EXON NT CODON DIS SEQUENCE REGION OF PROTEINa REFb

(nucleotide) (protein)5'UTR ~403del98 deletion OHS 5'UTR 15

3 644C>T Q167X substitution nonsense MNK CAA>TAA CuBD 2 53 674insAAAG V177-fs insertion frameshift MNK insAAAG CuBD 2 28

4 798del5 H218-fs deletion frameshift MNK delATCTT CuBD 2-3 54 803del5 L219-fs deletion frameshift MNK delATCTC CuBD 2-3 54 1035delG S297-fs deletion frameshift MNK GAA^AGTACT CuBD 3 274 1173insA Y343X insertion nonsense MNK CTA^TAT>CTATAAT CuBD 3-4 194 1278delA T379-fs deletion frameshift MNK CAA^GAAACT CuBD 4 284 1370C>T R409X substitution nonsense MNK CGA-TGA CuBD 4 284 1377delC L412-fs deletion frameshift MNK TCC^CTT CuBD 4 28

5 1605C>A S487X substitution nonsense MNK TCA>TAA CuBD 5 7

6 1730G>T E529X substitution nonsense MNK GAA>TAA CuBD 5-6 7IVS6 IVS6+1g>a splice-donor MNK GTTgtaag>GTTataag 18IVS6 IVS6+5g>a splice-donor MNK GTTgtaag>GTTgtaaa 18IVS6 IVS6+2del4 splice-donor OHS GTTgtaagtaag 7,18

7 1879C>A C578X substitution nonsense MNK TGC>TGA CuBD 6 287 1893delAG I582-fs deletion frameshift MNK ATA^GAG^TCT CuBD 6 57 1913delAG G590-fs deletion frameshift MNK CAC^AGAGGG CuBD 6 287 1925insT Y594-fs insertion frameshift MNK CTA^TAC>CTA^TTAC CuBD 6 - TM 1 287 1962delT K606-fs deletion frameshift MNK CAT^ATTAAA CuBD 6 - TM 1 28IVS7 IVS7-1g>c splice-acceptor MNK agAGC>acAGC 28IVS7 IVS7+41C>T splice-acceptor same as C2055T 23

8 2030insA E628-fs insertion frameshift MNK GAA^GCT>GAA^GACT CuBD 6 - TM 1 78 2030G>C A629P substitution missense MNK GCT>CCT CuBD 6 - TM 1 288 2055C>G S637X substitution nonsense MNK TCA>TGA CuBD 6 - TM 1 288 2055C>T S637L substitution missense OHS TCA>TTA CuBD 6 - TM 1 238 2078C>T R645X substitution nonsense MNK CGA>TGA CuBD 6 - TM 1 58 2081G>T E646X substitution nonsense MNK GAA>TAA CuBD 6 - TM 1 8

Table 1. ATP7A mutation database.

Electronic supplementary material

TYPE

IVS8 IVS8+1g>c splice-donor MNK ACAgta>ACActa 28IVS8 IVS8+2t>c splice-donor MNK ACAgta>ACAgca 5IVS8 IVS8+2del2 splice-donor MNK ACAgtaagt 28IVS8 IVS8+5g>a splice-donor MNK ACAgtaag>ACAgtaaa 28IVS8 IVS8+5g>c splice-donor MNK ACAgtaag>ACAgtaac 28IVS8 IVS8+6t>g splice-donor MNK ACAgtaagt>ACAgtaag 28IVS8 IVS8dup5 splice-acceptor MNK ataagAT>ataagataagAT 5,28

9 2201delA N686-fs deletion frameshift MNK AAT^CAAAAC TM 1 - TM 2 289 2213G>T E690X substitution nonsense MNK GAA>TAA TM 1 - TM 2 289 2262T>G L706R substitution missense MNK CTT>CGT TM 2 89 2298T>A L718X substitution nonsense MNK TTA>TAA TM 2 209 2317G>T Q724H substitution missense MNK CAG>CAT TM 2 10IVS9 IVS9+5g>c splice-donor MNK 19

10 2324G>A G727R substitution missense MNK GGA>AGA TM 2 2810 2348insT A735-fs insertion frameshift MNK CAG^GCT>CAGGACT TM 2 - TM 3 2810 2429delTT L762-fs deletion frameshift MNK TAC^TCTTTG TM 3 2810 2459del4 R771-fs deletion frameshift MNK GAGAGAGCC TM 3 - TM 4 710 2482del14 T779-fs deletion frameshift MNK CCT^ATTACTTTCTTTGACACACCCCCT TM 4 2810 2528C>T R795X substitution nonsense MNK CGA>TGA TM 4 28IVS10 IVS10+3a>t splice-donor OHS gtaaagt>gttaagt 22

11 2591C>T Q816X substitution nonsense MNK CAA>TAA TD 1711 2642A>G S833G substitution missense OHS AGT>GGT TD 9

12 2653delA Q836-fs deletion frameshift MNK GAA^CAAGTG TD 2712 2763T>G L873R substitution missense MNK CTC>CGC TD 19IVS12 IVS12-2a>g splice-acceptor MNK agGGG>ggGGG 28

