ars.els-cdn.com · Web view[10] A.P. Feinberg, B. Vogelstein, A technique for radiolabeling DNA...

Evidence of putative non-coding RNAs from Leishmania untranslated regions.

Felipe Freitas de Castro1, Patricia de Cássia Ruy1, Karina Nogueira Zeviani, Ramon de

Freitas Santos, Juliano Simões Toledo, Angela Kaysel Cruz*

Department of Cell and Molecular Biology, Ribeirão Preto Medical School, University

of São Paulo

*Corresponding author: [email protected]. Present address: Department of Cell and

Molecular Biology, Ribeirão Preto Medical School, University of São Paulo, Av. Bandeirantes,

no. 3900, CEP 14049-900 Ribeirão Preto, SP, Brazil. Tel.: +55 16 3602 33181 The authors

contributed equally to this work.

Supplementary Data

Material and Methods

Cell lines and culture conditions

Promastigotes of the L. major LT252 clonal line CC1 (MHOM/IR/83/IR) [1]

and the L. donovani strain 1S2D clonal line BOB (MHOM/SD/62/1S-CL2D) [2] were

maintained at 26°C in M199 medium supplemented as previously described [1].

Sequence alignment analysis

All cDNA clone alignments were performed using the Geneious Read Mapper

algorithm and Geneious software (Biomatters) [3]. An assembled version of the L.

major genome was obtained from the Sanger Institute

(ftp://ftp.sanger.ac.uk/pub/pathogens/ Leishmania /major/V6_211210/ ). The coordinates

for each transcript are provided in Supplementary Table 1 modified from Rastrojo et al.

[4].

RNA-seq library preparation

Libraries were constructed with co-purified RNAs from non-polysomal RNPs

(ribonucleoproteins) from L. donovani. The protocol included an ultracentrifugation

step in a 2 M sucrose cushion and 150,000 × g for 2 hours in a SW41 Ti rotor (Beckman

Optima™ XL-100 K Ultracentrifuge). The supernatant containing the non-polysomal

RNPs was loaded and size fractionated on a Superdex 200 HR 10/30 gel filtration

column (GE Healthcare Life Sciences). Fractions containing ribonucleoproteins were

collected by FPLC (Fast Protein Liquid Chromatography) at a flow rate of 0.5 mL/min.

RNA was extracted from each fraction with TRIzol. The quality of the RNA was

inspected by digital electrophoresis with a Bioanalyzer (Agilent Technologies). A total

of 6 libraries, triplicates from L. donovani promastigotes in log and stationary phases,

were obtained. Paired-end libraries were prepared with a TruSeq® Stranded mRNA

Sample Preparation kit. The manufacturer’s protocol was modified: a poly(A)-RNA

population was not selected, and library fragmentation was not performed. The libraries

were sequenced using MiSeq-Illumina equipment (Ribeirão Preto Medical School

facility).

Computational analyses

ftp://ftp.sanger.ac.uk/pub/pathogens/Leishmania/major/V6_211210/

The L. donovani and L. major version 6.0 from TriTrypDB [15] were used as

reference genomes. From the L. donovani libraries the sequencing adaptor removal was

performed with cutadapt version 1.4.1 [16]. The read quality, size, and quantification

were obtained with FastQC [17]. The software Bowtie2 [18] was used for mapping the

reads and was configured to allow just one alignment mismatch and to not require com-

plete sequence alignment. SAMtools [19] software was used to process the alignment

files, and these results were visualized in Artemis [20]. To highlight the intercoding re-

gions with a high number of mapped reads (putative ncRNAs), an in-house Perl script

was created to obtain a gff file containing only non-CDS regions as features. This modi-

fied gff file1 was the input to the HTSeq [21] program (script htseq-count). For those

non-CDS regions with several discrete peaks, we chose one to test by Northern blotting.

This selection was based on the sequence specificity determined by BLAST [22] analy-

sis against the whole genome.

We used 26 ncRNA candidates from the L. major cDNA library and 37 L.

donovani ncRNA candidates for the in silico analyses conducted (Table S1).

Table S1. ncRNA candidates informations.

