Applications Tips and Techniques New Products …...AResource for LifeScience Research Number 108...

A Resource for Life Science Research Number 108

BioRadiationsApplications Tips and Techniques New Products

FeaturesNew Aurum™ Plasmid Kits — Performance and Reliability

Increasing the Specificity and Efficiency of Your PCR* Experiments

Proteomics Tools for Neuroscience

Flat Fielding for Beautiful Images

How Customer Support Serves Your Needs

Tips for Isoelectric Focusing

Optimizing Chromatography with pH Scouting

What’s NewProducts for Electrophoresis, Blotting, Chromatography, Protein Arrays, Nucleic Acid Analysis, and More…

Pupal Drosophila ovary with anti-tubulin (red), nanosGa14/UASp-sarcGFP (green), and anti-phosphorylated histone3 (blue). See image gallery on page 46.

Unlimited Growth Potential.

If you want a chromatography system that can expand

with your needs, the BioLogic DuoFlow system is the

answer. Unique modular components provide

functionality to match your current applications, and allow

easy upgrades when your

specifications change. So if your

protocol doesn’t require buffer

blending capabilities, you don’t pay

for them. Buy the components you

need, when you need them.

Whether you’re a novice or an

experienced chromatographer, you’ll

be a DuoFlow expert in no time.

The icon-based program guides

you in creating even complex new protocols

in four simple steps.

Recalling a repeated method is just two steps away.

And the easy-to-use software also allows users to keep

individual projects and files in separate, secure folders.

With open racks and movable bars, the DuoFlow

system’s modular design lets you place valves,

columns, and other components to make efficient

use of your laboratory. So even if you’re short on

space, you won’t be short on options.

Ready for a Change?

Contact Us.

Find out more about the

versatile BioLogic DuoFlow

system by visiting our web site

at discover.bio-rad.com

BioLogic™

Chromatography Systems

Visit us on the Web at discover.bio-rad.comCall toll free at 1-800-4BIORAD (1-800-424-6723); outside the US, contact your local sales office.

The BioLogic DuoFlow™ chromatography system:The system that grows with your research.

Request bulletin 2687on the reader response card.

BioRadiations Volume 108 3

BioRadiations is published byBio-Rad Laboratories, Inc.2000 Alfred Nobel DriveHercules, CA 94547 USA

©2002 Bio-Rad Laboratories, Inc.Copyright reverts to individual authors upon publication. Reprographic copying for personal use is allowed, provided credit is given to Bio-Rad Laboratories.

Bio-Rad SubsidiariesTelephone NumbersAUSTRALIA 02-9914-2800

AUSTRIA (1) 877-8901

BELGIUM 09-385-5511

BRAZIL (21) 507 6191

CANADA (905) 712-2771

CHINA 6305 2255

CZECH REPUBLIC (420) 2-4141-0532

DENMARK 45 4452 1000

FINLAND 09-804-2200

FRANCE 01-4795-6965

GERMANY 089-31884-177

HONG KONG 2789-3300

INDIA 91-124-6398112

ISRAEL 03-951-4127

ITALY 02-21609-1

JAPAN 03-5811-6270

KOREA 822-3473-4460

LATIN AMERICA (305) 894-5950

MEXICO (52) 5-534-2552

THE NETHERLANDS 31-318-540666

NEW ZEALAND 09-415 2280

NORWAY 4723-3841-30

POLAND (48) 22-8126 672

PORTUGAL 351-21-472-7700

RUSSIA 7-095 721-1404

SINGAPORE (65) 272-9877

SPAIN 91-590-5200

SWEDEN 46 (0) 8 55 51 2700

SWITZERLAND 41-0-61-717-9555

UNITED KINGDOM 44-208-328-2000

USA 800-4BIORAD (800-424-6723)

Freephone Numbers forConfocal InformationFRANCE 0800 909190

HOLLAND 0800 022 60 48

GERMANY 0800 180 03 74

BELGIUM 0800 754 89

BIO-RAD LABORATORIES UK0800 181134

departmentsWhat’s New . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

Events Calendar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

Call for Papers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25

Tips and Techniques . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43

@ the Web . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45

Announcement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

New Literature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49

technical reportsQualitative and Quantitative Assessment of Plasmid DNA Isolation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15A Day, C Schneider, L Ottmers, and B Schneider, Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, Lubbock, TX USA

Identification of Nonspecific Products Using Melt-CurveAnalysis on the iCycler iQ™ Detection System . . . . . . . . . . . . . . . . . . . . . . . . . . . 18M Brisson, L Tan, R Park, and K Hamby, Bio-Rad Laboratories, Hercules, CA USA

Combination of 2-D Gel and Liquid-Phase ElectrophoresisSeparations as Proteomic Tools in Neuroscience . . . . . . . . . . . . . . . . . . . . . . . . 26P Davidsson, Department of Clinical Neuroscience, Göteborg University, Mölndal, Sweden

Rapid Chromatography Optimization by pH Scouting Using the New BioLogic Maximizer™ Valve System . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36C Moran, Bio-Rad Laboratories, Hercules, CA USA

product focus articleThe VersaDoc™ Imaging Systems Eliminate Nonuniformitieswith Patent-Pending Flat Fielding Technology . . . . . . . . . . . . . . . . . . . . . . . . . . . 39

feature articleAccessing Customer Services . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

issue:BioRadiations Volume 108, 2002in this

* The polymerase chain reaction (PCR) process is covered by patents owned by Hoffman-LaRoche. Practice of the PCR process requires a license.

to our readersWe hope you enjoy this issue of BioRadiations, our magazine for you, our Life Science customers.You’ll find articles and announcements on research applications and new product releases, andinformation to help you get the most from Bio-Rad’s wide range of products and services. In this issue,we’ve included a feature article on our Customer Service and Technical Support teams, so if you haveany questions or difficulties, you’ll know about the range of options available to help you. And if youhave an application you’d like to share with us and colleagues around the world, see our applicationnote program description on page 25.

Ultimately, we want our magazine to reflect your interests, so please tell us what you think! Fill out theenclosed survey card so we can include your ideas in future issues of BioRadiations.

newwhat’s

4 BioRadiations Volume 108

E. coli protein extract (~300 µg) from Bio-Rad’s ReadyPrep™ 2-D starter kit was loaded onto 11 cm ReadyStrip IPG strips (pH 7–10). A, the sample cup was placed close to the anode terminal; B, a conventional in-gel sample loading protocol was used. The samples were run in the first dimension on aPROTEAN IEF cell, followed by the second dimension on 8–16% linear gradient Criterion™ Tris-HCl precast gels. Gels were stained with SYPRO Rubyprotein gel stain and imaged on a Molecular Imager FX™system.

Ordering InformationCatalog # DescriptionCup Loading Tray165-4050 Cup Loading Tray Set, includes 1 tray base, 1 pair electrodes,

1 pack each large and small replacement cups* 165-4051 Large (150 µl) Replacement Cups, 1 pack (120 count)165-4052 Small (100 µl) Replacement Cups, 1 pack (120 count)165-4053 Movable Electrodes, I pair165-4054 Tray Base, 1

*Note: The cup loading tray is not intended or designed for active or passiverehydration of IPG strips. Please use the appropriate rehydration/equilibration tray(see below) that matches your IPG strip’s length.

PROTEAN IEF System and Accessories165-4000 PROTEAN IEF System, complete, includes basic unit, 7, 11,

and 17 cm focusing tray with lids, 1 pack each of 7, 11, 17 cmrehydration/equilibration trays with lids, 2 pairs of forceps, pack of electrode wicks, mineral oil, cleaning brushes

165-4035 Disposable Rehydration/Equilibration Tray with Lid, 7 cm, 25165-4025 Disposable Rehydration/Equilibration Tray with Lid, 11 cm, 25165-4015 Disposable Rehydration/Equilibration Tray with Lid, 17 cm, 25165-4041 Disposable Rehydration/Equilibration Tray with Lid, 18 cm, 25165-4043 Disposable Rehydration/Equilibration Tray with Lid, 24 cm, 25

For more information, request bulletin 2426 on the readerresponse card.

SYPRO is a trademark of Molecular Probes, Inc.

pH 7 pH 10

pH 7 pH 10

Cup loading.

Conventional loading.

A

B

The new cup loading tray is the perfect accessory to enhance the utility of the PROTEAN IEF cell. Cup loading expands the versatility and range of applications for first-dimension isoelectricfocusing (IEF).

Cup loading is a user-friendly technique that improves IEFseparations at extreme pH ranges, compared to conventional in-gelprotein sample loading methods. The cup loading method involvesplacing a disposable sample cup at a user-selected loading positionalong a rehydrated IPG strip. The protein sample is then loadedinto the sample cup. This method of loading optimizes resolutionand separation of proteins that have isoelectric points at extremepH ranges.

The innovative movable electrode design provides flexibility to run IPG strips from 7 to 24 cm in length. And, combined withReadyStrip™ IPG strips for pH 7–10 or 3–6, or the new micro-rangestrips for pH 6.3–8.3, the cup loading tray delivers the same highcapacity and high throughput as the PROTEAN IEF cell’sconventional focusing trays!

Cup Loading Tray for the PROTEAN® IEF CellAn Effective Tool for Improving Resolution and Separation of Proteins at Extreme pH Ranges

Cup LoadingWell

SampleCup

IPG Strip

LoadProteinSample

Cup loading tray with capacity for up to 12 IPG strips per run. Movable electrodesaccommodate IPG strips from 7 to 24 cm in length.

