP–substratecomplex
Disaggregation
Hsp70ClpB and Hsp70
Low substrateaffinity
High substrateaffinity
Heat shock
Heat shock
Heat shock
Misfolded protein Native protein
AutophagosomeA double-membrane vesicle in the cytoplasm that includes intracellular components for lysosomal degradation.
The ATP- and ubiquitin-dependent AAA+ chaperone valosin-containing protein (VCP; also known as p97) is another candidate for exerting disaggregation activity in the cytosol of animal cells (see TABLE 1). Like ClpB and Hsp104, VCP contains two ATPase domains and acts in numerous cellular activities by cooper ating with many adaptor proteins109. VCP mutations are linked to inclusion body myopathy with early-onset Paget’s disease and frontotemporal dementia (IBMPFD) and loss of VCP function in mammalian cells leads to the accumulation of insoluble ubiquitylated proteins110,111. VCP also associates with polyubiquitylated aggregates generated on proteasomal inhibition, and their sub-sequent solubilization requires VCP activity112. Direct evidence for a disaggregation activity of VCP is, how-ever, still missing. The potential function of VCP in aggregate clearance may relate to its role in aggresome formation113. Thus, VCP mutations can lead to changes in aggregate localization, thereby potentially affecting aggregate clearance.
Distinct roles of the ubiquitin proteasome system in formation and clearance of protein aggregates. Degradation by cellular proteases is an alternative route for the elimination of protein aggregates. In view of the limited refolding activity found in higher eukaryotes, the degradation route might have gained increasing importance in multicellular organisms. The 26S pro-teasome is the central cellular machine responsible for the degradation of soluble, misfolded proteins, thereby preventing protein aggregation (TABLE 1). Inhibition of proteasomal degradation can cause neurodegenera-tion, underlining the crucial function of the ubiqui-tin proteasome system in protein degradation114, 115.
Misfolded proteins are recognized and marked for deg-radation by different specific E3 ubiquitin ligases, often in concert with Hsp70 chaperones. The most promi-nent examples of E3 ubiquitin ligases are C terminus of HSP70-interacting protein (CHIP) in mammals116, Ubr1 and San1 in yeast117–119,120, and HMG-CoA reduct-ase degradation protein 1 (Hrd1; also known as Der3) and Doa10 for proteins derived from the endoplasmic reticulum13.
A role of the ubiquitin proteasome system in the deg-radation of pre-existing protein aggregates is suggested by the presence of ubiquitylated proteins in protein inclusions, the frequent co-localization of the 26S pro-teasome with protein aggregates and the increased aggregate formation and delayed removal of aggre-gates on inhibition of proteasomal activity57,76,115,121–124. However, the involvement of the ubiquitin proteasome system in aggregate clearance may be less important than suggested by these observations. The 26S pro-teasome cannot degrade aggregates in vitro125,126, and aggregates even reduce proteasomal activity in vivo127 by irreversible sequestration of proteasomes or other effects128,129. Together, these findings do not support a major contribution of 26S protea somes in the removal of pre-existing aggregates. They also indicate that the increased levels of aggregated proteins observed on proteasomal inhibition are a consequence of increased levels of misfolded proteins caused by substrate stabi-lization and the obstruction of other quality-control pathways.
Aggregate clearance by autophagy
Macroautophagy uses specialized, cytosolic, double-membrane structures that engulf substrates to form autophagic vesicles that ultimately fuse with the lyso-some for degradation of their content19,20. It has tradi-tionally been viewed as a rather unspecific degradative pathway, in which cytosolic contents and organelles are turned over in a non-selective manner. More recently, however, a form of selective macroautophagy has been identified as a major contributor in the clearance of misfolded and aggregated proteins in the cytosol of mammalian cells14,18–20. Initially, aggregates of pro-teins involved in neurodegenerative disease, such as α-synuclein or mutant huntingtin, were identified as substrates for this type of autophagy130–132, which was regarded as a back-up system to complement protea-somal degradation when it is overwhelmed or incapable of dealing with specific aggregated substrates. In agree-ment with this, autophagy was also suggested to have a role in the clearance of aggresomes130,131,133,134 (FIG. 5). Interestingly, one of the main players of aggresome formation, HDAC6, also controls a step that is essen-tial for aggregate turn over by autophagy; the fusion of autophagosomes with lysosomes by the recruitment of the actin-remodelling machinery that is involved in this process135. An implication for autophagy in the clear-ance of misfolded proteins under more physiological conditions came from the observation that the con-ditional knock out of genes essential for autophagy, autophagy protein 5 (Atg5) and Atg7, in mouse liver and
Figure 4 | The role of small heat shock proteins in protein aggregation. Small heat shock
proteins (sHSPs) are in equilibrium between oligomeric structures and exchanging subunits.
They can exist in two states, with a low and high substrate affinity, respectively. During heat
shock, the equilibrium shifts towards the high affinity state, which can then form a stable
complex with substrates, such as the misfolded proteins that arise during the heat shock.
The stable sHSP–substrate complex is thought to prevent irreversible aggregation and
can facilitate the re-solubilization of aggregated proteins by the bi-chaperone system,
consisting of Hsp104 and the Hsp70 chaperone system, or by Hsp70 only.
REVIEWS
NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 11 | NOVEMBER 2010 | 783
© 20 Macmillan Publishers Limited. All rights reserved10
Tyedmers et al. 2010
3
TYPES OF HEAT SHOCK PROTEINS HSPs are organized into 5 superfamilies: HSP100, HSP90, HSP70, HSP60
(chaperonins), and the small Heat Shock Proteins. Each are classified based on their structure
and molecular weight [5]. Native proteins shield their hydrophobic areas on their interior so
that they do not bind with the hydrophilic cell. The outer part of the protein consists of
hydrophilic regions. The hydrophobic regions are exposed when the protein is folded into an
unnatural state due to a stressor. Chaperone protein synthesis occurs when the hydrophobic
amino-acid residues of a protein are accessed. The HSPs then rescue the deformed protein
during stressful conditions by refolding the protein into its native state [10].
Small HSPs (sHSPs) are a class of heat-shock proteins proven to assist in maintaining
homeostasis in the cell by preventing irreversible aggregation [11]. This cellular mechanism
has implications in the protection against oxidative stress and aging, heat stress, apoptosis, as
well as with neurological diseases. Small HSPs have also been found in all living organisms
with the exception of some pathogenic bacteria. These proteins are not constitutively active
and have found to be turned on during stressful situations. Research has shown that sHSPs
have different sequences as well as sizes among different species, however their activity
remains similar [4].
PLANT HEAT SHOCK PROTEINS HSPs work together as a molecular chaperone machine in order to aid a protein that
has been misfolded into its nonnative state (see Figure 1). HSP70’s are the first to interact
with aggregated proteins. They block proteases from binding to the misfolded protein and
they also facilitate the transport of the protein to the HSP100/ClpB complex [7]. The HSP100
family has been proven to be necessary in the thermotolerance of several organisms. The job
of the HSP100/ClpB family of proteins is to interact with aggregated proteins in order to
make the substrate on the nonnative protein exposed for HSP70 to then work with. Studies
have show that HSP101 is necessary for thermotolerance in a variety of species. Researchers
have conducted knock out studies of HSP101 in A. thaliana. These plants were able to grow
normally but had no tolerance of heat stress [12]. Interestingly, Tonsor et al. showed that
HSP101 is more highly expressed in populations at higher latitude [13]. The authors suggest
that HSP101 expression is important in emergency high-temperature tolerance. They also
4
reported that there were trade-offs to high expression of HSP101. These trade-offs include
reduced root growth and lower fruit production. Thus HSP101 expression can be costly to
plant growth and reproduction. Small HSPs are responsible for keeping the misfolded
proteins in a form in which they can be refolded [3]. A number of studies have found that
expression of sHSPs is correlated to thermotolerance [14]. However, plants can have more
than 30 sHSPs and no single sHSP has the same impact on thermotolerance that HSP101 has
been demonstrated to have. Together, all of the HSP families work together to assist and
support stressed proteins so that they may be refolded and are able to perform their metabolic
processes properly.
There are eleven classes of small HSPs in plants that are classified according to their
cellular location. Six of the classes are found in the cytosol and in the nucleus (class I-VI),
and the other three are localized in the plastids, the mitochondria, or the endoplasmic
reticulum [14]. The small HSPs are named so because of their low molecular weight of
15-43 kDa. All small HSPs have the same conserved 90-amino acid carboxyl-terminal
domain, also known as the heat shock domain. One of the main roles of the small HSPs is to
bind stressed proteins, prevent their further aggregation, and to then work with other HSPs to
refold the stressed protein back into their native state [3].
The sHSP families that are of interest to our lab include HSP20 cytosolic class I,
HSP18.2 cytosolic class I, HSP17.7 cytosolic class II, HSP17.6 cytosolic class II, and HSP21
chloroplast. HSP21 CP is an essential tool in maintaining the integrity of the chloroplast
during heat shock.
STUDY SPECIES Arabidopsis thaliana has been extensively studied as a plant model organism. There
have been many HSPs identified in A. thaliana; including Hsp100, Hsp70, HSP90, and small
HSPs. Like the other better-studied HSP chaperone families, the small HSP family has been
found to prevent the aggregation of other proteins in vitro [15]. They have also been
identified as support proteins involved in photosystem II [16]. Photosystem II is a protein
complex that assists in ATP generation during photosynthesis [17]. It has been hypothesized
that the main role of small HSPs (HSP21) is the protection of photosynthesis during heat
stress [15]. Photosynthesis is the process in which plants use energy from sunlight in order to
5
break down carbon dioxide into sugars and releasing oxygen into the atmosphere, which is an
essential nutrient to other life forms on Earth. Therefore, the role of small HSPs in the cell is
crucial for plant survival.
I am interested how these heat-shock proteins are expressed in Boechera
depauperata, Boechera pulchra, and Boechera sparsiflora. Arabidopsis thaliana is the plant
model organisms and is closely related to these four Boechera species. This makes it a useful
comparison species since it’s genome has been sequenced and is publicly accessible using
The Arabidopsis Information Resource (TAIR) website [18].
Boechera is a genus that is North American and is closely related to Arabidopsis.
Gene expression levels of HSPs have not yet been studied in Boechera. Therefore, I plan to
compare gene expression patterns of these HSP families in B. pulchra, B. depauperata, and
B. sparsiflora. These species are all found in California but have different distributions. One
is a coastal species (B. sparsiflora), one is a desert species (B. pulchra), and B. depauperata
is found in the mountains.
GENES EXAMINED IN THIS STUDY In this study I examined the gene expression patterns of the following genes: HSFA3,
HSP101, HSP20 I, HSP18.2 I, HSP17.7 II, HSP17.6 II, HSP21 CP, and RuBisCO Activase.
Table 1 shows the name of each gene with the TAIR gene identification number and the
cellular location of the gene. HSFA3 is a heat shock factor that is named AT-HSFA3 in the
A. thaliana genome (Table 1). There are 21 HSFs found in Arabidopsis. HSFA3 is a
transcriptional activator that is regulated by the transcription factor, Dehydration-Responsive
Element Binding Protein 2A (DREB2A). This transcription factor is the activator of many
heat shock genes. Transcription factors are transcribed in the nucleus and are translated in the
cytoplasm. HSFs transcriptionally regulate the heat shock genes by binding to HSEs, which
are dispersed throughout the genome. The HSFs recognize the sequence that encodes the
HSEs, thereby turning the heat shock genes on or off [19].
