Biology Booklet
description
Transcript of Biology Booklet
First semester
Grade 10 Advanced
Unit 4
DNA and protein synthesis
Name :------------------------------------------ Class-------------------:
Booklet keyBooklet keyThis picture Means that this is a
Key words
links
Exercises
Reading text for improving
language only
Grade 10 Advanced Unit4:DNA&Protein synthesis
TopicNo. Pg
Unit 3 : DNA & Protein synthesis
The structure of DNA and RNA.………………………………………………3
Structure of a nucleotide.………………………………………………………4
Nitrogenous bases…………………………………………………………… 6
Base pairing.……………………………………………………………………8
DNA Replication………………………………………………………………….11
Meselson and Stahl (1958).……………………………………………………12
The genetic code..……………………………………………………………15
Transcription.……………………………………………………………………17
Translation..………………………………………………………………………18
Unit project..…………………………………………………………………… 24
Contents
Grade 10 Advanced Unit4:DNA&Protein synthesis
Unit 4
Standards:
1
DNA & Protein synthesis
10A.11.1 Describe the double-helix structure and semi-conservative replication of DNA, and recognise the
importance of the base pairings.
الذاتي واالستساخ أ ن د ال لجزئ المزدوج الحلزوني التركيب يصفالجزئ . هذا قواعد تزاوج أهمية ويدرك
10A.11.2Describe the role of DNA, mRNA and tRNA in protein synthesis and understand how a base sequence on DNA controls the structure and function of a protein
بناء في الناقل أ ن ر ، الرسول أ ن ر ، أ ن د من كال دور يصففي يتحكم أ ن د جزئ في القواعد تتابع أن كيف ويفهم ، البروتينات
البروتين . ووظيفة تركيب
10A.11.3 Know that the base sequence on DNA forms the genetic code and is passed from generation to generation
الوراثية الشفرة يشكل الذي هو أ ن د ال في القواعد تتابع أن يعرفآخر . إلى جيل من ينتقل وأنه ، الجينية أو
Grade 10 Advanced Unit4:DNA&Protein synthesis
Key WordsKey WordsScientific term معنى
المصطلح Scientific term معنى
المصطلح
nucleotidenon-overlapping
adenineprotein synthesis
thyminetranscription
cytosinetranslation
guanineamino acid activation
complementary base pairing
mRNA
semi-conservative replication
tRNA
genetic codepolyribosome
triplet base codecodon
degenerateanticodon
2
Grade 10 Advanced Unit4:DNA&Protein synthesis
Genetic material of living organisms is either DNA or RNA.
DNA – Deoxyribonucleic acid
RNA – Ribonucleic acid
Genes :are lengths of DNA that code for particular proteins.
• Both DNA and RNA are polynucleotide's.• They are made up of smaller molecules called nucleotides.• DNA is made of two polynucleotide strands:• RNA is made of a single polynucleotide strand:
3
أ ن د النووي الحمض من الحية الكائنات في الوراثية المادة ا أو تتكون ن ر
أ ن األكسجين : د منقوص النووي الحمض
أ ن األكسجين : ر كامل النووي الحمض
محدد : .الجينات بروتين يعبرعن جين وكل ، أ ن د ال من أجزاء هي
المتعددة .• النيوكليوتيدات من أ ن ر ، أ ن د الحمضين يعتبر
تدعى ( • صغيرة جزيئات من من كالهما )نيوكليوتايديتكون
المتعددة .• النيوكليوتيدات من خيطين من أ ن د ال يتكون
المتعددة .• النيوكليوتيدات من واحد خيط من أ ن ر ال يتكون
The structure of DNA and RNAأ & ن ر ال أ ن د ال تركيب
Deoxyribonucleic acid
Ribonucleic acid
Genes
polynucleotide's.nucleotides
strand
Grade 10 Advanced Unit4:DNA&Protein synthesis
Structure of a nucleotideالنيوكليوتيدة تركيب
3- A Nitogenous baseIn DNA the four bases are:
Thymine (Uracil in RNA)AdenineCytosineGuanine
A nucleotide is made of 3 components:
1- A Pentose sugar
This is a 5 carbon sugar
The sugar in DNA is deoxyribose.
The sugar in RNA is ribose.
