Lezione 10

Metagenomica ed environmental DNA (eDNA)

Quali campioni e quali dati sono tipici della metagenomica?

Target capture and variant calling

Metagenomics is the study of genetic material recovered directly from environmental samples. (Wikipedia)

Metagenomics is the study of all genomes present in any given environment without the need for prior individual identification or amplification. For example, in its simplest form, a metagenomic study might be the direct sequence results of DNA extracted from a bucket of sea water. (EBI metagenomics)

OTU: Operational Taxonomic Unit. The taxonomic level of sampling defined by the researcher in a study; for example, individuals, populations, species, genera, or strains.

https://www.ebi.ac.uk/metagenomics/

Species specific primers OR universal primer (BARCODING)

Mitocondriale

Nucleare

Plastidiale

Amplificazione di un marcatore per distinguere le OTU e tag per distinguere gli individui

A DNA barcoding reference database, including rbcL and trnH-psbA sequences from 693 plant species (104 sequenced in this study) was assembled.

Pollen composition was largely influenced by floristic local biodiversity, plant phenology, and the presence of alien flowering species.

45 samples were isolated from slices or fillets (i.e. white muscular tissue) of sharks sold as ‘‘palombo” (we checked the name reported on the label) in different Italian fish markets and supermarkets.

DNA marker: COI

Only three (6.7%) can be unequivocally assigned to ‘‘palombo” and in particular to the species M. mustelus.

Further, six cases out of 45 (13.3%) refer to species belonging to the genus Mustelus. Altogether, we identified 35 cases of species substitution out of 45 (77.8%) collected samples.

http://www.zooplantlab.btbs.unimib.it/

Maurizio Casiraghi

Massimo Labra

http://www.zooplantlab.btbs.unimib.it/

Microbiome

The microbiome comprises all of the genetic material within a microbiota (the entire collection of microorganisms in a specific niche, such as the human gut). This can also be referred to as the metagenome of the microbiota.

DNA marker: 16s RNA

http://microbiomaitaliano.it/

In this work, we compared the fecal microbiota of European children (EU) and that of children from a rural African village of Burkina Faso (BF), where the diet, high in fiber content, is similar to that of early human settlements at the time of the birth of agriculture.

By using high-throughput 16S rDNA sequencing and biochemical analyses, we found significant differences in gut microbiota between the two groups.

BF children showed a significant enrichment in Bacteroidetes and depletion in Firmicutes (P < 0.001), with a unique abundance of bacteria from the genus Prevotella and Xylanibacter, known to contain a set ofbacterial genes for cellulose and xylan hydrolysis, completely lackingin the EU children

We hypothesize that gut microbiota coevolved with the polysaccharide-rich diet of BF individuals, allowing them to maximize energy intake from fibers while also protecting them from inflammations and noninfectious colonic diseases. This study investigates and compares human intestinal microbiota from children characterized by a modern western diet and a rural diet, indicating the importance of preserving this treasure of microbial diversity from ancient rural communities worldwide.

PubMed search:

microbiome AND human disease

5992 articoli

Environmental DNA (eDNA)

trace DNA in samples such as water, soil, or faeces.

eDNA is a mixture of potentially degraded DNA from many different organisms.

Bohmann et al. 2014 TEE

Bohmann et al. 2014 TEE

Bohmann et al. 2014 TEE

sanguisuga

Bohmann et al. 2014 TEE

iDNA > eDNA

(iDNA= invertebrate)

Bohmann et al. 2014 TEE

Bohmann et al. 2014 TEE

Bioinformatica: i file fastq contengono sequenze (reads) di più organismi per lo stesso marcatore

@FCAD1E3:1:1101:19588:1266#NGAATGTG_CAACAGGT/1

GAGTGGACTCCTGCGGGAGGCAGCAGTGGGGAATCTTCGGCAATGGGCGCAAGCCTGACCGAGCCATGCCGCGTGAGTGAAGAAGGCCTTAGGGTCGT

AAAGCTCTTTCGCCAGGGATGATAATGACAGTACCTGGTAAAGAAACCCCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGGGGTAGCGTT

GTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACTATTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTTGTAAACTCCCAGT

CTAGAG

+

CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGE

GGGGGGGGGGGGGGGGGGFFGGFGGGGGGGGGGFGGGFGFFGGGFFGGGGGGGGGGGFGGG@FGGGGGDGGFGGGG@FEGGGGFGGGGGG*?858>*A

EEGGGGGGGGGGGFGG5CCEGDFGC7DG:*:EEGGGDG5CFFGGFF467?FB>D:*@>D?F2>)>5)-

8).2)646=A9>

Alpha: the mean species diversity in sites or habitats at a local scale

Beta: ratio between regional and local species diversity.

What are the microorganism capable of doing as a community?

Comparing different environments

Uso di uno specifico marcatore: problemi

-bisogna disegnare primers che vadano bene per molte OTU

-bisogna trovare il giusto marcatore (che sia cioè in grado di distinguere tra diverse OTU)

-bisogna amplificare specificamente

-questo si può superare con il capturing (ricordate le lezioni pratiche? Richiede meno specificità di una PCR)

-bisogna avere un database di riferimento che contenga quel marcatore per diversi organismi

Con i nuovi metodi di sequenziamento e l’aumento di informazioni nelle banche dati si può passare ad uno shotgun sequencing (simile ad un sequenziamento genomico, ma di tutto ciò che è stato raccolto nel campione) (vedere il progetto http://extrememicrobiome.org/)

(A) Sampling from habitat(B) filtering particles, typically by size(C) DNA extraction and lysis(D) sequencing (E) sequence assembly.

http://blog.booleanbiotech.com/nanopore_2016.html

D

E