Bell Ringer

• WELCOME BACK!!!!!• Please get started working on the

chapter 12.1 Vocabulary

Chapter 12

Molecular Genetics

Section 1

DNA: The Genetic Material

4

The Genetic Material

Chromosome

SupercoilsCoils

DNA double helix

DNA: The Genetic Material

5

DNA and RNA

6

DNA and RNA

(Helix: Watson & Crick, 1953)

Approximately 3 billion base pairs in human genome

DNA & RNA

• DNA– Double stranded– Deoxyribose sugar– Purine Bases

• Adenine (A)• Guanine (G)

– Pyrimidine Bases• Cytosine (C)• *Thymine (T)

• RNA– Single stranded– Ribose sugar– Purine Bases

• Adenine (A)• Guanine (G)

– Pyrimidine Bases• Cytosine (C)• *Uracil (U)

9

Chargaff’s Rule

• Within a species the amount of guanine nearly equals the amount of cytosine (same for thymine and adenine)

• Purines bonds with pyrimidines – C = G & T = A

11

• The more similar the base pair amounts are between species, the more closely related they are

Watson and Crick

• Built a model of the double helix based on prior research– Two outside strands consist of

ALTERNATING deoxyribose and phosphate

– Cytosine and guanine pair by THREE hydrogen bonds

– Thymine and adenine pair by TWO hydrogen bonds

14

DNA Structure

• Nucleotides – make up DNA– Consist of deoxyribose, a phosphate

group, and nitrogenous bases

16

NUCLEOTIDES

17

NUCLEOTIDES

• DNA looks like a twisted ladder• Rails are represented by the

alternating deoxyribose and phosphate groups

• Base pairs, C – G & A – T, form the steps

DNA Orientation

• Top rail: strand runs 5’ to 3’• Bottom rail: strand runs 3’ to 5’

Chromosome Structure

• To fit in a cell DNA must coil– DNA coils to form nucleosomes– Nucleosomes coil to form chromatin– Chromatin coil to form chromosomes

• NucleotideDNAnucleosomechromatinchromosome

Bell Ringer

1 - Write the complimentary strand for the following set of bases

5’ ATT/AGG/CTT/ACG/ACC 3’2 - What did Chargaff determine with

his research?3 - Describe how DNA can fit into a

cell

Section 2

Replication of DNA

Semiconservative Replication

• The purpose of replication is to copy the DNA for mitosis.

• Parental strands of DNA separate, serve as templates

• Produce DNA that have one strand of parental DNA and one strand of new DNA

3 Steps of Replication

• 1. UNWINDING• DNA double helix

unwinds and unzips (thanks to DNA helicase) creating two strands.

• 1. LEADING strand is elongated

• 2. LAGGING strand elongates away from the replication fork

3 Steps of Replication

• 2. BASE PAIRING– Appropriate bases are added to the

chain in the 3’ to 5’ direction.» LEADING strand is replicated

continuously» LAGGING strand is replicated in

segments called Okazaki fragments

• 3. JOINING– The Okazaki fragments must be joined

together to complete the strand

Example Problem 1:

Write the complimentary strand for the following set of bases:

5’ ATTAACGCGTAGGCCAATCC 3’

3’ TAATTGCGCATCCGGTTAGG 5’Complimentary Strand

Example Problem 2:Parental Strand:5’ ATTGTGCCGTTAACGGTGC 3’

Bell Ringer 1/9 & 1/10

1. Which of the following sequences are most closely related?

5’ ATTCCGTA 3’5’ GCCCGATG 3’5’ TCGCTATA 3’

2. When looking at DNA nucleotides, which part of the nucleotide determines our genetic makeup?

3. How many chromosomes are created with one DNA molecule?

4. What are the four nitrogenous bases?

12.3 Vocabulary

1. RNA2. messenger RNA (mRNA)3. ribosomal RNA (rRNA)4. transfer RNA (tRNA)5. Transcription6. RNA Polymerase7. Codon8. Translation

Section 3

DNA, RNA, and Protein

Remember That…

• RNA– Single stranded– Has base Uracil (U) instead of thymine

(T) (DNA)– Contains Ribose sugar instead of

deoxyribose (DNA)

3 Types of RNA

• 1. Messenger RNA (mRNA)– Long strands– Formed complimentary to one strand

of DNA– Travels from nucleus to ribosome

• 2. Ribosomal RNA (rRNA)– Makes ribosomes (associates with

protein synthesis)

• 3. Transfer RNA (tRNA)– Smaller segments carrying an

anticodon and an amino acid– Transported to the ribosome– Matched up with mRNA

RNA

Transcription (Process of transferring DNA code to mRNA)

• Occurs in the NUCLEUS• DNA is unzipped (RNA Polymerase),

RNA binds to a SPECIFIC section, and mRNA is synthesized

• DNA code is copied complementary as mRNA

• The code of DNA or mRNA is in segments of three bases called a CODON.