2- A Phosphate group
Phosphate groups are important because they link the sugar on one nucleotide onto the phosphate of the next nucleotide to make a polynucleotide.
4
من النيوكليوتيدة أجزاء :3تتكون
خماسي : - 1 سكر
من السكر ( 5يتكون يسمى أ ن د ال ففي ، كربون منقوص ذرات رايبوز ) .األكسجين
السكر ( فيسمى أ ن ر ال في ) .رايبوزأما
فوسفات :- 2 مجموعة
السكر تصل ألنها مهمة الفوسفات مجموعة تعتبر
على الموجود بالفوسفات النيوكليوتيدة على الموجود
المتعددة . النيوكليوتيدات لتكوين التالية النيوكليوتيدة
نيتروجينية - 3 : قاعدة
أ : ن د في قواعد أربعة توجد
أ ( ) ن ر في يوراسيل ثايمين
أدينين
سايتوسين
جوانين
Pentose sugar
Nitogenous base
Thymine
Adenine
Cytosine
Guanine
Uracil
Grade 10 Advanced Unit4:DNA&Protein synthesis
Question 1: Look at the DNA diagram and answer the
following questions:
: السؤال األول : انظر إلى نموذج ال د ن أ المرفق ، ثم أجب على األسئلة التالية Circle a nucleotide
ضع دائرة على نيوكليوتيدة كاملة -
Label the sugar and phosphate
حدد السكر والفوسفات -
Label the bases that are not already
labeled
حدد القواعد التي لم يتم تحديدها -
The two sides of the DNA helix are
held together by ____ _______bond
____ يرتبط خيطين ال د ن أ مع بعض بواسطة -
The amount of adenine is always equal to
the amount of___________
and the amount of guanine is always equal to
the amount of _____________
قواعد - أعداد مع األدنين قواعد أعداد تتساوى دائما
________
قواعد أعداد مع الجوانين قواعد أعداد تتساوى كما
_________
Exercises
5
Grade 10 Advanced Unit4:DNA&Protein synthesis
1. Thymine - T
2. Cytosine - C
3. Uracil - U
1. Adenine - A
2. Guanine - G
Base-Pairing Rule النيتروجينية القواعد ربط : قانون
A always pairs with T C always pairs with G
Purinesالبيورين
ات
Pyramidines
البريميدينات
6
Nitrogenous bases النيتروجينية القواعد
مع | دائما السايتوسين يرتبطالجوانين
مع | دائما األدينين يرتبطالثايمين
http://student.ccbcmd.edu/biotutorials/dna/dnareppr.html
Grade 10 Advanced Unit4:DNA&Protein synthesis
Sugar phosphate bonds (backbone of DNA)د ( ال لجزئ الفقري العمود والفوسفات السكر روابط
أ ) ن
Nucleotides are connected to each other by the phosphate on one nucleotide and the sugar on the next nucleotide
to form a Polynucleotide
البعض بعضها مع النيوكليوتيدات ترتبطمن الفوسفات مجموعة ارتباط بواسطة
الموجود بالسكر السابقة النيوكليوتيدةلتكوين ، الالحقة النيوكليوتيدة في
المتعددة . النيوكليوتيدات
nucleotide bases joined weakly in the middle by
hydrogen bonds .
7
في الموجودة القواعد ترتبطمع بالوسط النيوكليوتيدات
بواسطة البعض بعضهاضعيفة . هيدروجينية روابط
Grade 10 Advanced Unit4:DNA&Protein synthesis
Base pairingالقواعد بط رالنيتروجينية
The Nitrogenous Bases pair up with other bases. For example the bases of one strand of DNA base pair with the bases on the opposite strand of the DNA.
البعض بعضها مع النيتروجينية القواعد ترتبطفي
القواعد ترتبط بحيث ، أ ن د ال جزئ الموجودة
لها المتممة القواعد مع الخيطين أحد علىالربط قانون وفق اآلخر الخيط على
. السابق
8
Grade 10 Advanced Unit4:DNA&Protein synthesis
Question 1: Fill the space with the correct answer
المناسبة : بالكلمات التالية الفراغات أملئ األول : السؤال
1. There are 2 types of nucleic acids: ___________ and ____________
و ________________ -1 هما النووية األحماض من نوعان ___________ هناك
2 . The 5 nitrogen bases are divided into two groups:
Purines which include ___________________ and _______________
Pyrimidines which are ______________, _______________ and ________________
أساسيتين 5هناك -2 مجموعتين إلى تصنيفها تم والتي النيتروجينية القواعد من أنواع :
و : _______________ تشمل والتي _______________ البيورينات
و : _______________ تشمل والتي _______________ والبيريميدينات
Question 2: Choose a color for each part of the nucleotide and fill in the square with the color of your choice. Color the part to match .
