Biodegradation of Grass by a Rot Fungus Isolated from Cattle Faeces

Sasikarn Nuchdang1,2

, Savitri Vatanyoopaisarn 3 and Chantaraporn Phalakornkule

1,2,4

1 The Joint Graduate School of Energy and Environment, King Mongkut’s University of Technology

Thonburi, Bangkok 10140, Thailand

2 The Research and Technology Center for Renewable Products and Energy (CRePE)

3 Department of Agro-Industrial Technology, Faculty of Applied Science

4 Department of Chemical Engineering, Faculty of Engineering, King Mongkut’s University of Technology

North Bangkok, Bangkok 10800, Thailand

Abstract. In this study, the capability of a rot fungus isolated from cattle rumen was investigated as a

means of biodegrading field grass. Coprinopsis cinerea, which is classified as an obligate aerobic organism,

was isolated under semi-aerobic conditions from cattle rumen. The grass was inoculated with the isolated

fungus under aerobic conditions for 30 days. In a microscopic examination of the fungi-treated grass some

cavities could be seen. It was found that the amounts of cellulose, hemicellulose and total solids in the fungi-

treated grass were lower than those of the untreated grass by 8%, 9%, and 13% respectively. The lower

contents of cellulose, hemicellulose and total solids in the fungi-treated grass indicated the biodegradation

activity of the isolated C. cinerea. Data from batch biogas production suggested that the initial conversion

rate of the fungi-treated grass to methane was more than double that of the untreated grass.

Keywords: Coprinopsis cinerea, biopretreatment, hydrolysis, biogas, pretreatment, biomass

1. Introduction

Biological pretreatment of lignocellulosic materials has been shown to enhance biogas production

[1].The pretreatment can change the chemical structure of the lignocellulosic biomass and make it more

accessible to hydrolysis [2]. The biological treatment is considered to be more environmentally friendly and

less energy-consuming than mechanical and chemical pretreatments [3].

A number of fungal and bacterial strains have been shown to effectively degrade lignocellulosic biomass.

Among fungal strains, white-rot fungi have been shown to be potential biomass degraders. A white-rot

fungus Pleurotus florida which produces lignin-degrading enzymes was reported to help the hydrolysis of

raw corn straw [4]. P. ostreatus was found to degrade phenolic compounds in olive-mill wastewater and

consequently to enhance stability of the biogas production system [5]. It has been shown that ethanol

production from biomass under aerobic conditions can be increased by use of a white-rot fungus Chalara

parvispora and a soft-rot fungus Trametes versicolor when compared with fermentation using only

Saccharomyces cerevisiae [6]. However, there has been little work on the effects of biomass pretreatment by

Coprinopsis cinerea, a litter-decaying fungus.

In this study, the capability of C. cinerea isolated from cattle rumen in degrading field grass was

investigated. Changes in the physical structures of the field grass after 30 days of aerobic treatment were

examined and the biogas productions of the untreated and the fungi-pretreated grass were compared.

2. Materials and Method

Corresponding author. Tel.: + 6689-135-3253; fax: +662-587-0024.

E-mail address: cpk@kmutnb.ac.th, cphalak21@yahoo.com.

24

2014 4th International Conference on Future Environment and Energy

IPCBEE vol.61 (2014) © (2014) IACSIT Press, Singapore

DOI: 10.7763/IPCBEE. 2014. V61. 4

2.1. Materials

Buffalo grass (Brachiaria mutica) was used as the carbon source. The grass was dried at 30-35C until

the moisture content dropped to less than 10% [7]. The materials were chopped by a chopper (20 mm) and

ground into 2-3 mm powder by a blender. The raw materials were then stored in a black bag at room

temperature (30-35C) prior to use.

Mesophilic anaerobic sludge was used as the inoculum for anaerobic biogas production. This sludge was

obtained from Ngaung-Khaem Water Quality Control Plant, a domestic wastewater treatment plant in

Bangkok, Thailand.

C. cinerea isolated from cattle rumen was used as the inoculum in the aerobic treatment of the buffalo

grass. Molecular identification was made using the 18s rDNA sequences database. The identification showed

that the white mycelia fungus was Coprinopsis cinerea (99% similarity). The nucleotide sequence was as

follows.

