Bifidobacterium can mitigate intestinalimmunopathology in the context of CTLA-4 blockadeFeng Wanga,b,1, Qian Yinc, Liang Chenc, and Mark M. Davisb,c,d,1

aCenter for Microbiota and Immunological Diseases, Shanghai General Hospital, Shanghai Institute of Immunology, Shanghai Jiao Tong University Schoolof Medicine, Shanghai 200025, China; bHoward Hughes Medical Institute, Stanford University School of Medicine, Stanford, CA 94305; cInstitute forImmunity, Transplantation and Infection, Stanford University School of Medicine, Stanford, CA 94305; and dDepartment of Microbiology and Immunology,Stanford University School of Medicine, Stanford, CA 94305

Contributed by Mark M. Davis, November 13, 2017 (sent for review July 24, 2017; reviewed by Jeffrey J. Molldrem and David M. Sansom)

Antibodies that attenuate immune tolerance have been used toeffectively treat cancer, but they can also trigger severe autoim-munity. To investigate this, we combined anti–CTLA-4 treatmentwith a standard colitis model to give mice a more severe form ofthe disease. Pretreatment with an antibiotic, vancomycin, pro-voked an even more severe, largely fatal form, suggesting that aGram-positive component of the microbiota had a mitigating ef-fect. We then found that a commonly used probiotic, Bifidobacte-rium, could largely rescue the mice from immunopathology withoutan apparent effect on antitumor immunity, and this effect may bedependent on regulatory T cells.

probiotics | Bifidobacterium | CTLA-4 | immune checkpoint blockade |intestinal immunopathology

Cancer immunotherapy has focused on harnessing the hostimmune system to stimulate an antitumor response. Mono-

clonal antibodies (mAbs) that block immune inhibitory path-ways, specifically the CTLA-4 pathway and the PD-1/PD-L1 axis,have been successfully used in the clinic to improve the overallsurvival of patients with advanced cancers (1–3). However, im-mune checkpoint blockade has the drawback of frequently pro-ducing immune-mediated effects on various organ systems thatcan lead to autoimmunity, most commonly colitis (4). Thischeckpoint blockade-associated toxicity can be serious and lifethreatening and therefore requires prompt and appropriatemanagement to ensure that it is relatively quickly resolved (5),although this can fail to prevent life-long autoimmune syn-dromes or death.Recently, studies have begun to shed light on the crucial role of

the gut microbiota in antitumor responses induced by checkpointblockade antibodies (6, 7). These syndromes most frequently affectsites that are exposed to commensal microorganisms (i.e., the skinand gastrointestinal tract). However, there remains a lack ofknowledge regarding how the gut microbiota influences this type oftoxicity. Here, we show that the gut microbiota of mice can beoptimized by the oral administration of appropriate antibioticsfollowed by supplementation with probiotics. This optimization al-lows checkpoint blockade to achieve the desired immune responseof stimulating antitumor immunity with minimal immunopathology.To establish a checkpoint blockade-related autoimmune mouse

model, mice were tested to determine their response to orallyadministered dextran sulfate sodium (DSS) with an injection ofthe anti–CTLA-4 antibody 9D9 or an isotype control. After theadministration of 2% or 3% DSS in drinking water for 7 d, micethat received an anti–CTLA-4 antibody showed more severe weightloss compared with mice that received DSS plus the isotype controlantibody (Fig. 1 A and B). No significant weight loss was observed inanti–CTLA-4-treated mice in the absence of DSS (Fig. S1). Diseasewas particularly severe in mice that received 3% DSS plus anti–CTLA-4 antibodies and 40% of the mice died (Fig. 1C). In addi-tion, H&E-stained histological sections from the colons of miceshow that the combined treatment showed exacerbated hyperplasia,inflammatory leukocyte infiltration, and ulceration compared with

controls, with worse histopathological scores (Fig. 1 D and E). Wealso observed a therapeutic effect of the anti–CTLA-4 antibodyagainst established B16F10 melanoma in the same mice (Fig. S2) asreported previously (7). Thus, the data from our colitis and tumormodels are consistent with clinical observations of patients whoreceived ipilimumab, an antibody against CTLA-4 (8), where colitisis the most frequent problem encountered.A previous study showed that vancomycin worsens histopatho-