HSP101 [20] is one of the most studied heat-shock proteins in the HSP100 gene
family. This HSP is also located in the cytosol of cells. Previous research has shown that
HSP101 is necessary for heat tolerance in plants [21]. The activity of HSP101 is required for
survival during heat stress in A. thaliana. It has also been found that HSP101 is not necessary
6
Table 1. A. thaliana Specific Genes Chosen for qRT-PCR Experiments, with TAIR Gene Identifier and Cellular Location
Gene Description Gene Identifier Cellular Location 18S AT2G03810 ribosome Actin 3 AT3G53750 cell wall, cytoskeleton HSFA3 AT5G03720 nucleus HSP101 AT1G74310 cytosolic HSP20 I AT1G53540 cytosolic I HSP18.2 I AT5G59720 cytosolic I HSP17.7 II AT5G12030 cytosolic II HSP17.6 II AT5G12020 cytosolic II HSP21 CP AT4G27670 chloroplast RuBisCO Activase AT2G39730 chloroplast
in seed growth and development in A. thaliana [12]. This suggests that the primary role of
this HSP is in thermotolerance. HSP100 and HSP70 proteins assist with disaggregation using
a method that is still being investigated (see Figure 1). It is thought that the system unravels
the aggregated polypeptides. It then transfers them to the central channel in the Clp/HSP104
system where they are unfolded using ATP hydrolysis. The polypeptides are then freed and
refolded naturally or with the help of the HSPs [10].
HSP20 I (AT1G53540) is another cytosolic class I heat-shock protein that responds to
heat (Table 1). This gene is located on chromosome 1. It is phylogenetically related to
HSP18.2 I based on amino acid sequences [22]. HSP18.2 I is a small heat shock protein that
is induced by heat shock (Table 1). It is a class I cytosolic heat-shock protein and is located
on chromosome 5. HSP18.2 I is highly expressed in vegetative tissues, however, it is not
expressed during seed development [23].
HSP17.7 II (AT5G12030) is a cytosolic class II small heat shock protein that is
activated during heat stress as well as osmotic stress (Table 1). It was shown that this
molecular chaperone was induced during mild heat-shock (37°C) in A. thaliana cells. The
same study also found an inhibitory effect of these two HSPs when the plants were treated
with Salicylic Acid [24]. Both HSP17.7 II and HSP17.6 II are induced by osmotic stress as
well as heat stress [14]. HSP17.6 II (At5g12020) is another cytosolic class II small HSP that
is also located on chromosome 5. It is a sister protein to HSP17.7 II when phylogenetically
comparing amino acid sequences. It is classified as an HSP20-like chaperone protein [22]. It
7
is expressed during heat stress and is not known to be expressed under control or
non-stressed conditions.
HSP21 CP (AT4G27670) is a small heat shock protein located in the chloroplast of
plant cells and is 21kDa in size. It is located on chromosome 4 [22]. This protein accumulates
in the presence of a stressor and is not found in the cell during homeostasis. It is also stable
during recovery conditions, having a half-life of more than 50 hours. There has been
evidence of HSP21 CP functioning to protect photosystem II in the chloroplast [3].
RuBisCO activase is a chaperone protein that aids the RuBisCO (Ribulose-1,
5-biphosphate carboxylase oxygenase) protein, which is also involved in the photosynthetic
process. It is an enzyme that is highly involved in catalyzing photosynthesis in plants.
Previous studies have shown that the deactivation of this enzyme occurs at temperatures
above 30-32°C and that RuBisCO activase gene expression is altered during heat stress [25].
The goal of this project is to see how these HSPs and RuBisCO Activase are
expressed in A. thaliana, B. sparsiflora, B. pulchra, and B. depauperata. I would like to find
the maximum temperature at which these genes are expressed in A. thaliana as well as
B. sparsiflora, B. pulchra, and B. depauperata. The expression levels of these genes and the
patterns of expression along varying temperatures will only further our understanding of heat
tolerance in plants. Studying the expression of the small HSPs as well as HSP101 will help
us to gain insight into the genetic mechanism underlying the different thermotolerance
abilities in these four species.
8
MATERIAL AND METHODS
GROWTH OF PLANTS The Boechera plants were grown at San Diego State University to produce bulk seed.
The seed sources are described in Leann Ortmann’s thesis [26]. Seeds were then sterilized
using the ARBC guidelines [27]. They were then plated on MS agar plates with 10 seeds per
plate, 5 plates per treatment for each species in order to grow enough tissue for each
heat-treated sample [27]. The seeds were vernalized for 4 days at 4°C before being placed
into the growth chamber at 22°C. However, B. depauperata requires a 12-15 day
vernalization period. The seeds were then grown for 10-12 days before heat-shock
experiments were performed. They were grown in an E-36L Percival growth chamber with a
light intensity of 150µE.
HEAT SHOCK EXPERIMENTS Ten-day old seedlings were treated with a basal heat-shock or an acquired heat-shock
(Figure 2).
Basal heat-shock was performed by taking the seedlings from their optimal growth
temperature of 22°C and placed into a heat-shock chamber set at one of the following
temperatures for 2 hours: 30°C, 32°C, 34°C, 36°C, 38°C, 40°C, or 42°C. Our initial
A. thaliana basal heat-shock experiments were performed at 34°C, 35°C, 36°C, 38°C, 39°C,
40°C, 41°C, and 42°C for 2 hours.
Acquired heat-shock occurs when an organism is exposed to an hour of heat-shock at
38°C followed by an hour at their optimal temperature of 22°C for a short recovery period,
and then another heat-shock treatment of two hours at a temperature above 38°C. I examined
gene expression after the following acquired treatments of 2 hours at 40°C, 41°C, or 42°C.
Samples were also taken during the pretreatment and recovery periods of the heat-shock
experiment in order to understand more about the acquired behavior of these plants
(Figure 2). The plant tissue was flash frozen in liquid nitrogen for future analysis. The
experimental plan is as shown in Figure 3.
9
Figure 2. Diagram of heat-shock experiments, showing both basal and acquired heat-shock experiments.
Figure 3. Schematic of experimental process.
Basal heat shock:
Acquired heat shock:
10-12 day tissue growth 2 hour H-S
(22°C) (30 - 42°C)
Flash freeze
10-12 day tissue growth 1 hour 1 hour 2 hour H-S
(22°C) (38°C) (22°C) (39 - 45°C)
Flash freeze
Figure 2: Schematic of Heat Shock Experiments
Figure 3: Schematic of the Experimental Process
Heat-Shock Tissue
- basal and acquired (@various temperatures)
Isolate RNA - DNAse treatment
BioAnalyzer quality check
cDNA synthesis
quantitative-PCR
Data analysis
Grow tissue
10
RNA ISOLATIONS After subjecting the seedlings to heat-shock, they were pulled from the agar plates
and flash frozen in liquid Nitrogen in order to freeze the cells right at the point of heat-stress.
Tissue was stored in the -80°C freezer and was then ground into a fine powder for 5-10
minutes using a chilled mortar and pestle as well as liquid Nitrogen. About 100 mg of ground
tissue was used for each sample in order to isolate enough messenger RNA to use for the
cDNA synthesis. RNA extractions were performed using the Ambion RNAqueous® 4-PCR
kit along with Plant RNA Isolation Aid. The RNA was also treated with the Ambion
DNA-freeTM kit in order to in order to eliminate any DNA contaminants including genomic
DNA or DNAses. This was done to ensure that I was amplifying the protein encoding part of
the gene (cDNA) during the Reverse Transcription step.
RNA concentrations were measured using the Implen NanoPhotometer® Pearl using
1uL of RNA in elution buffer in order to obtain concentrations as well as RNA quality.
Isolated RNA was used for the rest of the workflow only if the 260/280 ratios were between
1.8 and 2.4 to ensure that I was using pure RNA that was not contaminated with protein. All
samples had a 260/230 ratio over 1.1 in order to make sure the DNAse treatment successfully
removed the genomic DNA. Concentrations, 260/280 ratios, and 260/230 ratios can be seen
in Tables 5-8 in Results Section. RNA samples were then tested on the Agilent 2100
BioAnalyzer in order to again verify RNA quality. Good quality plant RNA usually has an
RNA Integrity Number (RIN) of about 6.0 to 10.0 (Figures 4-9). The Electropherogram is
used to visualize the integrity of the RNA for each sample. The first peaks show the
chloroplast ribosomal RNAs before the larger 18S and 25S peaks. All electropherograms
show clear peaks. If there were degradation of any samples, the peaks would look wider than
those in Figure 4-9. The gel images obtained from the Agilent BioAnalyzer show clear bands
at the 18S and 25S ribosomal subunits. Signs of RNA degradation would show a smeared
band in the gel image for a sample instead of the clear bands seen in Figure 4-9. Therefore, it
was determined that this RNA is of good quality to convert into cDNA.
CDNA PRODUCTION Reverse Transcriptase PCR (RT-PCR) was performed using the Applied Biosystems
High-Capacity cDNA Reverse Transcription kit in order to convert the mRNA into cDNA.
11
Figure 4. BioAnalyzer results for A. thaliana RNA- basal heat-shock treatments.
Figure 5. BioAnalyzer results for A. thaliana and B. depauperata RNA- acquired heat-shock treatments.
Electropherogram:
Gel Image:
Electropherogram:
Gel Image:
12
Figure 6. BioAnalyzer results for B. depauperata RNA- basal heat-shock treatments.
Figure 7. BioAnalyzer results for B. sparsiflora RNA- basal heat-shock treatments.
Electropherogram:
Gel Image:
Electropherogram:
Gel Image:
13
Figure 8. BioAnalyzer results for B. sparsiflora and B. pulchra RNA- acquired heat-shock treatments.
Figure 9. BioAnalyzer results for B. pulchra RNA- basal heat-shock treatments.
Electropherogram:
Gel Image:
Electropherogram:
Gel Image:
14
Components used to perform the RT-PCR included 5µL RNase Inhibitor, 5 µL
Multiscribe™ Reverse Transcriptase, 10µL 10X RT Random Primers, 4µL 25X dNTP Mix
(100mM), and 10µL 10XRT Buffer along with a 16µL dilution of RNA and nuclease-free
H2O. RNA dilutions were calculated using the RNA concentrations and then diluting each
sample so that it was the same concentration as the lowest concentrated RNA sample. The
RT-PCR was performed in an Eppendorf MasterCycler Gradient thermal cycler. The thermal
cycler was set to the conditions found in Table 2.
Table 2. Eppendorf MasterCycler Gradient Thermal Cycler Protocol
Step 1 Step 2 Step 3 Step 4 Temperature (°C) 25 37 85 4 Time (minutes) 10 120 5 ∞
QPCR PRIMER DESIGN QPCR primers were designed using the PrimerQuest℠ PCR Design Tool on the
Integrated DNA Technologies website. All primer sets that were chosen had a melting
temperature (Tm) around 60°C and an amplicon size between 100 and 150 base pairs. Most
of the primers were designed using the A. thaliana gene sequences from the TAIR database
(see Table 3) [18]. The primers were then evaluated using the Primer Blast program on the
National Center for Biotechnology Information (NCBI) website [28]. This was done in order
to assure that the primers were annealing to the gene of interest and not a different gene in
the A. thaliana genome.
