Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Unique synergistic antiviral effects of Shufeng Jiedu Capsule and oseltamivirin influenza A viral-induced acute exacerbation of chronic obstructivepulmonary disease

Shuang Jia,1, Qin Baia,1, Xu Wua, Da-Wei Zhanga, Sheng Wangc, Ji-Long Shenb, Guang-He Feia,*a Department of Respiratory and Critical Care Medicine, First Affiliated Hospital of Anhui Medical University, Hefei, 230022, Anhui Province, PR ChinabDepartment of Pathogen Biology and Provincial Laboratories of Pathogen Biology and Zoonoses, Anhui Medical University, Hefei, 230032, Anhui Province, PR Chinac The Center for Scientific Research of Anhui Medical University, Hefei, 230032, Anhui Province, PR China

A R T I C L E I N F O

Keywords:Chronic obstructive pulmonary diseaseInfluenza A virusNLRP3 signal transductionOseltamivirShufeng Jiedu CapsuleSynergistic effects

A B S T R A C T

Background: The aim of the present study was to investigate the synergistic effects and interactive mechanismsof Shufeng Jiedu Capsule (SFJDC) combined with oseltamivir in the treatment of acute exacerbation of chronicobstructive pulmonary disease (AECOPD) induced by the influenza A virus (IAV).Methods: The extraction of SFJDC was analyzed by UHPLC/ESI Q-Orbitrap Mass Spectrometry. Human bron-chial epithelial cells were isolated from COPD (DHBE) bronchial tissues, co-cultured with IAV for 24 h, and weresubsequently treated with SFJDC and/or oseltamivir. Cell viability was detected by MTT assay. A rat model ofCOPD with IAV infection was established and treated with SFJDC and/or oseltamivir. Interleukin (IL)-1β and IL-18 in serum and bronchoalveolar lavage fluid (BALF) were measured by ELISA. Additionally, mRNA and proteinlevels of NLRP3 inflammasome pathway were measured by quantitative real-time PCR and Western blotting,respectively.Results: SFJDC and/or oseltamivir, at their optimal concentrations, had no significant cytotoxicity againstDHBEs. The levels of NLRP3-inflammasome-associated components were significantly elevated after cells wereinoculated with IAV, whereas the mRNA and protein levels of these components were significantly decreasedafter treatment with SFJDC and/or oseltamivir in vitro. Moreover, in vivo, the combination of SFJDC and osel-tamivir improved survival rates, attenuated clinical symptoms, induced weight gain, alleviated lung damage,and significantly reduced IL-1β and IL-18 levels in serum and BALF, as well as reduced the expression levels ofNLRP3-associated components and viral titers in lung homogenates.Conclusion: SFJDC combined with oseltamivir treatment significantly attenuated IAV-induced airway in-flammation and lung viral titers. Hence, our findings may provide a novel therapeutic strategy for IAV-inducedrespiratory infection.

1. Introduction

Chronic obstructive pulmonary disease (COPD) is a chronic re-spiratory inflammatory disease [1,2]. Growing evidence has indicatedthat COPD patients are more susceptible to influenza viral infection,which leads to an accelerated decline in lung function and rapid diseaseprogression and induces more severe symptoms [3,4]; however, effec-tive treatments are limited. Oseltamivir, a neuraminidase inhibitor, is aconventional antiviral drug that is commonly used against seasonal andpandemic influenza [5,6]. Despite oseltamivir being widely used, itsefficacy in the treatment of influenza is still controversial due to its

small optimal time window, side effects, and drug resistance [7]. Ad-ditionally, the World Health Organization (WHO) has downgradedoseltamivir on drug lists because they are less cost-effective [8].Therefore, it is necessary and urgent to discover novel and/or sy-nergistic drugs in the clinical setting for the treatment of influenza.Shufeng Jiedu Capsule (SFJDC) is a traditional Chinese medicine (TCM)consisting of eight medicinal herbs. Clinical investigations and evidencefrom basic research have indicated that SFJDC alone or in combinationwith other chemotherapeutic agents exhibits anti-inflammatory andimmunomodulatory functions [9–11] against upper respiratory tractinfections [12–14], acute lung injury [15–17], and cancers [18,19].

https://doi.org/10.1016/j.biopha.2019.109652Received 21 July 2019; Received in revised form 25 October 2019; Accepted 6 November 2019

⁎ Corresponding author.E-mail address: guanghefei@126.com (G.-H. Fei).

1 Shuang Ji and Qin Bai contributed equally to this work.

Biomedicine & Pharmacotherapy 121 (2020) 109652

0753-3322/ © 2019 First Affiliated Hospital of Anhui Medical University. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

T

Therefore, we hypothesized that a combination of SFJDC with oselta-mivir may achieve a better treatment efficacy compared to that ofmonotherapy in the treatment of patients with acute exacerbation ofCOPD (AECOPD) induced by the influenza A virus (IAV).

Human airway epithelial cells are an important interface for IAVinteractions and therapeutic targets in airway diseases [20]. As the firstphysical barrier, these cells are responsible for recognizing pathogensand coordinating immune responses with several pattern recognitionreceptors (PRRs) [21]. Current research shows that nucleotide-bindingoligomerization domain (NOD)-like receptor family pyrin domain-containing 3 (NLRP3) has a substantial impact on tissue inflammationand chronic airway diseases (e.g., COPD) and aggravates disease pro-gression [22–24]. In addition, the NLRP3 inflammasome is consideredto be an important target for the treatment of inflammatory diseases, asits activation can lead to increased release of Interleukin (IL)-1β and IL-18. Based on these findings, the NLRP3 inflammatory pathway mayplay an important role in the treatment of SFJDC alone and in combi-nation with oseltamivir for AECOPD patients.

Taken together, the aim of the present study was to investigate theantiviral effects of SFJDC either alone or via synergistic effects/me-chanisms with oseltamivir in IAV-stimulated COPD bronchial epithelialcells and IAV-infected COPD rats.

2. Materials and methods

2.1. Ethics statement

All experiment protocols were conducted with the approval of theAnimal Ethics Committee of Anhui Medical University as well as strictadherence in accordance with ethical principles.

2.2. Reagents and materials

Methanol, acetonitrile and formic acid of high performance liquidchromatography (HPLC) grade were purchased from Sigma (Sigma-Aldrich, USA). Ultrapure water (18.2MΩ) was purified by Milliporesystem (Millipore Corp, MA, USA). All of solutions were filteredthrough 0.22 μm pore size filters.