logical signs of gut inflammation but promotes enhanced antitumorimmunity (7) (Fig. S3). Using our DSS plus anti–CTLA-4 colitismodel, we assessed the impact of vancomycin on the severity ofcolitis under CTLA-4 blockade. Mice were pretreated with eithervancomycin or a water control for 2 wk before the induction ofcolitis. In the vancomycin group, mice began to lose body weightafter only 4 d of DSS and anti–CTLA-4 treatment (Fig. 2A),showing a much earlier onset of colitis than without antibiotictreatment (9, 10). Consistently, more severe weight loss was ob-served in mice pretreated with vancomycin than in mice that re-ceived the water control (Fig. 2A). By day 10, all mice in the controlgroup remained alive, whereas 80% of the vancomycin plus DSSand anti–CTLA-4 treated mice had died (Fig. 2B). Histopatho-logical scores were also significantly worse for vancomycin-treatedmice than for the controls (Fig. 2C). H&E staining of colon sec-tions showed severe immune cell infiltration and complete ulcer-ation in vancomycin-treated mice (Fig. 2D). Similar serum levels ofthree inflammatory cytokines, KC, IL-6, and CFS3, were alsodramatically increased in vancomycin-treated mice (Fig. 2E).Vancomycin is a broad-spectrum antibiotic with activity against

Gram-positive bacteria. We hypothesized that we might be able tosubstitute for this apparent protective effect of the microbiota inour system with one of the most commonly used probiotics, Bifi-dobacterium (a genus of Gram-positive anaerobic bacteria), which

Significance

The major stumbling block in the use of checkpoint inhibitorsfor cancer treatment is the severe autoimmunity that oftenresults. In this study, we found the toxicity of a checkpointblockade antibody can be ameliorated via administration ofBifidobacterium, a widely available probiotic. These resultssuggest that it may be possible to mitigate the autoimmunitycaused by anti–CTLA-4 and perhaps other checkpoint inhibitorsby manipulating gut microbiota.

Author contributions: F.W. and M.M.D. designed research; F.W. performed research; Q.Y.and L.C. contributed reagents/analytic tools; F.W. analyzed data; and F.W. and M.M.D.wrote the paper.

Reviewers: J.J.M., University of Texas MD Anderson Cancer Center; and D.M.S., UniversityCollege London Institute of Immunity and Transplantation.

The authors declare no conflict of interest.

Published under the PNAS license.1To whom correspondence may be addressed. Email: wangfeng16@sjtu.edu.cn ormmdavis@stanford.edu.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1712901115/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1712901115 PNAS | January 2, 2018 | vol. 115 | no. 1 | 157–161

IMMUNOLO

GYAND

INFLAMMATION

has been suggested as an effective treatment for inflammatorybowel disease (11–16). Indeed, Quantitative PCR (qPCR) analy-ses targeting Bifidobacterium species showed that the administra-tion of vancomycin decreased the abundance of these species to anundetectable level (Fig. 3A). To test whether this loss of Bifido-bacterium strains or others contributed to the severe colitis, weobtained a commercially available mixture of four Bifidobacteriumspecies and administered this mixture to mice via oral gavagebefore the induction of DSS colitis. This Bifidobacterium treat-ment resulted in a 10-fold increase in the relative abundance ofthese bacteria in feces (Fig. 3A).In our CTLA-4 blockade condition, Bifidobacterium treatment

resulted in substantially less weight loss; the average weight ofvancomycin-treated mice improved from 75% of their initialweight in the DSS plus anti–CTLA-4 group to 95% in the Bifi-dobacterium group on day 8 after DSS administration (Fig. 3B,blue and pink lines). Mice treated with both Bifidobacterium andvancomycin exhibited less weight loss than control mice (Fig. 3B,yellow and pink lines), suggesting that Bifidobacterium treatmentameliorated the immunopathology associated with CTLA-4 blockade by helping to rescue vancomycin-induced gut dys-biosis. Consistent with this assessment, H&E staining of colonsections revealed that Bifidobacterium treatment resulted in areduced histopathological score with partial restoration of thecolon structure and less leukocyte infiltration into gut tissue (Fig.3 C and D). Bifidobacterium treatment also decreased serum

levels of the inflammatory cytokines KC, IL-6, and CFS3 incolitic mice (Fig. 3E).Importantly, we found that the growth kinetics of established