Organism Putative ncRNA ID

Predicted Length

(nt)

Start coordinate

End coordinate Annotation Gene

L. major

Lm_ncRNA1 369 28071 28439 3'UTR LmjF.01.0110 (AA741618)Lm_ncRNA2

(ODD1) 224 131881 132104 5'UTR LmjF.06.0390 (W88361)

Lm_ncRNA3 390 497287 497676 intergenic LmjF.06.1255 (AA728072)

Lm_ncRNA4b 357 514696 515052 3'UTR LmjF.06.1300 (AI034537)

Lm_ncRNA5b 439 514704 515142 3'UTR LmjF.06.1300 (AI034621)


Lm_ncRNA7 273 635291 635563 5'UTR LmjF.12.1250 (AA680652)


Lm_ncRNA9a 146 85864 86009 5'UTR LmjF.19.0270 (AI034878)

Lm_ncRNA10 344 62415 62758 5'UTR LmjF.26.0240 (AA741583)Lm_ncRNA11

(ODD3) 114 259871 259984 3'UTR LmjF.26.0890 (AA728081)

Lm_ncRNA12 264 770033 770296 3'UTR LmjF.27.1805 (AI034514)







1 Areas with assembly or annotation errors were manually curated.









L. donovani

Ld_ncRNA1 190 519680 519869 intergenic LdBPK_061340.1_LdBPK_061350.1


Ld_ncRNA3 402 527740 528141 3’ UTR LdBPK_061360.1

Ld_ncRNA4 280 272530 272809 5’ UTR LdBPK_080650.1_1


Ld_ncRNA6 415 46465 46879 intergenic LdBPK_100120.1_LdBPK_100130.1_1
































L. major nucleotide sequence data is deposited in GenBank database under the accession numbers shown in column Gene in brackets. L. donovani raw sequencing data is available in SRA (Sequence Read Archive) database using accession number SRP090024. a - cDNAs (AI034537 and AI034621) have similar coordinates in the same 3’ UTR; b- cDNA expands from intergenic to the 5’ UTR

The same L. major and L. donovani putative ncRNA were submited to a BLAST

analysis to evaluate conservation; the genomes of L. major Friedlin, L. donovani

BPK282A1, L. infantum JPCM5, L. amazonensis MHOMBR71973M2269, L.

braziliensis MHOMBR75M2903, L. tarentolae ParrotTarII, L. enriettii LEM3045, T.

brucei TREU927 (TriTrypDB – version 28) were used for this analysis. A hit was

considered positive with an e-value <10-5. In Table S2, “ok” denotes acceptance of 20

nucleotides difference, “-” denotes no hit found with the mentioned cutoff. For partial

matches a different annotation was used: e.g. (165/197) means that 165 nucleotides

from a given Leishmania species matches the whole sequence of reference species (197

nt).

Table S2. Conservation of ncRNA candidates.

Organism Putative ncRNA ID L. major L.

donovaniL.

infantumL.

amazonensisL.

braziliensisL.

tarentolaeL.

enriettiiT.

brucei

L. major

Lm_ncRNA1 ok ok ok ok (64/449) (52/449) - (50/449)

Lm_ncRNA2 ok ok ok ok ok ok (167/224) -

Lm_ncRNA3 ok ok ok ok (299/390) (324/390) (298/390) -

Lm_ncRNA4 ok ok ok ok (266/357) (287/357) - -

Lm_ncRNA5 ok ok ok ok (266/439) (384/439) - -


Lm_ncRNA7 ok ok ok ok - (80/273) - -

Lm_ncRNA8 ok (76/163) ok (32/163) - - - -

Lm_ncRNA9 ok ok ok ok (73/146) - - -


Lm_ncRNA11 ok - ok - - ok - -

Lm_ncRNA12 ok ok ok (99/264) (32/264) (30/264) (29/264) -

Lm_ncRNA13 ok ok ok (165/197) - (101/197) - -

Lm_ncRNA14 ok ok ok ok - (205/365) (242/365) -

Lm_ncRNA15 ok ok ok ok - - - -


Lm_ncRNA17 ok (336/515) ok ok (82/515) (245/515) - (36/515)


Lm_ncRNA19 ok ok ok ok ok ok - -

Lm_ncRNA20 ok ok ok ok - ok - -





Lm_ncRNA25 ok ok ok ok (180/206) - -

Lm_ncRNA26 ok ok ok ok ok (73/105) - -

L. donovani

Ld_ncRNA1 ok ok ok ok ok ok - -

Ld_ncRNA2 ok ok ok ok (204/586) (223/586) (55/586) -

Ld_ncRNA3 ok ok ok ok (234/402) (377/402) - -

Ld_ncRNA4 ok ok ok ok - - - -

Ld_ncRNA5 ok ok ok ok (50/235) (46/235) (45/235) (45/235)