2.3. Preparation of SFJDC and oseltamivir

SFJDC was purchased from Ji Ren Pharmaceutical Company (Anhui,China, Batch number 2170901). 1.00 g of the SFJDC capsule contentpowder was accurately measured and added into 25ml volumetricflask, 25ml of solvent (methanol: H2O=7:3) was added into the vo-lumetric flask and weighed, followed by circumfluence extraction for1 h. The solution was cooled to room temperature, and the solvent(methanol: H2O=7:3) was added for weight loss. The SFJDC capsulesolution was finally filtered with a 0.22 μm syringe filter and stored at4 °C before use.

Oseltamivir phosphate was purchased from Chang JiangPharmaceutical Company (Yichang, China). Chemicals were dissolvedin phosphate-buffered saline (PBS) and stored at −20 °C prior to use.

2.4. Chromatographic conditions

A ultra-high performance liquid chromatography (UHPLC) DionexUltimate 3000 (Thermo Scientific, San Jose, USA) equipped withcooling autosampler and column oven was utilized. The separation wasperformed in a Syncronics C18 column (100mm × 2.1mm, 1.7 μm,Thermo Fisher, USA) with a column temperature maintained at 45 °C.Binary mobile solvents were consisted of acetonitrile (A) and watercontaining 0.1 % formic acid (B), and the following gradient elutionprogram was used: 0–3min, 5 % A; 3–4min, 5–14 % A; 4–9min,14–22.5 % A; 9–11min, 22.5–24 % A; 11–14min, 24–40 % A;14–16min, 40–55 % A; 16–19min, 55–70 % A; 19–22min, 70 % A;

22–24min, 70–90 % A; 24–26min, 90 % A ; 26–26.1min, 90–5 % A;26.1–30min, 5 % A. The flow rate was 0.2mL/min, and the injectionvolume was 2 μL.

2.5. Mass spectrometric conditions

A Q-Exactive plus hybrid quadrupole-orbitrap mass spectrometer(Q-Orbitrap MS) (Thermo Scientific, San Jose, USA) with a heat elec-trospray ionization (HESI) was employed. The mass conditions were asfollows: spray voltage: −3.5 kV; capillary temperature: 320 °C; aux-iliary gas heater temperature: 200 °C; S-lens RF level: 50 V; by full MS/dd-MS2 scan mode: Scan range: 100−1200m/z; Resolution: 17,500;Automatic gain control (AGC) target: 1.0 e5; Loop count: 5; Maximuminjection time (IT): 50ms;

Isolation window: 2.0m/z; Stepped nce: 20, 40, 60; Apex trigger:2−6 s; Dynamic exclusion: 10 s. Nitrogen was used for spray stabili-zation and as the collision gas in the C-trap. Q-Exactive 2.9 (ThermoFisher Scientific, San Jose, USA) was used to control the mass spec-trometer, Xcalibur 4.1 software (Thermo Fisher Scientific, San Jose,USA) was used to control the instrument and for data acquisition andanalysis. Compound Discoverer 3.0 software and MS Frontier 7.0 soft-ware (Thermo Fisher Scientific, San Jose, USA) were used to dataanalysis.

2.6. Cell culture

Diseased human bronchial epithelial cell of COPD (DHBE, n=3)harvest was modified from described methods [25,26], and was pur-ified, identified and cultured at 37℃ in a humidified atmosphere with 5% CO2 in BEGM medium (Lonza, NJ, USA) for 3–4 weeks.

Bronchial epithelial cells were expanded on dishes coated with typeI rat-tail collagen until 70%–80 % were confluent, then detached bytrypsin/EDTA at 37℃ for 3−5min, and collected by centrifugation andresuspended in BEGM for reseeding on collagen-coated 12mm trans-well Clear (Corning Life Sciences, USA) supported membranes at adensity of 2.0× 105/insert. When confluent, the apical medium waswithdrawn to create an air-liquid interface. And medium in the basiccompartment changed every 2–3 days.

2.7. Cell viability assay

DHBE cells were seeded at a density of 5000 cells/well into a 96-well. The medium was removed and replaced with fresh medium. After48 h, the cells were incubated with SFJDC or oseltamivir at variousconcentrations for 24 h and examined using an MTT (3-[4,5-dimehyl-2-thiazolyl]-2,5-diphenyl-2H–tetrazolium bromide) assay. Briefly, cellswere added with 10 μl MTT (5mg/ml in PBS) (Beyotime Biotechnology,Shanghai, China) into each well, followed by incubation at 37℃ for 4 h.The culture medium was removed and 100 μl dimethylsulfoxide(DMSO) was added to each well, followed by shaking at room tem-perature for 10min. The spectrometric absorbance at 490 nm was de-termined with a microplate reader (Thermo Scientific, Waltham, MA,USA) [27].

2.8. SFJDC and/or oseltamivir treatment of DHBE cells

DHBE cells were plated in 12 well plates coated with type I rat-tailcollagen. Then cells were induced with IAV/H3N2 (Multiplicity ofInfection (MOI)= 2) for 24 h. Through combining different con-centrations of SFJDC or oseltamivir, 20 μg/ml SFJDC and/or 1.0 μMoseltamivir were used for another 24 h. The cells were harvested todetect the levels of NLRP3, Caspase-1, IL-1β, and IL-18 with quantita-tive real-time PCR(qRT-PCR) and western blot.

S. Ji, et al. Biomedicine & Pharmacotherapy 121 (2020) 109652

2

2.9. Quantitative real-time PCR

RNA was extracted and reversed transcribed to cDNA using the highcapacity cDNA reverse transcription. Real-time PCR (RT-PCR) wasperformed using the SYBR Premix Ex Taq II (Tli RNaseH Plus) (TakaraBiotechnology, Dalian, China). Expression levels of target mRNA werecalculated using 2-ΔΔCt relative to the reference gene (β-actin), thencalculated as fold change relative to media control.

The following primers were used: NLRP3 (human) were forward: 5′–GGCAAATTCGAAAAGGG GTATT–3′, reverse: 5′–CTGATTTGCTGAGAGATCTTGC–3′; Caspase-1 (human) were forward: 5′–GAAGAAACACTCTGAGCAAGTC–3′, reverse: 5′–GATGATGATCACCTTCGGTTTG–3′; IL-1β (human) were forward: 5′–GCCAGTGAAATGATGGCTTATT–3′, re-verse: 5′–AGGAGCACTTCATC TGTTTAGG–3′; IL-18 (human) wereforward: 5′–GCTGAAGATGATGAAAACCTGG–3′, reverse: 5′ –CAAATAGAGGCCGATTTCCTTG–3′; β-actin (human) were forward: 5′−CCTGGCACCCAGCAC AAT–3′, reverse: 5′–GGGCCGGACTCGTCATAC–3′;NLRP3 (rat) were forward: 5′ –GAGCTGGAC CTCAGTGACAATGC–3′,reverse: 5′–ACCAATGCGAGATCCTGACAACAC–3′; Caspase-1 (rat) wereforward: 5′–ATGGCCGACAAGGTCCTGAGG–3′, reverse: 5′–GTGACATGATCGCACAGGT CTCG–3′; IL-1β (rat) were forward: 5′–AGCTTCCAGGATGAGGACCC–3′, reverse: 5′–GCTCACA TGGGTCAGACAGC–3′; IL-18 (rat) were forward: 5′–TGATATCGACCGAACAGCCAACG–3′, re-verse: 5′–GGTCACAGCCAGTCCTCTTACTTC–3′; β-actin (rat) were for-ward: 5′–TGTCACCAAC TGGGACGATA–3′, reverse: 5′–GGGGTGTTGAAGGTCTCAAA–3′.

