Author's personal copy -...

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

http://www.elsevier.com/copyright

Author's personal copy

Characterization of the region of the aryl hydrocarbon receptor required for liganddependency of transactivation using chimeric receptor between Drosophila andMus musculus

Kyoko Kudo a, Takeshi Takeuchi b, Yusuke Murakami c, Masayuki Ebina a, Hideaki Kikuchi a,c,⁎a United Graduate School of Agricultural Sciences, Iwate University, Morioka 020-8550, Japanb Institute of Development, Aging and Cancer, Tohoku University, Sendai 980-8575, Japanc Faculty of Agriculture and Life Science, Hirosaki University, Hirosaki 036-8561, Japan

a b s t r a c ta r t i c l e i n f o

Article history:Received 29 April 2009Received in revised form 17 June 2009Accepted 17 June 2009Available online 25 June 2009

Keywords:Aryl hydrocarbon receptorTCDDMouseDrosophilaHepa-1c1c7S2

The aryl hydrocarbon receptor (AhR) is a ligand-activated transcriptional factor. Although 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is high affinity and toxic to many vertebrate animals, invertebrateAhRs including Drosophila melanogaster AhR (spineless) have no ability to bind exogenous chemicals asligands. To analyze the ligand-binding domain (LBD) of AhR, we used chimeras between mouse and Dro-sophila AhR. The chimeric AhR revealed that the LBD determines constitutive transactivation in DrosophilaAhR or ligand-dependent activation in mouse AhR. The LBD was further divided into three blocks thatcorresponded to amino acids 230–300, 301–361, and 361–420 of the mouse sequence. Six chimeric proteinsclarified that amino acids 291–350 of the Drosophila LBD, i.e. the middle region, were required to keep theprotein in the active form in the absence of ligand binding, whereas in the mouse AhR, this region wasrequired to maintain the protein in the inactive form in the absence of ligand. Furthermore, Arg346 in themiddle region of the mouse LBD, was identified as amino acids that were critical for AhR activation by site-directed mutagenesis.

© 2009 Elsevier B.V. All rights reserved.

1. Introduction

The aryl hydrocarbon receptor (AhR) is a member of the basichelix–loop–helix-Per–Arnt–Sim (bHLH-PAS) superfamily. It is aligand-dependent transcriptional factor that regulates the transcrip-tion of several response genes; the best characterized of which is theCYP1A1 gene, whose product metabolizes exogenous chemicals [1–3].Various environmental pollutants, such as polycyclic aromatic hydro-carbons (PAHs) and halogenated aromatic hydrocarbons (HAHs), bindwith high affinity to AhR [4]. Numerous HAHs, including the AhRligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), have been char-acterized as planar molecules. Exposure to the most potent of thesechemicals produces a wide variety of species- and tissue-specific toxiceffects and can promote the formation of tumors [5–7]. The toxicity ofpollutants has been evaluated mainly according to their ability toactivate the AhR system. It has been proposed that inactive AhRremains in the cytosol. Ligand binding induces the receptor toundergo a series of processes, which involve translocation into thenucleus due to a conformational change in the AhR, association withthe AhR nuclear translocator (ARNT), recognition of xenobioticresponsive elements in the target genes, and induction of transcrip-

tion as mentioned above. Therefore, the binding affinity of pollutantsand the induction of target genes are related to their toxicity [8].Knock-in mice that contain the human AhR, which has a low affinityfor TCDD, are less susceptible to TCDD-inducible toxicity than micethat possess AhRs with a high affinity for TCDD [9].

The PAS proteins are external sensor proteins that are conservedthrough evolution. Many PAS proteins have been identified through-out the animal kingdom from fish tomammals and even flies [10]. PASproteins mediate the signals that regulate circadian rhythm, oxygenbalance, and xenobiotic metabolism [11,12]. The AhR was identified asa bHLH-PAS factor and its signaling mechanism has been studiedextensively. As described above, binding of the ligand to the AhRresults in conformational change, nuclear localization, and transacti-vation [13]. PAS domains, which generally consist of two repeatedmotifs (PAS-A and PAS-B), are important for ligand binding [14]. ThePAS domains of partner PAS proteins interact to allow dimerformation, but in addition, the PAS-B domain of the AhR can bindxenobiotic chemicals [12,15]. The majority of proteins in the PASsuperfamily do not share the ligand-binding ability of the AhR; onlythe FixL, PYP and Met gene products have been reported to bindligands [12,14,16–19]. Although AhR homologs have been found ininvertebrate species, for example Drosophila melanogaster AhR(spineless) and Caenorhabditis elegans AhR, invertebrate AhRs aredifferent from the vertebrate proteins. In fact, Drosophila AhR and C.elegans AhR cannot bind exogenous ligands [20,21]. However,

Biochimica et Biophysica Acta 1789 (2009) 477–486

⁎ Corresponding author. United Graduate School of Agricultural Sciences, IwateUniversity, Morioka 020-8550, Japan. Fax: +81 171 39 3586.

E-mail address: [email protected] (H. Kikuchi).

1874-9399/$ – see front matter © 2009 Elsevier B.V. All rights reserved.doi:10.1016/j.bbagrm.2009.06.003

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta

j ourna l homepage: www.e lsev ie r.com/ locate /bbagrm


Drosophila AhR does form a heterodimer with the Drosophila ARNThomolog (Tango) and activates transcriptionwithout binding a ligand[22,23].

What controls the inherent differences of functions of AhRbetween vertebrate and invertebrate? We questioned whether keyamino acids exist in PAS domain or any factors affect on liganddependency. In this paper, we used chimeras between mouse andDrosophila AhR to narrow the regions and to analyze the aminoacids involved in ligand dependency. The present study showed thatDrosophila AhR had no transactivation activity in Hepa-1c1c7 cells,and that a chimeric AhR, in which the PAS-B domain of the Drosophilaprotein had been introduced into the mouse AhR, exhibitedconstitutive transactivation. Furthermore, we could narrow the regionthat is characteristic in ligand dependency using chimera AhRbetween mouse and Drosophila. These results suggest a molecularmechanism for the differences in the binding of dioxin compoundsbetween species.

