BioBuilder : Engineering Cells
description
Transcript of BioBuilder : Engineering Cells
BioBuilder: Engineering Cells
James DixonSharon High School
Rebekah RavgialaTyngsborough High School
Aaron MathieuActon Boxboro High School
Natalie Kuldell
Our GoalsCover curriculum not add more
Authentic manner
Meet AP, MCAS, National standards
Introduce engineering through synthetic biology Current research and iGEM
Feasible for teachers and students
Can we grow houses?Not yet, but synthetic biologists have…
Engineered bacteriato change colorbased on light
Evolution didn’t do this!Engineers did…
And they have…
Abstraction Hierarchy
Parts
A device
A system
If given ONPG* as a substrate(*o-nitrophenyl-β- D-galactoside)
LacZ will produceGalactose o-nitrophenol, Which is yellow!
An indicator of enzyme activity
Promoter: • Strong• Medium• Weak
RBS:• Strong• Medium• Weak
LacZORF
Computer aided design (CAD) generated model:
We can use these slide bars to alter the system
And generate data like this…
Modeling the cell with electronics…
A Bread Board Model:
“BioBuilding” Professional Development Workshop @MIT
Synthetic Biology and Engineering EducationSynthetic Biology and Engineering Education
The BioBuilder curriculum
Genetics and microbiology
Engineering and science standards
Authentic manner and current research
Entry points allow flexibilityAppropriate for college, biotech and AP Bio and general bio classes
Synthetic Biology “…aims to apply standardized engineering techniques to biology and thereby create organisms or biological systems with novel or specialized functions to address countless needs.” (Science 33:6047, 9/2/11)
Eau that SmellCompeting Designs for BioBuilding!
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
MIT iGEM 2006
Part
ABS Plastic
“DNA”
Black box functions
System
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Abstraction Hierarchy for Biological Systems Analogy
Device
Input Output
Engineering & Design Cycle
What’s going on in this lab?
MABT, 3/10/12Rebekah Ravgiala, Tyngsborough High School
Design
Build
Test
The focus of this lab
Potential Learning Objectives1. What is synthetic biology?2. Synthetic biology vs. genetic engineering.3. Investigate population growth curve of bacteria.4. Practice standard microbiology methods.5. Measure the growth of a bacterial population.6. Define and properly use synthetic biology terms
(parts, device, system)7. Define and properly use molecular genetics
terms (promoter, RBS, ORF, Terminator, Plasmid)
*Highlighted are the LO focused on…
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Background
MIT students (iGEM 2006) designed Eau d’coli, E. coli that smell like bananas when their population is in the stationary phase.
System Components
1. Stationary phase promoter 2. BGD (a banana smell device)
a. RBS b. ORF (ATF1 enzyme & terminator sequence)
*The ATF1 enzyme converts isoamyl alcohol to isoamyl acetate, the molecule that gives bananas their characteristic smell.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Challenge Objectives:
1. Grow these bacterial populations2. Test for the banana smell of the population from lag to stationary phase. 3. Measure the density of the culture by using a Spec 20 OR the McFarland Turbidity Standards 4. Compare the banana smell to dilutions of banana extract standard.
Challenge: Evaluating Competing Designs
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Strain 1-1. (+ control)Original MIT Device
Strain 1-2. Original MIT Device + Inverter
Strain 1-3. Log Phase Promoter + BGD
Strain 1-4. (- control)No Smell Generating Device
Workflow Protocol A1. Prepared liquid cultures of each strain.
a. Bacterial strains have been transformed with plasmids corresponding to 1-1, 1-2, 1-3, 1-4b. They may arrive as slants or on Petri dishes or as liquid culturesc. Prepare stock growth media (LB, amp, isoamyl alcohol)d. Use 75ml of stock and add liquid cultures
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
Student Lab Protocol and Instructional Videos
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a 25ml sample in the refrigerator before it has time to incubate (lag phase).
Strain 1-1 Strain 1-4Strain 1-3Strain 1-2T0 T0T0T0
Strain 1-2
T0 T0 T0 T0
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a 25 ml sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-4Strain 1-3Strain 1-2Strain 1-1
T0T0T0T0
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a 25ml sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-4Strain 1-3Strain 1-2Strain 1-1
T0T0T0
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a 25ml sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-4Strain 1-3Strain 1-2Strain 1-1
T0T0
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a 25ml sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-4Strain 1-3Strain 1-2Strain 1-1
T0
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a 25ml sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-4Strain 1-3Strain 1-2Strain 1-1
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Strain 1-4Strain 1-3Strain 1-2Strain 1-1
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
Tlog Tlog TlogTlog
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Strain 1-4Strain 1-3Strain 1-2Strain 1-1
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
Tlog Tlog Tlog Tlog
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
Tlog Tlog Tlog
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
Tlog Tlog
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
Tlog
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Strain 1-4Strain 1-3Strain 1-2Strain 1-1
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
Strain 1-1 Strain 1-4Strain 1-3Strain 1-24. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples.