B16F10 melanoma tumors were not affected by the Bifidobacte-rium treatment (Fig. 3F). Tumors of comparable size were found inBifidobacterium-treated mice and PBS-treated control mice at day18 postinoculation (Fig. 3G). These data suggested that Bifido-bacterium ameliorated gut immunopathology without compromis-ing the therapeutic efficacy of vancomycin and CTLA-4 blockadeagainst melanoma in this system.We then investigated the immunologic mechanism underly-

ing the observed amelioration of colitis in Bifidobacterium-treated mice. Interestingly, we found that the protective effectof Bifidobacterium feeding was abrogated in regulatory T cell(Treg)-depleted mice (Fig. 4A). PBS and Bifidobacterium-treatedmice developed equally severe colitis with elevated serum in-flammatory cytokine levels after Treg cell depletion (Fig. 4 B andC). These data indicate that the effects of Bifidobacterium aredependent on the host immune regulatory response. We nexttested whether administration of Bifidobacterium increases thefrequency of Treg cells as has been reported in other studies ofmicrobiome influence on these cells (17–22), but we did not seeany differences between PBS- and Bifidobacterium-treated micewith respect to CD4+ Foxp3+ T cells isolated from the spleen orlamina propria (LP) (Fig. S4). Instead, we used RNA sequencingto profile the genome-wide transcriptional pattern of LP Treg cellsisolated from Bifidobacterium-treated mice versus controls. Gene

A B

C D

E

Fig. 1. Increased susceptibility of DSS-induced colitis in anti–CTLA-4 Ab-receiving mice. (A and B) Percent of initial weight of mice receiving the IgG isotypecontrol (Iso Ctrl) or the αCTLA-4 mAb. Mice were given 2% (A) or 3% DSS (B) for 7 d. There were five mice in each group. The data show mean with SEManalyzed by two-way ANOVA with Sidak’s correction for multiple comparisons. (C) Survival of the mice receiving the IgG isotype control (Iso Ctrl) or theαCTLA-4 mAb with 4% DSS administration. Survival was monitored for 14 d, n = 5 per group. (D) The histological score of mice receiving the IgG isotypecontrol (Iso Ctrl) or the αCTLA-4 mAb with 3% DSS administration, n = 6 per group, means with SEM analyzed by unpaired Student’s t test. (E) Representativecolon sections from mice treated with injection of isotype control (Left) or αCTLA-4 mAb (Right) and 3% DSS administration. Colon samples were collected atday 14 (H&E stained). (Scale bar, 50 μm.) *P < 0.05 and **P < 0.01.

158 | www.pnas.org/cgi/doi/10.1073/pnas.1712901115 Wang et al.

Ontology (GO) analysis of differentially expressed genes identifiednine metabolic pathways, including cellular macromolecules, ni-trogen compounds, and organic substances (Fig. S5). Thus, it islikely that Bifidobacterium acts primarily via modulating thesemetabolic functions of Treg cells (23–25) without either systemat-ically or locally affecting the number of Treg cells.In summary, our study demonstrates a role for Bifidobacterial

strains in ameliorating the immunopathology associated withCTLA-4 blockade. If the same mechanisms are at work in humanbeings, this may present a way to reduce or eliminate the auto-immunity that often accompanies checkpoint blockade therapieswithout diminishing the anticancer responses. This principlecould apply to other checkpoint-related immunotherapies, suchas antibodies targeting the PD-1/PD-L1 axis. Importantly, recentstudies have indicated that Bifidobacterium species promote an-titumor response in PD-L1 blockade by augmenting dendriticcell function (6). Thus, it would be valuable to explore the role ofBifidobacterium in the combined blockade of the CTLA-4 andPD-1 pathways. Our work also suggests caution in combiningantibiotics with anti–CTLA-4 treatment. Our results indicate a

role for Treg cells in colitis-ameliorating function of Bifido-bacterium, and we hope this stimulates further investigations inthe molecular mechanism underlying this process. In addition,since a failure in Treg activity has been implicated in both auto-immunity and allergy generally, the type of enhancement pro-vided by this widely available probiotic that we describe here maybe helpful in controlling those diseases as well (26).

Materials and MethodsMice. C57BL/6 and Foxp3-DTR mice were purchased from The Jackson Labora-tory. For all experiments, 6- to 14-wk-old female mice were used. Mice weremaintained in the Research Animal Facility at the Stanford University De-partment of ComparativeMedicineAnimal Facility in accordancewith guidelinesof the National Institutes of Health. Mice experiments were approved by theStanford University Administrative Panel on Laboratory Animal Care.