I decided to obtain the HSP21 CP sequences for all of the Boechera species so that I
could perform a comparative sequence analysis against the known A. thaliana HSP21 CP
sequence. DNA was extracted from seedlings using the DNEasy Plant Mini kit or the Qiagen
Qiaquick Gel Extraction kit. The DNA was then purified using a Qiagen Qiaquick PCR
purification kit. After clean, good quality DNA was obtained it was sequenced. It was found
that all four HSP21 CP sequences from the Boechera species were very similar. There were
2 nucleotides that were different on the sequence that was complementary to the forward
primer. There was only 1 nucleotide that was different in the sequence complementary to the
reverse primer sequence (see Table 3). Using this data, I could design species-specific
15
Table 3. Arabidopsis Thaliana Specific Primers for qRT-PCR Experiments for each Gene of Interest with Amplicon Size (bp) and Average Amplification Efficiency + SD
Gene Description
Primer Sequences (5’-3’ Forward/Reverse)
Amplicon Size (bp)
Average Amplification
Efficiency ± SD*
18S AATGATCACGCGCTTGGTAACTCG TTTCCGGGACCTTTAGCTCTGCAT
106 107.73 ± 9.98
Actin 3 ACCCAAAGGCTAACCGTGAGAAGA ACACCATCTCCAGAGTCAAGCACA
145 95.02 ± 5.51
HSFA3 ATCGTCGTCGATCACCACAATCCA ACCATTTCCTCCATCAATGCACGC
133 91.85 ± 2.29
HSP101 ATAGATGCAGGCGCTGGTGATCTT TCACTTCTCTTTGGCCCGTTAGCA
124 100.5 ± 8.14
HSP20 I ATGGATGTGGCAGCGTTCACAAAC TGCCATCCTCAACCTCCACTTTCA
124 92.44 ± 4.02
HSP18.2 I TTCTTCACGCCATCTTCTGCGTTG CTGGCAAGTCCGCTTTGAACACAT
124 92.98 ± 6.85
HSP17.7 II TACACCAGCTGACGTTATCGAGCA ACCACAAGCACGTTCTCGTTCTCT
114 94.3 ± 5.72
HSP17.6II TCACGAGTTTACATGCGAGACGCT AGCACATTGTCGTTCTCGACCTGA
146 103.39 ± 22.63
HSP21 CP TCACCAATGAGGACGATGCGACAA TGCACGAATCTCTGACACTCCACT
109 95.95 ± 5.09
**B. pulchra and B. depauperata- F TCACCAATGAGGACAATGCGGCAA
**B. sparsiflora and B. pulchra- R TGCACGAATTTCTGACACTCCACT
109 n/a
RuBisCO Activase
TGCTTTGGGAGACGCAAACGCTGA TCGTCACTTCTAGCCGTTGGATCA
141 86.81 ± 11.35
*Primer efficiencies were calculated with the following formula: E=[10^(-1/slope)]/2 **Species-specific HSP21 primers for B. depauperata, B. pulchra, and B. sparsiflora, with nucleotide differences highlighted in red
primers for the HSP21 CP gene. After discovering highly conserved sequences among all
five species, I decided to design primers using the A. thaliana genome. I then used these
primers for the qPCR experiments for the Boechera species. If the primers were not found to
be efficient, I would discard this data. These are the HSP21 CP sequences obtained for
Boechera species, regions where primers were designed are in bold and red nucleotides are
those that are different from the A. thaliana primer regions.
16
B. sparsiflora HSP21 sequence obtained for B. sparsiflora, with primer annealing regions in bold
and nucleotide differences within primer regions shown in red.
NNNNNNNNNNNNNNNNNNNTCCTCTGCCTCNTCCAATCCACTTCGCCGTTTCACTGTCGCCTTCCCACGGATGATGCCTAGTCGGATCAGAGCTGAAGACCAGAGAGAAAACTCCATTGATGTTGTTAACCAAGGACAACACAAAGGGAATGGAGGATCTAGCGTACAAAAAAGACCTCAACAACGCTTAGCCATGGACGCTTCGCCTTTCGGTACGTTGTTGAACTAATAAAAACTCGTTTGTATAACTCGAAACCTCTTCCTCTACTCACACAATTGACCTTTTTTTTATCACAACGACAGGACTGTTGGATCCTTTGTCACCAATGAGGACAATGCGGCAAATGCTGGACACCATGGACAGGATGTTCGAAGACGTTATGCCTGTCTCAGGAAGAAACAGAGGAGGAAGTGGAGTGTCAGAAATTCGTGCACCATGGGACATCAAAGAGGAAGAACATGAGATTAAGATGCGTTTTGACATGCCTGGTCTCTCCAAAGAAGACGTAAAAATCTCTGTCGAAGATAACGTCCTTGTAATCAAAGGAGAGCAGGAGAAGGAAGACGATAATGATTCTTGGTCTGGAAGGAGTGTTAGCTCTTATGGAACACGACTTCAGCTTCCAGACAACTGNGANAAAGACAAGATCAGAGCTGAGCTCAAGAACGGAGTCCTGTTTATCACTGTCCCTAAAACCAAAGTCGAACGCAANNNNNNNNNNNNNNNCNNN
B. pulchra HSP21 sequence obtained for B. pulchra, with primer annealing regions in bold and
nucleotide differences within primer regions shown in red.
TTNNNNNNCNCTCTCGCTCGATCTCNCTCTGCCTCATCCAAATCCACTTCGCCGTTCTCTGTCGCCTTCCCACGGATGATGCCTAGTCGGATCAGAGCTGAAGACCAGAGAGAAAACTCCATTGATGTTGTTAACCAAGGACAACACAAAGGGAATGGAGGATCTAGCGTACAAAAAAGACCTCAACAACGCTTAGCCATGGACGCTTCGCCTTTCGGACTGTTGGATCCTTTGTCACCAATGAGGACAATGCGGCAAATGCTGGACACCATGGACAGGATGTTCGAAGACGTTATGCCTGTCTCAGGAAGAAACAGAGGAGGAAGTGGAGTGTCAGAAATTCGTGCACCATGGGACATCAAAGAGGAAGAACATGAGATTAAGATGCGTTTTGACATGCCTGGTCTCTCCAAAGAAGACGTAAAAATCTCTGTCNAAGATAACGTCCTTGTAATCAAAGGAGAGCAGGNNNGGANNNNGATNNNNNTTGGTTNNNNGCCCNGAGGGNNTTTTTCTTCTGTNTGGAACTCTNTTTCCCNNNCANNNNCCTGNGGGAAGANAAGAANAAACCNAANANAAGATTGGGGTCNGGTTNTNCTGTCCCCAAAAACCANATTTAANCCAATCCTCCAAANTCAAAAATAT
B. depauperata HSP21 sequence obtained for B. depauperata, with primer annealing regions in bold
and nucleotide differences within primer regions shown in red.
17
NNNNNNNNNNNNNNNTCCTCTGCCTCATCCNNTCCACTTCGCCGTTCTCTGTCGCCTTCCCACGGAGGAAGCCTAGTCGGATCAGAGCTGAAGACCAGAGAGAAAACTCCATTGATGTTGTTAACCAAGGACAACACAAAGGGAATGGAGGATCTAGCGTACAAAAAAGACCTCAACAACGCTTAGCCATGGACGTTTCGCCTTTCGGACTGTTGGATCCTTTGTCACCAATGAGGACAATGCGGCAAATGCTGGACACCATGGACAGGATGTTCGAAGACGTTATGCCTGTCTCAGGAAGAAACAGAGGAGGAAGTGGAGTGTCAGAGATTCGTGCACCATGGGACATCAAAGAGGAAGAACATGAGATTAAGATGCGTTTTGACATGCCTGGTCTCTCCAAAGAAGACGTAAAAATCTCTGTCGAAGATAACGTCCTTGTAATCAAAGGAGACCAGGAGAAGGAAGACGATAATGATTCTTGGTCTGGAAGAAGCGTTAGCTCTTATGGAACACGACTTCAGCTTCCAGACAACTGTGAGAAAGACAAGATCAAAGCTGAGCTCAAGAACGGAGTCCTGTTTATCACTGTCCCTAAAACCAAAGTCGAACGCAAANNNNNNNAATGTCCA
QPCR EXPERIMENTAL DESIGN The Bio-Rad iQ5 qrt-PCR instrument uses fluorescence in order to measure the
average amplification from each sample. Qrt-PCR was chosen in order to measure gene
expression because it is a quantitative method of analysis. It is a more sensitive assay and is
the ultimate objective of this gene expression project. The experiment was performed on a
96-well plate. The Quanta Plus Melt Curve that was used can be found in Table 4. Qrt-PCR
was then conducted in order to obtain threshold cycle (Ct) values for gene expression
analysis. The ΔΔCt method was used to obtain fold averages for each sample and the Act3
gene was used as a reference gene. This was performed in Microsoft Excel in order to
accurately calculate the thermotolerance in these plant species.
Table 4. qPCR Protocol Used for BioRad IQ5 ThermaCycler
Cycle 1 2 3 4 5 6 Repeats 0 0 45 0 0 81 Step 1 1 1 2 1 1 1 Set Point (°C) 50.0 95.0 94.0 55.0 94.0 55.0 55.0 Dwell Time (minutes)
2:00 5:00 0:15 0:30 1:00 1:00 0:10
Real-Time Melt Curve
Enzyme Activation
Denaturation Data Collection
18
Each sample was run in triplicate and was prepared in a 1:40 dilution of cDNA to
RNAse and DNAse-free water. The cDNA for each sample was diluted 1:40 using 4uL of
cDNA to 156uL of water. This was used to run four plates over the course of one day, with
two primer sets per plate and a total of six genes of interest and two reference genes tested in
one day. Two plates were run per gene of interest and per reference gene, using different
aliquots of cDNA per qPCR run. This was done in order to perform technical replicates of
the samples.
Primers were tested for their efficiency using a standard curve with standards run in
duplicates using the 36°C sample for each species. It was important to use this sample in
order to test the primer efficiencies since I knew that the heat-shock proteins were expressed
at this temperature. The standards were prepared as 1:4, 1:40, 1:400, and 1:4000 dilutions. A
no-template control well was also prepared using the master mix and the RNAse and
DNAse-free water in order to test for contamination. The averages for each standard dilution
were calculated by the Bio-Rad iQ5 and were plotted in Microsoft Excel in order to calculate
the primer efficiencies. The slope was taken from a linear regression graph of the average
values from each standard dilution, which was graphed in Microsoft Excel. The standards
were then plotted and a linear regression line was used to obtain the slope (R2). The
following formula, E=[10^(-1/R2)]/2 x 100, was used in order to obtain a primer efficiency
for each primer set that was tested. Primer efficiencies between the values of 80 and 120 are
considered of good quality.
REFERENCE GENE ANALYSIS Several analyses were performed in order to compare the reference genes against each
other. One of the reference genes was treated as the gene of interest in order to compare the
difference in the Ct values for each reference gene. In order to test the difference from plate
to plate for each reference gene, an analysis was also done in which the values for the first
plate was treated as the gene of interest and the reference gene values for the second plate
were used as the reference gene (see Figures 10-13).
There were no significant differences when comparing the genes of interest to each
other in A. thaliana (see Figure 10). 18S and Act3 only had a fold change of about 4 as the
highest fold change value in A. thaliana. When comparing the reference gene fold changes
19
Figure 10. Relative expression of reference genes in A. thaliana (A) 18S expression levels using Act3 as reference gene (n=6), (B) Act3 expression levels using 18S as reference gene (n=6), (C) 18S expression levels using 18S as the reference gene (n=3). (D) Act3 expression levels using Act3 as the reference gene (n=3). Bars show mean values with standard error of the mean. X axes indicate temperature of either basal or acquired heat-shock.
from one plate to the next, most of the temperatures were stable in the A. thaliana samples,
except Act3 had a difference of 6 in fold change for its 36°C basal treatment. When using
this reference gene data to analyze the genes of interest with fold changes in the thousands to
the millions, this difference of 6 in fold change is insignificant. This will not alter the ΔΔCt
values when calculating the relative expression levels.