2.10. Western blotting

After being washed with PBS, cells or lung tissues were harvestedusing RIPA buffer, boiled for 10min in 100 ℃. Total protein was se-parated on SDS-PAGE and Transferred to a PVDF membrane. Afterblockade with 5 % non-fat dry milk in TBST (50 nM Tris−HCl, 150mMNaCl, 0.05 % Tween 20, pH 7.5) for 1 h at room temperature, mem-brane was incubated with the primary antibodies specific to NLRP3(1:1000, Cell Signaling Technology, MA), Caspase-1 (1:1000, CellSignaling Technology, MA), IL-1β (1:1000, Cell Signaling Technology,MA), IL-18 (1:1000, R&D Systems, MN), and β-actin (1:1000, CellSignaling Technology, MA) at 4 ℃ for overnight, and subsequent in-cubation with secondary HRP-conjugated antibody at 1:5000 dilutionfor 4 h at room temperature. An enhanced chemo-luminescence detec-tion kit (ECL Advance, Amersham, UK) was employed. Densitometry forall proteins was normalized against loading control.

2.11. Plaque assay

Influenza A virus (H3N2) strain was kindly provided by Prof. YanLiu (Department of Microbiology, Anhui Medical University). Virusaliquots were stored in liquid nitrogen, and freeze/thaw cycles wereavoided. Confluent monolayers of MDCK cells were infected with stockvirus or lung serially diluted in 1 % bovine serum albumin DMEM for2 h at 37 °C. Plates were washed with PBS and an overlay of 50 %2×DMEM, 50 % avecil (2.35 %), and N-acetyl trypsin (1.5 μg/mL)remained on the cells for 72 h at 37 °C. The overlay was removed, andthe monolayers were then stained with Naphthalene Blue-Black andplaques counted. All experiments that involved working with virus wasperformed according to biosafety level two requirements and re-commended personal protection equipment for all the involved re-searchers.

2.12. COPD rat modeling

Male Sprague-Dawley rats (200−250 g, 6–8 weeks), obtained fromthe animal services unit of Anhui Medical University, were given accessto food and water ad libitum. Animals were housed in a specific pa-thogen-free facility with controlled environment of twelve-hour light/

dark cycles. Rats were randomly picked out for COPD modeling withexposure to cigarette smoke and intratracheal instillation of lipopoly-saccharide (LPS) (1 mg/ml, 0.2 ml), LPS intervention was implementedevery 5 days, and cigarette smoke exposure was given in a passivesmoking chamber (70 cm ⅹ 40 cm ⅹ 60 cm), using a custom-designedand purpose-built, in house directed flow inhalation and smoke-ex-posure system contained in a laminar flow and smoke extraction unit.With 1 cigarette (tar 12mg, nicotine of flue gas 1.0mg, carbon mon-oxide of flue gas 14mg. Nanjing Tobacco industry, China) twice/day,10 cigarettes/30min/time, 5 times/week, for 8 weeks. Non-smokingcontrol rats were exposed to air and with tracheal instillation of sterilesaline for the same period.

2.13. Lung function tests

Pulmonary function tests were performed immediately after the lastexposure. Lung function parameters were assessed using a noninvasiverat pulmonary function measurement system (GYD-003, NoninvasiveRat Lung Function telemetry device, Emka, France).

2.14. Influenza virus infection for animals

Forty rats were randomly divided into the following five groups: themock group, PBS group, SFJDC group, oseltamivir group, SFJDC andoseltamivir group. The rats of the mock group received the same vo-lume of PBS instead of IAV (100 μl). On the last day of exposure, ratswere anesthetized with thiopental sodium and infected intranasallywith 1.25ⅹ103 plaque forming units (PFUs) of IAV in 100 μl. Followinginoculation, smoking was discontinued to remove the effects of acutesmoke exposure.

2.15. Drug treatments

The day of intratracheal injection with IAV or PBS was designatedday 0. From the next day, the rats in the administration group weregiven 1.2 ml SFJDC or oseltamivir solution daily, and the rats in the PBSgroup were given 1.2ml PBS by intragastric administration (ig). Therats in the SFJDC group were treated with SFJDC (0.6 g/kg/day, ig), therats in the oseltamivir group were treated with oseltamivir (25mg/kg/day, ig), and the rats in the SFJDC and oseltamivir group were treatedwith SFJDC (0.6 g/kg/day, ig) and oseltamivir (25mg/kg/day, ig).Clinical behaviors and body weight were monitored every day. Lungtissues were collected on the 7th day [28,29]. Half of the left lung wasfixed in 4 % phosphate-buffered paraformaldehyde for histopathologicpreparation, while the other half was prepared for homogenate.

2.16. Histological analysis

Rats were anesthetized and left lungs were removed from rats ofeach group, and distended with 10 % buffered formalin. The tissueswere sliced and embedded in paraffin, and 4mm sections were pre-pared for morphological evaluation with hematoxylin-eosin staining(HE). Sections from all the left lobes were examined blindly by threeindividuals.

2.17. Bronchoalveolar lavage fluid (BALF)

Bronchoalveolar lavage fluid was collected from the rats by en-dotracheal intubation using a 20-gauge angioatheter was ligated intothe trachea and the right lungs lavage with sterile saline (5ml), theusual retrieved portion was>80 %.

2.18. ELISA

The concentrations of IL-1β and IL-18 in serum and BALF weredetermined using rat ELISA kits (CUSABIO life sciences, MD, USA)

S. Ji, et al. Biomedicine & Pharmacotherapy 121 (2020) 109652

3

according to the manufacturer’s instructions.

2.19. Statistical analysis

Statistical analysis was performed using GraphPad Prism 5 software(San Diego, California) and SPSS 23.0 (IBM, Armonk, NY, USA).Continuous variables with normal distribution were presented asmean ± standard deviation (SD). Student t-test and one- or two-wayANOVA were used to compare means of 2 and 3 or more groups ofcontinuous normally distributed variables, respectively. P < 0.05 wasconsidered significant.