Ld_ncRNA6 ok ok ok ok (46/415) (58/415) (47/415) (53/415)


Ld_ncRNA8 ok ok ok ok - (294/334) - -



Ld_ncRNA11 (255/505) ok ok ok - (122/505) (39/505) -


Ld_ncRNA13 ok ok ok - - (57/154) - -

Ld_ncRNA14 (253/343) ok ok ok (44/343) (95/343) (63/343) (28/343)




Ld_ncRNA18 (103/127) ok ok ok - - - -

Ld_ncRNA19 ok ok ok ok (63/325) ok - -

Ld_ncRNA20 ok ok ok ok ok ok - -






Ld_ncRNA26 (240/280) ok ok ok - - - -



Ld_ncRNA29 (517/550) ok ok ok (36/550) (50/550) (41/550) (32/550)







Ld_ncRNA36 ok ok ok ok - (205/330) (31/330) -

Ld_ncRNA37 ok ok ok ok ok (38/113) (31/113) (40/113)

The selected regions were tested as putative ncRNAs in silico with four programs

developed for ncRNA identification. The chosen programs were (i) RNAcon, a tool

based on SVM (Support Vector Machine) that uses nucleotide composition to classify a

sequence as coding or not coding. RNAcon further uses IPknot to predict structure and

eventually classify the sequence as one of 18 different ncRNA categories [23]; (ii)

RNAspace, which searches databases of known ncRNA domains [24]; (iii) PORTRAIT,

which uses ab initio methods to evaluate the coding potential of a sequence by SVM

methodology [25] and (iv) snoscan, which uses probabilistic modeling methods to

screen for methylation guide snoRNAs [26] (Table S3).

Table S3. Putative ncRNA in silico prediction

Organism Putative ncRNA ID

PORTRAIT (%) RNASpace RNAcon snoscan

L. major

Lm_ncRNA1 13.47 - catalytic intron -

Lm_ncRNA2 61.29 - - -


Lm_ncRNA4 31.77 - - -

Lm_ncRNA5 38.99 - - -

Lm_ncRNA6 0.13 - - -

Lm_ncRNA7 72.39 - - -

Lm_ncRNA8 91.17 - rRNA -


Lm_ncRNA10 76.08 - - -


Lm_ncRNA12 83.80 - - -

Lm_ncRNA13 95.68 - - -


Lm_ncRNA15 37.24 - IRES ok

Lm_ncRNA16 88.38 - IRES -

Lm_ncRNA17 6.46 snoRNA catalytic intron -


Lm_ncRNA19 82.13 - - ok


Lm_ncRNA21 0.38 - - -

Lm_ncRNA22 55.54 - - ok


Lm_ncRNA24 56.33 - - -


Lm_ncRNA26 79.07 RtT (tyrT operon) rRNA -

L. donovani

Ld_ncRNA1 87.41 - - -

Ld_ncRNA2 30.98 - - -

Ld_ncRNA3 71.62 - catalytic intron -

Ld_ncRNA4 11.67 IRES - -



Ld_ncRNA7 70.56 - rRNA -


Ld_ncRNA9 72.33 - IRES -


Ld_ncRNA11 50.00 - - -





Ld_ncRNA16 82.51 IRES IRES -


Ld_ncRNA18 93.53 snoRNA rRNA -

Ld_ncRNA19 92.00 - IRES -


Ld_ncRNA21 - snoRNA catalytic intron -



Ld_ncRNA24 38.61 tRNA-like structure catalytic intron ok

Ld_ncRNA25 10.95 - - -


Ld_ncRNA27 62.33 Telomerase-like - -


Ld_ncRNA29 59.30 Rnase P IRES -

Ld_ncRNA30 25.51 - signal recognition particle -




Ld_ncRNA34 86.89 - - -

Ld_ncRNA35 65.78 signal recognition particle rRNA -

Ld_ncRNA36 66.09 IRES catalytic intron -


Reverse transcription-Quantitative PCR (RT-qPCR)

RNA was extracted using an adapted protocol. The cells were lysed using

TRIzol reagent (Invitrogen), and the aqueous phase (chloroform fractions) was used for

RNA purification with an RNAqueous Kit (Thermo Fisher Scientific). The extracted

RNA was treated with DNase Turbo (Thermo Fisher Scientific), and PCR was

performed as previously described elsewhere [11] in an ABI 7500 thermocycler

(Thermo Fisher Scientific). The following primers were used for quantification:

Table S4. Primers used for RT-qPCR.Specificity Name 5’-3’ Sequence

LmjF.26.0880 CDS

RTLmjF260880_F ATCCTTTCGTTTTAGGCCCATCRTS16_R CACCGTTCACCTTGATGTTGC

LmjF.26.08803’ UTR

RT3UTRLmjF26.0880_F GAATGGTGGTGGAAAGAGGT

RT3UTRLmjF26.0880_R ACGCAGTCACACACACACAG

LmjF.26.0890 CDS

RTLmjF260890_F GTTAGAGTGAAAGCATCAGCCC

RTS16_R CACCGTTCACCTTGATGTTGC

LmjF.26.08903’ UTR (ODD3)

RTODD3_F GACCGTCAGTCAGTCGGTTAC

RTODD3_R GTGCGGAACAAAATAATGTCAG

Housekeeping gene G6PD [11]

LLG6PD_F ACCGCATTGACCACTACCTC

LLG6PD_R GATGTTGTTCGAGTTCCAC

Housekeeping gene rRNA45 [12]

RTrRNA45_F CCTACCATGCCGTGTCCTTCTA

RTrRNA45_R AACGACCCCTGCAGCAATAC

Each RT-qPCR experiment consisted of three independent biological replicates

with three technical replicates for each. Data were analyzed according to the ΔΔCt

method [13] using the geometric mean of two selected housekeeping genes (G6PD and

rRNA45) for normalization according to the strategy previously described [14]. RT-

qPCR data were analyzed using GraphPad Prism 5 (Prism). Where shown, data

correspond to the means and standard deviations (±SD) from 3 independent

experiments. Statistics were performed using two-way ANOVA with post hoc

Bonferroni tests. Data were considered significant if p<0.05. Asterisks indicate

statistically significant differences in the samples *(p<0.05).

Northern blot analysis

Total RNA was extracted from 4×108 promastigotes using TRIzol according to

the manufacturer's instructions (Invitrogen) and was resolved in an 8% or 4-10%

polyacrylamide-7M urea denaturing gel following standard procedures [5]. The RNA

gels were transferred to Hybond-N+ nylon membranes (GE-Healthcare) and were

hybridized according to standard protocols [6-8].

Probes and hybridization conditions

For Northern hybridization experiments, radiolabeled oligonucleotide probes

were prepared using ATP [gamma-32P] (6,000 Ci mmol-1) (PerkinElmer), T4

Polynucleotide Kinase (New England Biolabs), and a specific primer and end-labeling

DNA protocol [6, 9]. Alternatively, double-stranded DNA probes were prepared using

dCTP [alpha-32P] (3,000 Ci mmol-1) (PerkinElmer), a specific PCR product and the

random priming method [10] with a Ready-To-Go DNA labeling beads Kit (-dCTP)

(GE Healthcare).

Table S5. Description of probes and oligonucleotide sequences.Probe

ID Specificity Name 5’-3’ Sequence

1* 5’ UTR LdBPK_080650.1

LdBPK_080640_LdBPK_080650_F GATCTTTTCTCGCGCGCTACLdBPK_080640_LdBPK_080650_R GAGAGGAGAAGGGGAGGGA

2* 3’ UTR LdBPK_080650.1

LdBPK_080650_LdBPK_080660_F ATGCTTCCATCGCTAGGCTLdBPK_080650_LdBPK_080660_R TGTGTGTCGGGTGGTACTTT

3 3’ UTR LdBPK_300920.1 LdBPK_300920_LdBPK_300930_R GTGTGTGTTTGCTACCCAGG

4 3’ UTR LdBPK_302210.1 LdBPK_302200_LdBPK_302210_F TCCAGATTCAACTCGGCAGA

5Intergenic region

(LdBPK_100120.1/ LdBPK_100130.1)

LdBPK_100120_LdBPK_100130_R CTGCTGGTGTTGCTTCAAGG

6 ODD3 ODD3_antisense1 CGTAATTTTCCTTTCCCT

7 ODD3 ODD3_antisense2 GTGCTTATGTGCGGAACAAAATAATGTC

*- PCR products labeled by random priming.

Primer extension

Primer extension was performed using the Primer Extension System - AMV

Reverse Transcriptase according to the manufacturer’s directions (Promega, Madison,

WI, USA). Briefly, ODD3_antisense1 was labeled using ATP [gamma-32P] (6,000 Ci

mmol-1) and T4 polynucleotide kinase (Promega, Madison, WI, USA). A 32P-end-

labeled primer was hybridized to 2 µg mRNA and extended with Avian Myeloblastosis

Virus Reverse Transcriptase (AMV-RT). Reaction products were resolved on a gel with

10% denaturing polyacrylamide and 7.5 M urea and were visualized by

autoradiography. Two independent experiments were performed with similar results.

