Biotechnology questions

sample

Note : don't show to the teacher

Good luck : )

1- Which of the following statements is correct?

A. Agrobacterium causes crown gall tumors that kill the plant

B. Plant cells utilize opines as nutrient molecules

C. The Ti plasmid of agrobacterium enters injured plant cells in the soil

D. Virulence genes on the Ti plasmid facilitate entry of T-DNA into plant

cells

E. T-DNA of agrobacterium encodes genes for enzymes that inhibit plant

hormones

2- Which of the following statements about plant hormones is incorrect?

A. Active at low concentration

B. Have only one specific action each

C. Regulate cell enlargement, cell division and cell differentiation

D. Regulate organogenesis, senescence and dormancy

E. Control flower formation and reproduction

3- Which of the following are produced by plant cells infected with crown

gall tumors and can only be utilized by agrobacteria as nutrients?

A. Opines

B. Quinones

C. Cytokines

D. Lignans

E. Tropanes

4- Which of the following statements is incorrect?

A. An antisense oligo sequence can efficiently bind to any part of a target

RNA

B. Oligos mixed with lipofectamine lose their biological activity

C. It is easy for antisense oligo to bind to DNA because it is loosely packed

D. Antisense oligos will bind more efficiently to newly transcribed RNA

E. All parts of an m-RNA are not necessarily accessible to an antisense oligo

5- Which of the following is likely to be the most efficient and practical for

in vitro antisense delivery?

A. Liposome encapsulation

B. Micro-injection

C. Endocytosis

D. Ligated to a plasmid vector

E. Encapsulation in a bacterial protoplast

6- Which of the following is not plant hormone or growth factor?

A. Cytokinin

B. Cytokine

C. Abscisic acid

D. Gibberellin

E. Indole-3-acetic acid

7- Which of the following modifications would not be expected to improve

the function of an antisense oligonucleotide?

A. Replacement of the deoxyribose backbone by a polymerase structure

B. Replacement of the phosphate by phosphothioate

C. Replacement of the phosphate by phosphoramidate

D. Replacement of the deoxyribose by a hexose sugar

E. Alteration of the phosphate to a methylphosphonate

8- Which of the following criteria for antisense drugs is incorrect?

A. They must be rapidly modified when introduced into the cell

B. Should be available in relatively large amounts

C. There must be an efficient delivery system

D. Should have high affinity binding to target RNA or DNA

E. Should be highly specific in vivo

9- Which of the following would be unsuitable for plant cell cultures?

A. Infusion of heavy metals

B. Periodic supply of nutrients

C. Controlled sterile conditions

D. Addition of hormones

E. Selected growth factor

10- Which of the following is not involved in the RNA interference pathway?

A. Long double stranded RNA

B. siRNAs

C. RISC complex

D. Ribosome complex

E. Cleavage of dsRNA by dicer

11- Which of the following statements is correct?

A. Oxyzyme specifically cleaves the HBV pre-genomic RNA

B. Heptazyme is aimed at the HER2 (c-erbB2) oncogene

C. Vitravene is an oligo used to treat CMV infections

D. HerZyme is an example of a natural ribozyme

E. HepBzyme is used to cleave RNA at carbonyl group

12- Short inhibitory RNAs (siRNA)

A. Act by delaying onset of gene transcription

B. Mediate the degradation of specific m-RNAs

C. Specifically inhibit ribosome function

D. Interrupt DNA unwinding during replication

E. Interact with cellular ribozymes to degrade RNA

13- Ribozymes are

A. RNA molecules with self-cleaving activity

B. General proteolytic enzymes

C. Derivatives of ribose sugar

D. The activated form of ribosomes

E. Involved in the control of DNA replication

14- An antisense sequence is best described as a specific sequence

A. Strand of RNA of 15-30 bases

B. Of DNA of 5-25 bp

C. Of double stranded DNA of 15-18 bp

D. A double strand of RNA of 15-25 base

E. Of single stranded DNA of 20-25 bases

15- Antisense oligonucleotides can

A. Bind to any DNA sequence

B. Bind to complementary DNA by forming a triple helix

C. Bind to both strands of DNA forming a double helix

D. Block translation by inhibiting amino acyl t-RNA synthetases

E. Increase transcription by activating gene promoters

16- Designing antisense oligonucleotides is much simpler than protein drug

design because

A. DNA is easier to isolate

B. m-RNA three dimensional structures are easier to predict

C. it is simpler to access the target

D. proteins have more subunits than nucleic acid

E. they are smaller than proteins

17- A "helper virus"

A. Helps the recombinant virus to enter the host cell

B. Provides the viral proteins to package the recombinant genome

C. Has the sequences needed for packaging itself in the host cell

D. Is one that contains only the gag. pol and P sequences

E. Assists host cell mechanisms for DNA repair of damaged viral genome

18- Which of the following retroviral components is needed for viral

packaging?