3. Results

3.1. SFJDC composition analysis

In this study, we performed a multi-chemical component screeningof SFJDC extracts using UHPLC/ESI Q-Orbitrap Mass Spectrometry. Atotal of 46 chromatographic peaks were clearly separated, each ofwhich was independently verified by matching the MS/MS spectrumand comparing it to data reported in the literature, references fromnatural product information, and corresponding fragments (Fig. 1 andSupplementary Fig. 1). Based on the features of the 46 peaks, ap-proximately 33 compounds were clearly identified (SupplementaryTable 1). Source attributions were determined by MS analysis (Sup-plementary Table 2).

3.2. Effect of SFJDC and/or oseltamivir on the viability of DHBE cells

To detect the optimal concentration of SFJDC for cell viability,DHBE cells were treated with either 0, 5, 10, 20, 40, 80, 100, or 200 μg/ml of SFJDC for 24 h. The results showed that SFJDC did not exhibitcytotoxicity in DHBE, except at high concentrations of 100 and 200 μg/

ml (P < 0.05 and P < 0.001, respectively; Fig. 2A). Similarly, wefound that oseltamivir did not exhibit cytotoxicity in DHBE cells at 0,0.1, 0.3, 0.5, 1.0, or 4.0 μM, while high concentrations at 10 or 20 μMexhibited significant cytotoxicity (P < 0.05 and P < 0.001, respec-tively; Fig. 2B). Subsequently, DHBE cells were treated with a combi-nation of 20, 40, or 80 μg/ml of SFJDC and 0.5, 1.0, or 4.0 μM ofoseltamivir. The results showed that the addition of 0.5 or 1.0 μMoseltamivir with 20 μg/ml of SFJDC did not exhibit cytotoxicity inDHBE cells (Fig. 2C), while 1.0 μM of oseltamivir had better inhibitoryeffects than that of 0.5 μM of oseltamivir on NLRP3 inflammasomecomponents (Fig. 2D). Consequently, 20 μg/ml of SFJDC and 1.0 μM ofoseltamivir were used for all further in vitro experiments.

3.3. Effects of SFJDC and/or oseltamivir on the NLRP3 inflammasomepathway in IAV-infected DHBE cells

To investigate whether SFJDC and/or oseltamivir may inhibitairway inflammatory reactions, we measured and compared the ex-pression levels of NLRP3-associated components (i.e., NLRP3, Caspase-1, IL-1β, and IL-18) in DHBE cells. As shown in Fig. 3, compared tothose in the mock group, the mRNA and protein expression levels ofNLRP3, Caspase-1, IL-1β, and IL-18 were significantly higher in theIAV-infected groups (P < 0.001; pre-SFJDC and/or oseltamivir treat-ment), including the PBS group, SFJDC group, oseltamivir group, andSFJDC/oseltamivir combination group. The mRNA and protein ex-pression levels of NLRP3 components were lower in the SFJDC groupand oseltamivir group than in the PBS group (P < 0.05); the lowestlevels occurred in the SFJDC/oseltamivir combination group comparedto those in the monotherapy groups, and there were significantly dif-ferent levels of NLRP3, IL-1β, and IL-18 among the three therapy groups(P < 0.05). The relative expression levels of NLRP3 in the SFJDC,oseltamivir, SFJDC/oseltamivir combination groups decreased by 58.9% (P < 0.001), 68 % (P < 0.001), and 96.6 % (P < 0.001) compared

Fig. 1. UHPLC/ESI Q-Orbitrap mass-spectrometry analysis of SFJDC extractions. The red numbers from 1 to 46 indicate different chromatographic peaks, and eachpeak represents one chemical derived from SFJDC.

S. Ji, et al. Biomedicine & Pharmacotherapy 121 (2020) 109652

4

to those in the PBS group (Fig. 3A); additionally, the normalized levelsof NLRP3 decreased by 43 % (P < 0.001), 53.6 % (P < 0.001), and 60% (P < 0.001), respectively (Fig. 3F). The expression levels of Caspase-1, IL-1β, and IL-18 were similar to those of NLPR3. However, therewere no significant differences between the mRNA or protein levels ofNLRP3-inflammasome-relative components between oseltamivir treat-ment and SFJDC treatment (P > 0.05). The levels of NLRP3 compo-nents were significantly reduced in the SFJDC/oseltamivir combinationgroup compared to those in the monotherapy groups (P < 0.05). Theseresults indicated that SFJDC and oseltamivir exerted similar inhibitionand that the SFJDC/oseltamivir combination treatment exerted astronger inhibitory effect on the expression levels of NLRP3 componentsthan those of the two compounds alone in DHBE cells.

3.4. Combining SFJDC and oseltamivir therapies improves survival rate andgain weight in IAV-infected COPD experimental rats

To investigate the therapeutic effect of SFJDC and/or oseltamivir invivo, IAV-infected COPD rats were established and tested. We observedthat the mean survival time of rats in the PBS group was 5.4 ± 0.8days, and the survival rate was 37.5 % (P < 0.01). SFJDC or oselta-mivir monotherapy had protective effects that yielded mean survivaltimes of 6.5 ± 0.4 and 7.0 ± 0.8 days, with survival rates of 75 % and87.5 %, respectively. However, only oseltamivir yielded a statisticallysignificant difference (P < 0.05). Similar to corresponding parametersin the mock group, SFJDC/oseltamivir combination therapy increasedthe mean survival time (7 ± 0 days) and survival rate (100 %;P < 0.01; Fig. 4A). Consistent with the survival results, the weights ofthe rats in the PBS group gradually decreased with time (P < 0.01) andaberrant behaviors emerged (e.g., coat ruffling, febrile shaking, andmild lethargy). However, weight loss and aberrant symptoms were

ameliorated via SFJDC/oseltamivir combination therapy. The timecourse of the observed weight changes is shown in Fig. 4B. The max-imum average weight loss was 18.3 % on the seventh day in the PBSgroup (P < 0.001), while it was 8.5 %, 9.3 %, and 1.7 % in the SFJDC,oseltamivir, and SFJDC/oseltamivir combination groups, respectively.The average weight losses for the rats in each monotherapy group weresimilar to each other (P > 0.05), whereas weight losses were sig-nificantly decreased in the SFJDC/oseltamivir combination group(P < 0.05). Therefore, SFJDC combined with oseltamivir therapy im-proved survival and weight gain in IAV-infected COPD rats.

3.5. Histopathological changes of IAV-infected COPD rats

Upon histological examinations of lung tissue, the PBS groupshowed extensive lung damage that included bronchiolar epithelial-celldesquamation, diffuse alveolar damage, air sac formation, lung inter-stitial thickening, and severe inflammatory infiltration compared tothese features in the mock group. However, the use of SFJDC andoseltamivir alone or in combination prevented and rescued the aboveinjuries (Fig. 4C).