Table S6. Sequence of the ODD3 antisense oligonucleotide.Specificity Name 5’-3’ Sequence

ODD3 ODD3_antisense1 CGTAATTTTCCTTTCCCT

Data deposition

RNA-seq data can be accessed from the SRA (Sequence Read Archive) database

using accession number SRP090024.

References

[1] G.M. Kapler, C.M. Coburn, S.M. Beverley, Stable transfection of the human parasite Leishmania major delineates a 30-kilobase region sufficient for extrachromosomal replication and expression, Mol Cell Biol 10(3) (1990) 1084-94.[2] D.M. Dwyer, Antibody-induced modulation of Leishmania donovani surface membrane antigens, J Immunol 117(6) (1976) 2081-91.[3] M. Kearse, R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A. Cooper, S. Markowitz, C. Duran, T. Thierer, B. Ashton, P. Meintjes, A. Drummond, Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data, Bioinformatics 28(12) (2012) 1647-9.[4] A. Rastrojo, F. Carrasco-Ramiro, D. Martín, A. Crespillo, R.M. Reguera, B. Aguado, J.M. Requena, The transcriptome of Leishmania major in the axenic promastigote stage: transcript annotation and relative expression levels by RNA-seq, BMC Genomics 14 (2013) 223.[5] P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal Biochem 162(1) (1987) 156-9.[6] E. Várallyay, J. Burgyán, Z. Havelda, MicroRNA detection by northern blotting using locked nucleic acid probes, Nat Protoc 3(2) (2008) 190-6.[7] E. Southern, Southern blotting, Nat Protoc 1(2) (2006) 518-25.[8] E.M. Southern, Detection of specific sequences among DNA fragments separated by gel electrophoresis, J Mol Biol 98(3) (1975) 503-17.[9] J.S. Toledo, T.R. Ferreira, T.P. Defina, F.e.M. Dossin, K.A. Beattie, D.J. Lamont, S. Cloutier, B. Papadopoulou, S. Schenkman, A.K. Cruz, Cell homeostasis in a Leishmania major mutant overexpressing the spliced leader RNA is maintained by an increased proteolytic activity, Int J Biochem Cell Biol 42(10) (2010) 1661-71.[10] A.P. Feinberg, B. Vogelstein, A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity, Anal Biochem 132(1) (1983) 6-13.[11] T.R. Ferreira, E.V. Alves-Ferreira, T.P. Defina, P. Walrad, B. Papadopoulou, A.K. Cruz, Altered expression of an RBP-associated arginine methyltransferase 7 in Leishmania major affects parasite infection, Mol Microbiol (2014).[12] M. Ouakad, N. Bahi-Jaber, M. Chenik, K. Dellagi, H. Louzir, Selection of endogenous reference genes for gene expression analysis in Leishmania major developmental stages, Parasitol Res 101(2) (2007) 473-7.[13] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res 29(9) (2001) e45.[14] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F. Speleman, Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes, Genome Biol 3(7) (2002) RESEARCH0034.[15] M. Aslett, C. Aurrecoechea, M. Berriman, J. Brestelli, B.P. Brunk, M. Carrington, D.P. Depledge, S. Fischer, B. Gajria, X. Gao, M.J. Gardner, A. Gingle, G. Grant, O.S. Harb, M. Heiges, C. Hertz-Fowler, R. Houston, F. Innamorato, J. Iodice, J.C. Kissinger, E. Kraemer, W. Li, F.J. Logan, J.A. Miller, S. Mitra, P.J. Myler, V. Nayak, C. Pennington, I. Phan, D.F. Pinney, G. Ramasamy, M.B. Rogers, D.S. Roos, C. Ross, D. Sivam, D.F. Smith, G. Srinivasamoorthy, C.J. Stoeckert, S. Subramanian, R. Thibodeau, A. Tivey, C. Treatman, G. Velarde, H. Wang, TriTrypDB: a functional genomic resource for the Trypanosomatidae, Nucleic Acids Res 38(Database issue) (2010) D457-62.[16] M. Martin, Cutadapt removes adapter sequences from high-throughput sequencing reads, in: U.B. Centre, S.U. The Linnaeus Centre for Bioinformatics (Eds.) EMBnet journal, Sweden, 2011, pp. 10-22.[17] S. Andrews, FastQC: a quality control tool for high throughput sequence data, 2010.