GCCCGTCACCTTTATTTCTCCACCTGTGCACACACTGTAGGCCTGGATACCTCTCGT

CGCAAGGCGGATGCGTGGCTTGCTGTCGCTTTCGAAAGAAGGCCGGCTTGCCATGAA

TTTCCAGGTCTATGATTTCTTACACACCCCAAACTGAATGTTATGGAATGTCATCTC

AAGGCCTTGGTGCCTATAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCG

CATCGATGAAAAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAAAATTCAGTGA

ATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCAAGGAGCATGCCTGT

TTGAGTGTCATTAAATTCTCAACCTCACCAACTTTGTTGTGTGCAGG

2.2. Aerobic pretreatment of the buffalo grass by the isolated fungus

Five grams (dry weight) of the grass powder (2-3 mm long) were transferred into a 250 ml Erlenmeyer

flask and moisturized with 15 ml of tap water. Then the grass was autoclaved for 15 min at 121°C to ensure

sterilization. The flask was then inoculated with 10 disks (each with 1 cm in diameter) of the fungal culture

and incubated at 28°C for 30 days.

After the specified pretreatment period, the grass was washed with 37.5 ml distilled water and filtered

under vacuum. The solid fractions were then dried at 85°C [8] and analyzed for dry weight and cellulose,

hemicellulose and lignin contents. The liquid fractions were analyzed for pH, reducing sugar, volatile fatty

acids (VFA), soluble chemical oxygen demand (sCOD), total nitrogen (TN) and total phosphate (TP).

2.3. Anaerobic biogas production

One hundred milliliter serum bottles, each with a rubber stopper, were used as batch reactors. The bottles

contained 1 g volatile solids (VS) of buffalo grass (with or without biopretreatment) and anaerobic sludge at

a ratio of 1 g VS/gVS. The batch reactor had 5% total solids (TS). The reactor bottles were first flushed for 1

min with 99.995% argon to ensure anaerobic conditions and then incubated under mesophilic temperatures

between 30°C and 35°C for 1 month. The generated biogas was collected using either 25 ml- or 50 ml-

hospital needle syringes [9]. The amounts of biogas production were reported per gram VS under standard

conditions (STP: 0°C and 1 atmosphere). The biogas samples were taken daily with a syringe through the

septum from the headspace of the reactors for the measurement of biogas composition.

For each run, a control blank with only the inoculum was run in parallel. After each specified incubation

period, the samples were collected for analysis of pH, volatile fatty acid (VFA), VS and TS, soluble chemical

oxygen demand (sCOD) and cellulose, hemicellulose and lignin content.

2.4. Analysis

Biogas composition was determined by a gas chromatograph equipped with a thermal conductivity

detector (GC-2014, SHIMADZU, Japan) and a unibeads C column. The argon flowrate was 25 ml/min.

Measurements of cellulose, hemicellulose and lignin contents were performed by the detergent method [10]. The hemicellulose content was calculated from the difference between neutral detergent fibre (NDF)

and acid detergent fibre (ADF). The lignin content was the difference between ADF and permanganate lignin

(PML). After the PML analysis, the cellulose content was estimated from the weight loss of the sample when

held at 550°C for 3 hrs.

25

Reducing sugar was measured by the dinitrosalicylic acid (DNS) method [11]. Total nitrogen (mg/l) and

total phosphate (mg/l) were measured using HACH Test’N test tubes [12]. VFA concentration was

determined by a gas chromatograph (GC-2010, SHIMADA, Japan) equipped with a flame ionization detector.

The concentrations of TS, VS and VSS were determined by the Standard Methods [13], and the sCOD was

determined using the closed-tube method [14]. The pH was measured by a pH meter (Schott, Lab 850,

Germany).

The microscopy images of the untreated grass and the fungi-pretreated grass were obtained using a

MEIJI TECHNO ML 2000 (Japan) microscope.

3. Results and Discussion

3.1. Changes in physical structures and chemical compositions of the field grass

Rot fungi are known to secrete cellulase from their hyphae [15]. This leads to the formation of

microscopic cavities inside cellulosic materials [16]. Fig. 1 shows a comparison of the microscopy images of

the untreated grass and of the fungi-pretreated grass after 30 days under aerobic conditions. It can be seen

that some microscopic cavities are present in the fungi-treated grass. The pretreatment should therefore

increase the specific area of the cell wall saccharides. The increase in the specific area should in turn

accelerate enzymatic hydrolysis as suggested by Gharpuray et al. [17].

Fig. 1: Microscopy images of the untreated grass (left) and of the fungi-pretreated grass (right) after 30 days under

aerobic conditions.

Table 1 compares the chemical compositions of the insoluble parts and the soluble parts of the untreated

grass and the fungi-treated grass. The values shown in Table 1 are based on one gram of grass substrate (dry

weight). The amount of dry weight or total solid content of the fungi-treated grass was lower than that of the

untreated grass by 13%. Similarly, the cellulose and the hemicellulose contents of the fungi-treated grass

were lower than those of the untreated grass by 8% and 9%, respectively. The lower contents of the total

solids, cellulose and hemicellulose in the fungi-treated grass indicated the biodegradation activity of the

isolated C. cinerea.