13 2831C>T Q896X substitution nonsense MNK CAG>TAG TD 2813 2915C>T Q924X substitution nonsense MNK CAA>TAA TD 28

14 3012G>A W956X substitution nonsense MNK TGG>TAG TM 5 2814 3032delA N963-fs deletion frameshift MNK TTT^CTGAATTTT TM 5 28IVS14 IVS14-4a>g splice-acceptor OHS 6

15 3083delC R980-fs deletion frameshift MNK ATC^TCCCGAACA TM 5 - TM 6 2815 3083C>T R980X substitution nonsense MNK TCC^CGA TM 5 - TM 6 715 3101C>T R986X substitution nonsense MNK CGA>TGA TM 6 2115 3162T>C L1006P substitution missense MNK CTG>CCG TM 6 28

15 3201G>A G1019D substitution missense MNK GGT>GAT TM 6 2815 3219insAT I1024-fs insertion frameshift MNK ATACTA>ATACTATA TM 6 7

16 3386G>T E1081X substitution nonsense MNK GAA>TAA PD - SEHPL 2816 3392insA N1083-fs insertion frameshift MNK AGTAAC>AGTAAAC PD - SEHPL 2816 3438delAG Q1098-fs deletion frameshift MNK AAACAGGTAC SEHPL - ATP 7

17 3498G>A G1118D substitution missense MNK GGT>GAT ATP 817 3636delT I1164-fs deletion frameshift MNK TCC^ATGATTATT ATP 28IVS17 IVS17+5g>a splice-donor mild 6,16

19 3825delC A1227-fs deletion frameshift MNK ATAGCC ATP 1719 3849delA E1235-fs deletion frameshift MNK AAG^CCTGAAGCA ATP 2819 3908G>A G1255R substitution missense MNK GGA>AGA ATP 8

20 4026delA K1294-fs deletion frameshift MNK GAG^GGGAAA ATP 2820 4049G>A G1302R substitution missense MNK GGA>AGA ATP 520 4150delG R1335-fs deletion frameshift MNK ATA^AGGAAT ATP 7IVS20 IVS20-2a>g splice-acceptor MNK agAA>ggAA 5

21 4159delTCT L1339del deletion deletion MNK GATCTTCTGGAT or GATCTTCTGGAT ATP 721 4175insTGCCA S1344-fs insertion frameshift MNK GCA^ATGCCAGT ATP 2821 4177T>A S1344R substitution missense MNK AGT>AGA ATP 721 4178A>T I1345F substitution missense MNK ATT>TTT ATP 721 4230C>T A1362V substitution missense MNK GCT>GTT TM 7 1IVS21 IVS21+3a>t splice-donor MNK 9

22 4277insA M1378-fs insertion frameshift MNK TTT^AATG TM 7 122 4286del10 G1381-fs deletion frameshift MNK CCC^ATTGGTTTGGTTTTGCA TM 7 2822 4346delGT V1400-fs deletion frameshift MNK GTT^TCTGTAGTA TM 8 2822/IVS22 4353del15+IVS22del19 L1402-fs splice-donor MNK CTT^TCTTCTCTCTTAAACTgtaagtatgatagcttttg C-terminus 7IVS22 IVS22+2t>c splice-donor MNK ACTgt>ACTgc 28

23 4497delG K1449-fs deletion frameshift OHS AAA^CTGGGT C-terminus 4

bFull references listed below

aCuBD: copper-binding domain; TM: transmembrane helix; TD: transduction domain; PD: phosphorylation domain; SEHPL: conserved SEHPL motif; ATP: ATP-binding domain

References

13. Levinson B, Packman S, Gitschier J (1997) Mutation analysis of mottled pewter. Mouse Genome 95:163-165.

15. Levinson B, Conant R, Schnur R, Das S, Packman S, Gitschier J (1996) A repeated element in the regulatory region of the MNK gene and its deletion in a patients with occipital horn syndrome. Hum Mol Genet 5:1737-1742.

21. Ozawa H, Kodama H, Murata Y, Takashima S, Noma S. (2001) Transient temporal lobe changes and a novel mutation in a patient with Menkes disease. Pediatrics International 43: 437-440.

22. Qi M, Byers PH (1998) Constitutive skipping of alternatively spliced exon 10 in ATP7A gene abolishes Golgi localization of the Menkes protein and produces the occipital horn syndrome. Hum Mol Genet 7: 465-469.

17. Mak BS, Chi CS and Tsai CR (2002) Menkes gene study in the Chinese population. J Child Neurol 17(4): 250-2.

18. Moller LB, Tumer Z, Lund C, Petersen C, Cole T, Hanusch R, Seidel J, Jensen LR, Horn N (2000) Similar splice-site mutations of the ATP7A gene lead to different phenotypes: classical Menkes disease or occipital horn syndrome. Am J Hum Genet 66:1211-1220.

