Biotechnology Introduction

Gel Electrophoresis

Gel Electrophoresis

• Method of analyzing DNA

• Allows a researcher to determine how alike or different two samples of DNA are.

Gel Electrophoresis Equipment

1. Gel

2. Gel box

3. Well and “lane”

4. Power supply

5. Liquid buffer solution

6. Restriction enzyme

7. DNA sample

1. The “gel”

• Made from agarose (like gelatin).• Poured into a thin, flat square to harden.• A comb-like object is left in one end to create

“wells.”• Agarose is porous when it cures.• A current is forced through the gel from one side

to the other.• Lengths of DNA will travel with the current.• The DNA will have to “work its way around” the

pores in the gel.• Shorter lengths of DNA will travel around the

pores faster than longer ones.

Top View of a Gel Wells (DNA sample will be placed in here)

Lanes (not actually visible & only three are labeled)

DNA samplewill “run” in this direction

Side view of a gelWell

Arrow shows the direction DNA will “run” in

Microscopic view of a gelpore

agarose

Fragmentof DNA “running”through gel

2. Gel box

• Plastic box that holds– Gel– Buffer solution– Electrodes to carry current through gel

Top view of gel boxElectrodesBlack = negRed = posThese plug into the power source & create the electrical current

Gel

Direction of current

Side view of a gel box

Electrode WellGel

Buffer solutionHelps carry the current

Plastic block gel sits on

Direction of current

Direction DNA “runs”

3. Wells

1. Small holes in the gel that the DNA samples will be placed in.

2. Created by placing a comb in the gel as it cures.

4. Lanes

1. Area below each well that the DNA sample will “run” through.

2. DNA always will stay in its lane and run with the current.

3. How far the DNA runs depends on how long it is.

4. Each lane will have “bands” of DNA when you are done “running” the gel.

Top view of DNA banding in lanes

DNA “bands”(MANY pieces of DNAfrom a sample that are allthe same length.

Bands from differentsamples that “line up” show DNA that is similar.

5. Power supply

1. Electrical power that plugs into the gel box.

2. Provides a current that will flow across the gel.

3. Current will move DNA samples from the wells and down through the lanes.

6. Liquid buffer

1. Mostly water with some chemicals added.

2. Allows the current to travel through the gel better.

3. “Just” covers the gel in the box.

7. Restriction Enzymes

1. Enzymes that recognize certain base sequences in the DNA.

2. The enzyme will attach itself to the DNA at that sequence.

3. The enzyme will cut the DNA somewhere along the sequence

Restriction Enzyme Illustration

• A restriction enzyme may recognize the following base sequence in a DNA sample:– GGCTGG

• The restriction enzyme will bind to the DNA every time it “sees” that sequence of bases.

• It will cut the DNA between the C and the T• Therefore the DNA will be cut into many smaller

fragments.• There are many different restriction enzymes &

each recognizes a different base sequence.

Restriction Enzyme Illustration

TAGCATAGCAGGCTGGTGGCTGGTATTATATTATGGCTGGTGGCTGGTGCAGCA

Two restriction enzymes would bind to the bold segments

Each restriction enzyme would cut the DNA between the C and T

The DNA would now be in three fragments…

TAGCATAGCAGGCGGCTGGTTGGTATTATATTATGGGGCCTGGTTGGTGCAGCA

If this sample was run through a gel, the bottom fragment would travel the farthest, the top fragment the second farthest, and the middle fragment the least farthest.