Induction of DSS Colitis. Mice received 2–4% DSS (MP Biomedicals) in theirdrinking water for 6–7 d. Weight was recorded daily. For gut commensalmanipulation, mice were provided with vancomycin (0.5 g/L; Sigma) in thedrinking water for at least 14 d. After that, DSS was added to the antibiotic-containing water. Mice were injected with 100 μg of anti–CTLA-4 mAb (clone9D9) or isotype control twice (started 1–3 d before the DSS administration).

AB

C D

E

Fig. 2. Vancomycin augments the immunopathology of CTLA-4 blockade. (A) Percent initial weight of H2O- or vancomycin-treated mice after injection of theαCTLA-4 mAb and the administration of 3% DSS. In each group, n = 5. ****P < 0.0001; Data show means with SEM analyzed by two-way ANOVA with Sidak’scorrection for multiple comparisons. (B) Survival of H2O- or vancomycin-treated mice after injection of the αCTLA-4 mAb and administration of 3% DSS, withn = 5 per group. (C) Histological score of H2O- or vancomycin-treated mice after injection of the αCTLA-4 mAb and administration of 3% DSS, n = 5 per group,****P < 0.0001, unpaired Student’s t test. (D) Representative colon sections of mice treated with H2O or vancomycin after injection of αCTLA-4 mAb and 6-dadministration of 3% DSS (H&E stained). (Scale bar, 100 μm.) (E) Concentrations of KC, IL-6, and CSF3 in the serum of mice treated with H2O or vancomycinafter CTLA-4 blockade and 6-d administration of 3% DSS, n = 5–7 per group. *P < 0.05, unpaired Student’s t test.

Wang et al. PNAS | January 2, 2018 | vol. 115 | no. 1 | 159

IMMUNOLO

GYAND

INFLAMMATION

Melanoma Model. Mice were s.c. injected into the right flank with 1 × 105

B16F10 tumor cells. Mice were injected intraperitoneally (i.p.) with 100 μg ofisotype control (clone MPC11) or anti–CTLA-4 mAb (clone 9D9). Mice were

injected four times at ∼3-d intervals with the mAb. Tumor size was measured bya caliper until the mandated endpoint (500 mm2). Tumor size was determinedas length × width.

Rel

ativ

e ab

unda

nce

of B

ifido

A B

C D

E

F G

Fig. 3. Bifidobacterium ameliorates the immunopathology, but does not affect antitumor immunity of vancomycin and CTLA-4 blockade. (A) The relative abundanceof Bifidobacteriumwas quantified with real-time PCR. This was normalized to total bacteria, with n = 4–5 per group. **P < 0.01, unpaired Student’s t test. (B) Percentinitial weight of 2.5% DSS-induced colitis in αCTLA-4 mAb-injected mice treated with H2O + PBS, vancomycin + PBS, or vancomycin + Bifidobacterium. In each group,n = 5. **P < 0.01, ****P < 0.0001. Data show means with SEM analyzed by two-way ANOVA with Sidak’s correction for multiple comparisons. Histological score(C) and representative colon sections (D) of 2.5% DSS-induced colitis in vancomycin and αCTLA-4 mAb-treated mice oral gavaged with PBS or Bifidobacterium, n = 5 pergroup, **P < 0.01, unpaired Student’s t test (H&E stained). (Scale bar, 50 μm.) (E) Concentrations of KC, IL-6, and CSF3 in serum from mice oral gavaged with PBS orBifidobacterium. These mice were also repeatedly injected i.p. with the αCTLA-4 mAb and a 6-d administration of 2.5% DSS, n = 5–7 per group. *P < 0.05; **P < 0.01,unpaired Student’s t test. B16F10 tumor growth kinetics (F) and tumor size at day 18 postimplantation (G) in mice pretreated with vancomycin followed by treatmentwith PBS or Bifidobacterium by oral gavage. The αCTLA-4 mAb was injected at 3, 6, 10, and 13 d posttumor implantation. n.s., not significant.

160 | www.pnas.org/cgi/doi/10.1073/pnas.1712901115 Wang et al.