2. Materials and methods

2.1. Cell culture

The mouse Hepa-1c1c7 hepatoma cell line was cultured in 5% CO2

at 37 °C in Dulbecco's modified Eagle's medium (Nissui, Tokyo, Japan)that contained 5% fetal bovine serum (Biosource International, Inc.,Camarillo, CA),100,000 U/l penicillin,100 μg/l streptomycin, and 3.7 g/l NaHCO3. The D. melanogaster S2 cell line was generously provided byDr. K. Miura (Mie University, Tsu, Japan). S2 cells were cultured at25 °C in Express Five Serum-free medium (Gibco BRL) that contained9 mM L-glutamine.

2.2. Chemicals

TCDD was obtained from Cambridge Isotope Laboratories (And-over, MA), diluted with DMSO, and used at a final concentration of2 nM.

2.3. Plasmid constructs for chimeric AhR

Dr. Stephen T. Crews (University of North Carolina at Chapel Hill,USA) generously provided the full-length Drosophila AhR (spineless)cDNA, which was described as sscA5 in their report [23,24]. For thereporter gene assays in mouse Hepa-1c1c7 cells, a construct wasgenerated in which Drosophila AhR (dAhR) cDNA, which wastruncated at the N-terminal end and encoded amino acids 36–884,was fused with the Gal4-DNA-binding domain (Gal4-DBD) in themammalian expression vector pFA-CMV (Stratagene, La Jolla, CA). ThecDNA was first amplified by PCR using specific primers (Table 1) andthe PCR product was ligated into pT7 Blue using pT7 Blue PerfectlyBlunt Cloning Kit (Novagen, Inc. Madison, WI). This plasmid DNAwasdigested with SmaI and NcoI and the N-terminal fragment of dAhR inpBluescriptIISK (+) was replaced by the SmaI–NcoI fragment. TheSmaI–HindIII full-dAhR fragment was cut out from the pBSII-dAhRand was ligated into unique cloning sites of pFA-CMV.

To construct the chimera between the mouse and Drosophila AhRgenes, pBSIISK(+) constructs that contained the mouse AhR (mAhR)or dAhR coding sequences were used as PCR templates. Six fragmentsthat corresponded to the DNA-binding (amino acids 36–224 of dAhRand 37–229 of mAhR), ligand-binding (amino acids 225–410 of dAhR

and 230–421 of mAhR), and transactivation (amino acids 411–884 ofdAhR and 422–805 of mAhR) domains of the two AhR proteins wereamplified by PCR using Pfx DNA polymerase (Invitrogen Corp.,Carlsbad, CA). The following reaction conditions were used: an initialdenaturation for 2 min at 94 °C; 35 cycles of denaturation at 94 °C for15 s, annealing at 55 °C for 30 s, and extension at 68 °C for 1 min 30 s.The primers that were used are shown in Table 2. The primary PCRproducts of Drosophila (D) and mouse (M) fragments were purifiedfrom primers before the second step. The overlaps were approxi-mately 20 bases of each primary PCR products, following to combiningand annealing at 72 °C. Secondary PCR of the chain extension reactionwas performed using LA Taq DNA polymerase (TaKaRa Bio Inc. Otsu,Japan)with outer primers (Table 2). The PCR products were subclonedinto pT7-blue. Then, the purified plasmid DNAs were cut with SmaIand NotI in 3′-region of mAhR or SmaI and SacII in 3′-region of dAhR,and the fragments were subcloned into the same unique cloning sitesin the pFA-CMV/mAhRor pFA-CMV/dAhR, respectively. For expressionin S2 cells, the fragments of mAhR or dAhR were subcloned into thesame unique cloning sites in the pAc5.1-V5/HisA vector (InvitrogenCorp., Carlsbad, CA). The sequence of the constructs was confirmed byDNA sequencing using the BigDye Terminator Cycle SequencingReady Reaction Kit (Applied Biosystems, Foster City, CA) andanalyzed on an ABI PRISM DNA sequencer 310 (Applied Biosystems).Six chimeric AhRs were individually named MDD, MMD, DMD, DMM,DDM and MDM.

For further fine mapping of the chimeric protein, pFA-CMV thatcontained the chimeric MDM-AhR was used as the template for eachPCR reaction. To make the additional chimeric Drosophila/mouseexpression plasmids, six fragments that corresponded to the N-terminal (N) (amino acids 225–291 of dAhR and 230–299 of mAhR),middle (M) (amino acids 292–350 of dAhR and 300–361 of mAhR),and C-terminal (C) (amino acids 351–417 of dAhR and 362–420 ofmAhR) regions of the ligand-binding domain (LBD) were amplified byPCR using Pfx DNA polymerase. The same reaction conditions wereused as described above. The primers that were used are shown inTable 3. Heteroduplex synthesis and subcloning were performed asdescribed above. Then, the purified plasmid DNAs were digested withSmaI and NotI, and the fragments were subcloned into the sameunique cloning sites in the pFA-CMV/mAhR plasmid.

2.4. Site-directed mutagenesis

The single point mutants were created using the Gene Tailor™Site-Directed Mutagenesis System (Invitrogen Corp.) [25]. Primerswere designed to introduce the single point mutations. The chimericMDM-AhR sequence from SmaI to NotI site inserted in pBSIISK(+)was used as the template for the PCR reaction by using Fast Taq DNApolymerase (Roche Diagnostics, Mannheim, Germany). The templateDNAwas pretreated with methylase at 37 °C for 60 min. The followingPCR reaction conditions were used: an initial denaturation for 4min at

Table 2Primers for chimeric AhR.