Schematic diagram of sample loading viaa pipet tip into a disposable sample cuppositioned above an IPG strip.


ReadyStrip™ 3–10 Nonlinear (NL) StripsNow get more resolution over the entire pH 3–10 range on asingle gel. The majority of protein spots in a complex sampleusually focus in the middle range of a pH 3–10 gradient. Thiscrowding of spots often obscures low-abundance proteins.While higher resolution can be achieved with the use of narrow- and micro-range strips, if you need to view the entiresample on a single gel, the nonlinear gradient is your answer.The graph below shows how the pH gradient slope changesacross the length of the nonlinear gel. This change in slopespreads out areas with crowded spots while compressing theless populated acidic and basic regions.

2-D separations of identical protein samples after first-dimension IEF on different IPG strips. A, first-dimension separation on pH 3–10 strip; B, first-dimension separation on pH 3–10 NL strip.

pH 5 pH 6 pH 7 pH 8pH 4

8.3

Nobody else has this range!The new Bio-Rad micro-range ReadyStripIPG strips deliver high-resolution results overthe broadest pH range available.

5.1

30% overlapLess redundancybetween gels

5.9

Broad total pH range More data from 4 gelsInnovative gradient overlaps

3.94.7

6.75.56.3

Increase your 2-D focusing power with the new ReadyStrip micro-range gradient strips. Three gradients spanning 1 pH unit andone gradient spanning 2 pH units cover the range of pH 3.9–8.3. No other strips deliver this level of resolution over such a broadrange with a total of only four strips. We also built efficiency into our gradient overlaps so you can match gels with minimal dataredundancy. This saves time and expense, and increases throughput.

ReadyStrip™ 18 cm StripsReadyStrip 18 cm IPG strips, which fit in the PROTEAN® IEFcell as well as other manufacturers’ focusing cells, are availablein the entire range of pH gradients to meet your needs.

100x ReadyStrip™ BuffersBio-Lyte® ampholytes are now available in special blends for ReadyStrip IPG strips. Manufactured with proprietarychemistry, these buffers offer optimal focusing for eachReadyStrip gradient. Conveniently packaged in 1 ml vials at100x concentrations, they can simply be diluted to 1x withyour sample to achieve the recommended 0.2% ampholyte.Bio-Lyte 3/10 ampholyte is recommended for both broad and narrow IEF gradients. For optimal focusing of basic and micro-range gradients, use the ReadyStrip buffer formulationwith the specific pH range for your strip.

A B

10

9

8

7

6

5

4

30 5 10 15

pH

Length, cm

ReadyStrip™ IPG Strips and BuffersReadyStrip™ IPG Micro-Range Gradient Strips

Ordering InformationReadyStrip IPG Strips, 12 per Package NEWpH Range 7 cm 11 cm 17 cm 18 cm3–10 163-2000 163-2014 163-2007 163-20323–10 nonlinear (NL) 163-2002 163-2016 163-2009 163-20334–7 163-2001 163-2015 163-2008 163-20343–6 163-2003 163-2017 163-2010 163-20355–8 163-2004 163-2018 163-2011 163-20367–10 163-2005 163-2019 163-2012 163-20373.9–5.1 163-2028 163-2024 163-2020 163-20384.7–5.9 163-2029 163-2025 163-2021 163-20395.5–6.7 163-2030 163-2026 163-2022 163-20406.3–8.3 163-2031 163-2027 163-2023 163-2041

Catalog # DescriptionReadyStrip Buffers163-2094 100x Bio-Lyte 3/10 Ampholyte, 1 ml163-2093 100x ReadyStrip 7–10 Buffer, 1 ml163-2098 100x ReadyStrip 3.9–5.1 Buffer, 1 ml163-2097 100x ReadyStrip 4.7–5.9 Buffer, 1 ml163-2096 100x ReadyStrip 5.5–6.7 Buffer, 1 ml163-2095 100x ReadyStrip 6.3–8.3 Buffer, 1 ml

newwhat’s

Criterion™ Staining TraysTired of endless tray washing — but not ready to throw away yourcostly staining trays? Worried about impurities left behind byprevious staining? The new Criterion™ staining/blotting trays arelow-cost, semi-disposable trays specifically designed for stainingCriterion gels or performing western blot detection. Lightweight,compact, and stackable, the tray dimensions are designed foroptimal Criterion gel staining and blot detection, providing aworking volume of approximately 500 ml. Lids and spouts alloweasy pouring without unnecessary gel handling. Leave tedious traywashing and oversized trays behind!

Ordering InformationCatalog # Description345-9920 Criterion Staining/Blotting Trays, 12 trays with lids

Criterion™ Gel with IPG+1 Well Comb2-D in a day has never been easier! With the revolutionary, easy-to-use Criterion system you can now load an 11 cm ReadyStrip™

IPG strip and molecular weight standards on a single Criterionprecast gel. The new Criterion gels with IPG+1 combs combineexcellent spot resolution with the convenience of a standards lane.

Get the fast, excellent 2-D results you need with the completeCriterion precast gel system for 11 cm strips.

Ordering InformationCatalog # Description345-0101 10%, Tris-HCl, IPG+1 Comb345-0102 12.5%, Tris-HCl, IPG+1 Comb345-0103 4–15%, Tris-HCl, IPG+1 Comb345-0104 4–20%, Tris-HCl, IPG+1 Comb345-0105 8–16%, Tris-HCl, IPG+1 Comb345-0106 10.5–14%, Tris-HCl, IPG+1 Comb345-0107 10–20%, Tris-HCl, IPG+1 Comb

Coomassie is a trademark of Imperial Chemical Industries.

IPG+1IPG+1

IPG+1

E. coli lysate separated on a ReadyStrip IPG strip, pH 4–7, run on a Criterion 12% Tris-HCl gel with Precision Plus Protein™ standards at 200 V for 60 min, andstained with Bio-Safe™ Coomassie stain.

Membrane SandwichesBlotting made easier — Preassembled sandwiches save time and effort during western blot preparation. Two sheets of thick filter paper and a blotting membrane have been precutand assembled into a sandwich that fits a Criterion™ gel (8.5 x 13.5 cm) or a Ready Gel®/Mini-PROTEAN® II-size gel(7 x 8.5 cm). Membrane sandwiches are available in 0.2 and0.45 µm nitrocellulose for western blotting, Sequi-Blot™

PVDF for protein sequencing, and now also Immun-Blot®

PVDF for western blotting.

Ordering InformationCatalog # Description162-0238 Immun-Blot PVDF/Filter Paper Sandwich, 8.5 x 13.5 cm, 20 pack162-0239 Immun-Blot PVDF/Filter Paper Sandwich, 8.5 x 13.5 cm, 50 pack162-0218 Immun-Blot PVDF/Filter Paper Sandwich, 7.5 x 8.5 cm, 20 pack162-0219 Immun-Blot PVDF/Filter Paper Sandwich, 7.5 x 8.5 cm, 50 pack

For more information on membrane sandwiches and completeordering information, request bulletin 1939 on the readerresponse card.


Filter Paper

Membrane

Filter Paper

Gel


Certified™

Agarose PowdersNow Bio-Rad offers a complete line ofadvanced agarose powders for nucleic acidelectrophoresis. Our new line of agarosepowders is genetic quality tested (GQT) to ensure confidence for both routineseparations and downstream molecularbiology applications. Select a Certified

specialty agarose to suit yourparticular research needs and optimize your results.

Product

Certified molecularbiology agarose

Certified PCR agarose

Certified low rangeultra agarose

Certified megabaseagarose

Certified low-meltagarose

Certified PCR low-meltagarose

Description

General-purpose agarose ideal for routine separations from ~500 bp to 20 kb. Used tomake 0.8% and 1% ReadyAgarose™ gels.

High-strength agarose that provides high resolution for small fragments. Recommended forseparation of DNA fragments 20–1,000 bp.

Gives exceptional resolution of small fragmentsand primers (~10–200 bp)

Provides high gel strength, high electrophoreticmobility, and high exclusion limit ideal for CHEFand FIGE applications.

Low melting point agarose with a high resolvingcapacity for DNA fragments ≥1,000 bp.Recommended for preparative electrophoresisand in-gel applications. Also excellent for embedding chromosomes and megabase-sizedDNA for pulsed field applications.

Agarose with high sieving capacity that yieldsexcellent resolution of fragments <1,000 bp in alow-melt or preparative format. Ideal for digestionby agarase and all in-gel applications.

Catalog # Quantity

161-3100 25 g161-3101 125 g161-3102 500 g

161-3103 25 g161-3104 125 g161-3105 500 g

161-3106 25 g161-3107 125 g

161-3108 25 g161-3109 125 g161-3110 500 g

161-3111 25 g161-3112 125 g

161-3113 25 g161-3114 125 g161-3115 500 g

Immun-Star™ HRP Chemiluminescence KitSee more with less! Bio-Rad now offers chemiluminescence detectionkits for both AP and HRP enzyme formats. The new Immun-StarHRP chemiluminescence kit is a highly sensitive, fast-actingalternative to isotopic detection that gives you stronger signal withless sample. The Immun-Star HRP kit features: • Detection to low picogram levels• 24 hours of working solution stability at room temperature • Signal duration of 6–8 hours• Short exposure times• Compatibility with both nitrocellulose and PVDF • Stripping and reprobing options

Ordering InformationCatalog # Description Substrate Antibody TBS Tween 20 Blocker170-5040 Substrate only, 500 ml •

170-5041 Substrate only, 100 ml •

170-5042 GAR-HRP detection reagents • •

170-5043 GAM-HRP detection reagents • •

170-5044 GAM-HRP detection kit • • • • •

170-5045 GAR-HRP detection kit • • • • •

170-5046 GAR-HRP conjugate, 2 ml •

170-5047 GAM-HRP conjugate, 2 ml •

Detection kits include 500 ml substrate, 2 ml conjugate, 1 L 10x TBS, 75 g of nonfat dry milk, and 15 ml Tween 20. Detection reagents include 500 ml substrate and 2 ml conjugate.