Figure 11 shows the relative gene expression of 18S and Act3 reference genes in
B. sparsiflora. The fold changes are not significantly different when analyzing one reference
gene compared to the other. The highest fold change in the 18S gene expression is about
3 and the highest fold change in the Act3 gene expression is only 2. Also, when graphing the
Act3 Gene Expression in Arabidopsis thaliana
22 34 35 36 38 39 40 41 42 39 40 41 420
2
4
6
Act
3 E
xp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
Act3 Gene Expression in Arabidopsis thaliana
Temperature (°C)
Act
3 E
xp
ress
ion
Lev
el (!!
Ct)
22 34 35 36 38 39 40 41 42 39 40 41 420
2
4
6
8
Basal Acquired
18S Gene Expression in Arabidopsis thaliana
22 34 35 36 38 39 40 41 42 39 40 41 420
1
2
3
18S
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
18S Gene Expression in Arabidopsis thaliana
22 34 35 36 38 39 40 41 42 39 40 41 420
2
4
6
18S
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
!" #"
$" %"
Figure 6: Relative expression of reference genes in A. thaliana (A) 18S expression levels using Act3 as the reference gene (n=6) (B) Act3
expression levels using 18S as the reference gene (n=6) (C) 18S expression levels using 18S as the reference gene (n=3) and (D) Act3
expression levels using Act3 as the reference gene (n=3). Bars show the mean values with the standard error of the mean. X axes indicate the
temperature of either basal or acquired heat-shock.
20
Figure 11. Relative expression of reference genes in B. sparsiflora (A) 18S expression levels using Act3 as the reference gene (n=6), (B) Act3 expression levels using 18S as the reference gene (n=6), (C) 18S expression levels using 18S as the reference gene (n=3), (D) Act3 expression levels using Act3 as the reference gene (n=3). Bars show mean values with standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments.
reference genes against themselves comparing one plate to the next, the levels are very
stable.
Figure 12 shows the expression levels of 18S and Act 3 in the heat-shocked
B. pulchra samples. The fold changes look relatively stable. The expression levels of 18S
when using Act3 as the reference gene are slightly higher, but this is due to the 18S
expression being lower than the Act3 expression levels in the B. pulchra species. The bars
still look relatively even on the 18S gene expression graph.
Act3 Gene Expression in Boechera sparsiflora
22 30 32 34 36 38 40 42 38 22 40 41 420
1
2
3
HS
P17.6
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
Act3 Gene Expression in Boechera sparsiflora
22 30 32 34 36 38 40 42 38 22 40 41 420.0
0.5
1.0
1.5
Act
3 E
xp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
18S Gene Expression in Boechera sparsiflora
22 30 32 34 36 38 40 42 38 22 40 41 420.0
0.5
1.0
1.5
18S
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
18S Gene Expression in Boechera sparsiflora
22 30 32 34 36 38 40 42 38 22 40 41 420
1
2
3
4
5
Temperature (°C)
18S
Exp
ress
ion
Lev
el (!!
Ct)
Basal Acquired
!" #"
$" %"
Figure 7: Relative expression of reference genes in B. sparsiflora (A) 18S expression levels using Act3 as the reference gene (n=6) (B) Act3
expression levels using 18S as the reference gene (n=6) (C) 18S expression levels using 18S as the reference gene (n=3) and (D) Act3
expression levels using Act3 as the reference gene (n=3). Bars show the mean values with the standard error of the mean. X axes indicate the
temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the
acquired heat-shock experiments.
21
Figure 12. Relative expression of reference genes in B. pulchra (A) 18S expression levels using Act3 as the reference gene (n=6), (B) Act3 expression levels using 18S as the reference gene (n=6), (C) 18S expression levels using 18S as the reference gene (n=3), (D) Act3 expression levels using Act3 as the reference gene (n=3). Bars show mean values with standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments.
The reference gene analysis in B. depauperata also confirmed that 18S and Act3 were
stable throughout our heat-shock samples. The samples were relatively stable when
comparing the 18S to the Act3 values as well as when comparing the reference gene plates to
each other. At most, the fold change differences were about a 2-fold difference. Figure 13
shows the relative stability of these genes when compared together.
Act3 Gene Expression in Boechera pulchra
22 30 32 34 36 38 40 42 38 22 40 41 420.0
0.5
1.0
1.5
2.0
Act
3 E
xp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
18S Gene Expression in Boechera pulchra
22 30 32 34 36 38 40 42 38 22 40 41 420
1
2
3
18S
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
!" #"
$" %"
18S Gene Expression in Boechera pulchra
22 30 32 34 36 38 40 42 38 22 40 41 420
5
10
15
18S
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
Act3 Gene Expression in Boechera pulchra
22 30 32 34 36 38 40 42 38 22 40 41 420
2
4
6
Act
3 E
xp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
Figure 8: Relative expression of reference genes in B. pulchra (A) 18S expression levels using Act3 as the reference gene (n=6) (B) Act3
expression levels using 18S as the reference gene (n=6) (C) 18S expression levels using 18S as the reference gene (n=3) and (D) Act3
expression levels using Act3 as the reference gene (n=3). Bars show the mean values with the standard error of the mean. X axes indicate the
temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the
acquired heat-shock experiments.
22
Figure 13. Relative expression of reference genes in B. depauperata (A) 18S expression levels using Act3 as the reference gene (n=6), (B) Act3 expression levels using 18S as the reference gene (n=6), (C) 18S expression levels using 18S as the reference gene (n=3), (D) Act3 expression levels using 18S as the reference gene (n=3). Bars show mean values with standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments.
Act3 Gene Expression in Boechera depauperata
22 30 32 34 36 38 40 42 38 22 40 41 420.0
0.5
1.0
1.5
2.0
2.5
Act
3 E
xp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
18S Gene Expression in Boechera depauperata
22 30 32 34 36 38 40 42 38 22 40 41 420
1
2
3
4
18S
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
Act3 Gene Expression in Boechera depauperata
Temperature (°C)
Act
3 E
xp
ress
ion
Lev
el (!!
Ct)
22 30 32 34 36 38 40 42 38 22 40 41 420.0
0.5
1.0
1.5
Basal Acquired
18S Gene Expression in Boechera depauperata
22 30 32 34 36 38 40 42 38 22 40 41 420.0
0.5
1.0
1.5
2.0
18S
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
Figure 9: Relative expression of reference genes in B. depauperata (A) 18S expression levels using Act3 as the reference gene (n=6) (B) Act3
expression levels using 18S as the reference gene (n=6) (C) 18S expression levels using 18S as the reference gene (n=3) and (D) Act3
expression levels using Act3 as the reference gene (n=3). Bars show the mean values with the standard error of the mean. X axes indicate the
temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the
acquired heat-shock experiments.
!" #"
$" %"
23
RESULTS
RNA concentrations and quality was obtained for each species using the Implen
NanoPhotometer. The RNA concentrations, 260/280 ratios, and 260/230 ratios can be seen in
Tables 5-8. Concentrations were used to calculate RNA dilutions for the RT-PCR assay.
Table 5. A. thaliana RNA Concentrations, Ratio of the Absorbance at 260 nm and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm
Sample Concentration (ng/µL) 260/280 260/230 22°C control 129.0 2.110 1.633 34°C basal 72.0 2.155 1.240 35°C basal 145.0 2.110 1.763 36°C basal 60.0 2.127 0.239 38°C basal 23.1 2.148 0.935 39°C basal 51.7 2.063 1.757 40°C basal 44.1 2.135 1.734 41°C basal 48.5 2.103 1.627 42°C basal 85.9 2.097 2.000 39°C acquired 40.6 2.125 0.313 40°C acquired 59.2 2.099 1.221 41°C acquired 76.7 2.075 0.704 42°C acquired 99.0 2.075 4.446
The first goal of this project was to choose several reference genes that had good
primer efficiencies and were stable in the A. thaliana heat-shock samples. I chose the 18S
pre-ribosomal (At2g03810) gene based on other qPCR studies found in the literature [29].
The 18S ribosomal gene turned out to be a reliable reference gene when tested. I decided
choose the 18S ribosomal gene as the reference gene for the first set of qPCR experiments.
Actin 3 was also chosen as a second reference gene in order to analyze the genes of interest.
It is another housekeeping gene that was found to be stable in A. thaliana [30].
After demonstrating the ability to obtain gene expression levels in A. thaliana, our
model organism, I evaluated these HSPs in B. sparsiflora, B. pulchra, and B. depauperata
using qPCR. Gene expression levels were obtained for HSP20 I, HSP18.2 I, HSP17.7 II,
24
Table 6. B. sparsiflora RNA Concentrations, Ratio of the Absorbance at 260 nm and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm
Sample Concentration (ng/µL) 260/280 260/230 22°C- control 189.0 2.154 1.845 30°C- basal 51.7 1.940 5.200 32°C- basal 97.4 2.207 1.551 34°C- basal 90.7 2.214 1.490 36°C- basal 64.4 2.250 1.110 38°C- basal 142.0 2.023 2.760 40°C- basal 173.0 2.028 2.952 42°C- basal 73.6 2.229 1.164 38°C- pretreatment 81.5 2.253 1.185 22°C- recovery 120.0 2.196 1.530 40°C- acquired 136.0 2.030 1.183 41°C- acquired 200.0 2.163 1.762 42°C- acquired 113.0 2.007 2.948
Table 7. B. pulchra RNA Concentrations, Ratio of the Absorbance at 260 nm and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm
Sample Concentration (ng/µL) 260/280 260/230 22°C- control 268.0 2.097 2.521 30°C- basal 95.8 2.078 2.648 32°C- basal 109.0 2.037 1.030 34°C- basal 113.0 2.081 2.721 36°C- basal 115.0 2.064 2.779 38°C- basal 239.0 2.098 2.477 40°C- basal 173.0 2.097 2.425 42°C- basal 62.4 2.039 2.661 38°C- pretreatment 128.0 2.064 2.556 22°C- recovery 212.0 2.078 2.498 40°C- acquired 103.0 2.056 2.525 41°C- acquired 136.0 2.073 2.478 42°C- acquired 87.9 2.046 2.631
25
Table 8. B. depauperata RNA Concentrations, Ratio of the Absorbance at 260 nm and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm
Sample Concentration (ng/µL) 260/280 260/230 22°C- control 55.7 2.222 1.443 30°C- basal 57.7 2.231 1.408 32°C- basal 49.7 2.232 1.225 34°C- basal 217.0 2.163 1.975 36°C- basal 78.7 2.225 1.277 38°C- basal 84.7 2.242 1.602 40°C- basal 116.0 2.229 1.545 42°C- basal 70.4 2.269 1.405 38°C- pretreatment 60.4 2.269 1.490 22°C- recovery 76.3 2.233 1.500 40°C- acquired 86.3 2.26 1.365 41°C- acquired 40.6 2.318 1.172 42°C- acquired 143.0 2.338 1.545
HSP17.6 II, and HSP21 CP during basal and acquired heat-shock in these three Boechera
species. The following genes were successfully analyzed in A. thaliana and B. depauperata:
HSFA3, HSP101, and RuBisCO activase. I performed both basal and acquired heat-shock
treatments, but the heat shock temperatures were slightly different from the Arabidopsis
samples. I decided to use the 22°C (control), 30°C, 32°C, 34°C, 36°C, 38°C, 40°C, 42°C
basal temperatures and 40°C, 41°C, and 42°C acquired temperatures. In order to understand
more about the acquired heat stress, I also took samples after the 38°C pretreatment and the
22°C recovery treatments that are performed during the acquired heat shock.