[18] B. Langmead, S.L. Salzberg, Fast gapped-read alignment with Bowtie 2, Nat Methods 9(4) (2012) 357-9.[19] H. Li, B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis, R. Durbin, G.P.D.P. Subgroup, The Sequence Alignment/Map format and SAMtools, Bioinformatics 25(16) (2009) 2078-9.[20] K. Rutherford, J. Parkhill, J. Crook, T. Horsnell, P. Rice, M.A. Rajandream, B. Barrell, Artemis: sequence visualization and annotation, Bioinformatics 16(10) (2000) 944-5.[21] S. Anders, P.T. Pyl, W. Huber, HTSeq--a Python framework to work with high-throughput sequencing data, Bioinformatics 31(2) (2015) 166-9.[22] S.F. Altschul, W. Gish, W. Miller, E.W. Myers, D.J. Lipman, Basic local alignment search tool, J Mol Biol 215(3) (1990) 403-10.[23] B. Panwar, A. Arora, G.P. Raghava, Prediction and classification of ncRNAs using structural information, BMC Genomics 15 (2014) 127.[24] M.J. Cros, A. de Monte, J. Mariette, P. Bardou, B. Grenier-Boley, D. Gautheret, H. Touzet, C. Gaspin, RNAspace.org: An integrated environment for the prediction, annotation, and analysis of ncRNA, RNA 17(11) (2011) 1947-56.[25] R.T. Arrial, R.C. Togawa, M.e.M. Brigido, Screening non-coding RNAs in transcriptomes from neglected species using PORTRAIT: case study of the pathogenic fungus Paracoccidioides brasiliensis, BMC Bioinformatics 10 (2009) 239.[26] T.M. Lowe, S.R. Eddy, A computational screen for methylation guide snoRNAs in yeast, Science 283(5405) (1999) 1168-71.[27] D. Eliaz, T. Doniger, I.D. Tkacz, V.K. Biswas, S.K. Gupta, N.G. Kolev, R. Unger, E. Ullu, C. Tschudi, S. Michaeli, Genome-wide analysis of small nucleolar RNAs of Leishmania major reveals a rich repertoire of RNAs involved in modification and processing of rRNA, RNA Biol 12(11) (2015) 1222-55.[28] T. Carver, S.R. Harris, M. Berriman, J. Parkhill, J.A. McQuillan, Artemis: an integrated platform for visualization and analysis of high-throughput sequence-based experimental data, Bioinformatics 28(4) (2012) 464-9.

Supplemental Figures

Figure S1. Alignment of RPS16 genes. Nucleotide alignment between Ribosomal Protein S16 genes using Geneious [3]. Identical nucleotides are shaded in black. Colored arrowed lines depicted different regions of the transcript: blue line indicates CDSs, gray lines indicate UTRs and the red line localizes ODD3 within RPS16 transcript and head-arrow indicates the transcription direction. Numbers represent alignment coordinates.

Figure S2. Workflow analysis of non-polysomal RNA fraction from L. donovani. Preparation and computational analyses of L. donovani RNA-seq libraries.

Figure S3. Intergenic putative ncRNA. Non-polysomal RNA fractions from L. donovani promastigotes in log and stationary phases of axenic culture was extracted, and RNA-seq libraries were constructed and processed as described in the Supplementary Material. Images were generated with Artemis [28]. Representation to scale of intergenic region between LdBPK_100120.1 and LdBPK_100130.1 genes. The black boxes represent the CDS, the gray boxes indicate the UTRs, the stacked black lines represent the mapped reads, and the red box indicates the putative intergenic ncRNA. Northern blotting was performed using RNA extracted from different developmental stages of L. donovani hybridized to probe 5 (Table S5). RNA was resolved on 8% polyacrylamide–7 M urea gels. LOG represents the logarithmic phase (3rd day), and STAT represents the stationary phase (6th day) of axenic promastigote culture.

LdBPK_100130.1LdBPK_100120.1

STATLOG

300 nt –

80 nt –

150 nt –

Intergenic

ars.els-cdn.com · Web view[10] A.P. Feinberg, B. Vogelstein, A technique for radiolabeling DNA...

Documents

Transcript of ars.els-cdn.com · Web view[10] A.P. Feinberg, B. Vogelstein, A technique for radiolabeling DNA...