As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I...

72
As you come in • Make two lists under the 2 headings: - ‘Features I got from my mum and dad’ - ‘Features I did not get from my mum and dad’

description

What is a ‘gene’? What is a ‘locus’? Write on a post it note…. Stick it on to the chromosome I think a gene is a type of mythical creature with 3 heads…….

Transcript of As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I...

Page 1: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

As you come in

• Make two lists under the 2 headings:- ‘Features I got from my mum and

dad’- ‘Features I did not get from my mum

and dad’

Page 2: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Learning objectives• Recall the differences between

environmental and inherited effects• What is a gene?• How does a gene code for a polypeptide

Success criteriaComplete bracelet models to describe

translation.Take away knowledge of key terms.

Page 3: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

What is a ‘gene’?What is a ‘locus’?

• Write on a post it note….Stick it on to the chromosome

I think a gene is a type of mythical creature with 3 heads…….

Page 4: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 6: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Making DNA• Order the original dna sequence

using colour code.• Make a complimentary strand of DNA

(remember DNA is a double helix)

A = blue T = redC = green G = black

Page 7: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Learning objectives• Be able to describe the genetic code• Explain and compare the structure of

RNA(t and m) and DNA• Explain the preocess of transcription

and splicing.

Page 8: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

The triplet codeGiven that there are four bases in DNA, and these code for 20 amino acids, what is the basis for the genetic code?

If three bases = one amino acid, possible aminoacids = 64 (4×4×4)

The existence of a three-base (triplet) code was confirmed by experiments by Francis Crick and his colleagues in 1961. The triplet code is degenerate, which means that each amino acid is coded for by more than one triplet.

Page 9: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

What is mRNA?When a polypeptide is required, the triplet code of its gene is converted into a molecule of messenger RNA (mRNA).

This process is called transcription and is the first stage of protein synthesis.

Like DNA, mRNA is a nucleic acid, but it differs in that:

it is single stranded, not double stranded

it contains ribose instead of deoxyribose

it contains uracil instead of thymine.

mRNA strand during

transcription

Page 10: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

U A G

tRNAmolecule

Page 11: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Differences between DNA and RNA

• Bases• Structure• Pentose sugar• Where is it

found?• Quantity in cells• Stability?

Page 12: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Transcription and codonsDuring transcription, the mRNA is built up by complementary base pairing, using the DNA as a template. The DNA’s base triplets are converted into mRNA codons.

What are the codons in the mRNA transcribed from this sequence of DNA base triplets?

DNA

mRNA

T A C G C A G A T T A C A U G C G U C U A A U G

The genetic code is non-overlapping: each base is only part of one triplet/codon, and each triplet/codon codes just one amino acid.

Page 13: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

OVERLAPPING

AACGTAAGCACGTTCGCACCCCAAACACAC

EACH CODON CODES FOR ONE AMINO ACID. However these may be the same amino acid.

Page 14: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

What is tRNA?

nucleotides

amino acidattachment site

anticodon

In the cytoplasm, amino acids become attached to transfer RNA (tRNA) molecules. Each tRNA is specific for one amino acid.

Each tRNA molecule has a sequence of three bases called an anticodon. These are complementary to codons on the mRNA molecule.

3’ end

5’ end

hydrogen bond

What is the anticodon for the codon A U G

U A C

Page 15: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

What is translation?Once a molecule of mRNA has been transcribed, it moves out of the nucleus via a nuclear pore.

In the cytoplasm, the mRNA combines with a ribosome – the cellular structure on which the polypeptide chain will be built in a process called translation.

How are the correct amino acids transported to the ribosome, and how are they linked together in the correct order?

mRNA strand

ribosome

Page 16: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 17: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 18: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 19: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 20: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 21: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 22: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 23: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 24: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 25: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 26: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 27: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 28: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 29: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 30: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 31: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 32: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 33: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 34: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 35: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 36: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 37: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 38: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 39: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 40: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 41: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 42: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 43: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 44: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 45: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 46: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 47: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 48: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 49: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 50: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 51: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 52: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 53: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 54: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 55: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 56: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 57: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 58: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 59: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 60: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 61: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 62: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad
Page 63: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Next step in the polypeptide process

• Unwind your double helix• You are going to write the mRNA

sequence to your original DNA strand on your strip of card.

AGCUGUCUAGUAB

C

Page 64: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Next is the tRNA• Write on your tRNA molecules the

anticodons which are complimentary to the codons on your mRNA sequence.

• Next, write down the Amino Acids which are attatched to the specific amino acids.

Page 65: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

AMINO ACID LINKED TO tRNA ANTICODONS

Valine - CAU/ CACAspargine – UUGSerine – AGAGlutamate - CUCPhenylalanine – AAA/AAGLeucine - AAUArganine - GAAProline - GGU

Page 66: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

What happens during translation?tRNA molecules attach to the ribosome, and their anticodons pair up with the appropriate codons on the mRNA.

The amino acids transported by the tRNA link together, and the tRNA molecules then return to the cytoplasm.

The ribosome moves along the mRNA, and amino acids continue to join together until all the codons have been translated and the polypeptide is complete.

Page 67: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Draw a chromosome

SIMILARITIES

DIFFERENCES

Page 68: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

mRNAANDtRNA

Page 69: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

CODONAND

ANTICODON

Page 70: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

DNAANDRNA

Page 71: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Extension ‘ how do genes code for polypeptides?’

Answer this question using the following key words:

Gene complimentary transcribe Ribosome tRNA Amino acids peptide bonds DNA translate mRNA

Page 72: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Learning objectives• What is a gene?• How does a gene code for a

polypeptide

Success criteriaComplete bracelet models to describe

translation.Take away knowledge of key terms.