Tstat Tstat Tstat Tstat
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
4. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples. Refrigerate.
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
TstatTstatTstatTstat
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
4. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples. Refrigerate.
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
TstatTstatTstat
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
4. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples. Refrigerate.
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
TstatTstat
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
4. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples. Refrigerate.
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
Tstat
Workflow Protocol A1. Prepared liquid cultures of each strain.
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
4. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples. Refrigerate.
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
Workflow Protocol A
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-25. There are 12 samples all together (4 cultures each at three time points).
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
1. Prepared liquid cultures of each strain.
4. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples. Refrigerate.
Data Collection: The Smell Test
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
5. There are 12 samples all together (4 cultures each at three time points).
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
1. Prepared liquid cultures of each strain.
4. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples. Refrigerate.
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
}6. Test ALL samples for Banana Scent on a scale of 0-6 compared to Banana Standards. Record data.
Data Collection: Measure Cell Density
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
5. There are 12 samples all together (4 cultures each at three time points).
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
1. Prepared liquid cultures of each strain.
4. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples. Refrigerate.
6. Test ALL samples for Banana Scent on a scale of 0-6. Record data.
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
}6. Measure % Absorbance for ALL samples at OD600. Record data. Calculate the bacterial population: 1 OD600 unit = 1 x 109 bacteria.
Data Collection: Measure Cell Density
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
5. There are 12 samples all together (4 cultures each at three time points).
3. For each strain, let sample run for 6 hours (log phase) on a stir plate. Remove 25ml samples. Refrigerate.
2. For each strain, place a sample in the refrigerator before it had time to incubate (lag phase).
1. Prepared liquid cultures of each strain.
4. For each strain, let a sample run overnight (stationary phase) on a stir plate. Remove 25ml samples. Refrigerate.
6. Test ALL samples for Banana Scent on a scale of 0-6. Record data.
6. Estimate the turbidity of the bacterial population. Record estimated turbidity and determine comparable OD600. Calculate the bacterial population: 1 OD600 unit = 1 x 109 bacteria.
Strain 1-4Strain 1-3Strain 1-2Strain 1-1Strain 1-1 Strain 1-4Strain 1-3Strain 1-2
}McFarland Turbidity Scale
Analysis: What Does it All Mean
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
?
THS
KEYStrain 1-1. Original MIT DeviceStrain 1-2. Original MIT Device + InverterStrain 1-3. Log Phase Promoter + BGDStrain 1-4. No Smell Generating Device
Some “Thinks” for Your Students to Ponder…
1. Is using smell to measure the banana smell valid? Why or why not?
2. What methods did you use to try to increase your confidence in the results?
3. How might we try to change this system so that we can quantify the banana smell? Would we be better off using a different kind of signal? If so, what would you suggest?
4. If you could construct a different genetic system, what might you construct? What would you need to do?
Review: Applying the Abstraction Hierarchy to “Eau that Smell”
actgaactgctgacactgaactgatgact…
DNASequence of bases
Finite sequence with a specific function (ex. promoter, RBS)
Parts
Multiple parts with a higher level function
Device
Isoamyl alcohol
Isoamyl acetate
BGD
SystemMultiple devices hooked together
to realize a goal
1
2
3
4
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
FIRST Robotics Competition
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
2004 summer competition
Rebekah Ravgiala, Tyngsborough High School
2010: 130 teams, 26 countries
MABT, 3/10/12
Past Collegiate Division iGEM Projects
Arsenic Detector (U of Edinburgh 2006) Bacterial Buoy
(Melbourne 2007)Polkadorks
(MIT-IAP 2004)
Polkadorks
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
iGEM at THS… The “Natural” Extension
international Genetically Engineered Machines competition
Rebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Holiday Fundraiser February Fundraiser
Starting a Team… Yes You Can!
iGEM HomepageRebekah Ravgiala, Tyngsborough High School MABT, 3/10/12
Date Chronicle
Aug-Sept Promote the Team
Oct What is SynBio?BioBuilder Curriculum
Nov-Dec Brainstorm IdeasConnect with iGEM alumni
Jan-May Divide & Conquer1. Wiki2. Lab duties3. Poster4. Presentation5. PR (Fundraising & Outreach)
June Jamboree (Virtual?)
Happy BioBuilding!
Thank you!Natalie Kuldell, MITJim Dixon, Sharon HSAaron Mathieu, Acton-Boxborough HSMABT
Contact:Rebekah RavgialaTyngsborough High SchoolTyngsborough, MA [email protected] ext. 3068