For more information on both HRP and AP chemiluminescence detection kits, request bulletin 2050 on the reader response card.

Tween is a trademark of ICI Americas, Inc.

newwhat’s

iQ™ Supermix for Real-Time PCR ApplicationsBio-Rad’s new iQ supermix is specially formulated to help youachieve unrivaled results in real-time PCR, and is qualified for usewith the iCycler iQ™ real-time detection system. This supermixwill accelerate your research, facilitating the optimization of yourreactions in the shortest time possible. • 2x reaction mix certified for use in real-time PCR assays• Demonstrated performance with genomic DNA — linear

response over 4 orders of magnitude • Demonstrated performance with plasmid DNA — linear

response over 6 orders of magnitude • Consistent quality from the real-time PCR experts

Amplification of the IL-1β gene from human genomic DNA. Serial dilutions of humangenomic DNA (10-fold from 500 ng to 50 pg) were amplified using gene-specific primers.

iTaq™ DNA Polymerase for Conventional PCR ApplicationsiTaq DNA polymerase is a hot-start DNA polymerase suitable formany PCR applications and is qualified for use with the iCycler™

thermal cycler. The hot-start attribute is mediated through a specific antibody. The enzyme is activated after an initial 3 minutedenaturation step at 95°C, which ensures ease of use and highspecificity.

Ordering InformationCatalog # DescriptionFor Conventional PCR170-8870 iTaq Polymerase, includes 250 U polymerase,

10x PCR buffer, MgCl2 solution170-8872 MgCl2 Solution, 1.25 ml of 50 mM MgCl2170-8874 dNTP Mix, 200 µl of 10 mM each dNTP

For Real-Time PCR170-8860 iQ Supermix, 100 x 50 µl reactions170-8862 iQ Supermix, 500 x 50 µl reactions

To see data generated using iQ supermix and iTaq DNApolymerase, visit our web site at www.bio-rad.com/iCycler(select “What’s New”). For more information, request bulletins2779 and 2764 on the reader response card.

Introducing PCR* and Quantitative PCR Reagents


New Primer and Probe Design Software for the iCycler iQ SystemIf you use the iCycler iQ system, you can now take advantage ofthis easy-to-use, comprehensive software package for real-timePCR assay design. Beacon Designer software from PREMIERBiosoft International is a probe and primer design package thatmakes designing probes effortless for important applications suchas multiplex gene expression analysis and allelic discrimination.• Designs optimal TaqMan probes, molecular beacons, and

primers • Screens for secondary structure and calculates thermodynamic

properties• Avoids cross-homologies using multiplex function• Designs allelic discrimination assay probes for mutant and

wild-type alleles• Integrated to the Web for quick Entrez retrieval and BLAST

searches

Molecular beacon design interface in Beacon Designer software.

Beacon Designer is available with the iCycler iQ real-time PCR detection system. Contact your local Bio-Rad office for more information.


Real-Time PCR Software New iCycler iQ™ SoftwareAccelerates Assay Designand Data AnalysisGradient Feature Minimizes Assay Optimization TimeNow you can use the valuablegradient feature of the iCycler iQsystem for optimization of real-timePCR experiments. The innovativedesign of the iCycler gradient allowsevaluation of multiple reactionconditions at each gradienttemperature. The gradients arehighly reproducible and are recordeddirectly in the data file for reviewduring data analysis and forinclusion in data reports.

New Allelic Discrimination Feature Is Remarkably FlexibleIn addition to automating real-time PCR analysis, the iCycler iQsoftware also offers the most comprehensive allelic discriminationpackage ever. Researchers may select Threshold Cycle mode orRFU mode to initiate the automatic calling of sample types. Allsample type assignments are easily editable.

The iCycler iQ software allows all data parameters to beanalyzed in manual mode at any time, ensuring maximum controlover results while offering flexibility for individual preferences ofmany users.

As always, the software comprehensively reports all data analysisevents so you can be confident in the integrity of the results.

Automatic Data Analysis Generates Instant ResultsThe iCycler iQ software, the most sophisticated analysis packagefor real-time PCR, now enables researchers to speed time to resultswith automatic data analysis features. Upon completion of the real-time PCR run, automatic data analysis presents results immediately.This saves valuable research time and allows new users to becomeproficient with data analysis more quickly.

This release of software also includes: • Entry of sample names or numbers for each sample well • Post-run editing of sample identifier, sample type, and

concentration • Enhanced customization of amplification graph options, including

sample trace colors • More comprehensive reports, including sample protocol and

plate layouts

This is the most significant feature upgrade to the iCycler iQsoftware yet. Contact your local Bio-Rad office to arrange for anupgrade today.

* Practice of the patented polymerase chain reaction (PCR) process requires alicense. The iCycler thermal cycler and iCycler iQ system include a licensed thermalcycler and may be used with PCR licenses available from Applied Biosystems.

TaqMan is a trademark of Roche Molecular Systems, Inc. Molecular beacons andtheir use are licensed under patents and patent applications owned by The PublicHealth Research Institute of the City of New York, Inc.

Gradient temperatures may bereviewed during data analysis toeasily compare optimization results.

Allelic discrimination options, including automated analysis, accelerate results whilemaintaining maximum flexibility.

Optimal data results may be achieved quickly with comprehensive automatic data analysis.

SEQueaky Kleen™ H2O Dye Terminator Removal KitDye terminator removal is one of the primary cleanup objectivesbefore sample addition onto either a slab-gel or capillary automated

sequencer. The SEQueakyKleen H2O kit has a newproprietary size exclusionmatrix, fully hydrated andslurried in pure water andprepacked into a 96-well filter plate. Much easier,faster, and more reliable touse than traditional ethanolprecipitation methods,SEQueaky Kleen H2Ominimizes handling anddelivers purified samplesready to use in a 96-wellmicrotiter plate.

Performance features:• Removal of unincorporated dye terminators,

including BigDye version 3.0 (Applied Biosystems)• Elimination of dye blobs• Maximum signal strength and read lengths• Parallel processing of sequencing reactions• Rapid and simple protocol — 4 minutes to purity!

Ordering InformationCatalog # Description

732-6500 SEQueaky Kleen H2O Kit, 2 pack732-6505 SEQueaky Kleen H2O Bulk Pack, 50 units

For more information, request bulletin 2656 on the reader response card.

newwhat’s

BioFrac™ Fraction CollectorExpand Your Application Capabilities!The new BioFrac fraction collector is a menu-driven,programmable, microliter to liter fraction collector that offersreliable, accurate operation. Numerous off-the-shelf and customrack options increase the variety of experimental applicationssupported by this innovative fraction collector. The hardwaredesign allows quick setup, while the programming providesversatility in sample fraction management, from simple“Collect All” mode to peak cutting and concentration ofmultiple samples. The BioFrac fraction collector integratesseamlessly with BioLogic DuoFlow™ chromatography systems,yet can be easily set up to run as a stand-alone fractioncollector, enhancing any chromatography system.

Off-the-Shelf Rack CompatibilityWith off-the-shelf racks you can collect directly into thecontainer that works best for your storage and assay needs.Off-the-shelf racks are:• Available for a wide assortment of tube sizes

and configurations• Useful for sample storage• Autoclavable for easy maintenance• Economical• Packaged flat, using little storage space, and easily

assembled in seconds

Custom Rack OptionsThe ice bath/microplate rack provides dualfunctionality in a single unit with:• Ice held in the rack tub while test tubes are held

securely in place with the ice bath insert• 120-tube capacity• Snap rings to securely hold 12–13 mm tubes for quick

one-step decanting • Capacity to securely hold 4 microplates or microtiter

tube plates• Collection in 12-, 24-, 48-, or 96-well microplates, from

standard to deep-well collection plates

The Prep-20 rack adds the capability of:• Collecting up to 20 fractions at a time, in vessel sizes

ranging from small bottles to large carboys• Collection flow rates as high as 100 ml/min


Ordering InformationCatalog # Description

BioFrac Fraction Collector741-0002 BioFrac Fraction Collector, 110 V, includes rack set F1,

diverter valve, fittings kit, power cord, instructions

741-0010 Rack Set F1, 2 x flatpack, each holds 90 tubes, 12–13 mmdiameter, for total of 180 tubes per collection

741-0011 Rack Set F2, 2 x flatpack, each holds 60 tubes, 15–16 mmdiameter, for total of 120 tubes per collection

741-0012 Rack Set F3, 2 x flatpack, each holds 40 tubes, 18–20 mm,for total of 80 tubes per collection

741-0013 Rack Set H1, 4 x flatpack, each holds 42 capless 1.5 mlmicrotubes, for total of 168 microtubes per collection

741-0014 Rack Set H2, 4 x flatpack, each holds 63 capless 0.5 mlmicrotubes, for total of 252 microtubes per collection