3.6. Combining SFJDC and oseltamivir treatments reduces IL-1β and IL-18expression levels in serum and BALF

The therapeutic effect of SFJDC and/or oseltamivir on amelioratingsymptoms may have been due to its regulation of viral-induced in-flammatory activity. Hence, we next examined IL-1β and IL-18 levels inserum and BALF. As shown in Fig. 4D–G, the IL-1β and IL-18 levels inthe PBS group were significantly higher than those in the mock group(P < 0.001). Further analysis showed that the levels of IL-1β and IL-18were lower in monotherapy groups compared to those in the PBS group

Fig. 2. Effect of SFJDC and/or oseltamivir on the viability of DHBE cells. (A, B) After DHBE cells were treated with SFJDC or oseltamivir for 24 h, cellular viabilitywas assessed via MTT (*denotes P < 0.05, ***denotes P < 0.001 versus control group). (C) After DHBE cells were treated with different concentrations of SFJDCand oseltamivir for 24 h, cellular viability was assessed via MTT (*P < 0.05, ** P < 0.01, ***P < 0.001 versus the control group; # P < 0.05, ## P < 0.01, ###

P < 0.001 versus the SFJDC 20 μg/ml groups; &P < 0.05, && P < 0.01 versus the SFJDC 40 μg/ml groups). (D) DHBE cells were treated with 20 μg/ml of SFIDC and0.5 μM/1.0 μM of oseltamivir after incubation with IAV (MOI=2) for 24 h, and the protein levels of NLRP3-inflammasome components were measured by Westernblotting. Each dataset comprises three independent experiments.

S. Ji, et al. Biomedicine & Pharmacotherapy 121 (2020) 109652

5

(P < 0.001). In addition, the IL-1β and IL-18 levels were significantlylower in the SFJDC/oseltamivir combination group compared to thosein the monotherapy groups (P < 0.01). Moreover, the concentration ofIL-1β in BALF was much higher than that in serum (Fig. 4D and F).These findings indicated that the levels of IL-1β and IL-18 were elevatedin the IAV-infected group but significantly attenuated by SFJDC/osel-tamivir combination treatment.

3.7. SFJDC and oseltamivir mediate inhibition of NLRP3 inflammasomecomponents and decrease viral titers in lung tissues

Finally, the mRNA and protein expression levels of NLRP3-asso-ciated components in lung tissues were measured. The mRNA andprotein levels of NLRP3, Caspase-1, IL-1β, and IL-18 in the PBS groupwere significantly increased compared to those in the mock group(P < 0.05) but were significantly decreased via SFJDC and/or oselta-mivir treatment (P < 0.05). Additionally, the SFJDC/oseltamivircombination therapy exhibited the strongest inhibitory effect(Fig. 5A–F). Compared to that of the PBS group, the relative expressionlevels of NLRP3 decreased by 77 % (P < 0.01), 88 % (P < 0.01), and93 % (P < 0.01), and the normalized levels of NLRP3 decreased by 19% (P < 0.05), 24 % (P < 0.05), and 34 % (P < 0.01) in the SFJDC,oseltamivir, SFJDC/oseltamivir combination groups, respectively. Thenormalized levels of caspase-1 decreased by 22 % (P < 0.001), 50 %(P < 0.001), and 54 % (P < 0.001) in the SFJDC, oseltamivir, SFJDC/

oseltamivir combination groups. The relative expression levels of IL-1βdecreased by 71 % (P < 0.001), 61 % (P < 0.001), and 75 %(P < 0.001), and the normalized levels of IL-1β decreased by 57 %(P < 0.01), 56 % (P < 0.01), and 59 % (P < 0.01) in the SFJDC,oseltamivir, and SFJDC/oseltamivir combination groups. The relativeexpression levels of IL-18 decreased by 84 % (P < 0.001), 80 %(P < 0.001), and 91 % (P < 0.001), and the normalized levels of IL-18 decreased by 18 % (P < 0.05), 30 % (P < 0.01), and 34 %(P < 0.01) in the SFJDC, oseltamivir, and SFJDC/oseltamivir groups,respectively. Compared to those in the monotherapy groups, theSFJDC/oseltamivir combination group had a significantly higher de-cline in mRNA and protein levels of NLRP3 components (P < 0.05).

As shown in Fig. 5G, viral titers were significantly decreased in themonotherapy groups compared with those in the PBS group, and theviral titers were lowest in the SFJDC/oseltamivir combination groupafter seven days post-infection. There was no significant difference inthe reduction of the viral titers between oseltamivir or SFJDC mono-therapies (P > 0.05). These results revealed that SFJDC/oseltamivircombination therapy had a synergistic effect on NLRP3 components andsignificantly protected IAV-infected COPD rats.

4. Discussion

COPD patients are more susceptible to influenza viral infection,which induces acute exacerbation. Moreover, the antigenic drift of IAV

Fig. 3. Effects of SFJDC and/or oseltamivir on the NLRP3-inflammasome pathway in IAV-infected DHBE cells. After DHBE cells were incubated with IAV (MOI= 2)for 24 h, the mRNA and protein levels of NLRP3, Caspase-1, IL-1β, and IL-18 were detected by (A–D) qRT-PCR (E) and Western blotting (FeI). NLRP3-inflammasome-relative components were normalized to β-actin. Each dataset comprises three independent experiments (*denotes P < 0.05, **denotes P < 0.01, ***denotesP < 0.001; # P < 0.05, ## P < 0.01, ### P < 0.001 versus the mock group; &P < 0.05, && P < 0.01, &&& P < 0.001 versus the PBS group).

S. Ji, et al. Biomedicine & Pharmacotherapy 121 (2020) 109652

6

and the emergence of drug-resistant strains pose great challenges to thelimited treatments that are currently available. Oseltamivir has beenwidely used against influenza. However, there is still doubt about theefficacy of oseltamivir in the treatment of influenza [30]. Therefore, itis necessary to continue to discover novel drugs or synergistic combi-nations of drugs for the clinical treatment of influenza.

The separation and identification of components constitute theprimary analytical approach implemented in phytochemical studies,which are vital for the modernization of TCM [15]. In the present study,46 chromatographic peaks of SFJDC were separated and 33 peaks wereclearly profiled, while 41 peaks were identified in a previous study[14]. In addition, we found that forsythia suspensa exhibited anti-in-flammatory effects, which is similar to the findings of the same previousstudy [14]. Additionally, we summarized fragmental patterns andcharacteristic fragments of various types of SFJDC based on referencecompounds and previous articles (Supplementary Fig. 1). Taken to-gether, this is an efficient data pipeline that can rapidly discover andcharacterize chemical constituents from complicated herbal extracts,without the help of standard substances. Component analysis andidentification of SFJDC laid the foundation for our subsequent experi-ments in the present study.