أسفل : : نموذج في عنه يعبر الذي باللون جزء كل أمام الموجود المربع لون الثاني السؤال
Phosphate
Pentose Sugar
Nitrogen Base
Exercises
9
فوسفات
خماسي سكر
نيتروجينية قاعدة
Grade 10 Advanced Unit4:DNA&Protein synthesis
Question 3 Fill out the following table comparing DNA and RNA:
: السؤال الثالث : إمأل الجدول التالي للمقارنة بين ال د ن أ و ال ر ن أ
DNARNA
Sugar moleculeجزئ السكر
Basesالقواعد
Number of strands عدد الخيوط
Locationالموقع
10
Grade 10 Advanced Unit4:DNA&Protein synthesis
It means the copying of DNA. It is described as semi-conservative replication. This means that the DNA molecule replicate and produce new molecule with both old and new one.Each daughter DNA composed of old strand and new strand.DNA replication occurs just before cell division.
على المحافظة مع إضافية نسخة اصدار فيه ويتم ، ونسخه أ ن د ال مضاعفة ويعنيعلى البقاء مع جديد جزئ إلنتاج أ ن د ال جزئ نسخ يتم أنه بمعنى ، األصلية النسخة
أحدهما ( ) شريطين خيطين من يتكون أ ن د ال من جديد جزئ وكل ، األصلي الجزئمباشرة – – الدخول قبل النسخ عملية وتتم ، تصنيعه يتم جديد واألخر األصلي من قديم
الخلوي االنقسام . في
DNA Replicationأ ن د ال نســـخ
11
األصلي أ ن د ال حلزون
عملية بعد أ ن د ال جزيئينواحدة نسخ
Replication
semi-conservative
composed
cell division.
Grade 10 Advanced Unit4:DNA&Protein synthesis
Meselson and Stahl (1958)ستال & ميسيلسون 1958نموذج
12http://users.rcn.com/jkimball.ma.ultranet/
BiologyPages/M/Meselson_Stahl.html
Grade 10 Advanced Unit4:DNA&Protein synthesis
Question 1: with the reference to the figure below answer the following
questions:
: السؤال األول : بالرجوع للصورة أسفل ، أجب على األسئلة التالية
1. DNA replication occurs just before a cell _________________
____________ تقوم الخلية بنسخ ال د ن أ قبل دخولها في -1
2 . The process of making a copy of DNA is described as
__________________
______________ تسمى العملية التي يتم فيها نسخ جزئ د ن أ بال -2
3 . Which of the above represents:
اختر من األجزاء األربعة السابقة ما يعبر عن -3
- The parental DNA? ____________
جزئ ال د ن أ األصلي
- The daughter DNA? _____________
جزئ ال د ن أ المنسوخ ) الجديد (
)a( )b( )c( )d(
Exercises
13
Grade 10 Advanced Unit4:DNA&Protein synthesis
Question 2: For each of the three DNA sequences below, write the sequence of the
complementary strand of DNA that results after replication.
المتمم : ( ) الخيط أو الشريط اكتب ، التالية أ ن د ال أشرطة من خيط أو شريط لكل الثاني السؤال
النسخ عملية بعد له
DNA molecule األول 1# الجزئ : TACCGGATGCCAGATCAAATC
Complementary DNA المتمم أ ن د 1 # جزئ ________________________________
DNA molecule الثاني 2 #الجزئ : TACGGGGGCGTAACCACAACT
Complementary DNA المتمم أ ن د 2 #جزئ _________________________________
DNA molecule الثالث 3 #الجزئ : TACCTGTTAAGCTACAAAATT
Complementary DNA المتمم أ ن د 3 #جزئ _________________________________
14
Grade 10 Advanced Unit4:DNA&Protein synthesis
The genetic code
الوراثية الشفرة
It’s the information needed to make particular protein from DNA molecule .