741-0015 Rack Set H3, 4 x flatpack, each holds 30 reduced-volumescintillation vials, 16 mm diameter, for total of 120 vials percollection

741-0016 Rack Set H4, 4 x flatpack, each holds 6 scintillation vials, 30 mm diameter, for total of 24 vials per collection

741-0020 Rack Set H4-Tall, 4 x flatpack, each holds 6 centrifuge tubes, 30 mm diameter, for a total of 24 tubes per collection

741-0017 BioFrac Ice Bath/Microplate Rack, holds 120 tubes, 12–13 mm diameter; microplate rack feature allows use of up to 4 MP96 format microplates in 96-, 48-, 24-, or 12-well configurations; Titertube® collection can be done using an 8 x 12, 96-tube configuration

741-0018 BioFrac Prep-20 Preparative Rack

741-0007 BioFrac Fraction Collector Fittings Kit, includes replacementfittings and tubing for setup of the fraction collector to theBioLogic LP™ or BioLogic DuoFlow systems

Tubes223-9750 Clear Polystyrene Tubes, 13 x 100 mm, 9 ml nominal capacity,

1,000/box

223-9751 Natural Polypropylene Tubes, 13 x 100 mm, 9 ml nominalcapacity, 1,000/box

223-9500 Capless Micro Test Tubes, 1.5 ml, polypropylene, natural, foruse with micro tube adaptor, 500/box

For more information, request bulletin 2711 on the readerresponse card.

Reliable Operation and Easy Programming Enable Daily Fraction Collection with ConfidenceCollection and programming features of the BioFrac fraction collector include:• Time, volume, and drop collection modes • Collection of peaks by peak detection, time windows (up to 20),

or a combination of peak detection and time windows • Large panel display to facilitate quick programming when

method building • Automated control through BioLogic DuoFlow software • Connection of non-Bio-Rad pump and UV monitors via optional

BioFrac accessory and system cables, transmitting start/stop andfraction advance signals

• Methods Library to store up to 20 user-defined collection methods• On-the-fly editing that allows immediate changes during

a method run• An Overlay function that pools fractions for efficient sample

concentration


newwhat’s

Bio-Plex Manager™ Support ofLuminex InstrumentsAttention Luminex 100 Users!Did you know that Bio-Plex Manager software supports Luminex 100 instruments? Now, with several installation options available, you can run Bio-Plex Manager on any Luminex systemand take advantage of its powerful assaytemplate setup, system operation, and dataanalysis features. For more information oninstallation options, contact your local Bio-Rad sales representative.

The World’s Most Powerful Multiplex Protein ArraySystem Just Got Better! With fully integrated system hardware, software, calibration and validation kits, and the widest array of multiplex assays, the Bio-Plex™ protein array system with Bio-Plex Manager software hasestablished itself as the premier multiplex protein array system on themarket. And now Bio-Plex Manager just got better! Many newfeatures and functions for analyzing multiplex data from the Bio-Plexsystem have been added to Bio-Plex Manager version 2.0, including:• Bead map and histogram to monitor and evaluate bead

read progress• 5-parameter logistic (5-PL) regression methods for improved

standard curve generation• Printing of report tables and standard curves for all analytes at once• Automatic, onboard data analysis to eliminate the tedium of

accessory template files• Recovery settings to determine the accuracy of your standard

curve and calculated concentrations• An enhanced interface for selecting analytes

New Bio-Plex Manager Desktop VersionBio-Plex Manager is now available in a desktop version to permitthe analysis of Bio-Plex results on any computer configured with aWindows 98, 2000, or NT operating system. You can analyze datausing all the features available in the version of Bio-Plex Managerthat controls the Bio-Plex array reader; however, the Bio-PlexManager desktop is not designed to control the Bio-Plex system.Network desktop software versions are also available for thesimultaneous analysis of data files on multiple computers linkedthrough a common server. For more information on Bio-PlexManager and the Bio-Plex protein array system, visit us on theWeb at bio-rad.com/bioplexsystem/

Ordering InformationCatalog # Description171-001002 Bio-Plex Manager Desktop Software171-001003 Bio-Plex Manager Network Desktop Software, 5-user license171-001004 Bio-Plex Manager Network Desktop Software, 10-user license171-001005 Bio-Plex Manager Network Desktop Software, 20-user license

Luminex 100 is a trademark of the Luminex Corporation. Windows is a trademarkof Microsoft Corp.

Bio-Plex Manager™ Software Upgrade

Standard curve plotand data table

Bio-Plex bead mapand histogram


calendarevent


✃C

ut a

long

the

dot

ted

line

to s

ave

this

cal

enda

r

Below is a list of conferences that will have Bio-Rad representatives available on-site. For an updated list of conferences and other events, visit our web site at discover.bio-rad.com and click on “events”. Contact your local Bio-Rad representative to let us know of other events of interest to you.

Conference Exhibit Dates Location

Ceramic Hydroxyapatite Seminar May 10 Tokyo, JapanLaborama May 15 Liege, BelgiumWaterside Conference — Monoclonal Antibodies May 19–22 Savannah, GA, USAMicrobiology May 20–23 Salt Lake City, UT, USATransgenic BioProcessing May 23–24 Savannah, GA, USAPathologen Kongress May 23–25 Vienna, AustriaShared Healthcare Supply Services Labfest 2002 May 28–29 Toronto, CanadaLaborama May 29 Gent, Belgium

American Society for Mass Spectrometry June 2–6 Orlando, FL, USAInternational Conference on Functional Genomics and Proteomics June 5–7 Munich, Germany Proteomics June 6–7 San Diego, CA, USATagung der Deutschen Milchwirtschaft June 10–11 Munich, GermanyCanadian Federation of Biological Societies June 12–15 Montreal, CanadaInstitute of Food Technologists June 15–19 Anaheim, CA, USAPrep 2002 June 16–19 Washington, DC, USAAnti-Aging Conference June 24–26 SingaporeMikromethodentagung June 24–27 Munich, GermanyJoint Microscopy Meeting June 24–28 Lille, FranceBioTech Kongress, BW Landesjubiläum June 27 Heidelberg, GermanyEuropean Life Scientist Organisation/Société Française de Biologie Cellulaire June 30–July 2 Nice, France

Japanese Neuroscience Society July 7–9 Tokyo, JapanMicroScience 2002 July 9–11 London, UKVirginia Tech/Fralin Biotechnology Center July 18–20 Blacksburg, VA, USA

Microscopy and Microanalysis Aug 4–8 Quebec City, CanadaDrug Discovery Aug 4–9 Boston, MA, USAScaling Up from Bench to Clinic and Beyond Aug 14–16 San Francisco, CA, USAProtein Society Annual Symposium Aug 17–21 San Diego, CA, USA

Methods of Protein Structure Analysis Sept 8–12 Valencia, Spain The Botanical Society of Japan Sept 21–23 Kyoto, JapanDrei Länder Tagung Lebensmittelhygiene Sept 24–27 Garmisch, Germany Österreichische Gesellschaft für Molekularbiologie & Gentechnologie Sept 16–18 Salzburg, Austria

Biotech Malaysia Oct 2–4 Kuala Lumpur, MalaysiaGenome Sequencing and Analysis Conference/TIGR Oct 2–5 Boston, MA, USAInt’l Symposium on Preparative and Industrial Chromatography and Allied Techniques Oct 6–9 Heidelberg, GermanyJapan Biochemical Society Oct 14–17 Kyoto, JapanNew Jersey Science Teachers Association Oct 15–16 Somerset, NJ, USAR&D in Life Sciences Oct 15–18 Basel, SwitzerlandWest Virginia Science Teachers Association Oct 17–19 Charleston, WV, USAMaryland Association of Science Teachers Oct 18 Urbana, MD, USANational Science Teachers Association, Eastern Area Oct 24–26 Louisville, KY, USACalifornia Science Teachers Association Oct 24–27 San Francisco, CA, USAMetropolitan Association of College and University Biologists Oct 26 Brooklyn, NY, USA4th HUGO Pacific Meeting and 5th Asia-Pacific Conference on Human Genetics Oct 27–30 Pattaya, Chonburi, ThailandBio Med Asia Oct 28–30 SingaporeASME Bioprocess Technology Seminar Oct 28–Nov 1 San Diego, CA, USAJapan Bioimaging Society Oct 30–Nov 1 Nagoya, JapanNational Association of Biology Teachers Oct 30–Nov 2 Cincinnati, OH, USA

Request bulletins 2664, 2665, and2668 on the reader response card.

Visit us on the Web at www.bio-rad.comCall toll free at 1-800-4BIORAD (1-800-424-6723); outside the US, contact your local sales office.

AurumTM Plasmid Purification Kits Combine Performance and Technology.

No Limits on High-ThroughputPlasmid Purification

Aurum kits use a new methodology in membrane-based plasmid purification to streamline routine high-throughput sample preparation.Using patent-pending binary technology, lysate filtration and plasmid DNA binding are performed in a single step, vastly improving efficiency, throughput, and fidelity of small-scale parallel processing of up to 96 different samples. Aurum kits are adaptable to both vacuum and spin formats, as well as robotic and manual platforms. For the most reliable well-to-well and plate-to-plate performance,Aurum plasmid kits produce highly purified samples with the fewest handling steps. For more information on Aurum kits, see our web site at www.bio-rad.com/aurum/

IntroductionSmall-scale isolation and purification of plasmidDNA from E. coli bacterial strains is a widelyused and essential technique in molecularbiology laboratories. With the rapid pace ofmolecular research, it is vitally important thatplasmid DNA isolation and purificationprotocols and commercially available kits satisfyfour criteria — they should be reliable, efficient,reproducible, and cost-effective. We conductedan extensive test of Bio-Rad’s new Aurum™

miniprep and midiprep plasmid DNA isolationkits. We conclude that these kits satisfy all of theabove criteria.