SFJDC has a variety of functions that contribute to alleviatingchronic disease progression [9,12,17,19,31]. To demonstrate whether

SFJDC had antiviral and anti-inflammatory effects and/or compensatedfor deficiencies of oseltamivir treatment in influenza-induced AECOPDpatients, we used human bronchial epithelial cells in vitro and IAV-in-duced COPD rats in vivo to compare the therapeutic effects of SFJDCand oseltamivir monotherapies with SFJDC/oseltamivir combinationtherapy (Figs. 2 and 3). Most interestingly, we found that SFJDC hadmany therapeutic benefits in the treatment of influenza. Overall, SFJDCinhibited airway inflammatory reactions and showed similar effects onmodulating mRNA and protein expression levels compared to theseeffects of oseltamivir in vivo and vitro. SFJDC/oseltamivir combinationtreatment revealed strong positive synergistic effects with no or lessadverse events and drug resistance compared to those of mono-therapies. One reasonable explanation for these benefits may be thatSFJDC not only had inhibitory effects on viral proliferation and anti-inflammation but also exhibited certain immunoregulatory functions.Consistent with our results, Yao and colleagues demonstrated thatSFJDC alleviated clinical symptoms of AECOPD patients and shortenedtheir length of hospital stay [32]. Previous research showed that SFJDCcombined with Western-medicine-based plans shortened the averageincreased temperature of patients with fevers, especially at 24 and 48 hafter admission [33]. Poon and associates also found that the propor-tion of CD4-CD8 in T lymphocytes increased significantly after 14 daysof treatment with Chinese herbal medicine [34]. Meanwhile, SFJDC as

Fig. 4. Effects of SFJDC and/or oseltamivir in IAV-infected COPD experimental rats. (A) Survival rates are shown. (B) Changes in body weight after drug inter-ventions are shown. (C) Pulmonary tissue sections were prepared at day 7 and were stained with HE (scale bar =100 μm, original magnification: ×100; scale bar=50 μm, original magnification: ×200). (D, E) The expression levels of IL-1β and IL-18 in serum are shown. (F, G) The expression levels of IL-1β and IL-18 in BALFare shown. Each dataset was derived from eight rats per group (**denotes P < 0.01, ***denotes P < 0.001; # P < 0.05, ### P < 0.001 versus the mock group; &&&

P < 0.001 versus the PBS group).

S. Ji, et al. Biomedicine & Pharmacotherapy 121 (2020) 109652

7

a complementary and alternative medicine to influenza prevention andtreatment has reduced both social and economic burdens, especially indeveloping countries [35]. Therefore, administration of SFJDC hasgreat benefits for treating viral infections and can be used as a combi-nation therapy to overcome the adverse effects of oseltamivir. Fur-thermore, combination therapies for influenza can prolong the durationof antiviral therapy, reduce side effects, and combat the emergence ofdrug-resistant viral strains. Therefore, it is an encouraging expectationthat the combination of SFJDC and oseltamivir may represent abreakthrough advance in theoretical and clinical application for IAV-infected respiratory diseases.

IAV-infected rats treated via intragastric administration combinedwith SFJDC and oseltamivir therapy had a higher survival rate com-pared to that of controls (Fig. 4A), which was characterized by sig-nificant body weight gain (Fig. 4B), alteration of behaviors and alle-viation of lung injuries (Fig. 4C) as well as decrease in lung viral titer(Fig. 5G). These results demonstrated that the SFJDC/oseltamivir pro-tective effects were significantly associated with decreased levels of IL-1β and IL-18 in serum and BALF (Fig. 4D–G). It is well known that the

influenza virus has been a source of human social and economic burdenfor centuries. Previous studies have also reported that NLRP3-depen-dent productions of IL-1β and IL-18 are expressed in a variety of cellswith their corresponding binding cell-surface receptors to induce potentnuclear factor kappa beta (NF-κB)-dependent secondary cytokinesagainst IAV infection [36,37]. Therefore, airway inflammation and lunginjury in IAV-infected rats may be controlled by the combination ofSFJDC and oseltamivir through modulating the NLRP3 inflammasomeand subsequently down-regulating IL-1β and IL-18; these protectiveeffects of SFJDC/oseltamivir combination therapy on chronic diseasesshould be validated in clinical studies.

Finally, previous studies have also found that combined antiviraldrugs have better efficacies than those of many monotherapies [38–40].Ohgitani et al. reported that the combination of oseltamivir and hochu-ekki-to (TJ-41) significantly decreased viral load in the lungs of agingmice during influenza viral infection [41]. However, not all combina-tions have shown consistent additive or synergistic activities [42].Oseltamivir and zanamivir monotherapies were compared with thecombination of the two drugs in a study of 541 participants and found

Fig. 5. SFJDC and oseltamivir mediate inhibi-tion of NLRP3 inflammasome components anddecrease viral titers in lung tissues. The mRNAexpression levels relative to that of β-actin of(A) NLRP3, (B) Caspase-1, (C) IL-1β, and (D)IL-18 are shown. (E) Representative Westernblotting of the protein levels of NLRP3-in-flammasome-relative components. (F) NLRP3-inflammasome-relative components were nor-malized to β-actin. β-actin was also used as aloading control. (G) Viral titers in lung homo-genates of COPD IAV-infected rats followingdifferent treatments at the indicated day post-infection. Each dataset consisted of data fromeight rats per group (*denotes P < 0.05,**denotes P < 0.01, ***denotes P < 0.001; #

P < 0.05, ## P < 0.01, ### P < 0.001versus the mock group; &P < 0.05, &&

P < 0.01, &&& P < 0.001 versus the PBSgroup).

S. Ji, et al. Biomedicine & Pharmacotherapy 121 (2020) 109652

8

that the combination therapy was not as effective as oseltamivir andzanamivir monotherapies [43]. Therefore, the effectiveness of SFJDC incombination with oseltamivir requires further clinical investigationsand large-scale studies to explore the potential and mechanisms ofSFJDC/oseltamivir combination therapy. In conclusion, our researchprovides the first direct evidence that SFJDC has a significant ther-apeutic effect on IAV-infective respiratory disease, and that its combi-nation with oseltamivir shows a strong synergetic effect compared tocorresponding monotherapies. SFJDC, as a mixture of several activeingredients, may compensate for the single targeting model of con-ventional antiviral drugs and circumvent the adverse reactions ofoseltamivir. Therefore, the combination of SFJDC and oseltamivir mayrepresent a novel treatment strategy that can improve the therapeuticefficiency and quality of life of patients with IAV-induced chronicairway disease, especially AECOPD patients.

Consent for publication

All authors gave their consent for publication.

Availability of data and material

The datasets are available from the corresponding author on rea-sonable request.

Funding

This work was supported by the National Natural ScienceFoundation of China (81570034 and 81870036) and Key TechnologyResearch and Development Program of Anhui Province(1804h08020237).