It should be noted that the scales in each figure are different for each species. Each
graph (A, B, C, or D) per figure (14, 15, 16, 17, 18. 19, 20, 21) is in a different scale due to
the fold change differences amongst the four species. The scales also differ between different
gene graphs for each species. Each species expresses each HSP at different levels. No two
graphs were exactly the same as a result of this study. The data is also displayed in tables so
that absolute values of expression can be easily compared across species.
The reference genes had the following primer efficiencies; 18S was 107.73 with a
standard deviation of 9.98 and the Actin 3 efficiency was 95.02 with a standard deviation of
5.51. The gray bars in the Boechera bar graphs represent the samples taken during the
26
acquired pretreatments. These samples were not taken for the A. thaliana data since this was
a part of the preliminary data collection.
HSFA3 QPCR was used to test HSFA3 in the A. thaliana and B. depauperata species. The
average primer efficiency for the HSFA3 gene for these two species was 91.85 with a
standard deviation of 2.29 (see Table 2). This gene was only run as a single plate for each
species with each sample run in triplicate. The gene expression pattern for this transcription
factor is similar to the pattern seen in the HSP pattern for the A. thaliana species. The
HSFA3 expression pattern in B. depauperata is also similar to the HSP101 pattern for this
species (see Figures 14 and 15). The fold changes are much lower in the B. depauperata
species compared to the fold changes in A. thaliana (see Table 9).
Figure 14. Relative expression of HSFA3 in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is 6 replicates.
HSP101 HSP101 has a primer efficiency of 100.50 with a standard deviation of 8.14. This
amplification efficiency is only calculated from the A. thaliana and B. depauperata samples.
The primers that were designed using the A. thaliana HSP101 sequence were not efficient for
!" #"
Figure 10: Relative expression of HSFA3 in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using
both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of
either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock
experiments. N for each sample for each graph is 6 replicates.
HSFA3 Gene Expression in Boechera depauperata
22 30 32 34 36 38 40 42 38 22 40 41 420
20
40
60
80
100H
SF
A3 E
xp
ressio
n L
evel
(!!
Ct)
Temperature (°C)
Basal Acquired
AT-HSFA3 Gene Expression in Arabidopsis thaliana
Temperature (°C)
AT
-HS
FA
3 E
xp
ressio
n L
evel
(!!
Ct)
22 34 35 36 38 39 40 41 42 39 40 41 420
100
200
300
400
500
Basal Acquired
!"
27
Figure 15. Relative expression of HSP101 in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 10-12 replicates.
Table 9. HSFA3 Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures
Species Temperature (°C) A. thaliana B. depauperata 22 control 2.20 ± 0.90 2.20 ± 0.86 Basal Heat-Shock 34 basal 7.90 ± 2.90 11.90 ± 4.90 36 basal 37.90 ± 14.42 20.90 ± 6.99 38 basal 298.90 ± 130.54 30.10 ± 10.41 40 basal 10.10 ± 4.34 55.30 ± 22.00 42 basal 12.10 ± 5.59 2.10 ± 0.97 Acquired Heat-Shock 40 acquired 43.60 ± 18.00 41.60 ± 15.39 41 acquired 28.40 ± 40.09 53.90 ± 13.22 42 acquired 29.70 ± 12.57 53.10 ± 20.70
Note: Highest fold change is bolded for each species.
B. sparsiflora and B. pulchra. There is a much higher expression of HSP101 in A. thaliana
than in B. depauperata (see Table 10 and Figure 15). The highest expression of HSP101 is at
the 39°C basal treatment in A. thaliana (9,164.70 ± 3,974.86) and at the 42°C basal treatment
in B. depauperata (249.57 ± 74.27).
HSP101 Gene Expression in Arabidopsis thaliana
22 34 35 36 38 39 40 41 42 39 40 41 420
5000
10000
15000
HS
P101 E
xp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
!" #"
Figure 11: Relative expression of HSP101 in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using
both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of
either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock
experiments. N for each sample for each graph is from 10-12 replicates.
HSP101 Gene Expression in Boechera depauperata
Temperature (°C)
HS
P101 E
xp
ress
ion
Lev
el (!!
Ct)
22 30 32 34 36 38 40 42 38 22 40 41 420
100
200
300
400
Basal Acquired
28
Table 10. HSP101 Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures
Species Temperature (°C) A. thaliana B. depauperata 22 control 2.27 ± 0.67 2.92 ± 0.92 Basal Heat-Shock 34 basal 88.38 ± 35.31 39.59 ± 12.04 36 basal 906.57 ± 389.09 105.77 ± 8.90 38 basal 6,903.77 ± 2,860.78 138.50 ± 35.67 39 basal 9,164.70 ± 3,974.86 n/a 40 basal 4,807.47 ± 2,21.70 188.00 ± 56.64 42 basal 3,087.72 ± 1,268.62 249.57 ± 74.27 Acquired Heat-Shock 40 acquired 1,141.30 ± 484.31 117.20 ± 31.16 41 acquired 1,371.61 ± 596.00 176.09 ± 43.55 42 acquired 1,020.01 ± 438.65 225.25 ± 61.80
Note: Highest fold change is bolded for each species.
HSP20 I The expression levels for HSP20 I are the highest levels for all four species among all
genes of interest. The efficiency for this gene was 92.44 with a standard deviation of 4.02.
Again, the 38°C basal fold change in A. thaliana was the highest expression value
(1,343,677.00 ± 276,441.60) overall for HSP20 I. B. sparsiflora had the highest expression
level at the 36°C basal (120,448.30 ± 29,384.10) out of all four species. B. depauperata also
had the highest values for the 41°C and 42°C acquired treatments among all four species. It is
important to note that for HSP20 I, the scales are different on the graphs for each species,
which can be seen in Figure 16. However, when looking at the raw data, there are some
samples that have similar fold changes at certain temperatures. For instance, B. depauperata
and A. thaliana have relatively close expression values for the 34°C, 36°C, and 42°C basal
samples as well as the 41°C acquired sample (see Table 11).
HSP18.2 I The HSP18.2 I expression levels can be seen in Figure 17. Overall, HSP18.2 I has the
highest values in A. thaliana. Again, the expression pattern for A. thaliana has the highest
expression at the 38°C basal treatment. However, B. depauperata expresses HSP18.2 I
29
Figure 16. Relative expression of HSP20 I in (A) A. thaliana, (B) B. sparsiflora, (C) B. pulchra, and (D) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 11-12 replicates.
higher than the other species for the 34°C basal treatment. The 38°C basal treatments are
similar to the 38°C pretreatment values in both B. pulchra and B. sparsiflora. There is
relatively high expression for HSP18.2 I for B. depauperata and B. sparsiflora when
comparing this gene to the other genes for these species. There is also slightly higher
expression in the B. pulchra acquired samples compared to the basal samples for HSP18.2 I
(see Table 12). The scales are different on the HSP18.2 I graphs for each species, however,
when looking at the raw data- there are some samples that had similar fold changes at certain
temperatures. For instance, B. depauperata and A. thaliana have relatively close expression
values for the 34°C, 36°C, and 42°C basal samples.
HSP20 I Gene Expression in Boechera sparsiflora
22 30 32 34 36 38 40 42 38 22 40 41 420
50000
100000
150000
200000
Temperature (°C)
HS
P20 I
Exp
ress
ion
Lev
el (!!
Ct)
Basal Acquired
HSP20 I Gene Expression in Boechera depauperata
22 30 32 34 36 38 40 42 38 22 40 41 420
50000
100000
150000
200000
250000
HS
P20 I
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
HSP20 I Gene Expression in Boechera pulchra
Temperature (°C)
HS
P20 I
Exp
ress
ion
Lev
el (!!
Ct)
22 30 32 34 36 38 40 42 38 22 40 41 420
5000
10000
15000
20000
25000
Basal Acquired
HSP20 I Gene Expression in Arabidopsis thaliana
22 34 35 36 38 39 40 41 42 39 40 41 420
500000
1000000
1500000
2000000
HS
P20 I
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
!" #"
$" %"
30
Table 11. HSP20 I Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures
Species Temperature (°C) A. thaliana B. sparsiflora B. pulchra B. depauperata 22 control 1.56 ± 0.38 3.22 ± 1.06 1.25 ± 0.21 3.50 ± 1.38
Basal Heat-Shock 34 basal 23,701.81 ±
5,326.34 8,075.29 ± 2,452.56
2,276.00 ± 257.04
19,791.58 ± 6,899.50
36 basal 115,375.20 ± 41,993.70
120,448.30 ± 29,384.10
3,953.09 ± 673.55
90,660.07 ± 19,356.23
38 basal 1,343,677.00 ± 276,441.60
37,997.77 ± 10,758.44
9,488.79 ± 1,353.22
92,070.03 ± 36,974.26
40 basal 137,251.80 ± 39,495.07
45,416.39 ± 14,184.60
11,257.97 ± 1,363.96
90,207.50 ± 29,345.96
42 basal 54,398.40 ± 15,574.75
20,507.49 ± 7,170.61
5,487.10 ± 701.49
36,608.50 ± 14,088.38
Acquired Heat-Shock 40 acquired 104,462.30 ±
29,220.30 32,850.72 ±
8,739.90 6,673.84 ±
796.35 70,974.29 ± 21,845.94
41 acquired 131,229.80 ± 36,614,69
44,829.37 ± 13,288.17
12,348.92 ± 1,572.58
135,646.80 ± 45,287.96
42 acquired 66,051.76 ± 18,413.45
46,466.22 ± 13,328.38
17,252.14 ± 2,215.76
144,148.10 ± 48,493.63
Note: Highest fold change is bolded for each species.
HSP17.7 II The average primer efficiency for the HSP17.7 II gene for all of the species was 94.3
with a standard deviation of 5.72 (see Table 2). HSP17.7 II had the highest relative
expression for the 38°C sample in A. thaliana. B. sparsiflora had a high amount of
expression (11,610.97 fold change ± 1,666.83) for the 36°C basal temperature, compared to
the other expression values for this species (see Table 13). This is similar to the pattern seen
for 38°C basal (626,365.28 fold change ± 166,848.18) in A. thaliana. However, the overall
fold changes were much lower for all of the B. sparsiflora heat-shock treatment samples (see
Figure 18). B. pulchra had the lowest expression levels overall for all temperatures. The
highest expression level of HSP17.7 II for B. pulchra was at the 42°C acquired treatment
(1,899.86 ± 255.73). B. depauperata also had the highest expression level of HSP17.7 II at
the 42°C acquired treatment (3,550.37 ± 1,135.11) compared to the other samples for this
species.
31
Figure 17. Relative expression of HSP18.2 in (A) A. thaliana, (B) B. sparsiflora, (C) B. pulchra, and (D) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 8-12 replicates.
HSP17.6 II The primers that were designed for HSP17.6 II were designed based on the
A. thaliana HSP17.6 II sequence. However, these primers had inefficient amplification in
both the B. pulchra and B. sparsiflora species and for one of the B. depauperata plates. The
primer efficiencies for the B. pulchra plates were 111.77 and 145.80, for B. sparsiflora they
were 140.15 and 169. 48, and B. depauperata was 108.42 and 133.24. The poor efficiencies
were a result of two qPCR runs, proving that the bad efficiencies were a result of the primers
not annealing properly and not due to another experimental error. These efficiencies were not
HSP18.2 I Gene Expression in Boechera depauperata
22 30 32 34 36 38 40 42 38 22 40 41 420
20000
40000
60000
80000
100000
Temperature (°C)
HS
P18.2
I E
xp
ress
ion
Lev
el (!!