Its made up of three bases triplets. (the sequence of bases or triplets is called codon.
ATC CTG TAGEach codon matches certain
amino acid. Many amino acids make peptide to give
protein this is known as protein synthesis
15
لتكوين توفرها الواجب المعلومات هيجزئ من محدد بروتين
من وتتكون ، أ ن د قواعد 3الالشفرة . عليها يطلق نيتروجينية
حمض عن تعبر وراثية شفرة وكل
األحماض ومجموعة ، واحد أميني
ليعطي الببتيد لتكوين بعض مع تتحد
مايسمى . وهو البروتين البروتين ببناء
genetic codetriplets codon
peptide
protein synthesis
Grade 10 Advanced Unit4:DNA&Protein synthesis
16
DNA, protein synthesis, mRNA and tRNA
الناقل أ ن ر ، الرسول أ ن ر ، البروتين بناء ، أ ن د
Protein SynthesisIt is the formation of protein from DNA molecule using the genetic code by transcription and translation.
البروتين : بناءبواسطة الوراثية الشفرة باستخدام أ ن د جزئ من البروتين تكوين به ويقصد
والترجمة النسخ . عمليتي
DNA mRNA PROTEIN
ن دأ
أ ن رالرسول
بروتين
mRNA
tRNA
formation
transcription
translation
www.biostudio.com/demo_freeman_protein_synthesis.htm
Grade 10 Advanced Unit4:DNA&Protein synthesis
Transcription steps
1. Unwind one gene in the DNA.
2. match up bases of RNA to one side DNA ( AA binds T), ( CC binds G)
3. mRNA detaches from the DNA.
4. mRNA moves out of the nucleolus into the cytoplasm.• Genetic code= Codon= triple code, they code for specific amino acid.
النسخ عملية : خطوات
أ -1 ن د ال جزئ من واحد جين ينحل أو . ينفك2- ) ، الثايمين مع األدينين أ ن د ال من واحد جانب في أ ن ر ال قواعد ربط يتم
الجوانين ) مع . والسايتوسين
أ -3 ن د ال من الرسول أ ن ر . ينفصلالسيتوبالزم -4 إلى ويخرج النوية الرسول أ ن ر . يترك
الثالثية = = الشفرة الكودون الوراثية الشفرةمحدد أميني حمض بتكوين خاصة شفرة . وكل
It is to change DNA in to RNA (messenger RNA) in the nucleus according base pairing (A-U) and (G-C)
إلى أ ن د ال تغيير عملية الرسول هي أ ن األدنين ( ر القواعد ربط لقانون | وفقا النواة فيوالسايتوسين ) ( ) . الجوانين و واليوراسيل
DNA TAG GAC ATC CGC
mRNA UAG GAC AUC CGC
Transcription happened because mRNA can leave the nucleus but DNA can’t.
يستطيع . ال أ ن د بينما ، النواة مغادرة يستطيع الرسول أ ن ر ألن النسخ عملية تحدث
17
1 -Transcription : النسخ عملية أوالً
Grade 10 Advanced Unit4:DNA&Protein synthesis
is the process of using coded mRNA instructions for a sequence of amino acids to produce a polypeptide
tRNA is short RNA with one codon matches the mRNA called anti codon and amino acid match the anticodon.Protein synthesis happened in the ribosome.
من تتابعات لتكوين الرسول أ ن ر ال في الموجودة الشفرات استخدام عملية هيالببتيد عديد إلنتاج تؤدي األمينية . األحماض
أ ن ر بال متصل واحد كودون من يتكون فهو ، أ ن ر أقصر الناقل أ ن ر ال ويعتبرتحدث . كما الكودون بمضاد األميني الحمض ويتصل ، الكودون مضاد ويسمى الرسول
الرايبوسوم في البروتين بناء . عملية
m RNA UAG GAC AUC CGC
t RNA AUC CUG UAG GCG
Peptides Amb Asp lleu Arg
(amino acids) different codons mean different amino acids
األمينية ) األمينية : ( األحماض األحماض اختالف يعني الكودونات اختالف
2 -Translation )process of making a protein(
الترجمة : عملية ثانيا4البروتين( ) صناعة عملية
18
أ ن ر على القواعد تتابع
الرسولأ ن ر على القواعد تتابع
الناقل السابقة للقواعد | تبعا الناتجة األمينية األحماض
Grade 10 Advanced Unit4:DNA&Protein synthesis
Translation steps
1. mRNA attaches to a ribosome 2. Transfer RNA( tRNA) brings amino acids to build up a copy peptide.3. Anticodon (3 bases on tRNA) matches up Codon on mRNA .4. Protein( chain of amino acids) detaches of ribosome and goes of to work.Different Codons means different amino acids.