Authorship

Conception and design of the study: FGH and JS Perform research:BQ, WX, ZDW and WS. Draft the article: FGH and JS. Analyze data: BQ,ZDW and WX. Manuscript revision: FGH, SJL and JS.

Declaration of Competing Interest

The authors declare that there are no conflicts of interest.

Acknowledgments

We would like to sincerely thank Xu Zhang, a doctoral student ofDepartment of Epidemiology and Biostatistics, School of Public Health,Anhui Medical University for assistance in this experiment. We wouldlike to thank Dr. Hui-Mei Wu from Department of Geriatric Respiratoryand Critical Care, First Affiliated Hospital of Anhui Medical Universityfor her revised assistance.

Appendix A. Supplementary data

Supplementary material related to this article can be found, in theonline version, at doi:https://doi.org/10.1016/j.biopha.2019.109652.

References

[1] P.J. Barnes, Inflammatory mechanisms in patients with chronic obstructive pul-monary disease, J. Allergy Clin. Immunol. 138 (1) (2016) 16–27.

[2] C. Colarusso, M. Terlizzi, A. Molino, A. Pinto, R. Sorrentino, Role of the in-flammasome in chronic obstructive pulmonary disease (COPD), Oncotarget 8 (47)(2017) 81813–81824.

[3] P. Mallia, M. Contoli, G. Caramori, A. Pandit, S.L. Johnston, A. Papi, Exacerbationsof asthma and chronic obstructive pulmonary disease (COPD): focus on virus in-duced exacerbations, Curr. Pharm. Des. 13 (1) (2007) 73–97.

[4] M.Y. Dai, J.P. Qiao, Y.H. Xu, G.H. Fei, Respiratory infectious phenotypes in acuteexacerbation of COPD: an aid to length of stay and COPD Assessment Test, Int. J.

Chronic. Obstr 10 (2015) 2257–2263.[5] J.S. Nguyen-Van-Tam, S. Venkatesan, S.G. Muthuri, P.R. Myles, Neuraminidase

inhibitors: who, when, where? Clin. Microbiol. Infec. 21 (3) (2015) 222–225.[6] M.G. Ison, Finding the right combination antiviral therapy for influenza, Lancet

Infect. Dis. 17 (12) (2017) 1221–1222.[7] Y. Abed, A.M. Bourgault, R.J. Fenton, P.J. Morley, D. Gower, I.J. Owens, M. Tisdale,

G. Boivin, Characterization of 2 influenza A(H3N2) clinical isolates with reducedsusceptibility to neuraminidase inhibitors due to mutations in the hemagglutiningene, J. Infect. Dis. 186 (8) (2002) 1074–1080.

[8] Z. Kmietowicz, WHO downgrades oseltamivir on drugs list after reviewing evi-dence, BMJ 357 (2017) j2841.

[9] Y. Lin, X. Yang, M. Lu, W. Zheng, J. Zhang, H. Zhuang, Z.C. Hua, Herbal compoundtriptolide synergistically enhanced antitumor activity of vasostatin120-180,Anticancer Drugs 24 (9) (2013) 945–957.

[10] L. Cheng, F. Li, R. Ma, X. Hu, Forsythiaside inhibits cigarette smoke-induced lunginflammation by activation of Nrf2 and inhibition of NF-kappaB, Int.Immunopharmacol. 28 (1) (2015) 494–499.

[11] A. Nemmar, S. Al-Salam, P. Yuvaraju, S. Beegam, B.H. Ali, Emodin mitigates dieselexhaust particles-induced increase in airway resistance, inflammation and oxidativestress in mice, Resp. Physiol. Neurobiol. 215 (2015) 51–57.

[12] Z.Q. Xi, J.Z. Zhou, J.Q. Mei, S.Z. Tan, A.Q. Ge, Y. Zhen, F.Q. Chen, Q. Zhao, L. Geng,M. Shao, L. Zhang, Effect of Shufeng Jiedu capsule on the fever caused by viralupper respiratory tract infection: a report of 130 cases, J. Trandit. Chin. Med.(2010) 28–33.

[13] W.W. Lv, T.N. Zhu, H. Qiu, T. Hu, S.H. Huang, Pharmacodynamic study on antiviraland antibacterial effects of shufeng jiedu capsules in vitro, Tradit. Chin. Drug Res.Clin. Pharmacol. 3 (2013) 234–238.

[14] Y. Li, N. Chang, Y. Han, M. Zhou, J. Gao, Y. Hou, M. Jiang, T. Zhang, G. Bai, Anti-inflammatory effects of Shufengjiedu capsule for upper respiratory infection via theERK pathway, Biomed. Pharmacother. 94 (2017) 758–766.

[15] Z. Tao, X. Meng, Y.Q. Han, M.M. Xue, S. Wu, P. Wu, Y. Yuan, Q. Zhu, T.J. Zhang,C.C.L. Wong, Therapeutic mechanistic studies of ShuFengJieDu capsule in an acutelung injury animal model using quantitative proteomics technology, J. ProteomeRes. 16 (11) (2017) 4009–4019.

[16] Z. Tao, J. Gao, G. Zhang, M. Xue, W. Yang, C. Tong, Y. Yuan, Shufeng Jiedu Capsuleprotect against acute lung injury by suppressing the MAPK/NF-kappaB pathway,Biosci. Trends 8 (1) (2014) 45–51.

[17] Y. Yuan, Q. Liao, M. Xue, Y. Shi, L. Rong, Z. Song, Z. Tong, W. Zheng, Q. Zhu, X. Cui,Z. Tao, Shufeng jiedu capsules alleviate lipopolysaccharide-induced acute lung in-flammatory injury via activation of GPR18 by verbenalin, Cell. Physiol. Biochem.50 (2) (2018) 629–639.

[18] Y. Ying, L. Qingwu, X. Mingming, S. Zhenju, T. Chaoyang, T. Zhengang, Emodin:one main ingredient of shufeng jiedu capsule reverses chemoresistance of lungcancer cells through inhibition of EMT, Cell. Physiol. Biochem. 42 (3) (2017)1063–1072.

[19] J. Xia, L. Rong, T. Sawakami, Y. Inagaki, P. Song, K. Hasegawa, Y. Sakamoto,W. Tang, Shufeng Jiedu Capsule and its active ingredients induce apoptosis, inhibitmigration and invasion, and enhances doxorubicin therapeutic efficacy in hepato-cellular carcinoma, Biomed. Pharmacother. 99 (2018) 921–930.

[20] W. Gao, L. Li, Y. Wang, S. Zhang, I.M. Adcock, P.J. Barnes, M. Huang, X. Yao,Bronchial epithelial cells: the key effector cells in the pathogenesis of chronic ob-structive pulmonary disease? Respirology 20 (5) (2015) 722–729.