Ct)
Basal Acquired
HSP18.2 I Gene Expression in Boechera pulchra
Temperature (°C)
HS
P18.2
I E
xp
ress
ion
Lev
el (!!
Ct)
22 30 32 34 36 38 40 42 38 22 40 41 420
5000
10000
15000
20000
Basal Acquired
HSP18.2 I Gene Expression in Arabidopsis thaliana
22 34 35 36 38 39 40 41 42 39 40 41 420
100000
200000
300000
400000
500000H
SP
18.2
I E
xp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
!" #"
$" %"
HSP18.2 I Gene Expression in Boechera sparsiflora
22 30 32 34 36 38 40 42 38 22 40 41 420
50000
100000
150000
Temperature (°C)
HS
P18.2
I E
xp
ress
ion
Lev
el (!!
Ct)
Basal Acquired
32
Table 12. HSP18.2 I Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures
Species Temperature (°C) A. thaliana B. sparsiflora B. pulchra B. depauperata 22 control 2.56 ± 1.02 3.37 ± 1.17 1.33 ± 0.28 4.98 ± 2.27
Basal Heat-Shock 34 basal 6,961.79 ±
2,457.00 4,010.63 ±
1113.64 2,501.09 ±
306.24 10,281 ± 4360.84
36 basal 85,989.38 ± 35,317.52
79,075.72 ± 16,519.14
4,323.81 ± 772.54
66,068.78 ± 16,719.03
38 basal 405,097.20 ± 68,186.77
15,051.32 ± 3,660.11
8,323.66 ± 1,181.00
54,915.11 ± 21,900.79
40 basal 43,121.56 ± 18,210.39
19,596.54 ± 5,664.69
9,084.96 ± 1,077.91
27,380.30 ± 9526.93
42 basal 13,563.86 ± 5742.12
10,881.55 ± 3,316.64
4,759.99 ± 597.88
12,758.0 ± 4,994.48
Acquired Heat-Shock 40 acquired 54,704,34 ±
22,748.30 17,369.80 ±
4,250.33 6,918.49 ± 1,031.22
39,525.90 ± 14,006.72
41 acquired 65,179.59 ± 28,407.21
20,677.74 ± 5,538.52
11,704.04 ± 1,431.70
48,144.70 ± 17,715.21
42 acquired 41,818.17 ± 18,515.61
22,740.33 ± 7,514.08
14,808.97 ± 1,878.60
5,6974.71 ± 22,760.05
Note: Highest fold change is bolded for each species.
included in the Table 2 since they were above the range that is considered efficient
amplification.
The HSP17.6 II expression levels can be seen in Figure 19. The average primer
efficiency for the HSP17.6 II gene for A. thaliana and B. depauperata was 103.39
with a standard deviation of 22.63 (see Table 2). The A. thaliana samples had much
higher expression of HSP17.6 II when compared to B. depauperata (see Table 14).
A. thaliana had its highest fold change at the 38°C basal treatment (2,436,996.00 ±
712,817.40). B. depauperata has its highest fold change at the 42°C acquired treatment
(309.13 ± 85.12).
HSP21 CP HSP21 CP has a primer efficiency of 95.95 with a standard deviation of 5.09. The
A. thaliana 38°C basal treatment had the highest expression value (see Table 15). This
species also expressed the HSPs at a much higher level in comparison to the Boechera
33
Table 13. HSP17.7 II Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures
Species Temperature (°C) A. thaliana B. sparsiflora B. pulchra B. depauperata 22 control 1.59 ± 0.41 2.91 ± 0.87 1.31 ± 0.23 2.99 ± 0.95
Basal Heat-Shock 34 basal 9,489.37 ±
2,340.14 1,095.91 ±
332.98 348.16 ±
44.74 714.97 ± 256.23
36 basal 49,984.72 ± 15,716.26
11,610.97 ± 1,666.83
496.31 ± 82.71 2,627.23 ± 250.20
38 basal 626,365.28 ± 166,848.18
3,681.62 ± 946.51
1,331.00 ± 250.39
2,992.02 ± 777.92
40 basal 67,463.04 ± 21,376.08
4,659.03 ± 1,308.97
1,516.97 ± 238.52
3,104.60 ± 1,067.72
42 basal 27,297.20 ± 8,515.65
2,014.94 ± 580.07
724.27 ± 135.25
1,252.75 ± 393.75
Acquired Heat-Shock 40 acquired 27,102.87 ±
75,71.82 4,158.80 ± 1,055.92
1,252.18 ± 210.94
2,517.56 ± 752.14
41 acquired 36,214.06 ± 10,778.17
5,427.83 ± 1,514.58
1,830.68 ± 254.58
3,279.68 ± 901.35
42 acquired 22,508.56 ± 6,237.58
5,556.17 ± 1,504.21
1,899.86 ± 255.73
3,550.37 ± 1,135.11
Note: Highest fold change is bolded for each species.
species. The HSP21 CP expression pattern seen in B. sparsiflora is very similar to the one
found for the HSP17.7 II gene. The 36°C basal treatment had the highest expression level
(8,635.26 ± 1,382.70) for this species. B. pulchra had the lowest HSP21 CP expression
values out of all four species (see Figure 20). The highest expression level for B. pulchra was
at the 42°C acquired treatment (1,822.42 ± 332.45). B. depauperata also had a spike at the
36°C basal treatment for HSP21 CP expression (19,293.47 ± 4,206.38).
RUBISCO ACTIVASE RuBisCO activase was only tested using one technical replicate (with three replicates
on one plate) in A. thaliana and B. depauperata as a preliminary screen for the activity of this
protein. Its expression was very low for both the A. thaliana and B. depauperata species (see
Figure 21). The expression levels only reached a fold change of (5.70 ± 2.63) in the 38°C
34
Figure 18. Relative expression of HSP17.7 II in (A) A. thaliana, (B) B. sparsiflora, (C) B. pulchra, and (D) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 11-12 replicates.
basal treatment in A. thaliana. The highest expression level for B. depauperata was at the
34°C basal treatment (3.30 ± 1.47), which can be seen in Table 16. Overall, expression levels
were around 1 or 2 in both species for most treatments. This led us to the decision to stop
further experiments with this gene, since the expression was so low.
HSP17.7 II Gene Expression in Boechera pulchra
22 30 32 34 36 38 40 42 38 22 40 41 420
500
1000
1500
2000
2500
HS
P17.7
II
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
HSP17.7 II Gene Expression in Boechera sparsiflora
Temperature (°C)
HS
P17.7
II
Exp
ress
ion
Lev
el (!!
Ct)
22 30 32 34 36 38 40 42 38 22 40 41 420
5000
10000
15000
Basal Acquired
HSP17.7 II Gene Expression in Arabidopsis thaliana
22 34 35 36 38 39 40 41 42 39 40 41 420
200000
400000
600000
800000
1000000
HS
P17.7
II
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
!" #"
$" %"
HSP17.7 II Gene Expression in Boechera depauperata
22 30 32 34 36 38 40 42 38 22 40 41 420
1000
2000
3000
4000
5000
HS
P17.7
II
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
35
Figure 19. Relative expression of HSP17.6 II in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 11-12 replicates.
Table 14. HSP17.6 II Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures
Species Temperature (°C) A. thaliana B. depauperata 22 control 3.93 ± 1.76 3.41 ± 1.28 Basal Heat-Shock 34 basal 59,529.06 ± 25,406.13 49.49 ± 15.58 36 basal 462,618.30 ± 215,576.00 203.91 ± 26.45 38 basal 2,436,996.00 ± 712,817.40 247.64 ± 82.64 40 basal 352,336.70 ± 169,024.08 201.14 ± 55.43 42 basal 136,560.60 ± 66,570.27 98.92 ± 51.41 Acquired Heat-Shock 40 acquired 270,412.60 ± 126,709.90 191.92 ± 51.41 41 acquired 344,648.90 ± 163,931.80 259.93 ± 73.36 42 acquired 202,124.50 ± 95,387.89 309.13 ± 85.12
Note: Highest fold change is bolded for each species.
HSP17.6 II Gene Expression in Boechera depauperata
22 30 32 34 36 38 40 42 38 22 40 41 420
100
200
300
400
500
HS
P17.6
II
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
HSP17.6 II Gene Expression in Arabidopsis thaliana
22 34 35 36 38 39 40 41 42 39 40 41 420
1000000
2000000
3000000
4000000H
SP
17.6
II
Exp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
!" #"
36
Table 15. HSP21 CP Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures
Species Temperature (°C) A. thaliana B. sparsiflora B. pulchra B. depauperata 22 control 3.28 ± 1.01 2.50 ± 0.71 1.08 ± 0.13 4.25 ± 1.53
Basal Heat-Shock 34 basal 7,181.32 ±
2,861.62 920.27 ± 294.35
398.98 ± 66.30
3,198.80 ± 1,066.53
36 basal 44,283.34 ± 18,819.12
8,635.26 ± 1,382.70
577.23 ± 86.68
19,293.47 ± 4,206.38
38 basal 572,746.10 ± 212,141.10
2,456.53 ± 630.32
1,195.34 ± 248.02
12,595.66 ± 4,030.11
40 basal 36,610.95 ± 14,145.15
3,809.90 ± 1,069.05
1,160.94 ± 191.77
13,128.87 ± 5,002.76
42 basal 33,309.65 ± 13,946.74
1,943.66 ± 565.59
763.54 ± 137.36
4,192.34 ± 1,440.00
Acquired Heat-Shock 40 acquired 36,610.95 ±
14,145.15 3, 509.17 ±
913.67 1,263.64 ±
284.37 13,147.54 ±
4,230.31 41 acquired 49,817.86 ±
21,629.48 6,442.17 ±
1971.75 1,812.00 ±
381.93 13,402.79 ±
4,069.93 42 acquired 33,309.65 ±
13,946.74 6,160.31 ± 1,630.01
1,822.42 ± 332.45
14,981.81 ± 5,140.74
Note: Highest fold change is bolded for each species.
37
Figure 20. Relative expression of HSP21 CP in (A) A. thaliana, (B) B. sparsiflora, (C) B. pulchra, and (D) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 11-12 replicates.
HSP21 CP Gene Expression in Boechera pulchra
Temperature (°C)
HS
P21 C
P E
xp
ress
ion
Lev
el (!!
Ct)
22 30 32 34 36 38 40 42 38 22 40 41 420
500
1000
1500
2000
2500
Basal Acquired
HSP21 CP Gene Expression in Boechera depauperata
22 30 32 34 36 38 40 42 38 22 40 41 420
5000
10000
15000
20000
25000
HS
P21 C
P E
xp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
HSP21 CP Gene Expression in Boechera sparsiflora
Temperature (°C)
HS
P21 C
P E
xp
ress
ion
Lev
el (!!
Ct)
22 30 32 34 36 38 40 42 38 22 40 41 420
5000
10000
15000
Basal Acquired
HSP21 CP Gene Expression in Arabidopsis thaliana
22 34 35 36 38 39 40 41 42 39 40 41 420
200000
400000
600000
800000
1000000H
SP
21 C
P E
xp
ress
ion
Lev
el (!!
