Aspects of Genetics and Genomics in Cancer Research Li Hsu Biostatistics and Biomathematics Program...
-
date post
19-Dec-2015 -
Category
Documents
-
view
213 -
download
0
Transcript of Aspects of Genetics and Genomics in Cancer Research Li Hsu Biostatistics and Biomathematics Program...
Aspects of Genetics and Genomics in Cancer Research
Li HsuBiostatistics and Biomathematics ProgramFred Hutchinson Cancer Research Center
Outline
• Cancer facts
• Linkage analysis of family studies
• Genome-wide association studies
Etiology of Cancer
• The etiology of cancer is multifactorial, with genetic, environmental, medical, and lifestyle factors interacting to produce a given malignancy.
• The breakthroughs in high throughput genotyping technologies have made it possible for systematically identifying genes that are responsible for disease occurrence.
BRCA1 and Breast Cancer
• BRCA1 (breast cancer 1) is a human gene that belongs to a class of genes known as tumor suppressors, which maintains genomic integrity to prevent uncontrolled proliferation. Variations in the gene have been implicated in a number of hereditary cancers, namely breast, ovarian and prostate. The BRCA1 gene is located on the long (q) arm of chromosome 17 at 38Mb.
Probability of developing breast cancer by age (Chen et al. 2009)
carriers
Non-carriers
Probability of Developing Breast Cancer for BRCA1 carriers
Average Person BRCA1 Carrier
Age 50 2.1%(1.7%-2.7%) 18.8%(8.2%-2.3%)
Age 60 4.1%(3.4-5.0%) 31.3%(14.3%-61.2%)
Age 70 7.2%(6.0%-9.0%) 45.4%(22.7%-74.3%)
Age 80 10.2%(8.4%-12.5%) 54.9%(30.4%-81.4%)
• How was BRCA1 found?
Linkage Analysis
1/2 3/4
1/3 2/4
3/4 3/2 1/4 1/4 1/2 3/2
Assume disease gene (D) is rare with full penetrance
1/2 3/4
1/3 2/4
3/4 3/2 1/4 1/4 1/2 3/2
d/d D/d
d/D d/d
D/d D/d d/d D/d d/d D/d
Linkage Analysis (continued)
• Disease allele (D) originally in chromosome with allele 3
• How often does D co-segregate with allele 3 (non-recombinant)?
Assume disease gene (D) is rare with full penetrance
1/2 3/4
1/3 2/4
3/4 3/2 1/4 1/4 1/2 3/2
d/d D/d
d/D d/d
D/d D/d d/d D/d d/d D/d
Linkage Analysis (continued)
• Disease allele (D) originally in chromosome with allele 3
• How often does D co-segregate with allele 3 (non-recombinant)?– 5 meiosises
• How often is D separated from allele 3 (recombinant)?
Assume disease gene (D) is rare with full penetrance
1/2 3/4
1/3 2/4
3/4 3/2 1/4 1/4 1/2 3/2
d/d D/d
d/D d/d
D/d D/d d/d D/d d/d D/d
Linkage Analysis (continued)
• Disease allele (D) originally in chromosome with allele 3
• How often does D co-segregate with allele 3 (non-recombinant)?– 5 meiosises
• How often is D separated from allele 3 (recombinant)?– 1 meiosis
Likelihood function
• Set a parameter θ which measures the distance between allele 3 and D by how frequently they recombine.
• The likelihood function L(θ) = (1- θ)5 θ
• The maximum likelihood estimate is 1/6
• LOD = log10 L(1/6)/L(1/2)
= 0.63
• LOD for 7 families = 7x0.63 = 4.41
Issues
• Linkage analysis has narrowed down to a region about 1Mb. However it took another four years before the BRCA1 gene was mapped.
• Reduced penetrance, phenocopy, and genetic heterogeneity are among the factors that limit the success of the linkage analysis.
• Relevance of the findings to the population at large.
Genome-Wide Association Studies(GWAS)
• The Human Genome Project began in 1990 and completed in 2003.
Part of sequence from Chromosome 7
• AGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGG • TTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTG • TATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCT • GCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTT • TGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAA • ATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTC • TGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCT • CAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAG • GAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGAT • GGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACA • GTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACA • TCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTT • ATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAA • CTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCC • AGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCA • TGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATT • ACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGT • ATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTA • TTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATT • TAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATA • GTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATA • AGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAA • AAGAAAGAAACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGA • TAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA
Genome-Wide Association Study
• 550,000 SNPs on an array
• 2000 diseased individuals (colon cancer cases) and 2000 normal individuals
• Genotype all DNAs for 550,000 SNPs
• That is 2 billion genotyping!
GWAS on Type 2 Diabetes (Steinthorsdottir et al., 2007, Nature Genetics)
Cases Controls
AA 809 3049 3858
Aa 509 1917 2426
aa 81 305 385
1398 5271 6669
• Expected count for cases if AA is not associated with the disease. First, calculate the frequency of AA genotype in both cases and controls combined:
freq = 3858/6669 = 57.85%
• For 1398 cases, we expect to see 1398*57.85%=809 individuals having genotype AA.
Cases Controls
AA 751 3107 3858
Aa 539 1887 2426
aa 108 277 385
1398 5271 6669
GWAS on Type 2 Diabetes
• The chi-square statistic is calculated by finding the difference between each observed and expected for each cell, squaring them, dividing each by the expected, and taking the sum of the results.
(757-809)^2/809+(3107-3049)^2/3049+…• Compare the value to a standard chi-square distribution
with degrees of freedom (# rows-1)*(# col -1) = 2.• The p-value for this SNP is 6.772e-5.
Issues
• Too many SNPs!
• Identifying gene-gene and gene-environmental interactions are now possible.
• Germline mutations account for only a small portion of cancer cases.
http://envirocancer.cornell.edu/FactSheet/General/fs48.inheritance.cfm
Summary
• The amount of the data that have been generated increases exponentially in the last few years.
• This creates a great demand on efficient and valid computational and statistical methods and tools for picking the needles from a haystack.