الترجمة : خطوات
بالرايبوسوم -1 الرسول أ ن ر ال . يرتبطبروتين ( ) -2 الببتيد من نسخة لبناء األمينية األحماض بإحضار الناقل أ ن ر ال . يقوم
الكودون ( -3 الرسول ) 3مضاد أ ن ر ال على بالكودون تتصل الناقل أ ن ر ال على قواعد . وظيفته ( ) -4 ألداء ويذهب الرايبوسوم من األمينية األحماض من سلسلة البروتين . ينفصل
مختلفة أمينية أحماض تعني المختلفة . الكودونات
A U G G GC C A A AC C C C CU U U
ThrAlaMet Leu Pr
G GG
ribosome
19
Grade 10 Advanced Unit4:DNA&Protein synthesis
ExercisesQuestion 1 : For each of the same DNA sequences below, write
the sequence of messenger RNA codons that is synthesized during
transcription. Be sure to separate the codons into triplets.
للتابعات : | وفقا الرسول أ ن ر ال على ستتكون التي الكودونات اكتب االول السؤال
كل ( أن تأكد النسخ عملية أثناء البروتينات ستبني والتي أ ن د ال على الموجودة
عن عبارة فقط )3كودون قواعد :
DNA molecule #1: TACCGGATGCCAGATCAAATC
mRNA #1 _____________________________________________________
DNA molecule #2: TACGGGGGCGTAACCACAACT
mRNA #2___________________________________________________
DNA molecule #3: TACCTGTTAAGCTACAAAATT
mRNA #3__________________________________________________
20
Grade 10 Advanced Unit4:DNA&Protein synthesis
B) :for each of the mRNA codon sequences you have written, determine the
sequence of tRNA anticodons that match it.
: ( � تبعا الناقل أ ن ر ال على الكودون لمضاد النيتروجينية القواعد تتابع اكتب ب
السابقة : الخطوة في كتابتها تم التي الرسول أ ن ر ال على الموجودة للكودونات
Anticodons for mRNA #1___________________________________________ :
Anticodons for mRNA #2___________________________________________ :
Anticodons for mRNA #3___________________________________________ :
Question 2 : Using the chart below, write the amino acid sequence coded for by
each mRNA.
Polypeptide #1__________________________________________________ :
Polypeptide #2__________________________________________________ :
Polypeptide #3__________________________________________________ :
21
Grade 10 Advanced Unit4:DNA&Protein synthesis
Question 3: Look at the diagram below and answer the following questions:
: السؤال الثالث : انظر للرسم باألسفل ، ثم أجب على األسئلة التالية
b) DNA transcription takes place in the _________ of the cell whereas the
translation occur in the cell _____________
أ ( ضع البيانات التالية على الرسمة : بروتين - ر ن أ الرسول - رايبوسوم _ د ن أ
ب ( تحدث عملية نسخ ال د ن أ في ______________ الخلية ، بينما تحدث عملية الترجمة في
_________________ .
a) Label the following: protein, mRNA, ribosome, DNA
This stage is calledب ________ المرحلة هذه تسمى
This stage is called____________ ب ______________ المرحلة هذه تسمى
22
Grade 10 Advanced Unit4:DNA&Protein synthesis
Question4 :For each of the same DNA sequences below, write the sequence of
messenger RNA codons that is synthesized during transcription. Be sure
to separate the codons into triplets.
