Basics concepts of molecular virology
Transcript of Basics concepts of molecular virology
![Page 1: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/1.jpg)
Basics concepts of molecular virology
Dr Liã Bárbara ArrudaPostdoctoral Research Associate
Centre for Clinical Microbiology
PANDORA-ID-NET Consortium
14 Feb 2020
DIVISION OF INFECTION AND IMMUNITY
CENTRE FOR CLINICAL MICROBIOLOGY
![Page 2: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/2.jpg)
Viruses are just the coolests
![Page 3: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/3.jpg)
Detection of viruses
https://www.who.int/in-vitro-diagnostic/en/
Peeling et al. Nat Rev Microbiol. 2010 Dec;8(12 Suppl):S30-8. doi: 10.1038/nrmicro2459
![Page 4: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/4.jpg)
Polymerase chain reaction (PCR)
![Page 5: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/5.jpg)
PCR components
Nuclease-free water
Buffer
Taq DNA Polymerase*
Taq DNA Polymerase co-factor (Mg++)
dNTPs
Oligonucleotides
Template
![Page 6: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/6.jpg)
Real-time PCR (qPCR)
![Page 7: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/7.jpg)
TaqMan system
![Page 8: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/8.jpg)
TaqMan labels
Rotor Gene 5 plex HRM
Coulour Source (nm) Detector (nm)
Green 470 510
Yellow 530 555
Orange 585 610
370/510 530 510
370/555 530 555
Red 625 660
Crimson 680 710
HRM 460 510
![Page 9: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/9.jpg)
SYBR Green system
![Page 10: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/10.jpg)
Melting curve
Temperature at which 50% of the DNA is denaturated
![Page 11: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/11.jpg)
Template
• Ensure high quality of nucleic acid• Please prevent inhibitors: excess of phenol,
proteinase K, chelanting agents, haemoglobin, SDS, salt
• Please prevent contamination: amplicons and nucleases
• RNA – cannot be used as template for PCR• Synthesis of complementary DNA (cDNA)• RT-PCR = reverse transcriptase PCR
![Page 12: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/12.jpg)
Controls for extraction and amplification
• Positive = sample known to have the targeted region
• Negative = sample known to NOT have the target region (Nuclease free water/blank)
• Spike-in = exogenous nucleic acid added in knwon amount into the tested samples and controls before extraction
• Housekeeping = constitutive gene that is always expressed in the tested organism
![Page 13: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/13.jpg)
Controls for amplification
• Standards = serial diluted positive control
• Reverse transcripte negative (RT-) = control of DNA contamination in RNA samples
• No template control (NTC)/blank = water nuclase free instead of the sample. MANDATORY!
![Page 14: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/14.jpg)
What about the oligos?
• Size ~ 20 base pairs (bp)
• C+G content ~ 50%
• 3’ end should cotain CG
• Similar anneling temperature (Ta)
Ta = Melting temperature (Tm) – 5 °C
Tm = [2 x (T+A)] + [4 x (C+G)]
![Page 15: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/15.jpg)
What you want
5’ 3’
5’
5’
5’
3’
3’
3’
![Page 16: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/16.jpg)
What you want to avoid
• Primer dimer
• Primer hairpin
![Page 17: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/17.jpg)
Reverse complement
5’-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGG-3’
3’-CCTCCGTTGGCAATAGGTGGAGT-5’
5’-ATGGAACACTGGGGGGAGCC-3’
3’-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCC-5’
Primers (5’ > 3’)
Forward: ATGGAACACTGGGGGGAGCC
Reverse: TGAGGTGGATAACGGTTGCCTCC
![Page 18: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/18.jpg)
How can I trust in the literature?
![Page 19: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/19.jpg)
![Page 20: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/20.jpg)
BLAST
• Basic Local Alignment Search Tool• Finds regions of similarity between biological
samples
![Page 21: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/21.jpg)
Identity
• The higher the percent identity is, the more significant the match.
• The percent identity is a number that describes how similar the query sequence is to the target sequence (how many characters in each sequence are identical).
![Page 22: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/22.jpg)
E-value
• The BLAST E-value is the number of expected hits of similar quality (score) that could be found just by chance.
• E-value of 10 means that up to 10 hits can be expected to be found just by chance, given the same size of a random database.
•E-value can be used as a first quality filter for the BLAST search result
![Page 23: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/23.jpg)
Score
• The higher the bit-score, the better the sequence similarity
• The bit-score is the requires size of a sequence database in which the current match could be found just by chance.
• Bit-score does not depend on database size. The bit-score gives the same value for hits in databases of different sizes and hence can be used for searching in an constantly increasing database.