MethodsBacterial strains were transformed with 1 µl of 10 pg/µl of various plasmids by electroporation(Bio-Rad Gene Pulser® electroporator), and platedto LB plates containing 100 µg/ml ampicillin(Amp). Single colonies were grown to saturationovernight in 3 ml of liquid LB containing 100 µg/ml Amp for minipreps, or 30 ml of thesame medium for midipreps. Densities of thecultures were determined according to the Aurumprotocol, and 12 OD•ml* or 50 OD•ml of eachculture were used for plasmid purification forminiprep and midipreps, respectively. Plasmidconcentrations were quantitated with Bio-Rad’sHoechst dye 33258 DNA quantitation kit andVersaFluor™ fluorometer. Plasmid quality wasassessed by four criteria: restriction digests,transformation efficiency with both bacterial andyeast hosts, and sequencing. Restriction digestswere done on 500 ng of plasmid in 20 µl withEcoRI (NEB) for 2 hr at 37°C. Digests wereresolved on 0.7% agarose TAE gels. Bacteria weretransformed as described above. Yeast weretransformed by either a standard lithium acetateprotocol (Gietz and Woods 1994) or byelectroporation with 100 ng of plasmid. DNAsequencing was performed directly on 100 ng ofplasmid with 1 pmol of primer by a centralizedcore facility under standard conditions (availableon request).

Qualitative and Quantitative Assessment of Plasmid DNA IsolationAudra Day, Colette Schneider, Lisa Ottmers, and Brandt L Schneider, Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, Lubbock, TX 79430, USA

ResultsA wide variety of E. coli strains are frequently usedfor the propagation of plasmids. We have foundthat certain bacterial strains and certain plasmidpurification kits can result in poor plasmid yield or poor plasmid quality. Therefore, we assessed theyield and quality of plasmids isolated from 14common laboratory E. coli strains with the newAurum miniprep and midiprep kits. We testedboth endA- and endA+ bacterial strains becauseboth the quality and quantity of plasmid DNAisolated from endA+ strains can be poor. The yieldsfrom these experiments are summarized in Tables1 and 2. On average, ~20 µg and 120 µg of plasmid

*Bacterial GrowthGuidelinesAurum plasmid mini and midi kits can process up to 12 OD•ml and 50 OD•ml,respectively, of bacterial culturegrown in a variety of differentbroths, such as LB (Luria-Bertani broth), LBG (LB + 2%glycerol), TB (Terrific Broth), and2x YT. The quantity of bacteriaprocessed in a purificationprocedure, measured inOD•ml, was determined asfollows: First, a sample ofculture was diluted 1:20 bycombining 50 µl of bacterialculture with 950 µl of sterilebroth. The optical density ofthis sample at λ = 600 nm(OD600) was multiplied by 20 to calculate the density of theoriginal undiluted culture.Depending upon the OD600, aspecific volume of the undilutedculture was selected to providean appropriate quantity ofbacterial cells for processing.Appropriate volumes of culturewere calculated using thefollowing equation:

*(OD600 of undiluted culture†) x(culture volume in ml) =#OD•ml

For example, 12 OD•ml ofbacteria would require 2 ml ofan undiluted culture with anOD600 of 6, or 4 ml of a culturewith an OD600 of 3.†1 OD600 is equivalent toapproximately 8 x 108 cells/ml


Table 2. Yield of plasmid from E. coli cultures usingthe Aurum midiprep plasmid isolation kit. All prepswere from 50 OD•ml of culture grown in LB Amp medium.

Strain, Source Plasmid endA Yield (µg)

SCS110, Stratagene pB678 – 81pB679 – 136

XL1-Blue, Stratagene pB678 – 127pB679 – 128

TOP10, Invitrogen pB678 – 124pB679 – 128

Table 1. Yield of plasmid from various E. coli culturesusing the Aurum miniprep plasmid isolation kit. Allpreps were from 12 OD•ml of culture grown in LB Amp medium.

Strain, Source Plasmid endA Yield (µg)

SCS1, Stratagene pB275 – 20.6

XL2-Blue, Stratagene pB275 – 17.3

SCS110, Stratagene pB279 – 16.6

JM110, Stratagene pB279 + 5.3

JM109, Stratagene pB266 – 24.3

TOP10, Invitrogen pB266 – 24.3

BL21, Stratagene pB266 + 21.6

XL1-Blue, Stratagene pB271 – 30.0

E1301, Promega pB271 + 10.2

HB101, Life Technologies pB271 + 20.5

XL10-Gold, Stratagene pB292 – 27.7

KC8, Clontech pB292 + 35.0

DH5α, Gibco BRL pWS – 11.1

DH10B, Gibco BRL pWS – 11.8

reportstechnical


quantity of plasmid are obtained using 12 OD•mlof cells grown in LB Amp. Henceforth, LB Ampwas used exclusively as a growth medium.

We were interested in testing how the newAurum kits compared with other plasmidpurification kits commonly used in our laboratory.We found that plasmid yields using the other kitswere dramatically lower than what we achievedfrom similar cultures with the Aurum plasmid kits(Table 5). Aurum preps were of high quality,equivalent to or better than those obtained fromother kits (Figure 3, Tables 5 and 6).

We tested the quality of isolated plasmid DNA by four criteria: quality of restrictiondigests, DNA sequencing, and bacterial or yeasttransformation. All kits tested gave plasmid DNAthat was digested equivalently by restrictionenzymes (Figure 4). Two plasmid samples gavepoor or unusual restriction digestion patterns(Figure 4, lanes 3 and 11), and both of theseplasmids were isolated from endA+ bacterialstrains. We noticed no differences in the ability of isolated plasmids to transform either bacteriaor yeast. Plasmids from all kits and conditionstransformed strains equivalently with highefficiency. However, we did notice differenceswhen we sequenced plasmids derived by differentpurification methods (Table 6). Notably, Aurumpreps performed the best under these conditions.

were isolated from minipreps and midipreps,respectively. The yields from minipreps variedmore than from midipreps, but this may bebecause more variables (strains, endA- vs. endA+)were tested. In general, yield correlated mostclosely to specific plasmid type. Notably, goodyields of plasmid could be obtained from endA+

strains. Bacterial growth media can affect the quality

and quantity of isolated plasmid DNA. At leastfour different media are commonly used for thegrowth of E. coli. We routinely use LB Amp butwere interested in comparing the plasmid yield andquality when LBG Amp, 2x YT, or TB Amp wasused. We found that plasmid yield seems to varyconsiderably with the type of medium used (Table3). Notably, LBG Amp medium gave poor yieldsand plasmids that migrated unusually on agarosegels (Table 3, Figure 1). LB Amp and TB Ampgave the best yields and highest quality of plasmid.

To determine whether bacterial density affectedthe quality or quantity of plasmid DNA isolated,we tested the effect of using different OD•mlquantities of bacteria in Aurum minipreps. Wefound that plasmid yield increased until themaximum recommended load of bacterial culture(12 OD•ml) was reached (Table 4). In all cases,the plasmid yield was lower than was normallyattained with cells grown in LB Amp medium, andwe attribute this to using 2x YT medium. Using50% or 100% more culture than recommendedreduced the plasmid yield without greatly affectingthe quality of the preps (Figure 2). We concludedthat for Aurum minipreps, optimum quality and

Fig. 2. Plasmid DNA (10 µl each) from minipreps isolated from culture quantities described in Table 4. Left to right, 3 OD•ml, 6 OD•ml, 12 OD•ml, 18 OD•ml, 24 OD•ml; far right, 1 kb ladder.

Fig. 1. Plasmid DNA (500 ngper well) from cultures grown in different media.

Table 3. Yield of plasmid from E. coli cultures grownin different media. All preps were from 12 OD•ml of strainTOP10/pB266 (endA-), isolated using the Aurum plasmidminiprep kit. Yields shown are averages of two isolations.

Growth Medium Yield (µg)

LBG Amp 4.3

2x YT Amp* 7.9

LB Amp 11.2

TB Amp* 18.9

* In other experiments, plasmid preps derived from culturesgrown in these media varied widely in yield and quality.

Table 4. Yield of plasmid from various amounts of E. coli culture isolated using the Aurum plasmidminiprep kit. All preps were from the indicated amounts of asingle culture of strain TOP10/pB266, grown in 2x YT Ampmedium to a density of 4 OD.

Bacterial Quantity Yield (OD•ml) (µg)

3 0.4

6 0.4

12 * 3.8

18 3.2

24 2.3

* Maximum recommended amount to process for one Aurumminiprep.

reportstechnical


Conclusions Purified plasmid DNA from the new Aurumminiprep and midiprep kits was of high quality and reproducibly performed very well in restrictiondigestion, bacterial and yeast transformation, andautomated fluorescent DNA sequencing reactions.The Aurum kits also equaled or outperformedother commercially available plasmid purificationkits for overall yield and quality of plasmid.