[21] J.P. Mizgerd, Acute lower respiratory tract infection, N. Engl. J. Med. 358 (7)(2008) 716–727.

[22] I.C. Allen, M.A. Scull, C.B. Moore, E.K. Holl, E. McElvania-TeKippe, D.J. Taxman,E.H. Guthrie, R.J. Pickles, J.P. Ting, The NLRP3 inflammasome mediates in vivoinnate immunity to influenza A virus through recognition of viral RNA, Immunity.30 (4) (2009) 556–565.

[23] P.G. Thomas, P. Dash, J.R. Aldridge Jr, A.H. Ellebedy, C. Reynolds, A.J. Funk,W.J. Martin, M. Lamkanfi, R.J. Webby, K.L. Boyd, P.C. Doherty, T.D. Kanneganti,The intracellular sensor NLRP3 mediates key innate and healing responses to in-fluenza A virus via the regulation of caspase-1, Immunity. 30 (4) (2009) 566–575.

[24] M.A. Birrell, S. Eltom, The role of the NLRP3 inflammasome in the pathogenesis ofairway disease, Pharmacol. Ther. 130 (3) (2011) 364–370.

[25] M.L. Fulcher, S. Gabriel, K.A. Burns, J.R. Yankaskas, S.H. Randell, Well-differ-entiated human airway epithelial cell cultures, Methods Mol. Biol. 107 (2005)183–206.

[26] M. Yamaya, H. Nishimura, Y. Hatachi, M. Yoshida, H. Fujiwara, M. Asada,K. Nakayama, H. Yasuda, X. Deng, T. Sasaki, H. Kubo, R. Nagatomi, Procaterolinhibits rhinovirus infection in primary cultures of human tracheal epithelial cells,Eur. J. Pharmacol. 650 (1) (2011) 431–444.

[27] S. Ji, W. Lin, L. Wang, Z. Ni, F. Jin, X. Zha, G. Fei, Combined targeting of mTOR andakt using rapamycin and MK-2206 in the treatment of tuberous sclerosis complex, J.Cancer 8 (4) (2017) 555–562.

[28] D.E. Spiers, V. Candas, Relationship of skin surface area to body mass in the im-mature rat: a reexamination, J. Appl. Physiol. 56 (1) (1984) 240–243.

[29] V.H. Leyva-Grado, P. Palese, Aerosol administration increases the efficacy of osel-tamivir for the treatment of mice infected with influenza viruses, Antivir. Res. 142(2017) 12–15.

[30] L. Naesens, A. Stevaert, E. Vanderlinden, Antiviral therapies on the horizon forinfluenza, Curr. Opin. Pharmacol. 30 (2016) 106–115.

[31] X. Li, Clinical observation of Shufeng Jiedu Capsule in the treatment of acute ex-acerbation of chronic obstructive pulmonary disease with pulmonary infection,China J. Tradit. Chin. Med. Pharm. 32 (1) (2017) 395–397.

[32] X. Yao, L. Cao, J. Yang, M. Yao, L. Zhao, Curative effect evaluation of Shufeng JieduCapsules for the treatment of acute exacerbation of chronic obstructive pulmonary

S. Ji, et al. Biomedicine & Pharmacotherapy 121 (2020) 109652

9

disease, China J. Tradit. Chin. Med. and Pharm. 32 (7) (2017) 347–350.[33] C. Zhu, X. Deng, S. Wang, Clinical observation on Shufeng Jiedu Capsule combined

with western medicine basic plan in treating acute exacerbations of chronic ob-structive pulmonary disease with syndrome of wind-heat invading lung, China J.Tradit. Chin. Med. Pharm. 33 (9) (2018) 4227–4230.

[34] W.C. Poon, Fung K.P. PM, C.Y. Fong, E.L. Wong, J.T. Lau, P.C. Leung, S.K. Tsui,D.C. Wan, M.M. Waye, S.W. Au, C.B. Lau, C.W. Lam, Immunomodulatory effects ofa traditional Chinese medicine with potential antiviral activity: a self-control study,Am. J. Chin. Med. 34 (2006) 13–21.

[35] Z. Tao, Y. Yang, W. Shi, M. Xue, W. Yang, Z. Song, C. Yao, J. Yin, D. Shi, Y. Zhang,Y. Cai, C. Tong, Y. Yuan, Complementary and alternative medicine is expected tomake greater contribution in controlling the prevalence of influenza, Biosci. Trends7 (5) (2013) 253–256.

[36] A. Weber, P. Wasiliew, M. Kracht, Interleukin-1 (IL-1) pathway, Sci. Signal. 3 (105)(2010) cm1.

[37] H. Guo, J.B. Callaway, J.P. Ting, Inflammasomes: mechanism of action, role indisease, and therapeutics, Nat. Med. 21 (7) (2015) 677–687.

[38] S. Bantia, D. Kellogg, C.D. Parker, Y.S. Babu, Combination of peramivir and

rimantadine demonstrate synergistic antiviral effects in sub-lethal influenza A(H3N2) virus mouse model, Antiviral Res. 88 (3) (2010) 276–280.

[39] J. Dunning, J.K. Baillie, B. Cao, F.G. Hayden, Antiviral combinations for severeinfluenza, Lancet Infect. Dis. 14 (12) (2014) 1259–1270.

[40] K. Melville, T. Rodriguez, H.M. Dobrovolny, Investigating different mechanisms ofaction in combination therapy for influenza, Front. Pharmacol. 9 (2018) 1207.

[41] E. Ohgitani, M. Kita, O. Mazda, J. Imanishi, Combined administration of oseltamivirand hochu-ekki-to (TJ-41) dramatically decreases the viral load in lungs of senes-cence-accelerated mice during influenza virus infection, Arch. Virol. 159 (2) (2014)267–275.

[42] M.G. Ison, J.W. Gnann Jr, S. Nagy-Agren, J. Treannor, C. Paya, R. Steigbigel,M. Elliott, H.L. Weiss, F.G. Hayden, Safety and efficacy of nebulized zanamivir inhospitalized patients with serious influenza, Antivir. Ther. 8 (3) (2003) 183–190.

[43] X. Duval, S. van der Werf, T. Blanchon, A. Mosnier, M. Bouscambert-Duchamp,A. Tibi, V. Enouf, C. Charlois-Ou, C. Vincent, L. Andreoletti, F. Tubach, B. Lina,F. Mentre, C. Leport, Efficacy of oseltamivir-zanamivir combination compared toeach monotherapy for seasonal influenza: a randomized placebo-controlled trial,PLoS Med. 7 (11) (2010) e1000362.

S. Ji, et al. Biomedicine & Pharmacotherapy 121 (2020) 109652

10