DMD-1 5′- GAAATTCATTGCCAGGAAGCCGCTC -3′DMD-2 (pFA-F) 5′- CAGCATAGAATAAGTGCGAC -3′DMD-3 5′- CGGCGGCAGGGGATCCATTATGGG -3′DMD-4 5′- AGCGGCTTCCTGGCAATTTCC -3′DMD-5 5′- GATGGACCGTCCGAGGAGC -3′DMD-6 5′- TGGATCCCCTGCCGCCGCCGGTGAC -3′DDM-1 5′- TTTGGGTTTTCATCAGTC -3′DDM-2 5′- CGTATTGGCAGAGCGTGGGC -3′DDM-3 5′- CCACGCTCTGCCAATACGCACC -3′DDM-4 (pFA-R) 5′- GACTGTGAATCTAAAATACAC -3′MDD-1 5′- CTGGTTTTCTGCGCCTGGACATC -3′MDD-2 5′- GCTGACCTTGAAGTCCATGG -3′MDD-3 5′- CAGCATAGAATAAGTGCGAC -3′MDD-4 5′- GTCCAGGCGCAGAAAACCAGATG -3′

Table 1Primers for chimeric Gal4-dAhR.

dAhR.SmaIF 5′- GGATCCGCCCGGGCTCGGCATCGGGAGCGC -3′dAhR.1904R 5′- GCTGACCTTGAAGTCCATGG -3′

478 K. Kudo et al. / Biochimica et Biophysica Acta 1789 (2009) 477–486


95 °C; 30 cycles each of denaturation at 95 °C for 30 s, annealing at55 °C for 30 s, and extension at 72 °C for 2 min. All the PCR productswere transformed into DH5α-T1 cells to remove methylated templateDNA. Then, the purified plasmid DNAs was digested with SmaI andNotI, and the fragments were subcloned into the same unique cloningsites in the pFA-CMV/MDM plasmid that contained the Gal4-DBD. Thesequence of the constructs was confirmed by DNA sequencing asdescribed above.

2.5. Reporter gene assay

Cells were cotransfected with 0.1 μg of the pFA-AhR chimeric orpoint mutated constructs, 0.4 μg of the pFR-Luc reporter plasmid(Stratagene), which contained the Gal4-binding site upstream of thefirefly luciferase coding sequence, and 0.2 μg of pCAG-lacZ as aninternal control, which contained the beta-galactosidase codingsequence to check the transfection efficiency. pFA-CMV was used asa negative control plasmid, and the wild-type mAhR expressionconstruct as a positive control. For the S2 cells, the cells werecotransfected with 0.1 μg of the pAct-tgo plasmid, which wasgenerously provided by Dr. Stephen T. Crews [22]. Twenty-fourhours after transfection, the cells were treated with medium thatcontained TCDD at a final concentration of 2 nM or DMSO as a control.The cells were harvested and then lysed with Reporter Lysis Buffer(Promega Corp., Madison, WI). Luciferase activity in the cell extractswas analyzed by using a Luciferase Assay Reagent (Promega Corp.)and a Fluoroskan Ascent fluorometer (Labsystems, Helsinki, Finland).The values in the diagrams represent the mean±SE of threeindependent experiments.

2.6. Preparation of cell extracts and immunoprecipitation

Cell extracts were prepared and immunoprecipitation was per-formed according to a modified version of the method describedpreviously by Backlund et al. [26]. Briefly, Hepa-1c1c7 cells weretransfected with 1 μg of the pFA-CMV constructs, harvested at 48 hafter transfection, and resuspended in 300 μl of cell lysis buffer, whichcontained 20 mM Tris–HCl (pH 7.4), 137 mM NaCl, 10% glycerol, 1%Triton X-100, 2 mM EDTA, 5 mMNaF, 1 mMNa3VO4, 10 mMNa2MoO4,20 μM leupeptin, 10 μg/ml aprotinin, and 1 mM PMSF. The cells werelysed by incubation at 4 °C for 15 min with gentle agitation, and thecell lysate was passed through a 21-gauge needle. The lysates werecentrifuged for 10min at 10,000 ×g. The supernatant (1mg of protein)was precleared by the addition of 2 μl of normal mouse IgG (SantaCruz Biotechnology, Santa Cruz, CA) and 20 μl of Protein A Sepharose(CL-4B; GE Healthcare Amersham Biosciences, plc., Buckinghamshire,UK) followed by incubation for 30 min at 4 °C with gentle agitation. Toimmunoprecipitate the wild-type and mutant Gal4-AhR fusionproteins, 20 μl of anti-Gal4-DBD antibody-conjugated agarose beads(sc-510AC; Santa Cruz) was added to the precleared total cell lysate(1 mg of protein) and the mixture was incubated overnight at 4 °Cwith gentle agitation. The bound complexes were washed twice withimmunoprecipitation buffer (20 mM Tris–HCl, pH 7.4, 137 mM NaCl,1% glycerol, 0.1% TritonX-100, 2 mM EDTA, 5 mM NaF, 1 mM Na3VO4,

10 mM Na2MO4, 20 μM leupeptin, 10 μg/ml aprotinin, and 1 mMPMSF) and then washed twice with wash buffer (20 mM Tris–HCl,pH7.4, 137 mM NaCl, 5 mM NaF, 1 mM Na3VO4, 10 mM Na2MoO4,20 μM leupeptin, 10 μg/ml aprotinin, 1 mM PMSF). Finally, the agarosebeads were resuspended in SDS sample buffer (0.01% bromophenolblue, 2% SDS, 5% sucrose, 62.5 mM Tris–HCl, pH6.8, 5% 2-mercaptoe-hanol) and the immunoprecipitated proteins were analyzed bywestern blotting.

2.7. Western blotting

SDS-PAGEwas performed using a 6% polyacrylamide separating geland a 4% polyacrylamide stacking gel. After electrophoresis, theproteins were transferred to PDVF membrane (GE HealthcareAmersham Biosciences, plc.). The membrane was washed withTween-TBS (50 mM Tris–HCl, pH 8.0, 137 mM NaCl, 2.7 mM KCl and0.05% Tween 20) for 10 min, and then blocked for 1 h in TBS (50 mMTris–HCl, pH 8.0, 137 mM NaCl, and 2.7 mM KCl) that contained 5%skimmed milk (blocking buffer). The membrane was washed twice byagitating in 0.05% Tween-TBS for 10min and incubated overnight withthe antibody against Gal4-DBD (sc-510A; Santa Cruz), which had beendiluted in blocking buffer. To detect the interaction between AhR andTango, we used an antibody against Tango that was generouslyprovided by Dr. Stephen T. Crews [27]. After the membrane had beenwashed twice in Tween-TBS for 1 h, it was incubated for 2 h with anHRP-conjugated antibody against mouse IgG, which had been dilutedin blocking buffer. It was then washed four times with Tween-TBS,each for 15 min. Specific immunoreactive bands were detected usingan enhanced chemiluminescence kit (ECL Advance Western BlottingDetection Kit, GE Healthcare Amersham Biosciences, plc.) and X-rayfilm (Fujifilm Co., Tokyo, Japan).