The pH of the soluble part of the untreated grass was acidic, which corresponded to the high content of

VFA. The acidic pH and the high content of VFA in the untreated grass suggested the presence of hydrolysis

and acidogenesis activities of bacteria which may naturally present in the grass substrate. In contrast, the pH

of the soluble part of the fungi-treated grass was slightly alkaline. The content of soluble COD compounds

and specifically the amount of glucose in the fungi-treated grass was much lower than those of the treated

grass. The data suggested that C. cinerea utilized glucose and some other soluble compounds for their

growth. In the literature, it has been reported that white-rot fungi uptake and utilize glucose for their growth

[18].

3.2. First-stage of biogas production from the untreated and the fungi-pretreated grass

In contrast to anaerobic degradation which is usually coupled with anaerobic biogas production using co-

cultures or tri-cultures, aerobic degradation by fungi is a separate step. The aerobic degradation can be easily

terminated in order to start anaerobic digestion by limiting the air supply to the biogas production system.

26

Fig. 2a shows the methane content in the biogas produced from the untreated and the fungi-treated grass. The

methane content in the biogas produced from the fungi-treated grass reached a maximum of 60% within 4

days, while that of the untreated grass increased slowly and reached a maximum of 55% on day 10. Fig. 2b

compares the cumulative methane production from the untreated and the fungi-treated grass. The methane

production rate associated with the digestion of the fungi-treated grass was constant at 112 ml/lday during

the first fourteen days. In contrast, the methane production rates associated with the digestion of the

untreated grass can be divided into two phases. During the first seven days, the methane production rate was

48 ml/lday, which was lower than half of that of the fungi-treated grass. During the second seven days, the

methane production rates became comparable. The results suggested that biotreatment helped to accelerate

the hydrolysis at the initial stage. The fungal pretreatment therefore should be useful for biogas production

because hydrolysis is known to be the rate-limiting step of the biomass-to-biogas conversion process [19].

A previous study by Romano et al. [20] illustrated that the addition of enzyme products containing

cellulase, hemicellulase, and β-glucosidase to anaerobic digestion systems had positive effects on the

solubilization of wheat grass when used alone to treat grass. However, no significant differences in biogas

and methane yields, and volatile solids reduction resulted when the enzyme products were tested in the

anaerobic digestion systems. The results in this study suggested that the enhanced solubilization of grass

lignocelluloses may help accelerate the biogas production process, even though it may not help increase the

biogas and methane yields.

Table 1: Chemical composition of the untreated grass and the fungi-treated grass

Parameters grass

untreated treated

Insoluble part dry weight (g) 0.83 0.70

cellulose (g) 0.29 0.21

hemicellulose (g) 0.30 0.21

lignin (g) 0.09 0.07

Soluble part sCOD (mg) 109.32 82.70

TN (mg) 3.49 6.27

TP-PO43- (mg) 1.64 1.50

reducing sugar (mg) 42.13 11.25

pH 6.13

7.52

VFA (mg)

acetate 1.43 0.00

butyrate 0.00 0.00

ethanol 6.73 4.77

formate 0.94 0.76

lactate 1.82 0.84

propionate 5.81 0.00

valerate 0.47 0.06

Fig. 2: Comparative methane composition in biogas produced from anaerobic digestion (a) and cumulative methane

production (b) of the untreated and the fungi-treated grass

0

10

20

30

40

50

60

70

80

90

100

0 2 4 6 8 10 12 14

% M

eth

an

e

time (d)

Without fungi pretreatment

Pretreated with C. ceneria

0

500

1000

1500

2000

0 2 4 6 8 10 12 14

Cu

mu

lati

ve

meth

an

e (

ml/

L r

eacto

r)

time (d)

Without fungi pretreatment

Pretreated with C. ceneria

(a) (b)

27

4. Conclusion

Biopretreatment of field grass by C. cinerea was found to increase the initial methane production rate

during the first seven days. The overall conversion rate of the fungi-treated grass to methane was around

double that of the untreated grass. Some cavities can be observed in the fungi-treated grass at a microscopic

level. The biopretreatment may increase the specific area of the cell wall saccharides, which in turn should

accelerate enzymatic hydrolysis. However, the chemical composition data suggested that C. cinerea utilized

glucose and some other soluble compounds for their growth. Effects of the biopretreatment on biogas and

methane yields should be further investigated.