A. Terminal repeat sequences

B. Pol gene sequence

C. Alu repeat sequence

D. P sequence

E. Env gene sequence

19- When a retrovirus infects a target cell

A. The viral DNA is immediately transcribed by host enzymes

B. RNA is synthesized from the viral DNA

C. DNA polymerase directs synthesis of viral c-DNA

D. Reverse transcriptase copies the viral RNA into c-DNA

E. Host cell enzymes immediately replicates the viral RNA

20- Which of the following vectors would not be a useful delivery system for

in vivo gene transfer?

A. Retrovirus

B. HSV

C. Recombinant plasmid

D. Vaccinia virus

E. Adenovirus

21- Which of the following is not an absolute requirement for successful gene

therapy?

A. Insertion of the gene into several chromosomes

B. Cellular expression of the gene

C. The genetic defect must be known

D. An efficient delivery system

E. A cloned human gene

22- Which of the following is correct?

A. Somatic gene therapy is only applicable for treatment of multigenic

disorders

B. Clinical trials in humans are currently restricted to somatic gene therapy

C. Effects of somatic gene therapy are transmitted to the next generation

D. There are more ethical problems with somatic than with germ-line therapy

E. Germ-line therapy affects only the individual derived from that embryo

23- Which of the following statements is not correct?

A. An animal expressing a foreign gene is called a transgenic

B. Proteins expressed in bacteria can be collected in protein inclusion bodies

C. Recombinant proteins recovered by bacteria in denatured form can be

refolded in vitro

D. It is only possible to transfer a human gene into an animal cell in vitro

E. Functional recombinant human proteins are better made by mammalian

than bacterial cells

24- Site directed mutagenesis

A. Depends upon the length of the PCR product

B. Is used to delete a single base from a PCR template sequence

C. Is an in vitro method of inactivating genes

D. Requires a mismatched primer sequence for PCR

E. Refers to insertion of foreign DNA into a unique restriction site vector

25- Which of the following applications to PCR is unlikely to succeed?

A. Detection of HIV in an asymptomatic individual

B. Cloning of a 12 kb gene from frozen tumor tissue

C. Cloning of a 10 kb fragment from DNA extracted from fossil material

D. Identifying an individual from a dried specimen from his blood

E. Detecting cancer cells in bone marrow samples

26- The PCR usually reaches a plateau because

A. The products start to inhibit the enzyme

B. All the DNA templates has been used up

C. The enzyme starts to denature

D. Product strands anneal to each other more efficiently

E. The primers become depleted

27- Why PCR primers are generally about 18-30 bases in length?

A. This is a convenient length to synthesize

B. This is the optimum length for annealing to the target

C. This is the optimum length for the taq polymerase

D. This is the minimum length to make them gene specific

E. This is the most stable length for synthetic primers

28- Which is the least efficient method for transformation of eukaryotic cells?

A. Applying calcium phosphate precipitates of DNA

B. Electroporation of cells

C. Adding DEAE-dextran DNA complexes

D. Microinjection of DNA into cells

E. Fusion of bacteria with liposomes containing DNA

29- Which of the following statements about PCR is correct?

A. Cycling is normally carried out at one temperature

B. Taq polymerase usually works best at 37ᵒ C

C. It requires RNA primers

D. Extension is usually carried out at 95ᵒ C

E. It requires a very small amount of template DNA

30- Which of the following vectors would be best used to clone a 250 bp DNA

fragment?

A. Cosmid

B. Yeast artificial chromosome

C. Bacterial artificial chromosome

D. Plasmid

E. Phagemid

31- Which of the following features of vector is necessary for expression of

protein?

A. Origin of replication

B. Multiple cloning site

C. Promoter sequence

D. Antibiotic resistance gene

E. Unique restriction enzyme site

32- DNA has been cut into pieces and electrophoresed in an agarose gel.

Which size fragments will be best separated in a very low % gel?