3. Results

3.1. Design of a chimera between Drosophila and mouse AhRs

To construct the chimeric AhR proteins, we used the full-lengthcDNA sequences for the Drosophila and mouse AhRs, which encodeproteins of 884 (97.7 kDa) and 805 (90.4 kDa) amino acids,respectively [24,28–29]. The similarity between the Drosophila andmouse AhRs at the amino acid level is low and only 30% of the aminoacids are identical. However, they have a slightly higher sequenceidentity (40%) in the region that corresponds to the LBD (amino acids230–421) of mAhR, and amino acids 225–410 of dAhR (Fig. 1A). Inorder to identify the amino acid residues that are involved in ligandbinding in vertebrate AhRs, we prepared chimeric AhRs between thenon-ligand-binding dAhR and the ligand-binding mAhR as shown inFig. 1B. We constructed six chimera in total by exchanging threedomains (DNA-binding, ligand-binding, and transactivation domains)(Fig. 2A).

3.2. Drosophila LBD contributes to constitutive activity but mouse LBDdoes not

To evaluate the ligand dependency of the six chimeric AhRs, weperformed reporter gene assays in mouse Hepa-1c1c7 or DrosophilaS2 cells. As shown in Fig. 2A, the wild-type mAhR and DMMchimeric protein showed ligand-dependent transcriptional activity,but DDM and MDM showed constitutive activity. The AhRs thatcontained the Drosophila C-terminal amino acid sequence, dAhR,MDD, MMD and DMD, could not activate transcription in Hepa-1c1c7 cells. Therefore, it was possible that the Drosophila C terminuscould not interact with a mouse transcriptional cofactor. To test thispossibility, we performed the same experiment using Drosophila S2cells. Fig. 2B shows that the AhRs that contained the Drosophila LBD,such as MDM, DDM and dAhR, were constitutively active. However,

Table 3Primers for chimeric MDM AhR.

mdm-1 5′- CAAAGGGCAGCTTATCCTGGGCTACGCGGAC -3′mdm-2 5′- CTGTAAATCAAGCGCGAGCTCGTCTGCAGCC -3′mdm-3 5′- GTAGCCCAGGATAAGCTGCCCTTTGGCAT -3′mdm-4 5′- CAGACGAGCTCGCGCTTGATTTACAGAAATG -3′dmd-1 5′- CGCGGCAAGCACATTCTGGGCTATACA -3′dmd-2 5′- GTAGACCAGGCGTGCATTGGACTGGAC -3′dmd-3 5′- TAGCCCAGAATGTGCTTGCCGCGCT -3′dmd-4 5′- CAGTCCAATGCACGCCTGGTCTACAAGAAC -3′mAhR.710F 5′- TGA ATGGCTTTGTGCTG -3′mAhR.1967R 5′- AAA ATCAATCCCAAGGT -3′

479K. Kudo et al. / Biochimica et Biophysica Acta 1789 (2009) 477–486


Fig. 1. Alignment of the PAS-B sequences of vertebrate and invertebrate AhRs and domain structure of the mouse and Drosophila AhRs. (A) The PAS-B sequences of vertebrate andinvertebrate AhRs were aligned using the CLC Sequence Viewer 5 software (http://www.soft82.com/download/windows/clc-sequence-viewer/). (B) The AhR contains a bHLH regionthat is involved in dimerization with ARNT and in DNA binding. The PAS domain contains the structural repeats, PAS-A and PAS-B, which are involved in AhR/ARNT dimerization(PAS-A) and binding of the ligand and Hsp90 (PAS-B). The C-terminal Q-rich domain is responsible for the transactivation activity of the AhR. Stars show themouse-AhRmutants thatare described in this paper (G294, I319, C327, A375 and Q377).



the transcriptional activity of DMM, which contained the mouse LBDand transactivation domain (TAD), was ligand-dependent in S2 cells,and the results were similar to those obtained in Hepa-1c1c7 cells.The lower panel of each figure shows the fold increase in luciferaseactivity due to TCDD (luciferase activity in the presence of TCDDdivided by that in the absence of TCDD). These results indicated thatthe mouse LBD was responsible for ligand-dependent transactiva-tion. Fig. 2C shows that full-length chimeric AhR proteins could bedetected by western blotting. These results indicate that specificamino acids within the LBD may be responsible for ligand-dependent or -independent activity. In order to confirm Tangobinding with AhR in S2 cells, we investigated the binding of dAhR toTango by immunoprecipitation (Fig. 2C lower panel, Tgo). Droso-phila AhR and the chimeric DDM-AhR showed a clear interactionwith Tango in S2 cells.

3.3. Analysis of LBD by subdivision of MDM chimeric AhR

In order to analyze the LBD of mAhR, we subdivided the LBD of theMDM chimeric AhR. To construct the chimeric expression constructs,six fragments were produced inwhich three small domains within theLBD were exchanged (Fig. 3A). To evaluate the transactivation activityof these six chimeric AhRs, whichwere namedmdd,mmd, dmd, dmm,ddm and mdm, we performed reporter gene assays. As shown in Fig.3B, mmm, mmd and dmm showed ligand-dependent activity,whereas ddd, mdm, ddm and mdd were constitutively active.Interestingly, comparison of the value of fold induction for mmmwith that for mdm showed that the middle portion of the DrosophilaLBD region had a critical role in constitutive activity. On the otherhand, dmd, dmm, mmd and mmm, which all contained the middleportion of the mouse LBD, did not have transcriptional activity in theabsence of TCDD. The chimeric protein dmd was inactive in theabsence and presence of TCDD. This lack of activity may beattributable to the N- and C-terminal Drosophila domains, whichshowed poor activity in the dmm andmmd chimera, respectively. Thisresult suggests that the middle portion of the Drosophila LBD regionmay be required for ligand-independent transcriptional activity andfor maintaining activity in the absence of a ligand. Fig. 3C shows thatthe levels of protein expression of these chimeric constructs werealmost equal.