Ct)
Temperature (°C)
Basal Acquired
!" #"
$" %"
38
Figure 21. Relative expression of RuBisCO activase in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 6 replicates.
Table 16. RuBisCO Activase Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures
Species Temperature (°C) A. thaliana B. depauperata 22 control 2.80 ± 1.61 2.20 ± 0.85 Basal Heat-Shock 34 basal 1.70 ± 0.64 3.30 ± 1.47 36 basal 1.00 ± 0.39 2.40 ± 0.80 38 basal 5.70 ± 2.63 0.90 ± 0.31 40 basal 2.20 ± 0.96 0.50 ± 0.20 42 basal 2.90 ± 1.26 2.70 ± 1.31 Acquired Heat-Shock 40 acquired 1.40 ± 0.61 1.10 ± 0.45 41 acquired 0.90 ± 0.90 0.30 ± 0.31 42 acquired 1.50 ± 0.64 0.30 ± 0.12
Note: Highest fold change is bolded for each species.
RuBisCO Activase Gene Expression in Arabidopsis thaliana
Temperature (°C)
RA
Exp
ress
ion
Lev
el (!!
Ct)
22 34 35 36 38 39 40 41 42 39 40 41 420
2
4
6
8
10
Basal Acquired
!" #"
Figure 17: Relative expression of RuBisCO activase in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest
analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the
temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the
acquired heat-shock experiments. N for each sample for each graph is from 6 replicates.
RuBisCO Activase Gene Expression in Boechera depauperata
Temperature (°C)
RA
Exp
ress
ion
Lev
el (!!
Ct)
22 30 32 34 36 38 40 42 38 22 40 41 420
2
4
6
Basal Acquired
39
DISCUSSION
The gene expression experiments performed in this study have provided us with a
more quantitative understanding about the expression patterns for HSP genes in the
A. thaliana, B. sparsiflora, B. pulchra, and B. depauperata species. Considerable information
is available about the general expression patterns and function of these proteins but this is the
first study using qPCR to analyze these genes in A. thaliana and the first to examine HSP
expression with any gene expression technique in Boechera.
Previous studies of the comparative thermotolerance in Boechera and A. thaliana has
shown that the species B. depauperata has a much higher tolerance for high temperature
stress. The Waters lab has demonstrated that B. depauperata not only displays a higher
tolerance in terms of less chlorosis and plant death but that B. depauperata is able to continue
to photosynthesize even at temperatures at or above 45°C. The Waters lab also demonstrated
that the other Boechera species examined: B. pulchra and B. sparsiflora were more tolerant
to heat stress than A. thaliana but were not as thermotolerant as B. depauperata [26]. The
goals of my work were to establish gene expression patterns for key genes involved in
thermotolerance and to interpret these results in light of the comparative thermotolerance
data.
From the qPCR data that was collected, we can see some very interesting and
significant patterns. Most importantly, I have shown that A. thaliana has the highest
expression levels across all of the HSP genes examined. The pattern of high A. thaliana HSP
expression is seen for all of the heat shock genes examined: HSP101, HSP20 I, HSP18.2 I,
HSP17.7 II, Hsp17.6 II, and HSP21 CP. The extremely high expression of the HSP genes in
A. thaliana has been demonstrated by other methods most recently by gene chip analysis
[22], [31] and my findings are consistent with these previous studies.
In all of the A. thaliana genes examined, the highest expression was seen at 38°C
basal exposure. For example, A. thaliana had a fold change of about 2.5 million at the 38°C
basal treatment for HSP17.6 II. The other small HSP genes had similar high expression levels
at this heat-shock temperature, ranging from 400,000 (HSP18.2 II) at the low end to
1.3 million [32]. It is interesting to note how the HSP17.7 II and HSP21 CP genes had similar
40
fold changes of around 600,000. Even at the lowest basal treatments A. thaliana still
expressed the small HSPs at high levels, ranging from 7,000 (HSP21 CP and HSP18.2 II) at
the 34°C basal treatment to as high as 460,000 at the 36°C basal treatment in HSP17.6 II. We
can see that in the acquired heat-shock treatments, the HSP genes are expressed in
A. thaliana but not to the extremely high level seen at the 38°C basal treatment. These fold
changes range from 22,000 for the 42°C acquired treatment in HSP17.7 II to 344,000 for the
42°C acquired treatment in HSP17.6 II.
A. thaliana does not have the same gene expression pattern for HSP101 as it does for
the small HSPs. The fold changes are much lower for this protein with the 39°C basal
treatment being the highest of about 9,000. Also, the basal treatments are similar to some of
the acquired treatments for this A. thaliana gene 906.57 (36°C basal) to 1,300 (42°C
acquired). Overall, HSP101 expression in A. thaliana is not as high as it is in the small HSPs.
The coastal species, B. sparsiflora also has a clear expression pattern amongst the
small HSPs. There is a spike on the graphs for the 36°C basal treatment in HSP20 I, HSP18.2
I, HSP17.7 II, HSP17.6 II, and HSP21 CP. This pattern is similar to the one seen in
A. thaliana, however, it is seen at a lower temperature (36°C vs. 38°C for A. thaliana). The
36°C basal values in B. sparsiflora range from about 8,000 for HSP21 CP, 11,000 for
HSP17.7 II, 80,000 for HSP18.2 I, and 120,000 for HSP20 I. These values were nowhere
near as high as the values for the A. thaliana 38°C basal treatment. Which had a range of
400,000 for HSP18.2 I to 2.5 million fold change for HSP17.6 II. So, the highest 36°C basal
treatment for B. sparsiflora was much lower than the lowest 38°C basal treatment in
A. thaliana. Most of the values in the acquired treatments are a fourth to a tenth lower in
B. sparsiflora compared to A. thaliana. These values show that A. thaliana expresses all of
the small HSPs at a much larger rate than does B. sparsiflora.
The desert species, B. pulchra, also has a distinct pattern that is different than that
seen in A. thaliana and B. sparsiflora. Overall, B. pulchra has the lowest expression levels in
comparison to the 3 other species for all small HSP genes. Across all of the small HSPs, this
species had the highest expression levels for the 42°C acquired treatment. Overall, the pattern
is that the 41°C and 42°C acquired treatments were found to be higher in this species
compared to its basal treatments. For example, the 42°C acquired treatments range from
41
1,800 (HSP21 CP) to the highest at 17,000 (HSP20 I). The highest fold change out of all of
the small HSPs in A. thaliana was about 2.5 million at the 38°C basal treatment for
HSP17.6 II. The highest fold change found in B. sparsiflora was 120,000 at the 36°C basal
treatment in HSP20 I. Whereas the expression level range for the basal treatments are from
about 350 for the 34°C basal sample in HSP17.7 II to 11,000 for the 40°C basal sample in
HSP20 I. Also, the 38°C basal samples are very close in their values to the 40°C basal
samples. HSP 20 I had values with only a 2,000 fold change difference, HSP18.2 I had
values of only a 1,000 fold change difference, and HSP 17.7 II and HSP21 CP had almost
exactly the same fold changes differences for these two basal temperatures.
Examination of the expression of the HSF gene is highly informative. HSFA3 is one
of the heat-shock transcription factors and it plays an important role in inducing the
expression of the heat shock genes. All heat-inducible heat shock genes have heat shock
elements in the upstream region of the gene. During heat stress the HSFs bind to the heat
shock elements and the heat shock genes are expressed. From an examination of the HSF
expression patterns we see that A. thaliana has a very high expression level at 38°C and
lower levels in the acquired samples. It is important to note that the levels in the controls are
the same. In B. depauperata for basal stress the highest expression is not at 38°C but at 40°C
and that the levels of expression are very low for both species at control temps.
B. depauperata has higher levels of expression in the acquired 41°C and 42°C treatments.
An understanding of the expression patterns of HSFA3 is important because it and the
other HSFs control the expression of the heat shock genes. From this data we might expect
that the genes regulated by HSFA3 will have different patterns in A. thaliana and
B. depauperata and in fact we do see very different patterns of gene expression in
B. depauperata and the other two Boechera species compared to A. thaliana.
The mountainous species, B. depauperata, had similar levels in its basal treatments
versus its acquired treatments for the small HSP genes. Again, these levels were not as high
as those found in the A. thaliana HSPs. The HSFA3 expression levels for this species also
correlate to the expression levels in the HSPs. The expression levels are much lower in this
HSF and most of the basal and acquired levels are around a 30 to 50-fold change. There is a
low expression level of HSFA3 at the 42°C basal treatment of only 2.10. Perhaps, the HSFs
are not able to function at their optimum at this high temperature. This also correlates with
42
the small HSP gene data for B. depauperata, since the 42°C basal samples are lower than the
other heat-shock samples.
The small HSP pattern for B. depauperata is much different than the ones found in
A. thaliana, B. sparsiflora, and B. pulchra. There is no one temperature that has the highest
expression in all small HSPs for this species. Although, the basal treatments are expressed at
similar levels to the acquired treatments expressed in B. depauperata. For example, the
HSP17.7 II gene has expression levels of 600,000 for A. thaliana and is only at 3,500 for
B. depauperata. In HSP 20 I, the highest expression level in A. thaliana is 1.3 million at the
38°C basal treatment and the highest fold change in B. depauperata is only 150,000 at the
42°C acquired temperature. For HSP18.2 I, A. thaliana has a fold change of 400,000 at the
38°C basal treatment and B. depauperata has a fold change of about 66,000. The HSP17.6 II
expression level is highest in the 42°C acquired treatment in B. depauperata at around 300,
whereas the highest level in A. thaliana is at 2.5 million for the 38°C basal sample. Finally,
the HSP21 CP values are 600,000 for the A. thaliana 38°C basal sample and 20,000 for the
B. depauperata sample. These values are on different orders of magnitude. This just shows
the huge difference in expression of these genes in B. depauperata species compared to
A. thaliana.
HSP101 also shows a similar pattern to that seen with the small HSPs for
B. depauperata. The basal and acquired levels are expressed relatively the same. The levels
are also much lower than the levels seen for HSP101 in A. thaliana. The highest level of
expression in A. thaliana is about 7,000 at the 38°C basal treatment and for B. depauperata it
is only a 250-fold change for the 42°C basal treatment.
In summary, there are unique gene patterns for each species. There was high spike in
fold change for the A. thaliana 38°C basal and the B. sparsiflora 36°C basal samples
compared to the other temperatures in each of these species. Perhaps, this is the last
temperature each species can withstand before all cellular mechanisms begin to degrade. This
would explain the high expression level at this temperature and the drop in gene expression
when the temperature is increased thereafter.
There are some patterns that are consistent in one species for all HSP genes. First of
all, the expression pattern for A. thaliana was consistent for all of the genes analyzed.
43
Overall, A. thaliana had higher expression levels for all six HSPs that were evaluated as well
as for HSFA3, when compared to the three Boechera species. This is also consistent with the
phenotypic data previously obtained in the Waters lab [31].
The phenotypic thermotolerance data shows that the Boechera species can survive a
much longer duration of heat stress and at higher temperatures. The HSP20 and HSP18.2
genes had the highest levels of expression in the Boechera species. Perhaps these HSPs are
the most helpful for these species during heat stress.
It is also interesting to note how HSP17.7 II and HSP21 have similar patterns and
expression levels for A. thaliana, B. pulchra, and B. sparsiflora. This is a fascinating finding
especially since HSP17.7 is a cytosolic class II protein and HSP21 is a chloroplast protein.
Perhaps the two work together in some way in order to prevent further aggregation of
nonnative proteins.