5. Acknowledgements

This research was supported by the Science and Technology Postgraduate Education and Research

Development Office (PERDO), the Commission of Higher Education Thailand. The authors are grateful to

Thailand Research Fund (The Royal Golden Jubilee Ph.D. Program, Grant no. PHD/0311/2551) and the

Joint Graduate School of Energy and Environment (JGSEE) for the scholarship to S. Nuchdang.

6. References

[1] H. Vervaerena, K. Hostyna, G. Ghekiere, B. Willems. Biological ensilage additives as pretreatment for maize to

increase the biogas production. Renewable Energy 2010;35:2089-2093.

[2] P. Kumar, D.M. Barrett, M.J. Delwiche, P. Stroeve. Methods for pretreatment of lignocellulosic biomass for

efficient hydrolysis and biofuel production. Industrial and Engineering Chemistry Research. 2009;48:3713–3729.

[3] T. Canama, J.R. Towna, A. Tsang, T.A. McAllister, T.J. Dumonceaux. Biological pretreatment with a cellobiose

dehydrogenase-deficient strain of Trametes versicolor enhances the biofuel potential of canola straw. Bioresource

Technology. 2011;102:10020–10027.

[4] W. Zhong, Z. Zhang, W. Qiao, P. Fu, M. Liu. Comparison of chemical and biological pretreatment of corn straw

for biogas production by anaerobic digestion. Renewable Energy. 2011:1-5.

[5] P.S. Blika, K. Stamatelatou, M. Kornaros, G. Lyberatos. Anaerobic digestion of olive mill wastewater. Global

NEST Journal. 2009;11:364-372.

[6] M. Holmgren, A. Sellstedt. Identification of white-rot and soft-rot fungi increasing ethanol production from spent

sulfite liquor in co-culture with Saccharomyces cerevisiae. Journal of Applied Microbiology. 2008;105:134-140.

[7] C. Wan, Y. Li. Effectiveness of microbial pretreatment by Ceriporiopsis subvermispora on different biomass

feedstocks. Bioresource technology. 2011;102:7507-7512.

[8] D. Salvachua, A. APrieto, M.L. Abelairas, T.L. Chau, A.T. Martinez, M.J. Martinez. Fungal pretreatment: An

alternative in second-generation ethanol from wheat straw. Bioresource technology. 2011;102:7500-7506.

[9] C.H. Ting, D.J. Lee. Production of hydrogen and methane from wastewater sludge using anaerobic fermentation.

International Journal of Hydrogen Energy. 2007;32:677-682.

[10] T.Y. Ding, S.L. Hii, L.G.A. Ong. Comparison of pretreatment strategies for conversion of coconut husk fiber to

fermentablesugars. BioResources. 2012;7:1540-1547.

[11] F.D. Otajevwo, H.S.A. Aluyi. Cultural conditions necessary for optimal cellulase yield by cellulolytic bacterial

organisms as they relate to residual sugars released in broth medium. Modern Applied Science. 2011;5:141-151.

[12] W.H. Strosnider, B.K. Winfrey, R.W. Nairn. Biochemical oxygen demand and nutrient processing in a noval

multi-stage raw municipalwastewater and acid mine drainge passive co-treatment system. Water research.

2011;45:1079-1086.

[13] APHA. Standard methods for the examination of water and wastewater. USA1998.

[14] Finnish Standard Association. Determination of chemical oxygen demand (CODcr) in water with closed tube

method, oxidation with dichromate. SFS 5504. Finland1988.

[15] C.M. Popescu, C.M. Tibirna, A. Manoliu, P. Gradinariu, C. Vasile. Microscopic study of lime wood decayed by

Chaetomium globosum. Cellulose Chemistry and Technology. 2011;45:565-569.

28

[16] S.A.M. Hamed. In-vitro studies on wood degradation in soil by soft-rot fungi: Aspergillus niger and Penicillium

chrysogenum. International Biodeterioration and Biodegradation. 2013;78:98-102.

[17] M.M. Gharpuray, Y.H. Lee, L.T. Fan. Structural modification of lignocellulosics by pretreatments to enhance

enzymatic hydrolysis. Biotechnology and Bioengineering. 1983:157-172.

[18] M. Muthangya, A.M. Mshandete, A.K. Kivaisi. Enhancement of anaerobic digestion of sisal leaf decortication

residues by biological pre-treatment. ARPN Journal of Agricultural and Biological Science. 2009;4:66-73.

[19] A.T.W.M. Hendriks, G. Zeeman. Pretreatments to enhance the digestibility of lignocellulosic biomass.

Bioresource Technology. 2009;100:10-18.

[20] R.T. Romano, R. Zhang, S. Teter, J.A. McGarvey. The effect of enzyme addition on anaerobic digestion of Jose

Tall Wheat Grass. Bioresource Technology. 2009;100:4564–4571.

29