3.4. Identification of amino acids in mouse LBD that are responsible forligand-dependent transactivation

Given that the LBD is important for ligand-dependent activity (Figs. 2and 3), we tried to identify which amino acids in the LBD, especially in

themiddle region, playanessential role. Previous reportshave identifiedthe key amino acid residues in the LBD of mAhR as Ile319, Cys327 andAla375 [30–33]. These amino acids are conserved reasonably wellamong vertebrate animals (Fig. 1A). The corresponding amino acids indAhRwere assigned asVal308, Val316andCys364, respectively, and theywere located in a hydrophobic pocket, as shown in Fig. 4A.We searchedfor amino acids that were conserved among vertebrate AhRs, but werenot conserved in theDrosophila and C. elegans proteins.We selected twoaminoacid residues, Gly293 andGln377, in themAhR,whichwere in theregion of the hydrophobic pocket (Fig. 4A).

We introduced point mutations into the chimeric MDM-AhR: theDrosophila amino acids described above were replaced individuallywith those found in the mAhR.We evaluated the mutant AhR proteinsby reporter gene assay. It was expected that the replacement of theseamino acid residues in the chimeric MDM-AhR would change theligand dependency of the protein. Fig. 4B and C shows that the C364A,V316C and S283Q mutations decreased the level of transactivation ofthe reporter gene to that obtained with wild-type mAhR. However,these mutations did not change the ligand dependency from dAhR- tomAhR-type. The V308I mutation did not affect transactivation and theH366Q mutation reduced the activity of the protein markedly. Singlepoint mutations may not be sufficient to change the characteristics ofthe AhR. Therefore, we designed a series of proteins in which multipleamino acids were mutated. These included M2 (H366Q/S283G), M3(H366Q/S283G/V308I), M4 (H366Q/S283G/V308I/C364A), and M5(H366Q/S283G/V308I/C364A/V316C). Fig. 4D shows that the combi-nation of mutations did not alter the transcriptional activity or theligand dependency when compared to the effect of the H366Qmutation alone. Fig. 4E shows that the levels of protein expression ofthe mutational constructs are almost equal but V308I and H366Q waspoor expression.

3.5. Mutation analysis of the LBD region of mouse AhR

The LBD of mAhR is important for ligand-dependent activation, asdescribed above. Jacobs et al. and Procopio et al. have determinedpreviously that an Arg residue in the LBD interacts with the chlorine ofTCDD, and the benzene ring of a Phe residue participates in holding thebenzene ring of TCDD in the hydrophobic pocket [34,35]. Initially, wedesigned a number of mAhR mutants that were point mutated in theLBD, and evaluated them by reporter gene assay (data not shown). Weidentified two amino acids that were involved in transactivation of thereporter gene (Fig. 5A). F345A and R346A showed reduced transcrip-tional activity. This result was in agreement with those shown in Fig. 4.Due to the fact that Phe345 and Arg346 are located in the hydrophobicpocket of AhR, they are the first amino acid residues that have been

Fig. 1 (continued).



reported to be associated with ligand binding. We determined thatPhe345 and Arg346 in mAhR corresponded to Tyr334 and Arg335 indAhR (as shown in Fig. 1, open stars). We therefore tested whetherY334F and R335Amutations in MDM-AhR affected transactivation (Fig.5A, right panel). The Y334Fmutation decreased the level of transactiva-tion of the reporter gene slightly to that obtained with mAhR, whereasthe R335A mutant showed poor activity. Fig. 5C shows the levels ofprotein expression. Although the expression level of the Y334F mutant(the arrow head in the long exposure panel) was low compared withthat of R335A, the activity of Y334F was higher than that of R335A. Fig.5D shows a summary of the functional domains of AhR and the keyamino acid residues that are described above.

4. Discussion

The AhR is a member of the bHLH-PAS superfamily of transcriptionfactors and is widely conserved throughout the animal kingdom.

Interestingly, in many species, the activation of AhR requires bindingto xenobiotic chemicals.

In vertebrate AhRs, the activation mechanism is ligand-dependent[10]. However, in invertebrateAhRs, activation is not ligand-dependentand the proteins are constitutively active, at least in Drosophila andC. elegans [20,21]. In this report, we showed that the functionaldomain that determines ligand-dependent or -independent activitycorresponds to amino acids 300–361 in mAhR. These results are inagreement with previous findings by McGuire et al., whichindicated that the deletion of the LBD (amino acids 230–421)from mAhR resulted in constitutive activation [36]. Moreover, weshowed that a much smaller region (amino acids 300–361) wasessential for ligand binding by swapping this fragment with that ofdAhR, which does not require ligand binding for transactivation.The mouse sequence in this region contributes to ligand-dependentactivation by participating in the ligand-binding site, therefore thissequence may keep mAhR inactive in the absence of ligand.

Fig. 2. Transactivation of a reporter gene by chimeric Gal4-AhR fusion proteins in transiently-transfectedmouse Hepa-1c1c7 (A) or D. melanogaster S2 (B) cells, and expression levelsof the chimeric AhRs (C). Cells were cotransfected with the pFA-CMV/chimeric AhR constructs (0.1 μg), the pFR-Luc reporter plasmid (0.4 μg), and pCAG-lacZ (0.2 μg) as an internalcontrol. We used pFA-CMV plasmid DNA as a negative control and the wild-type mAhR expression construct as a positive control. On the day after transfection, the cells were treatedfor 24 h with 2 nM TCDD (open bars) or DMSO (filled bars) as a control. The luciferase activity of the cell extracts was normalized with respect to β-galactosidase activity. Data areshown as the mean±SD from three independent experiments. The lower panel of each graph shows the fold increase in luciferase activity due to TCDD (luciferase activity in thepresence of TCDD divided by that in the absence of TCDD). (C) Hepa-1c1c7 cells were transfected with 1.0 μg of the pFA-CMV/chimeric AhR constructs. After incubation for 48 h, totalcell extracts were immunoprecipitated using an antibody against Gal4-DBD. The expression level of the Gal4-AhR proteins was analyzed by western blotting using an antibodyagainst Gal4-DBD. The upper panel shows the expression levels of the proteins in Hepa-1c1c7 cells and the lower panel shows their expression levels in S2 cells. The bottom panel forthe S2 cells shows the membrane after it was reprobed with an antibody against Tango (Tgo).



However, we did not investigate the affinity constants of themutants by ligand-binding assay. Further analysis will be necessaryto determine whether the mutants that we examined can bind theligand.