ReferenceGietz RD and Woods RA, High efficiency transformation with lithium acetate, In Johnston JR (ed), Molecular Geneticsof Yeast: A Practical Approach, Oxford University Press, New York, 121–134 (1994)

DH5a and DH10B are trademarks of Life Technologies.QIAprep is a trademark of QIAGEN. Strataprep, XL1-Blue,XL2-Blue, and XL10-Gold are trademarks of Stratagene.Wizard Plus and SV Plus are trademarks of Promega.

For additional copies of this article, requestbulletin 2783 on the reader response card.

Fig. 3. Plasmid DNA isolated with Aurum and other plasmidpurification kits.

Fig. 4. EcoRI digests of 500 ng of plasmid preps listed in Table 7. Single bands were expected for alllanes except 14 and 15, for which two bands were expected.

Table 6. Quality of sequences of plasmid preps from cultures grown in different conditions or isolated withdifferent kits.

Kit Strain endA Medium Length Longest Best Core % Correct (bp) Correct Run Sequence in Core

Aurum miniprep TOP10 – 2x YT Amp 584 176 bp 516 bp 97Aurum miniprep TOP10 – LB Amp 594 155 bp 445 bp 98Aurum miniprep HB101 + LB Amp 576 142 bp 452 bp 99Promega Wizard Plus TOP10 – LB Amp 582 106 bp 453 bp 97Promega SV Plus TOP10 – LB Amp 585 105 bp 483 bp 98

Table 7. Lane identifications of plasmid preps shownin Figure 4.Lane # Plasmid Strain Kit

2 pB275 SCS1 Aurum3 pB279 JM110 Aurum4 pB292 XL10-Gold Aurum5 pB266 TOP10 Aurum6 pB266 JM109 Aurum7 pB271 HB101 Aurum8 pB292 KC8 Aurum9 pB275 XL2-Blue Aurum10 pB266 BL21 Aurum11 pB279 E1301 Aurum12 pB271 SCS110 Aurum13 pB271 XL1-Blue Aurum14 pWS DH5α Aurum15 pWS DH10B Aurum16 pB266 TOP10 Aurum17 pB266 TOP10 Aurum18 pB266 TOP10 Aurum19 pB266 TOP10 Aurum20 pB266 TOP10 Wizard Plus21 pB266 TOP10 SV Plus22 pB266 TOP10 Quantum Prep23 pB266 TOP10 QIAprep Spin

Table 5. Comparison of plasmid yields using various (competitors’) plasmidminiprep kits. All preps were from the indicated volumes of a single culture of strainTOP10/pB266, grown in 2x YT Amp medium to an OD of 3.5.

Yield

Culture Promega Promega Bio-Rad Stratagene QIAGENVolume Wizard Plus SV Plus Quantum Prep® Strataprep QIAprep Spin

0.9 ml 0.9 µg 1.8 µg 0.9 µg 0.2 µg 0.6 µg1.8 ml 2.9 µg 2.5 µg 1.3 µg 0.1 µg 0.8 µg2.7 ml 2.7 µg 2.2 µg 0.7 µg 0.0 µg 0.9 µg3.6 ml 1.5 µg 2.4 µg 1.3 µg 0.2 µg 1.5 µg


Identification of Nonspecific Products Using Melt-CurveAnalysis on the iCycler iQ™ Detection System Marni Brisson, Larissa Tan, Rob Park, and Keith Hamby, Bio-Rad Laboratories, Inc., 2000 Alfred Nobel Dr., Hercules, CA 94547 USA

IntroductionReal-time PCR is a powerful and effectivetechnique for accurate quantitation of DNA.Assays for the detection of a single gene involvecareful choice of primers, target sequence, and themethod for detecting the amplified DNA product.In addition, it is necessary to choose appropriatereaction conditions that will generate robust andefficient amplification for both relative andabsolute quantitation.

Specificity and efficiency are two essentialrequirements for successful real-time PCRamplification. Poor assay design can result in suchproblems as nonspecific products and inefficientprimer association with target, which dramaticallyaffect the quality of the data. Proper primer designensures that the chosen primers are specific for thedesired target sequence, bind at positions thatavoid secondary structure, and minimize theoccurrence of primer-dimer formation.Appropriate reaction conditions can also improvethe efficiency of amplification. Optimization ofthe detection method, Mg2+ concentration,annealing temperature, enzyme concentration,PCR product length, etc., are all ways ofperfecting real-time assays.

Another valuable tool in assay design is melt-curve analysis. With the use of DNA-binding dyessuch as SYBR Green I, a melt-curve profile can begenerated. The iCycler iQ system records the totalfluorescence generated by SYBR Green I bindingto double-stranded DNA as temperature changes,and plots the fluorescence in real time as afunction of temperature. The first derivative ofthis plot, dF/dT, is the rate of change offluorescence in the reaction, and a significantchange in fluorescence accompanies the meltingof the double-stranded PCR products. A plot of -dF/dT vs. temperature will display these changesin fluorescence as distinct peaks. The meltingtemperature (Tm) of each product is defined as thetemperature at which the corresponding peakmaximum occurs. This analysis can confirm thespecificity of the chosen primers as well as revealthe presence of primer-dimers. Because of theirsmall size, primer-dimers usually melt at lower

temperatures than the desired product.Additionally, nonspecific amplification may resultin PCR products that melt at temperatures aboveor below that of the desired product.

The presence of secondary nonspecific productsand primer-dimers can severely reduce theamplification efficiency and ultimately theaccuracy of the data. Primer-dimers can also limitthe dynamic range of the desired standard curvedue to competition for reaction componentsduring amplification. Therefore, melt-curveanalysis is essential in designing an efficient andspecific quantitative PCR assay.

MethodsStandard Curves with IL-1βThe following master mix was prepared togenerate standard curves with the IL-1β plasmidtemplate (IMAGE Consortium clone 324655)using SYBR Green I as the detection reagent:

1 ml Platinum PCR supermix (Life Technologies)5 µl 100 µM forward primer (see Table)5 µl 100 µM reverse primer (see Table)200 µl SYBR Green I (1:10,000 dilution of

Molecular Probes stock)750 µl ddH2O

Alternatively, the same components as above wereused except that 4 µl of a dual-labeled probe (seeTable) and 196 µl of ddH2O were used in place ofSYBR Green I to detect the amplified DNA.

A series of consecutive 5-fold dilutions of theIL-1β plasmid in ddH2O was made, creating fivedilutions from 104 to 16 copies of the plasmid.The master mix was dispensed in 294 µl aliqoutsto six separate tubes. Then a 6 µl aliquot fromeach plasmid dilution was added to one of thetubes containing master mix, with the last tubereceiving 6 µl of ddH2O as a no-template control.

Primers for the experiment in Figure 7 wereredesigned to prevent primer-dimer formation.The following master mix was used to generatethis standard curve using SYBR Green I as thedetection agent:

reportstechnical


1.425 ml Platinum PCR supermix (Life Technologies)

8.55 µl 100 µM forward primer (see Table)8.55 µl 100 µM reverse primer (see Table)285 µl SYBR Green I (1:10,000 dilution of

Molecular Probes stock)1.065 ml ddH2O

A series of consecutive 10-fold dilutions of the IL-1β plasmid template DNA ranging from 107 copies/µl to 102 copies/µl was generated. Master mix was dispensed in 343 µl aliquots toseven separate tubes. Each of the tubes thenreceived a 7 µl aliquot of one of the DNAdilutions. ddH2O (7 µl) was added to the last tube as a no-template control.

Aliquots (50 µl) of the reaction mixtures weretransferred to the wells of a 96-well thin-wallPCR plate. The plate was sealed with opticallyclear sealing film and spun briefly. Each plate wassubjected to a PCR amplification protocol of95°C denaturation for 3 min followed by 40–45cycles of 10 sec at 95°C and 45 sec at 55–60°C(annealing and data collection step) in Bio-Rad’siCycler iQ system. The protocol for Figures 4 and5 had an additional step where data werecollected at 82°C rather than at the 60°Cannealing step. Melt-curve analysis was performedimmediately after the amplification protocolunder the following conditions: 1 mindenaturation at 95°C, 1 min annealing at 55°C,80 cycles of 0.5°C increments (10 sec each)beginning at 55°C (data collection step).

Standard Curves with β-InhibinThe following master mix was used to producestandard curves from genomic DNA using β-inhibin primers:

2.125 ml Platinum PCR supermix (Life Technologies)

12.75 µl 100 µM forward primer (see Table)12.75 µl 100 µM reverse primer (see Table)1.419 µl ddH2O

Aliquots of 1.596 ml of master mix weredispensed to two separate tubes. To the first tube,3.8 µl of a dual-labeled probe (6-FAM/BHQ-1, see Table) plus 186.2 µl of ddH2O were added todetect amplified DNA. To the second tube, 190 µlof a 1:10,000 dilution of SYBR Green I were addedfor DNA detection (final dilution 1:100,000).

Genomic DNA was diluted from a 66.7 ng/µlstock to generate a 4-fold dilution series from 50 to 3.125 ng/µl. The genomic DNA stock waspreviously digested with BamHI and boiled for 10 min before being placed in an ice bath.Aliquots of 423 µl from either the 6-FAM/BHQ-1or SYBR Green I master mix were dispensed tofour separate tubes. Aliquots (27 µl) of eachgenomic DNA dilution or ddH2O were then addedto one tube from the 6-FAM/BHQ-1 mix and onetube from the SYBR Green I mix.