Histology. Freshly isolated colon was fixed in formalin and embedded inparaffin. H&E staining was performed by using a standard protocol. Forhistological quantitative analysis, five criteria were used to grade each sec-tion of intestine: (i) severity of inflammation, (ii) percent of area affected byinflammation, (iii) degree of hyperplasia, (iv) percent of area affected byhyperplastic changes, and (v) ulceration. Section of colon was graded bya pathologist.

Bifidobacterium Administration. Lyophilized Bifidobacterium species includingBifidobacterium bifidum, Bifidobacterium longum, Bifidobacterium lactis, andBifidobacterium breve (Seeking Health) were resuspended in PBS. Each mousewas given 300 μL of Bifidobacterium (1 × 109 cfu per mouse) by oral gavage.For DSS colitis, Bifidobacterium was given before DSS administration. Forthe tumor model, Bifidobacterium was given at 7 and 14 d following tumorinoculation.

Quantification of Bifidobacterium by qPCR Assay. Fecal samples were collected4 d after oral administration of Bifidobacterium species. Bacterial DNA wasisolated with the Qiagen DNA Stool Mini Kit following the manufacturer’sinstructions. Taqman-targeted qPCR was applied using primers and probes

specific for Bifidobacterium: Bifid forward (CGGGTGAGTAATGCGTGACC), Bifidreverse (TGATAGGACGCGACCCCA), and probe (6FAM-CTCCTGGAAACGGGTG).The relative abundance of Bifidobacterium was normalized by primers andprobe targeting all bacteria: all bacteria forward (CGGTGAATACGTTC-CCGG), all bacteria reverse (TACGGCTACCTTGTTACGACTT), and probe(6FAM-CTTGTACACACCGCCCGTC).

Serum Cytokine Measurement. Blood samples were collected at days 6–7 afterDSS colitis induction. After clotting at least 30 min at room temperature,serum was separated with centrifuge (10 min at 1,200 relative centrifugalforce). Luminex assay was performed following the product manual at theStanford Human Immune Monitoring Center.

ACKNOWLEDGMENTS. We thank J. L. Sonneburg, M. Fischbach, Y.-H. Chien,and A. Habtezion for helpful discussions and J. Vilches-Moure, Y. Zhang,Lei Chen, and T. Xiang for assistance on experiments and data analysis. Thisstudy was supported by the Program for Professor of Special Appointment(Eastern Scholar) at Shanghai Institutions of Higher Learning and the Shang-hai Pujiang Program (F.W.), and the Howard Hughes Medical Institute andthe Parker Institute for Cancer Immunotherapy (M.M.D.).

1. Hodi FS, et al. (2010) Improved survival with ipilimumab in patients with metastaticmelanoma. N Engl J Med 363:711–723.

2. Larkin J, et al. (2015) Combined nivolumab and ipilimumab or monotherapy in un-treated melanoma. N Engl J Med 373:23–34.

3. Tumeh PC, et al. (2014) PD-1 blockade induces responses by inhibiting adaptive im-mune resistance. Nature 515:568–571.

4. Michot JM, et al. (2016) Immune-related adverse events with immune checkpointblockade: A comprehensive review. Eur J Cancer 54:139–148.

5. Friedman CF, Proverbs-Singh TA, PostowMA (2016) Treatment of the immune-relatedadverse effects of immune checkpoint inhibitors: A review. JAMA Oncol 2:1346–1353.

6. Sivan A, et al. (2015) Commensal bifidobacterium promotes antitumor immunity andfacilitates anti-PD-L1 efficacy. Science 350:1084–1089.

7. Vétizou M, et al. (2015) Anticancer immunotherapy by CTLA-4 blockade relies on thegut microbiota. Science 350:1079–1084.

8. Lipson EJ, Drake CG (2011) Ipilimumab: An anti-CTLA-4 antibody for metastaticmelanoma. Clin Cancer Res 17:6958–6962.

9. Vrieze A, et al. (2014) Impact of oral vancomycin on gut microbiota, bile acid me-tabolism, and insulin sensitivity. J Hepatol 60:824–831.

10. Cotter PD, Stanton C, Ross RP, Hill C (2012) The impact of antibiotics on the gut mi-crobiota as revealed by high throughput DNA sequencing. Discov Med 13:193–199.

11. Ghouri YA, et al. (2014) Systematic review of randomized controlled trials of pro-biotics, prebiotics, and synbiotics in inflammatory bowel disease. Clin Exp Gastroenterol7:473–487.