It has been shown previously that the amino acids that areassociated with ligand binding in mAhR are Ala375, Phe318A, Ile319and His320 [30–33]. In the present study, we found that Phe345 andArg346 may have played a critical role in the activation by ligandbinding. Furthermore, the F345A mutant was shown to be localized inthe cytoplasm by fluorescence imaging of an AhR/F345A-YFP (yellowfluorescent protein) fusion protein in COS-1 cells (data not shown) inthe presence of TCDD. Interestingly, the R346Amutant localized to thenucleus (data not shown). These results suggest that Phe345 may beinvolved in nuclear import by ligand-binding activation. On the other

hand, Arg346 may be associated with transcriptional activity. Giventhat Arg346 in mAhR and Arg335 in dAhR were required fortranscriptional activity, these Arg residues were necessary to keepboth of the AhRs in the active form irrespective of the requirement forligand binding. On the other hand, other amino acids had little directeffect on ligand-dependent activity of AhR. In some cases, the amountof protein detected is relatively low. In particular, the fact that theprotein level of V308I and Y334F are lower thanWTmay be caused bydegradation in cell. It is possible that these changes of amino acid inAhR-MDM altered the conformation of the protein and it enhancedthe protein degradation. However the transcriptional activity of theconstructs are relatively high. We may explain this observation asfollows. Because the constitutively active AhR-MDM does not requirethe ligand binding, themutant proteins could initiate the transcription

Fig. 3. Transactivation of a reporter gene by a chimeric LBDwithin themAhR protein. (A) Diagram of chimeric constructs. Six chimeric constructs were generated by exchanging threesmall domains within the LBD, which were designated the N, M and C regions. (B and C) Hepa-1c1c7 cells were cotransfected with the pFA-CMV/chimeric AhR constructs (0.1 μg), thepFR-Luc reporter plasmid (0.4 μg), and pCAG-lacZ (0.2 μg). pFA-CMV and the wild-type mAhR expression construct were used as a negative and a positive control, respectively.Twenty-four hours after transfection, the cells were treated with 2 nM TCDD (filled bars) or DMSO, as a control (open bars). The cells were harvested by the addition of lysis bufferand luciferase activity was measured. Data are shown as the mean±SD from three experiments. The right hand panel of each graph shows the fold increase in luciferase activity dueto TCDD (luciferase activity in the presence of TCDD divided by that in the absence of TCDD). (D) Hepa-1c1c7 cells were transfected with the pFA-CMV/chimeric AhR plasmids (1 μg).After incubation for 48 h, total cell extracts were immunoprecipitated using an antibody against Gal4-DBD. The expression level of the Gal4-AhR proteins was analyzed by westernblotting using an antibody against Gal4-DBD.



Fig. 4. Effect of point mutations within the LBD of the chimeric MDM-AhR protein on the transactivation activity and protein expression level. (A) Schematic representation ofthe 3D structure of the hydrophobic region in the LBD of mAhR. The five arrows indicate the positions of the single point mutations that were introduced into the Gal4-AhRconstruct. This structural model was generated using the program 3D-PSSM (http://www.sbg.bio.ic.ac.uk/~3dpssm/index2.html). The 3D structure was simulated using 800amino acids of the full-length mouse AhR (805 amino acids), and was based on the crystal structure of homologous PAS family members, in particular the PAS-B structure ofhypoxia inducible factor 2α, which has high homology to AhR. (B–D) Hepa-1c1c7 cells were cotransfected with the pFA-CMV/chimeric AhR constructs (0.1 μg), the pFR-Lucreporter plasmid (0.4 μg), and pCAG-lacZ (0.2 μg). pFA-CMV and the wild-type mAhR expression construct were used as a negative and a positive control, respectively. Twenty-four hours after transfection the cells were treated with 2 nM TCDD (filled bars) or DMSO (open bars), as a control, and were harvested by the addition of lysis buffer. Theluciferase activity in the cell extracts was measured. Data are shown as the mean±SD from three independent experiments. (E) Hepa-1c1c7 cells were transfected with pFA-CMV/MDM and the series of mutants that are described in panel D. The expression level of the Gal4-AhR proteins was analyzed as described in the legend for Fig. 3. Specificimmunoreactive bands were detected using an enhanced chemiluminescence kit, ECL Advance Western Blotting Detection Kit (upper panel) and ECL plus Western blottingdetection reagents (lower panel).



promptly and the small amount of protein may be enough to start thetranscription. Again further analysis will be required to determinewhether these mutants can bind the ligand.

As shown in Fig. 2B, dAhR was constitutively active when thereporter gene assay was performed in Drosophila S2 cells. Due to thefact that dAhR required Tango, the homolog of mouse ARNT, foractivity in this assay (data not shown), pAct-Tango was cotransfectedwith pAc5.1-dAhR for the reporter gene assay. This is in agreementwith the previous observation by Emmons et al. [23]. The chimericAhRs that contained the Drosophila TAD, DMD, MMD and MDD,showed reduced levels of activation compared with those thatcontained the mouse TAD. We assume that dAhR requires interactionwith Tango and the TAD of Tango for full activity, due to the weaktransactivation activity of the Drosophila TAD. According to thishypothesis, we can explain the low transactivation level of thechimeric AhRs that contain the Drosophila TAD: the chimeric AhRsthat contain the mouse DBD or LBD (DMD, MMD and MDD) may notbind to Tango efficiently. Drosophila AhR and the chimeric DDM-AhRshowed a clear interaction with Tango in S2 cells. Further analysis isrequired to examine the role of Tango in the transcription complex inS2 cells.

In conclusion, we have identified two molecular mechanismsthat are involved in the ligand-dependent or -independent activa-tion of AhR. Firstly, amino acids 291–350 of dAhR were required toactivate transcription in the absence of ligand. Secondly, the middleportion of the mouse LBD was required to inactivate transcription inthe absence of ligand, and the adjacent N- and C-terminal regionswere required for ligand-dependent activity. It was evident thatArg346 of mAhR and Arg335 of dAhR were required to keep theseproteins in their active forms, irrespective of the requirement forligand binding. Our results support the role of AhR as a sensor ofextracellular signals that induces biological responses, and argue forthe characterization of the conformational state of AhR in the activeor inactive form.