Aliquots (50 µl) of the reaction mixtures weretransferred to two 96-well thin-wall PCR plates,one for each detection strategy. The plates weresealed with optically clear sealing film and spunbriefly. Both plates were subjected to similaramplification and melt-curve protocols differingonly in their annealing temperatures at the datacollection step of amplification. The amplificationsteps were 95°C denaturation for 3 min, 50 cyclesof 10 sec at 95°C, 45 sec at 57°C or 55°C (datacollection step); melt-curve steps were 95°Cdenaturation for 1 min, 55°C annealing for 1 min, 80 cycles of 0.5°C increments (10 sec each)beginning at 55°C (data collection step).

Table. Primers and probes designed to test the effects of primer dimerization on IL-1β standard curves.*

Forward Primer (5' to 3') Reverse Primer (5' to 3') Fluorescent Detection Agent Associated Figures

GTGCTGAATGTGGACTCAATCCC GGTTGCTCATCAGAATGTGGG SYBR Green I 1–5

GTGCTGAATGTGGACTCAATCCC GGTTGCTCATCAGAATGTGGG Texas Red-CAGGCCTCTCTCA- 6CCTCTCCGCCTGG-DABCYL

TGCTCCTTCCAGGACCT GTGGTGGTCGGAGATTC SYBR Green I 7

CTTTGCCGAGTCAGGAACA GACTTCTGCACGCTCC 6-FAM-CGCTGCACTTCGAGA- 8–9TTTCCAAGGAAGGCAG-BHQ-1

CTTTGCCGAGTCAGGAACA GACTTCTGCACGCTCC SYBR Green I 8–9

* Primers used for experiments in Figures 1–6 were designed to induce primer-dimers by a GGG/CCC overlap at the 3' ends.


ResultsPrimer-DimersA standard curve (5-fold dilution series) of IL-1βplasmid was generated with SYBR Green I usingprimers known to produce primer-dimers(GGG/CCC overlap at the 3' ends; see Table).The amplification data revealed that the last threedilutions could not be resolved from one another(Figure 1). In addition, amplification was alsopresent in the no-template controls. The standardcurve demonstrated an amplification efficiencyabove 100% (slope = -2.449 or 156% efficiency)and a poor correlation coefficient (r = 0.950). An amplification efficiency of >90% is typicallydesired for optimal results. Greater than 100%efficiency suggests that more than one product wasamplified in the reaction. Melt-curve analysis wasperformed in conjunction with the amplificationprotocol to determine if nonspecific products wereamplified during the reaction. The melt-curveresults revealed a large product peak in the no-template control wells at a melting temperature(Tm) of approximately 78°C (Figure 2A). Thispeak was generated completely by amplifiedprimer-dimer products. At the highest plasmidconcentration (104 copies/well), only one majorpeak was apparent at a Tm of 89°C (Figure 2B).This peak represented the specific amplifiedproduct. With the lower dilutions of amplified IL-1β DNA plasmid (for example, 4 x 102 copies/well; Figure 2C) the melt curve revealed thepresence of both the primer-dimer and the specificproduct, or the primer-dimer only. The melt-curvedata were confirmed by resolving the amplifiedproducts on a polyacrylamide gel (Figure 3). Thisanalysis demonstrates that primer-dimers arepresent in all of the amplification reactions. SinceSYBR Green I nonspecifically detects all double-stranded DNA, it will not distinguish between thespecific amplified product and the primer-dimersformed during the reaction. Therefore, theefficiency will be >100%. The amount of theprimer-dimers produced is also dependent on theoriginal concentration of the target DNAtemplate. When no template is present, a largeand significant amount of the primer-dimerproduct is present. At the lower plasmidconcentrations, the predominant product is stillthe primer-dimer. However, at higherconcentrations, the specific amplified productpredominates. Therefore, primer-dimer productionwill interfere with accurate quantitation of thetarget DNA by SYBR Green I. Furthermore, both

Fig. 1. Amplification of a dilutionseries of IL-1β plasmid with SYBRGreen I detection, using a primerset designed to generate primer-dimers. The inset represents thestandard curve of five plasmiddilutions.

Fig. 2. Melt-curve plotsrepresenting products from theamplification shown in Figure 1. No-template control (A), 104 copiesof IL-1β template (B), and 4 x 102

copies of IL-1β template (C).

Fig. 3. Ready Gel® 15% acrylamideTBE gel showing products from theamplifications of Figure 1. Lane 1,EZ Load™ 100 bp ladder; lane 2,AmpliSize® 50–2,000 bp molecularruler; lanes 3 and 4, 1 x 104 copiesIL-1β template/reaction; lanes 5and 6, 2 x 103 copies IL-1β; lanes7 and 8, 4 x 102 copies IL-1βtemplate/reaction; lanes 9 and 10,80 copies IL-1β template/reaction;lanes 11 and 12, 16 copies IL-1βtemplate/reaction; lanes 13 and 14,no-template controls.

Specificproduct

Primer-dimer

B

A

C

reportstechnical

Visit us on the Web at discover.bio-rad.com Call toll free at 1-800-4BIORAD (1-800-424-6723); outside the US, contact your local sales office.

Real-Time PCR*

• Performance qualified for use with theiCycler iQ™ real-time detection system

• 2x supermix blended expressly for usein real-time PCR assays

• Demonstrated performance over 4 logs of starting material (genomic DNA)

• Outstanding quality from the real-time PCR experts

Offering Real Solutions from the Real Experts.

*The polymerase chain reaction (PCR) process is covered by patents owned by Hoffman-LaRoche. Use of the PCR process requires a license.

Introducing iQ™ Supermix for Real-Time PCR


fluorescence recorded during amplification. Forthe experiment depicted in Figure 4, the samesteps were repeated (annealing temperatureremained at 60°C); however, the data werecollected in an additional step at 82°C after theprimer-dimers had melted. Fluorescence was notdetected in the no-template control duringamplification. This is to be expected since theprimer-dimers were denatured at this temperatureand could no longer contribute to thefluorescence. The lower plasmid dilutions couldalso be resolved from one another. Since SYBRGreen I does not detect primer-dimers at 82°C, a normal amplification efficiency was revealed(slope = -3.424 or 95.9% efficiency). However,the correlation coefficient remained poor (r =0.951). Collecting data at 82°C removes thefluorescent contribution of the primer-dimers in the amplification plot. However, it does notremove the primer-dimers themselves duringamplification. As seen in Figures 5A and 5B, theprimer-dimer peak is still present in the no-template control and in the various plasmiddilutions during amplification. The primer-dimersstill compete for reaction components and inhibitamplification of the specific product. This isfurther demonstrated when the same amplificationis performed using a dual-labeled probe (TexasRed/DABCYL) (Figure 6A). This probe shoulddetect only the specific IL-1β amplified productand should not recognize the primer-dimers. Theexperiment resulted in an extremely diminishedstandard curve with a very low efficiency (r =0.953, slope = -3.638 or 88.3% efficiency). Thelowest dilutions (80 and 16 copies) could not beincluded in the calculations for the standard curvebecause the amplification of the specific productwas severely or completely inhibited by theprimer-dimers (Figure 6B). Collecting data afterthe melting temperature of the primer-dimers doesnot correct for their interference duringamplification. Therefore, experiments in thepresence of significant primer-dimers will result in inefficient and inaccurate data.

There are several possible solutions to preventprimer-dimer formation. The experiments aboveused primers that were known to produce primer-dimer products based on a GGG/CCC overlap atthe 3' ends. Primer-dimers can be avoided byproper design. Using hot-start enzymes also greatlyreduces primer-dimer formation. Furthermore, theannealing temperature as well as the reactioncomponents themselves (eg., Mg2+, detergents,

Fig. 4. Amplification with SYBRGreen I and the same IL-1β primerswith an annealing temperature of60°C and data collection set at82°C. The inset represents thestandard curve of five plasmiddilutions.

Fig. 5. Melt-curve profilesrepresenting products generatedfrom the amplification seen in Figure4. No-template control (A), 2 x 104

copies of IL-1β template (B).

Fig. 6. Primer-dimer inhibition of specific product formation. A,dilution series of IL-1β plasmidamplification with a dual-labeledhybridization probe using the sameprimer set; the standard curve isshown in the inset. B, melt curveswith SYBR Green I representing all primer-dimer products fromamplifications with 16 or 80 copiesof IL-1β template.

B

AA

B

A

the primer-dimer and the specific product are indirect competition for the reaction componentsduring amplification. This indicates that primer-dimer formation will directly inhibit amplificationof a specific product resulting in a diminisheddynamic range (Figure 1).

A frequently suggested solution to primer-dimerinterference is to collect amplification data at atemperature where the primer-dimers havemelted, but the specific products have not. Then,the primer-dimers would not contribute to the

reportstechnical


SYBR Green I concentration) can also affect the amount of primer-dimers produced duringamplification. If a set of primers is consistentlycausing problems, redesigning the primersthemselves may be the best choice. Figure 7 showsa standard curve over a 10-fold difference inconcentration of the same IL-1β plasmid afterredesigning the primers. This amplificationdemonstrated an excellent correlation coefficient(r = 1.00) with a very high efficiency (slope = -3.362, 98.2% efficiency). After melt-curveanalysis, it is apparent that one major product wasamplified during the reaction that represents thespecific product (Figure 7B). In this case, a simpleredesign of the primers themselves greatlyimproved the quality and accuracy of the dataobtained during amplification.