Translation (at a ribosome)

• mRNA moves from the nucleus through the cytoplasm to a ribosome

• mRNA binds to a ribosome• mRNA moves through the ribosome where

the codons are matched up with tRNA’s ANTICODON – compliment to codon.

• tRNA acts as an interpreter of the mRNA CODON sequence.

• As mRNA and tRNA come together an amino acid chain is formed.

• Amino acids fold to form proteins.

The CODE

• Each codon codes for a specific amino acid.

• “Dictionary” of genetic code• AUG – start codon• Pg. 338

The Purpose of Transcription/Translation

• DNA mRNA ribosome tRNA amino acid protein

• Proteins are expressed as the heritable characteristics of an organism.

• http://www.youtube.com/watch?v=NJxobgkPEAo

Bell Ringer 1/11-1/14

1. Name three ways RNA is different then DNA.2. What is the first step of DNA replication?3. What was Chargaff’s contribution to the

scientific world and the study of DNA?4. What is the purpose of both transcription

and translation?5. Convert this strand of DNA into its

complementary mRNA strand. AATCGGATTAC

12.4 Vocab: Gene Regulation, Operon, Mutation, & Mutagen

Bell Ringer 1/15-1/16

1. Describe how mRNA moves through the cell during the process of transcription and translation? (Hint: Where does it start?)

2. What part of a nucleotide is responsible for our genetic variation?

3. How do we get from DNA to amino acids?4. Describe the importance of replication.5. Convert this strand of mRNA to tRNA:

CCGAUUACC

Section 4

Gene Regulation and Mutation

Gene Regulation

• Ensures that:– Genes are used at the right time– proteins are made in the right

amounts• Some proteins help control gene

expression• Gene regulation is crucial during

development

Mutations

• Permanent change in a cell’s DNA• Three examples:

– Point mutations– Insertion– Deletion

Point Mutation

• Point mutation – chemical change in just one base pair– Substitution – one base is exchanged

for another• Types of substitutions

– Missense – DNA code is altered so that it codes for the wrong amino acid

– Nonsense – causes translation to end early

Insertion and Deletion

• Frame Shift – change the multiple of three codons. This shifts the “frame” of the amino acid sequence.– Insertions – additions of a nucleotide

to the DNA sequence– Deletion – loss of a nucleotide to the

DNA sequence

Mutations can cause diseases and disorders

Cause and Effect of Mutations

• Causes of mutations:– X-rays– Gamma rays– UV– Radiation– Toxic chemicals

• Nicotine

*Can occur spontaneously

• Effects of mutations:– Alters proteins– Affects chemical reactions in the body– Structural development– Cancer

Body Cells vs. Sex Cells

• Somatic cells (body cells)– Mutations are not passed on to the

next generation– They participate in mitosis

• Sex cells (gametes)– Mutations are passed on to the next

generation – Mutation will then be present in every

cell (somatic and sex) of the offspring

Bell Ringer 1/17-1/18

• 1. Provide 3 examples that cause mutations. • 2. What is the difference between mutations

in body cells and sex cells?• 3. If DNA were exposed to large amounts of

heat, what could happen?• 4. What type of mutation is demonstrated

below?AATCGGA ATTCGGA

• 5. What is an insertion mutation?

Bell Ringer 1/22 & 1/23

1. What is the purpose of DNA replication?2. What is the purpose of translation and transcription?3. What is a codon?4. Which of these individuals is more closely related?

CGGGTATCTCTCGAGGTTCCCGAA

5. What would happen as a result of this mutation?AUGUUUCGCGCG – original strandAUGUUCGCGCG – mutated strand

Application Practice

• 1. At what temperature is the activity of the DNA enzyme the greatest?

2. What conclusions could you draw about the affect of temperature on this DNA enzyme?

Figure 1

0

20

40

60

80

100

120

0 30 35 40 45 50 55 60 65 70 75 80 85 90 100

Temperature (°C)

Rel

ativ

e A

ctiv

ity

of

DN

A

Lig

ase

(%)

Bell Ringer 1/24 & 1/25

• Get out both your bell ringer and science journal worksheets.

• What is the purpose of replication?• What is the purpose of

transcription and translation? • Study for your Chapter 12 test.