Acknowledgements

We thank Dr. Stephen T. Crews for providing us with the full-lengthDrosophila AhR cDNA used for these studies. We also thank Dr. K.Miura for providing us with S2 cell. This work was supported byGrant-in-Aid for Science Research (B) (No.15310032) from theMinistry of Education, Culture, Sports, Science and Technology

Fig. 5. Effect of point mutations within the LBD of mAhR and MDM-AhR on the transactivation activity (A and B). Hepa-1c1c7 cells were cotransfected with the mutated pFA-CMV/AhR constructs (0.1 μg), the pFR-Luc reporter plasmid (0.4 μg), and pCAG-lacZ (0.2 μg). pFA-CMV and thewild-typemAhR expression construct were used as a negative and a positivecontrol, respectively. Twenty-four hours after transfection, the cells were treated with 2 nM TCDD (filled bars) or DMSO (open bars) as a control. The cells were harvested by theaddition of lysis buffer and luciferase activity wasmeasured. Data are shown as themean±SD from three independent experiments. (C) Hepa-1c1c7 cells were transfected with pFA-CMV/mAhR, pFA-CMV/MDM (1 μg) or the point mutated constructs. The expression level of the Gal4-AhR proteins was analyzed as described in the legend for Fig. 3. Specificimmunoreactive bands were detected using an enhanced chemiluminescence kit, ECL AdvanceWestern Blotting Detection Kit (upper panel) and ECL plusWestern blotting detectionreagents (lower panel). (D) Summary of the functional domains of AhR and key amino acid residues. The novel domain that is essential for determining whether the transactivationactivity is ligand-dependent or -independent was identified as amino acids 291–350 in the Drosophila AhR.



(Monbu Kagakusho). We thank the staff of the Gene Research Center,Hirosaki University for the use of the facility.

References

[1] M.S. Denison, J.M. Fisher, J.P. Whitlock, Inducible, receptor-dependent protein–DNA interactions at a dioxin-responsive transcriptional enhancer, Proc. Natl. Acad.Sci. U. S. A. 85 (1988) 2528–2532.

[2] J.P. Whitlock, S.T. Okino, L. Dong, H.P. Ko, R. Clarke Katzenberg, Q. Ma, H. Li,Cytochromes P450 5: induction of cytochrome P4501A1: a model for analyzingmammalian gene transcription, FASEB J. 10 (1996) 809–818.

[3] J.P. Whitlock, Induction of cytochrome P4501A1, Annu. Rev. Pharmacol. Toxicol. 39(1999) 103–125.

[4] M.S. Denison, S.R. Nagy, Activation of the aryl hydrocarbon receptor by structurallydiverse exogenous and endogenous chemicals, Annu. Rev. Pharmacol. Toxicol. 43(2003) 309–334.

[5] S.H. Safe, Modulation of gene expression and endocrine response pathways by2,3,7,8-tetrachlorodibenzo-p-dioxin and related compounds, Pharmacol. Ther. 67(1995) 247–281.

[6] A. Poland, J.C. Knutson, 2,3,7,8-tetrachlorodibenzo-p-dioxin and related haloge-nated aromatic hydrocarbons: examination of the mechanism of toxicity, Annu.Rev. Pharmacol. Toxicol. 22 (1982) 517–554.

[7] L.S. Birnbaum, The mechanism of dioxin toxicity: relationship to risk assessment,Environ. Health Perspect. 102 (Suppl. 9) (1994) 157–167.

[8] A.B. Okey, M.A. Franc, I.D. Moffat, N. Tijet, P.C. Boutros, M. Korkalainen, J. Tuomisto,R. Pohjanvirta, Toxicological implications of polymorphisms in receptors forxenobiotic chemicals: the case of the aryl hydrocarbon receptor, Toxicol. Appl.Pharmacol. 207 (2005) 43–51.

[9] T. Moriguchi, H. Motohashi, T. Hosoya, O. Nakajima, S. Takahashi, S. Ohsako, Y.Aoki, N. Nishimura, C. Tohyama, Y. Fujii Kuriyama, M. Yamamoto, Distinct responseto dioxin in an arylhydrocarbon receptor (AHR)-humanized mouse, Proc. Natl.Acad. Sci. U. S. A. 100 (2003) 5652–5657.

[10] M.E. Hahn, Aryl hydrocarbon receptors: diversity and evolution, Chem. Biol.Interact. 141 (2002) 131–160.

[11] B.L. Taylor, I.B. Zhulin, PAS domains: internal sensors of oxygen, redox potential,and light, Microbiol. Mol. Biol. Rev. 63 (1999) 479–506.

[12] R.J. Kewley, M.L. Whitelaw, A. Chapman Smith, The mammalian basic helix–loop–helix/PAS family of transcriptional regulators, Int. J. Biochem. Cell. Biol. 36 (2004)189–204.

[13] M.J. Lees, M.L. Whitelaw, Multiple roles of ligand in transforming the dioxinreceptor to an active basic helix–loop–helix/PAS transcription factor coplex withthe nuclear protein Arnt, Mol. Cell. Biol. 19 (1999) 5811–5822.

[14] M.S. Denison, A. Pandini, S.R. Nagy, E.P. Baldwin, L. Bonati, Ligand binding andactivation of the Ah receptor, Chem. Biol. Interact. 141 (2002) 3–24.

[15] S.T. Crews, C.M. Fan, Remembrance of things PAS: regulation of development bybHLH-PAS protein, Curr. Opin. Genet. Dev. 9 (1999) 580–587.

[16] W. Gong, B. Hao, S.S. Mansy, G. Gonzalez, M.A. Gilles Gonzalez, M.K. Chan,Structure of a biological oxygen sensor: a newmechanism for heme-driven signaltransduction, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 15177–15182.

[17] J.L. Pellequer, K.A. Wager Smith, S.A. Kay, E.D. Getzoff, Photoactive yellow protein:a structural prototype for the three-dimensional fold of the PAS domainsuperfamily, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 5884–5890.

[18] M. Ashok, C. Turner, T.G. Wilson, Insect juvenile hormone resistance genehomology with the bHLH-PAS family of transcriptional regulators, Proc. Natl.Acad. Sci. U. S. A. 95 (1998) 2761–2766.

[19] K. Miura, M. Oda, S. Makita, Y. Chinzei, Characterization of the DrosophilaMethoprene-tolerant gene product. Juvenile hormone binding and ligand-dependent gene regulation, FEBS J. 272 (2005) 1169–1178.