There were tissue samples taken for all of the Boechera species during the
pretreatment procedure for the acquired heat-shock experiments. These species seem to have
similar gene expression levels when comparing the 38°C basal treatment with the 38°C
acquired pretreatment values. This is true of HSP20 I, HSP18.2 I, and HSP17.7 II. The
difference between these treatments is that the basal treatment is a 2-hour heat-shock, while
the 38°C acquired pretreatment was only a 1-hour heat-shock. This could infer that the HSP
genes are fully expressed after only 1 hour of heat-shock. It also seems that they are still fully
expressed at this level an hour later.
The RuBisCO activase data for A. thaliana and B. depauperata is consistent with data
found in the literature. Previous research has stated that RuBisCO Activase is sensitive to
temperatures as low as 30°C [27]. It would be interesting to perform a mild heat shock on the
species of interest in order to monitor the expressions levels of RuBisCO activase. Then I
may be able to detect the temperature in which this protein begins to degrade. This could also
be correlated with the onset of expression of HSPs. Perhaps, the HSPs allow RuBisCO
Activase to function at certain temperatures.
The gene expression analysis of the reference genes was performed as a second check
to make sure that the levels of these genes were consistent throughout the heat-shock
samples. There were no major discrepancies with either of the reference genes when
comparing them to each other or when comparing each reference gene against itself. This
44
assures that pipetting was relatively accurate, since the fold changes are stable for each
species.
The data generated here strongly suggest that the increased thermotolerance in all
Boechera species and in particular in B. depauperata is not due to elevated HSP expression.
The Boechera species express all of the small HSPs as well as HSP101 at a much lower level
in comparison to A. thaliana. The gene expression data also correlates with the climate,
which is inhabited by each of these different species. A. thaliana is found in a temperate
climate in Eastern Europe and therefore is used to a mild heat conditions. Therefore, it may
need the aid of the HSPs to help it survive when exposed to extreme heat stress.
B. sparsiflora is found on the coast of California and is used to moderate heat with less
variable temperature conditions. Therefore, it may need less help from the HSPs, but is more
sensitive to stress at a lower temperature than the other Boechera species. B. pulchra is a
California desert species and is therefore used to hot conditions with less variability in
temperature. Perhaps, the small HSPs do aid this plant in times of heat upregulation. Finally,
B. depauperata is found in the mountains of Northern California at a high altitude with
varying temperature. It has been found to have the highest thermotolerance using the
phenotypic data. This is also shown in the gene expression patterns, where this species
expresses these genes at a relatively stable level across treatments.
With this data as well as the knowledge that the Boechera species are phenotypically
more thermotolerant than A. thaliana, I can infer that there may be another system in the
Boechera species that is aiding these species during heat stress. Perhaps the Boechera species
have proteins that are less prone to aggregation due to the habitat in which they live.
Therefore, they do not need the help of the HSPs to deal with environmental stressors as
much as species like A. thaliana.
Reasons for the high thermotolerance of B. depauperata are still unknown but may be
due the climate that this species inhabits. This species grows at a higher altitude and in a
temperate climate. Perhaps, B. depauperata is more accustomed to variable living conditions.
We can infer from both studies that the patterns correlate when looking at both phenotypic
thermotolerance and gene expression data.
45
FUTURE DIRECTIONS
This study has answered a number of important questions, but it also raises other
questions worth of study. First, it would be interesting to test these HSPs in other species that
exist in similar habitats to the four species we have already tested. This will show whether
the gene expression patterns are specific to each species, or if it is indicative of the
environment in which they inhabit. The Waters lab has phenotypic thermotolerance data for
the B. perennans species, so it will be interesting to analyze the gene expression patterns for
this dessert species as well. There was a shortage of B. perennans seeds in order to perform
heat-shock experiments, so we have been collecting more seeds recently for this species. The
rest of the heat-shock experiments for this species will be performed soon, so we should be
able to move forward with plans to obtain data for this species as well. Then, I can compare
this desert species to the B. pulchra data to see if the patterns are similar.
The design of gene specific primers for the B. pulchra, B. perennans, and
B. sparsiflora species to re-test HSP101 and HSP17.6II genes using qPCR would provide
valuable information. This will be done using the same or similar procedure as was
previously performed in order to sequence HSP21 genes for all of the species. It will be
interesting to obtain data for the other species for the HSFA gene in order to see if the gene
expression patterns match the HSP expression patterns like they did in A. thaliana and
B. depauperata. It would also be interesting to examine other HSFs in order to correlate the
expression patterns of these HSFs to the HSP genes that they induce.
Another possibility for future work is to re-test the acquired heat-shock in
B. sparsiflora using 36°C as the pretreatment temperature instead of 38°C. This may alter the
acquired gene expression levels in this species. The choice of using the 38°C temperature as
a pretreatment for the other species was based on previous heat-shock experiments in the
literature.
After performing several qPCR experiments, I have learned several ways in order to
reduce the standard error values in my data. If I test only 5 temperatures per species, I will be
able to run more genes on one plate to be assayed during the same run. This should reduce
any variation I found from one plate to another plate. I can also test 6 genes of interest and
46
2 reference genes on two plates. Running each plate in triplicate will also decrease the
standard error values and assure that the data is accurate. I would also like to make a larger
pool of diluted cDNA in order to use across all plates. There are other HSPs that we may
choose to analyze in the future, so cutting down on the number of temperatures to run will
allow more genes to be analyzed on a single plate.
Analyzing a wider range of species with similar habitats to A. thaliana, B. sparsiflora,
B. pulchra, and B. depauperata will also expand our knowledge on the behavior of HSPs.
There are more Boechera species that the Waters lab is interested in researching. Examining
the thermotolerance of these species using a similar gene expression analysis will provide us
with a further understanding of the correlation between HSP gene expression and the climate
these plant species inhabit.
47
REFERENCES
[1] Lawlor DW: Musings about the effects of environment on photosynthesis. Ann Bot 2009, 103:543-549.
[2] Somero GN: The physiology of climate change: how potentials for acclimatization and genetic adaptation will determine ‘winners’ and ‘losers’. J Exp Biol 2010, 213:912-920.
[3] Boston RS, Viitanen PV, Vierling E: Molecular chaperones and protein folding in plants. Plant Mol Biol 1996, 32:191-222.
[4] Haslbeck M, Franzmann T, Weinfurtner D, Buchner J: Some like it hot: the structure and function of small heat-shock proteins. Nat Struct Mol Biol 2005, 12:842-846.
[5] Vierling E: The small heat shock proteins in plants are members of an ancient family of heat induced proteins. Acta Physiol Plant 1997, 19:539-547.
[6] Vierling E: The roles of heat shock proteins in plants. In Briggs, W R. 1991: 579-620: Annual Review of Plant Physiology and Plant Molecular Biology.
[7] Tyedmers J, Mogk A, Bukau B: Cellular strategies for controlling protein aggregation. Nat Rev Mol Cell 2010, 11:777-788.
[8] Johnston JA, Ward CL, Kopito RR: Aggresomes: A cellular response to misfolded proteins. J Cell Biol 1998, 143:1883-1898.
[9] Chen B, Retzlaff M, Roos T, Frydman J: Cellular strategies of protein quality control. Cold Spring Harbor Perspect Biol 2011, 3:14.
[10] Liberek K, Lewandowska A, Zietkiewicz S: Chaperones in control of protein disaggregation. EMBO J 2008, 27:328-335.
[11] Eyles SJ, Gierasch LM: Nature’s molecular sponges: small heat shock proteins grow into their chaperone roles. PNAS USA 2010, 107:2727-2728.
[12] Hong SW, Vierling E: Hsp101 is necessary for heat tolerance but dispensable for development and germination in the absence of stress. Plant J 2001, 27:25-35.
[13] Tonsor SJ, Scott C, Boumaza I, Liss TR, Brodsky JL, Vierling E: Heat shock protein 101 effects in A. thaliana: genetic variation, fitness and pleiotropy in controlled temperature conditions. Mol Ecol 2008, 17:1614-1626.
[14] Sun WN, Van Montagu M, Verbruggen N: Small heat shock proteins and stress tolerance in plants. BBA-Gene Struct Expr 2002, 1577:1-9.
[15] Waters ER, Lee GJ, Vierling E: Evolution, structure and function of the small heat shock proteins in plants. J Exp Bot 1996, 47:325-338.
48
[16] Neta-Sharir I, Isaacson T, Lurie S, Weiss D: Dual role for tomato heat shock protein 21: protecting photosystem II from oxidative stress and promoting color changes during fruit maturation. Plant Cell 2005, 17:1829-1838.
[17] Kotak S, Larkindale J, Lee U, von Koskull-Doering P, Vierling E, Scharf K-D: Complexity of the heat stress response in plants. Curr Opin Plant Biol 2007, 10:310-316.
[18] The Arabidopsis Information Resource (TAIR). www.tair.org. [19] Yoshida T, Ohama N, Nakajima J, Kidokoro S, Mizoi J, Nakashima K, Maruyama K,
Kim JM, Seki M, Todaka D, et al: Arabidopsis HsfA1 transcription factors function as the main positive regulators in heat shock-responsive gene expression. Mol Genet Genomics 2011, 286:321-332.
[20] Agarwal M, Katiyar-Agarwal S, Sahi C, Gallie DR, Grover A: Arabidopsis thaliana Hsp100 proteins: kith and kin. Cell Stress Chaperones 2001, 6:219-224.
[21] Larkindale J, Vierling E: Core genome responses involved in acclimation to high temperature. Plant Physiol 2008, 146:748-761.
[22] Waters ER, Aevermann BD, Sanders-Reed Z: Comparative analysis of the small heat shock proteins in three angiosperm genomes identifies new subfamilies and reveals diverse evolutionary patterns. Cell Stress Chaperones 2008, 13:127-142.
[23] Wehmeyer N, Vierling E: The expression of small heat shock proteins in seeds responds to discrete developmental signals and suggests a general protective role in desiccation tolerance. Plant Physiol 2000, 122:1099-1108.
[24] Pavlova EL, Rikhvanov EG, Tauson EL, Varakina NN, Gamburg KZ, Rusaleva TM, Borovskii GB, Voinikov VK: Effect of salicylic acid on the development of induced Thermotolerance and induction of heat shock protein synthesis in the Arabidopsis thaliana cell culture. Russian J Plant Physiol 2009, 56:68-73.
[25] DeRidder BP, Salvucci ME: Modulation of Rubisco activase gene expression during heat stress in cotton (Gossypium hirsutum L.) involves post-transcriptional mechanisms. Plant Science 2007, 172:246-254.
[26] The Arabidopsis Biological Resource Center. www.osu.abrc.edu. [27] Ortmann, L.M (2009). Comparative thermotolerance in the genus Boechera
(Master’s thesis). San Diego State University, San Diego, CA. [28] National Center for Biotechnology Information (NCBI). www.ncbi.nlm.nih.gov.
[29] Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR: Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol 2005, 139:5-17.
[30] Siddique M, Gernhard S, von Koskull-Doering P, Vierling E, Scharf K-D: The plant sHSP superfamily: five new members in Arabidopsis thaliana with unexpected properties. Cell Stress Chaperones 2008, 13:183-197.
49
[31] Swindell WR, Huebner M, Weber AP: Transcriptional profiling of Arabidopsis heat shock proteins and transcription factors reveals extensive overlap between heat and non-heat stress response pathways. BMC Genomics 2007, 8.
[32] Barta C, Dunkle AM, Wachter RM, Salvucci ME: Structural changes associated with the acute thermal instability of Rubisco activase. Arch Biochem Biophysics 2010, 499:17-25.