والتي : ( ) الرسول أ ن ر ال على الكودونات النيتروجينية القواعد اكتب الرابع السؤال
تأكد : ( التالية أ ن د ال سالسل من سلسلة لكل ، النسخ عملية أثناء تكوينها سيتم
ثالثية ) شفرات شكل على القواعد كتابة : من
DNA molecule #1: TACCGGATGCCAGATCAAATC
mRNA #1 ____________________________________________
DNA molecule #2: TACGGGGGCGTAACCACAACT
mRNA #2________________________________________________
DNA molecule #3: TACCTGTTAAGCTACAAAATT
mRNA #3_______________________________________________
23
األول : أ ن د ال جزئ
أ ن ر ال على الكودوناتاألول للجزئ الرسول
الثاني أ ن د ال جزئ :
الثالث أ ن د ال جزئ :
أ ن ر ال على الكودوناتالثاني للجزئ الرسول
أ ن ر ال على الكودوناتالثالث للجزئ الرسول
Grade 10 Advanced Unit4:DNA&Protein synthesis
10 minutes (max)
3 -Write a summary for the above text.بأسلوبك - 3 السابق النص لخص
………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………
READING ACTIVITY
Question5 :Read the text below then answer the following questions.
على : أجب ثم التالي النص أقرأ الخامس السؤالالتالية : األسئلة
24
Life is specified by genomes , Every organism, including humans, has a genome that contains all of the biological information needed to build and maintain a living example of that organism. The biological information contained in a genome is encoded in its DNA and is
divided into discrete units called Genes .
Grade 10 Advanced Unit4:DNA&Protein synthesis
Your final project is to make a three-dimensional model of DNA.
األبعاد ثالثي أ ن د لل نموذج تصميم عن عبارة النهائي المشروع
Project due date Is
لتسليم موعد آخر المشروع
--------------
25
You can work as a group of 3-4 student per group (I want to see a group working not an individual work (
Wikipedia, the free encyclopedia is very useful site to start with and get
information (nucleotide, DNA, adenine, thymine, cytosine, guanine ,
complementary base pairing
من مكونة مجموعات شكل على العمل يرجى ( 4 – 3تستطيعون ، طالبكمجموعة ) . العمل
بالموضوع متعلقة معلومات ألخذ مفيد موقع يعتبر الويكيبيديا موقع ) ، ثايمين ، أدينين ، أ ن د ، نيوكليوتيد المفردات بهذه االستعانة وتستطيعون
القواعد ) . ربط قانون ، جوانين ، سايتوسين
Grade 10 Advanced Unit4:DNA&Protein synthesis
Category1 2 3 4
1- Labels
البيـــانات
Labels are not accurate or the labels are absent.
Some labels are clear and correct
Most labels are clear and correct
All labels are clear and correct.
2- Base Pairing
ارتباط القواعد
Very little of the base pairing is accurate
Some of the base pairing is accurate
Most of the base pairing is accurate.
All base pairs are accurate.
3- Participation
المشاركة
Evaluation Rubric For your DNA model
أ ن د ال نموذج تقييم معايير
26
دقيقة غير البيانات
موجودة غير أو
البيانات بعض
وصحيحة موجودة
البيانات معظم
وصحيحة موجودة
البيانات جميع
وصحيحة موجودة
من جدا قليلالقواعد
النيتروجينية بشكل مرتبطةودقيق صحيح
من بعضالقواعد
النيتروجينية بشكل مرتبطةودقيق صحيح
القواعد معظمالنيتروجينية
بشكل مرتبطةودقيق صحيح
القواعد جميعالنيتروجينية
بشكل مرتبطةودقيق صحيح
أي يظهروا لممشاركة أو اهتمام
المناقشة أثناءالنموذج وبناء
Participated in or actively listened to the class discussion. Somewhat paid attention during model construction.
Played an active role in the class discussion of the activity. Paid attention during model construction.
Listened somewhat to the discussion. Had trouble paying attention during model construction.
No attention or participation in the discussion. Did not pay attention during model construction.
االستماع الى للمناقشة
واهتمام ، ما حدأثناء جدا بسيط
النموذج . بناء
االستماع للمناقشة
و ، بإهتمامبعض إظهار
أثناء االهتمامالنموذج . بناء
االستماع للمناقشة
وفاعلية بإهتمام
إظهار و ،االهتمام
بناء أثناء الشديدالنموذج .
Grade 10 Advanced Unit4:DNA&Protein synthesis
27
Grade 10 Advanced Unit4:DNA&Protein synthesis