[20] R.A. Butler, M.L. Kelley, W.H. Powell, M.E. Hahn, R.J. Van Beneden, An arylhydrocarbon receptor (AHR) homologue from the soft-shell clam, Mya arenaria:evidence that invertebrate AHR homologues lack 2,3,7,8-tetrachlorodibenzo-p-dioxin and beta-naphthoflavone binding, Gene 278 (2001) 223–234.

[21] J.A. Powell Coffman, C.A. Bradfield, W.B. Wood, Caenorhabditis elegans orthologs ofthe aryl hydrocarbon receptor and its heterodimerization partner the arylhydrocarbon receptor nuclear translocator, Proc. Natl. Acad. Sci. U. S. A. 95(1998) 2844–2849.

[22] M. Sonnenfeld, M. Ward, G. Nystrom, J. Mosher, S. Stahl, S. Crews, The Drosophilatango gene encodes a bHLH-PAS protein that is orthologous to mammalian Arntand controls CNS midline and tracheal development, Development 124 (1997)4571–4582.

[23] R.B. Emmons, D. Duncan, P.A. Estes, P. Kiefel, J.T. Mosher, M. Sonnenfeld, M.P.Ward,I. Duncan, S.T. Crews, The spineless-aristapedia and tango bHLH-PAS proteinsinteract to control antennal and tarsal development in Drosophila, Development126 (1999) 3937–3945.

[24] D.M. Duncan, E.A. Burgess, I. Duncan, Control of distal antennal identity and tarsaldevelopment in Drosophila by spineless-aristapedia, a homolog of the mammaliandioxin receptor, Genes Dev. 12 (1998) 1290–1303.

[25] J.C. Shen, W.M. Rideout, P.A. Jones, High frequency mutagenesis by a DNAmethyltransferase, Cell 71 (1992) 1073–1080.

[26] M. Backlund, M. Ingelman Sundberg, Different structural requirements of theligand binding domain of the aryl hydrocarbon receptor for high- and low-affinityligand binding and receptor activation, Mol. Pharmacol. 65 (2004) 416–425.

[27] L. Jiang, S.T. Crews, Transcriptional specificity of Drosophila dysfusion and thecontrol of tracheal fusion cell gene expression, J. Biol. Chem. 282 (2007)28659–28668.

[28] K.M. Burbach, A. Poland, C.A. Bradfield, Cloning of the Ah-receptor cDNA reveals adistinctive ligand-activated transcription factor, Proc. Natl. Acad. Sci. U. S. A. 89(1992) 8185–8189.

[29] M. Ema, K. Sogawa, N. Watanabe, Y. Chujoh, N. Matsushita, O. Gotoh, Y. Funae, Y.Fujii Kuriyama, cDNA cloning and structure of mouse putative Ah receptor,Biochem. Biophys. Res. Commun. 184 (1992) 246–253.

[30] M. Ema, N. Ohe, M. Suzuki, J. Mimura, K. Sogawa, S. Ikawa, Y. Fujii Kuriyama, Dioxinbinding activities of polymorphic forms of mouse and human arylhydrocarbonreceptors, J. Biol. Chem. 269 (1994) 27337–27343.

[31] S.I. Karchner, D.G. Franks, S.W. Kennedy, M.E. Hahn, The molecular basis fordifferential dioxin sensitivity in birds: role of the aryl hydrocarbon receptor, Proc.Natl. Acad. Sci. U. S. A. 103 (2006) 6252–6257.

[32] I.A. Murray, R.K. Reen, N. Leathery, P. Ramadoss, L. Bonati, F.J. Gonzalez, J.M. Peters,G.H. Perdew, Evidence that ligand binding is a key determinant of Ah receptor-mediated transcriptional activity, Arch. Biochem. Biophys. 442 (2005) 59–71.

[33] K. Goryo, A. Suzuki, C.A. Del Carpio, K. Siizaki, E. Kuriyama, Y. Mikami, K. Kinoshita,K. Yasumoto, A. Rannug, A. Miyamoto, Y. Fujii Kuriyama, K. Sogawa, Identificationof amino acid residues in the Ah receptor involved in ligand binding, Biochem.Biophys. Res. Commun. 354 (2007) 396–402.

[34] M.N. Jacobs, M. Dickins, D.F. Lewis, Homology modelling of the nuclear receptors:human oestrogen receptorbeta (hERbeta), the human pregnane-X-receptor(PXR), the Ah receptor (AhR) and the constitutive androstane receptor (CAR)ligand binding domains from the human oestrogen receptor alpha (hERalpha)crystal structure, and the human peroxisome proliferator activated receptor alpha(PPARalpha) ligand binding domain from the human PPARgamma crystalstructure, J. Steroid. Biochem. Mol. Biol. 84 (2003) 117–132.

[35] M. Procopio, A. Lahm, A. Tramontano, L. Bonati, D. Pitea, Amodel for recognition ofpolychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor, Eur. J.Biochem. 269 (2002) 13–18.

[36] J. McGuire, K. Okamoto, M.L. Whitelaw, H. Tanaka, L. Poellinger, Definition of adioxin receptor mutant that is a constitutive activator of transcription: delineationof overlapping repression and ligand binding functions within the PAS domain, J.Biol. Chem. 276 (2001) 41841–41849.

Glossary

AhR: aryl hydrocarbon receptorbHLH-PAS: basic helix–loop–helix-Period–Arnt–SimCYP1A1: Cytochrome P450 1A1TCDD: 2,3,7,8-tetrachlorodibenzo-p-dioxinPAHs: polycyclic aromatic hydrocarbonsHAHs: halogenated aromatic hydrocarbonsARNT: aryl hydrocarbon receptor nuclear translocatorPYP: photoactive yellow proteinMet: Methoprene-tolerantFBS: fetal bovine serumDMSO: dimethyl sulphoxidePCR: polymerase chain reactionEDTA: ethylenediaminetetraacetic acidPMSF: phenylmethylsulfonyl fluoridePVDF: polyvinylidene fluorideHRP: horseradish peroxidaseECL: enhanced chemiluminescenceYFP: yellow fluorescence protein


Author's personal copy -...

Documents

Transcript of Author's personal copy -...