12. Gareau MG, Sherman PM, Walker WA (2010) Probiotics and the gut microbiota inintestinal health and disease. Nat Rev Gastroenterol Hepatol 7:503–514.

13. Pronio A, et al. (2008) Probiotic administration in patients with ileal pouch-analanastomosis for ulcerative colitis is associated with expansion of mucosal regulatorycells. Inflamm Bowel Dis 14:662–668.

14. Ventura M, et al. (2009) Genome-scale analyses of health-promoting bacteria: Pro-biogenomics. Nat Rev Microbiol 7:61–71.

15. Jia W, Li H, Zhao L, Nicholson JK (2008) Gut microbiota: A potential new territory fordrug targeting. Nat Rev Drug Discov 7:123–129.

16. Shen J, Zuo ZX, Mao AP (2014) Effect of probiotics on inducing remission and

maintaining therapy in ulcerative colitis, Crohn’s disease, and pouchitis: Meta-analysis

of randomized controlled trials. Inflamm Bowel Dis 20:21–35.17. Fukuda S, et al. (2011) Bifidobacteria can protect from enteropathogenic infection

through production of acetate. Nature 469:543–547.18. Smith PM, et al. (2013) The microbial metabolites, short-chain fatty acids, regulate

colonic Treg cell homeostasis. Science 341:569–573.19. Di Giacinto C, Marinaro M, Sanchez M, Strober W, Boirivant M (2005) Probiotics

ameliorate recurrent Th1-mediated murine colitis by inducing IL-10 and IL-10-

dependent TGF-beta-bearing regulatory cells. J Immunol 174:3237–3246.20. Calcinaro F, et al. (2005) Oral probiotic administration induces interleukin-10 pro-

duction and prevents spontaneous autoimmune diabetes in the non-obese diabetic

mouse. Diabetologia 48:1565–1575.21. Furusawa Y, et al. (2013) Commensal microbe-derived butyrate induces the differ-

entiation of colonic regulatory T cells. Nature 504:446–450.22. Park J, et al. (2015) Short-chain fatty acids induce both effector and regulatory T cells

by suppression of histone deacetylases and regulation of the mTOR-S6K pathway.

Mucosal Immunol 8:80–93.23. Michalek RD, et al. (2011) Cutting edge: Distinct glycolytic and lipid oxidative meta-

bolic programs are essential for effector and regulatory CD4+ T cell subsets.

J Immunol 186:3299–3303.24. Zeng H, Chi H (2015) Metabolic control of regulatory T cell development and func-

tion. Trends Immunol 36:3–12.25. Galgani M, De Rosa V, La Cava A, Matarese G (2016) Role of metabolism in the im-

munobiology of regulatory T cells. J Immunol 197:2567–2575.26. Dwivedi M, Kumar P, Laddha NC, Kemp EH (2016) Induction of regulatory T cells: A

role for probiotics and prebiotics to suppress autoimmunity. Autoimmun Rev 15:

379–392.27. Yang Y, et al. (2014) Focused specificity of intestinal TH17 cells towards commensal

bacterial antigens. Nature 510:152–156.

DTX PBS

DTX Bifid

o0

2

4

6

8

10

His

tolo

gic

scor

e

DTX PBS

DTX Bifid

o0

20

40

60

KC le

vels

in s

erum

(pg/

mL)

0 1 2 3 4 5 6 7 8 970

80

90

100

110

Days after DSS adminstration

% o

f ini

tial w

eigh

t

DTX PBSDTX BifidoPBSBifido

A B C

Fig. 4. Immune regulatory function of Bifidobacterium depends on Treg cells. (A) Percent initial weight of DSS colitis in vancomycin and αCTLA-4 mAb-treatedFoxP3-DTR mice after oral gavage with PBS or Bifidobacterium under control or Treg depletion condition (with DTX injection). Histological score (B), andconcentrations of serum KC (C) were measured in DTX-injected mice in A at day 7. For each group, n = 5. Data show means with SEM analyzed by two-wayANOVA with Sidak’s correction for multiple comparisons in A. Unpaired Student’s t test in B and C. DTX, diphtheria toxin; **P < 0.01; n.s., not significant.

Wang et al. PNAS | January 2, 2018 | vol. 115 | no. 1 | 161

IMMUNOLO

GYAND

INFLAMMATION