19. Ogawa A, Yamamoto, S, Takayanagi M, Kogo T, Kanazawa M, Kohno Y. (1999) Identification of the three novel mutations in the MNK gene in three unrelated Japanese patients with classical Menkes disease. J Hum Genet 44:206-209.

20. Ogawa A, Yamamoto S, Kanazawa M, Ogawa E, Takayangi M, Hasegawa S, Kohno Y. (2000) Novel mutation of L718X in the ATP7A gene in a Japanese patients with classical Menkes disease, and four novel polymorphisms in the Japanese population. J Hum Genet 45: 315-317.

1. Ambrosini L, Mercer JFB (1999) Defective copper-induced trafficking and localization of the Menkes protein in patients with mild and copper-treated classical Menkes disease. Hum Mol Genet 8: 1547-1555.

4. Dagenais SL, Adam AN, Innis JW and Glover TW (2001) A novel frameshift mutation in exon 23 of ATP7A results in occipital horn syndrome and not in Menkes disease. Am J Hum Genet 69: 420-427.

5. Das S, Levinson B, Whitney S, Vulpe C, Packman S, Gitschier J (1994) Diverse mutations in patients with Menkes disease often lead to exon skipping. Am J Hum Genet 55: 883-889.

3. Beck J, Enders H, Schliephacke M, Buchwald-Saal M, Tumer Z (1994) X;1 translocation in a female Menkes patient: characterization by FISH. Clin Genet 46: 295-298.

12. Kapur S, Higgins JV, Delp K, Rogers B (1987) Menkes syndrome in a girl with X-autosome translocation. Am J Med Genet 26: 503-510.

14. Levinson B, Packman S, Gitschier J (1997) Deletion of the promoter region of the Atp7a gene of the mottled dapplied mouse. Nat Genet 16:223-224.

16. Levinson B, Gitschier J, Vulpe C, Whitney S, Yang S, Packman S (1993) Are X-linked cutis laxa and Menkes disease allelic? Nat Genet 3:6.

2. Barton NW, Dambrosia JM, Barranger JA (1983) Menkes kinky hair syndrome: report of a case in a female infant. Neurology 33 (Suppl 2), 154.

10. Kaler SG, Buist NRM, Holmes CS, Goldstein DS, Miller RC, Gahl WA (1995) Early copper therapy in classic Menkes disease patients with a novel splicing mutation. Ann Neurol 38: 921-928.

11. Kaler SG, Das S, Levinson B, Goldstein DS, Holmes CS, Patronas NJ, Packman S, Gahl WA 1996) Successful early copper therapy in Menkes disease associated with a mutant transcript containing a small in-frame deletion. Biochemical and Molecular Medicine 57: 37-46.

6. Das S, Levinson B, Vulpe C, Whitney S, Gitschier J, Packman S (1995) Similar splicing mutations of the Menkes/mottled copper-transporting ATPase gene in occipital horn syndrome and the blotchy mouse. Am J Hum Genet 56: 570-576.

7. Gu YH, Kodam H, Murata Y, Mochizuki D, Tanagawa Y, Ushijima H, Shiba T, Lee CC (2001) ATP7A gene mutations in 16 patients with Menkes disease and a patients with occipital horn syndrome. Am J Med Genet 99:217-222.

8. Hahn S, Cho K, Ryu K, Kim J, Pai K, Kim M, Park H, Yoo O. (2001) Identification of four novel mutations in classical Menkes diseas and successful prenatal DNA diagnosis. Molecular Genetics and Metabolism 73: 86-90.

9. Kaler SG, Gallo LK, Proud VK, Percy AK, Mark Y, Segal NA, Goldstein DS, Holmes CS, Gahl WA (1994) Occipital horn syndrome and a mild Menkes phenotype associated with splice site mutations at the MNK locus. Nat Genet 8: 195-202.

24. Tumer Z, Tommerup N, Kreuder J, Craig IW, Horn N (1992) Mapping of the Menkes locus to Xq13.3-q21.2. Hum Genet 88: 668-672.

28. Tumer Z, Lund C, Tolshave J, Vural B, Tonnesen T, Horn N. (1997) Identification of point mutations in 41 unrelated patients affected with Menkes disease. Am J Hum Genet 60:63-71.

23. Ronce N, Moizard MP, Robb L, Toutain A, Villard L, Moraine C (1997) A C2055T transition in exon 8 of the ATP7A gene is associated with exon skipping in an occipital horn syndrome family. Am J Hum Genet 61: 233-238.

25. Tumer Z, Tonnesen T, Bohmann J, Marg W, Horn N (1994) First trimester prenatal diagnosis of Menkes disease by DNA analysis. J Med Genet 31:615-517.

26. Tumer Z, Tonnesen T, Horn N. (1994) Detection of genetic defects in Menkes disease by direct mutation analysis and its implication in carrier diagnosis. J Inher Metab Dis 17: 267-270.

27. Tumer Z, Horn N, Tonnesen T, Christodoulou J, Clarke JTR, Sarkar B (1996) Early copper-histidine treatment for Menkes disease. Nat Genet 12: 11-13.

Sheet1