![Page 24: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/24.jpg)
Testing published primers/probe
• Copy only the nucleotides
• Forward primer and probe are in sense direction
• Reverse primer is in reverse complementary direction
![Page 25: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/25.jpg)
Paste in query
Make sure you are using blastn
Make sure you selected nucleotide collection
Make sure you selected the correct organism
collection
Paste forward primer on query
![Page 26: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/26.jpg)
Bottom of the query page
You may chose the default
“Megablast” for this analysis
![Page 27: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/27.jpg)
Addional parameters
You may chose the default paramenters for this analysis.
Click on “?” to learn the function of each paramenter.
Blast it
![Page 28: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/28.jpg)
Output - top page (1 of 3)
![Page 29: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/29.jpg)
Descriptions tab (2 of 3)
Observe:
• Do the organisms belong to the same taxonomical
clade as your query?
• Ideal identity should be ~ 100%
• Ideal e-value should be < 1
![Page 30: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/30.jpg)
Alignments tab (3 of 3)
Observe:
• Although the identity is 100%,
not the entire primer is aligned
to the output sequences
• E-value is too high
Conclusions:
• This primer is poor because it
is not specific to the species
analysed (COVID-19), although
it alignes to other coronavirus
(Pan-coronavirus primer)
• It is specifically poor to be able
to align to as many species
from the clade as possible
• It can generate unespecific
PCR products
![Page 31: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/31.jpg)
Reverse primer
• Must be converted to “reverse complementary” before searching it on the query.
• Copy/paste the reverse primer and “submit” it
• Copy the output and paste on the blastn query
like for the forward primer
• Repeat the analyses
• Input reverse primer
• Output reverse complementary
![Page 32: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/32.jpg)
Reverse primer output
Observe:
• Similar “poor” results as for
the forward primer
Conclusions:
• Pan-coronavirus primer
![Page 33: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/33.jpg)
Repeat the process using the probe
Observe:
• The whole probe is aligned to
the COVID-19 sequence, whith
identity is 100%
• E-value is quite low
Conclusions:
• The probe is specific to COVID-
19
• The set of primers detect
coronavirus in general, while
the probe confers specificity to
detect COVID-19
![Page 34: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/34.jpg)
Designing your own primers/probes
• Use primer-BLAST or any other designing tool
• Always use a Reference Sequence (RefSeq) as template to desing your oligos
• Use GenBank tools to get RefSeqs
• Double-check your designed oligos testing them using the same procedures as described previously
![Page 35: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/35.jpg)
Search for sequences on the nucleotide database
![Page 36: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/36.jpg)
Select preferably RefSeq sequences
RefSeqs are curated whole genome sequences and can be
trusted.
In the absence of a RefSeq, chose a “complete genome
sequence” from a reliable publication.
CLICK
![Page 37: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/37.jpg)
Check the information you know
Check:
• If the size of the complete genome is compatible with
what you learnt
• NC_ accession numbers indicate curated RefSeqs
• Record the accession numbers of all sequences you
are using in your research
• If you do not have a (reference) template sequence, you
will not be able to design your oligos
CLICK
![Page 38: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/38.jpg)
Learn more from the organism genome
Make sure you selected “all features”
to explore all annotated genes and
other information from the RefSeq
genome
![Page 39: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/39.jpg)
Primer-BLAST query (1 of 2)
• Copy/paste the RefSeq accession
number into the query on primer-
blast page
• You can change the settings
according to your choices
• Use “?” to learn more about the
parameters
![Page 40: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/40.jpg)
Primer-BLAST query (2 of 2)
• Make sure you selected the “nr”
database and the correct organism taxid
• To design probes, select “hybridization oligo” on
advanced parameters at the bottom of the page
![Page 41: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/41.jpg)
Addional information
In some cases primer-BLAST may ask
you to confirm addional information to
narrow down the analyses
![Page 42: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/42.jpg)
Predicted oligos output (1 of 2)
A graphical view is given showing the regions
where the predicted primers align
![Page 43: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/43.jpg)
Predicted oligos output (2 of 2)
A few oligo set options will be given. Chose the
best result.
A good oligo set should have:
• GC% (GC content) > 50%
• Similar Tm (melting temperature) for all
oligos in the set
• Self complementarity score near 0.00
![Page 44: Basics concepts of molecular virology](https://reader030.fdocuments.us/reader030/viewer/2022020700/61f42a24f1d4515aac4cdb9b/html5/thumbnails/44.jpg)
Your new best friends
• ViralZone https://viralzone.expasy.org/
• International Committee on Taxonomy of Viruses https://talk.ictvonline.org/taxonomy/
• Pubmed https://www.ncbi.nlm.nih.gov/pubmed/
• GenBank https://www.ncbi.nlm.nih.gov/genbank/
• Blast https://blast.ncbi.nlm.nih.gov/Blast.cgi
[email protected] @libarbaraa_ @PandoraIDNet