A. 25-100 bp

B. 100-1000 bp

C. 5-6 kbp

D. 7-10 kbp

E. 50-100 bp

33- EcoR1 cuts DNA at GAATTC. How many fragments would this enzyme

produce from a piece of DNA the sequence: AGTACACACGATAGACAGATAGCGAATTCGCATCGGAATCGAATTCGTCAATA

A. 1

B. 2

C. 3

D. 4

E. 5

34- A recombinant DNA molecule is

A. One that is synthesized using restriction enzymes

B. Created by joining two pieces of DNA together with DNA ligase

C. RNA that has been ligated into a vector

D. Made by copying the anti-sense strand of DNA

E. Created from a spliced m-RNA

35- Which of the following statements best describes c-DNA?

A. Formed by action of reverse transcriptase and DNA polymerase

B. Synthesized by reverse transcriptase

C. Synthesized by exonic regions of DNA

D. Synthesized by reverse transcriptase and DNA ligase

E. Only formed from eukaryotic cells

36- A mutation in the splice site of a eukaryotic hnRNA

A. Will result in a shorter m-RNA

B. Will cause premature termination of translation of that RNA

C. Changes a single amino acid at that codon

D. Will lead to premature splicing

E. Will result in abnormally long m-RNA

37- Which of the following is not usually present outside the cell nucleus of

eukaryotes?

A. Transcription factors

B. m-RNA

C. r-RNA

D. DNA

E. hnRNA

38- How many amino acids could you most confidently predict to be in the

protein translated from a eukaryotic Mrna that is 870 nucleotides long?

A. > 288

B. < 280

C. 289

D. 290

E. 435

39- The regions of DNA in a eukaryotic gene that encode proteins are called

A. Proteasomes

B. Leader sequences

C. Enhancers

D. Introns

E. Exons

40- Which of the following tools of recombinant DNA technology is correctly

paired with its use?

A. Restriction endonuclease – usually cuts at a 6-7 base sequence of DNA

B. Terminal transferase – enzyme that phosphorylates the end of DNA

C. Methylase – adds a cap to the terminal adenine on RNA

D. Reverse transcriptase – creates double stranded RNA

E. Electrophoresis – separation of DNA on the basis of size differences

41- Which of the following is responsible for unwinding the DNA during

transcription?

A. Helicase

B. Topoisomerase

C. Small transcription factors

D. Single strand DNA binding proteins

E. RNA polymerase binding

42- What is the function of leucylAminoacyl t-RNA synthetase?

A. To add a co-factor to newly synthesized protein

B. To attach leucine to its correct t-RNA

C. To align the m-RNA to the A site of the ribosome

D. To intiate protein synthesis by adding an amino group to leucine

E. To form a peptide bond between leucine residues

43- Which of the following statements regarding t-RNA is correct?

A. Is the most abundant form of RNA

B. Binds with proteins to form ribosomes

C. Has inter-chain double stranded regions

D. Is the smallest RNA involved in protein synthesis

E. Is translated at the ribosome

44- During the process of DNA replication

A. Gyrase is responsible for unwinding the double helix

B. Synthesis in eukaryotes starts from a single origin of replication

C. RNA polymerase copies the leading strand

D. Okazaki fragments are joined together by DNA ligase

E. DNA primers attach to the lagging strand

45- Which of the following best describes a gene promoter?

A. A short sequence constituting the starting point of transcription

B. Activates topoisomerase to supercoil the DNA

C. It is required to initiate DNA replication

D. Activates DNA polymerase for replication

E. Is a binding site for RNA polymerase

46- Which of the following best describes substitution mutation in DNA?

A. Point mutation

B. Non-sense mutation

C. Frame shift

47- Which of the following is used to detect low abundant protein in cell

extract?

A. Immunoprecipitate

B. Immunohistochemistry

48- Which of the following have a coding sequence for reverse transcriptase?

A. HIV

B. E.coli

C. Mouse genomic DNA

D. Cytomegalovirus

49- DNA expression vector differ from cloning vector such as PBR322 in that:

A. The cloning capacity is large

B. They have 2 origin of replication

C. They enter both prokaryotes and eukaryotes

D. They have sequence that permit transcription

50- Gene promoter is required to

A. Initiate RNA transcription

B. It is binding site for helicase unwindase

C. It is short sequence constituting start point of transcription.

51- The expression of transfected genes can be increased by

A. Adding a viral promoter to the gene construct

B. Transfecting a large amount of the gene