Secondary ProductsA 4-fold dilution series of human genomic DNAwas subjected to amplification with SYBR Green Iusing primers for the β-inhibin gene. In theamplification plot, the three dilutions in the serieswere resolved fairly well from one another (Figure8A). The standard curve revealed a goodcorrelation coefficient (r = 0.994) but a relativelypoor slope value (-2.515, 150% efficiency). Aftermelt-curve analysis, it was apparent that the>100% efficiency was caused by amplification ofmore than one product (Figure 8B). Two majorpeaks appeared in all three plasmid dilutions. The presence of nonspecific products was furtherconfirmed by running the amplification productson a 15% acrylamide TBE gel. The gel revealedtwo major bands: a 200 bp band corresponding to the specific amplified product and a 350 bpsecondary product (data not shown). Thepresence of the nonspecific product decreases theefficiency of amplification of the specific productdue to competition for reagents. However, theratio between the secondary product and specificproduct in this experiment remained the sameregardless of the DNA dilution. For this reason,the secondary product did not have a greaterimpact on the lower concentrations of DNA as in the case of primer-dimers (see Figures 1–2).

The same amplification was performed using a dual-labeled probe (6-FAM/BHQ-1) to detectamplification of the specific product only. Figure8C demonstrates a trend similar to that seen withSYBR Green I. Since the probe should detect onlythe specific 200 bp product, the standard curvewould be expected to be superior to that seen with

Fig. 7. Amplification (A) and melt-curve (B) profiles resulting from a10-fold standard curve amplificationwith a redesigned primer set for IL-1β. The inset in (A) representsthe standard curve generated over5 orders of dynamic range.

Fig. 8. Amplification of humangenomic DNA at 57°C using SYBRGreen I (A) or a dual-labeledhybridization probe (C) with primersrecognizing the β-inhibin gene.Insets represent the standardcurves generated from threeplasmid dilutions. The melt-curvediagram (B) was generated from theamplification shown in panel A.

B

A

B

A

C

nonspecific detection by SYBR Green I. However,the correlation coefficient was poor (r = 0.982)and the efficiency of the amplification remainedover 100% (slope = -2.890, 121.8%). Thisindicates that the coamplification of thenonspecific product influenced the amplificationefficiency of the specific product, possibly becausethe probe could not distinguish between thespecific and nonspecific products in the reaction (r = 0.982).

A simple method for reducing secondaryproduct formation is to try different annealing


Fig. 9. Amplification of humangenomic DNA at 55°C using SYBRGreen I (A) or a dual-labeledhybridization probe (C) with primersrecognizing the β-inhibin gene.Insets represent the standardcurves generated from threeplasmid dilutions. The melt-curvediagram (B) was generated from theamplification shown in panel A.

temperatures. It is often found that optimizing the annealing temperature for amplification willincrease primer specificity and eliminatesecondary products. In this example, theannealing temperature was lowered from 57°C to 55°C. It is evident from the amplification data(Figure 9A) that reducing the annealingtemperature greatly improved the correlationcoefficient of the standard curve (r = 0.996).Based on the melt-curve data, it seems thisimprovement is caused by the elimination of themajor nonspecific product (Figure 9B). Only onepeak appeared in the melt curve, indicating thatonly one product was amplified. However, theamplification efficiency remained over 100%(slope = -2.277, 175.4%). The amplified productswere separated on a 15% acrylamide TBE gel,which confirmed one major product at 200 bp(data not shown). However, several smallersecondary products were also present that couldnot be resolved by the melt curve. The melting of each product in the melt curve is based on boththe length and the G/C content of the sequence.Because of this, not all amplified products can beresolved from one another. Therefore, a singlepeak in a melt curve does not necessarily mean asingle product. In this example, the melt peak wasquite broad (Figure 9B). This indicates that some,if not all, of the minor products may have

approximately the same melting temperature asthe 200 bp specific product. When the dual-labeled probe was used in place of SYBR Green Ifor detection, the correlation coefficient (r =0.992) remained similar (Figure 9C). However,the slope (-3.253, 102% efficiency) and hence the efficiency was greatly improved. The smallersecondary products at the 55°C annealingtemperature had a greater impact on the SYBRGreen I experiments since this detection dye isnonspecific. The probe, however, was able todistinguish between the specific product and thesecondary products, leading to improved results.Therefore, it is important to minimizeamplification of nonspecific products as well as to choose the appropriate detection agent.

ConclusionsIn real-time PCR assays, it is important to amplify the target gene at high efficiency. This is important for generating the best possibledynamic range for standard curves and moreimportantly for multiplexing with other genes.Melt-curve analysis assists in improving real-timeassays because it identifies the products amplifiedin a particular reaction. Nonspecific amplificationand primer-dimer formation can greatly reduceamplification efficiency of the target gene sincethey compete for reaction components duringamplification. The greatest effect is observed at the lowest concentrations of DNA, whichultimately compromises the dynamic range. Sinceprimer-dimers directly interfere with target geneamplification, collecting data at a highertemperature after primer-dimers have meltedcould lead to inaccurate data. Optimization ofreaction components (Mg2+, detergents, SYBRGreen I concentrations) and annealingtemperatures will aid in decreasing nonspecificproduct formation. However, proper primer designis the best method to avoid primer-dimers andother nonspecific products (refer to bulletin 2593,General Considerations for PCR).

*The polymerase chain reaction (PCR) process is covered by patents owned by Hoffman-LaRoche. Use of the PCRprocess requires a license. The iCycler iQ system includes alicensed thermal cycler and may be used with PCR licensesavailable from Applied Biosystems.

BHQ is a trademark of Biosearch Technologies, Inc. SYBRand Texas Red are trademarks of Molecular Probes, Inc.

For general information on PCR, request bulletin2593 on the reader response card; for additionalcopies of this article, request bulletin 2684.

B

A

C

reportstechnical


Application Note Program

paperscall for

Let Us Publish Your Results and We Will Send You YourChoice of Bio-Rad Products, Equivalent to US $500.00! If you've found that Bio-Rad equipment orproducts have enhanced your research, weencourage you to share your application orresults with other researchers.

Please submit your results using Bio-Radproducts in applications in any of thefollowing categories: • Chromatography• Gene transfer• Imaging• Nucleic acid amplification• Nucleic acid or protein electrophoresis• Protein array technology• Proteomics• Sample preparation

Any author or group of authors whosubmits an application note that is acceptedand published by Bio-Rad will receive$500.00 worth (US dollars or equivalent inlocal currency) of Bio-Rad products.

Submission Guidelines Bio-Rad products must be an integral partof your application. The application noteshould be concise and include a Methodssection. Electronic submission of text inMicrosoft Word or similar software ispreferred. For initial review, figures may beprovided as low-resolution files embeddedin the Word document, or they may besent as separate files if they are clearlyidentified. Photography for an acceptedmanuscript must be mailed directly to Bio-Rad at the address at the right;electronic image files must be submitted asseparate (not embedded) high-resolutionfiles for print publication, in TIFF or EPSformat. Submitted materials will not bereturned. If you have questions about Bio-Rad’s application note program, pleasecontact us at the address at the right. You may also contact Technical Support or your local Bio-Rad office for help.

Submit Application Notes to:Bio-Rad Laboratories, Inc.Life Science Group2000 Alfred Nobel DriveHercules, CA 94547 USAAttn: Bio-Rad Application NotesE-mail: [email protected]

Also see the announcement of ourapplication note program on our web siteat discover.bio-rad.com


IntroductionThe most widespread strategy for studying proteinexpression in biological systems employs analyticaltwo-dimensional (2-D) polyacrylamide gelelectrophoresis (PAGE) followed by enzymaticdegradation of isolated protein spots, peptidemapping, and bioinformatic database searches.However, certain types of proteins, many of whichmay have important cellular functions, are noteasily analyzed using this general strategy. Theseprimarily include membrane and low-abundanceproteins. Proteomic approaches usingcombinations of analytical or preparative 2-Delectrophoresis — liquid-phase isoelectric focusing(IEF) in the Rotofor® cell, SDS-PAGE in theModel 491 prep cell, or one-dimensional (1-D)SDS-PAGE and electroelution in the mini wholegel eluter — followed by immunoblotting, massspectrometry (MS), and database searches will bepresented and discussed. The electrophoreticstrategies will be illustrated with examples fromour work on human cerebrospinal fluid (CSF) andbrain tissue to show the powerful combination ofanalytical and preparative 2-D electrophoresis.

Investigations of alteration of multiple proteinexpression patterns provide a powerful strategy for investigating complex pathophysiologicalprocesses in neurodegenerative disorders such

as Alzheimer’s disease (AD). Among the currentmethods for studying protein expression, 2-Delectrophoresis in combination with MS is theprincipal approach for proteome analysis. To studyneural proteins — markers for neuropathologicalprocesses or mechanisms — requires furtherdevelopments in proteomic methodology. Neuron-specific proteins are often low-abundanceor membrane-associated proteins. Therefore,alternative separation methods includingcombinations of analytical or preparative 2-Delectrophoresis have to be developed to provideinformation complementary to that derived fromanalytical 2-D electrophoresis. Our study of neuralproteins focuses on CSF. Analysis of proteins inCSF is of major diagnostic importance because of its close connection to the brain and the ease of clinical availability. Today, CSF proteinsidentifiable on a traditional 2-D gel are restrictedto high-abundance proteins. To study low-abundance proteins like neuron-specific proteins,a prefractionation step prior to analytical orpreparative 2-D electrophoresis has to beperformed. Many of the limitations of 2-Delectrophoresis arise from its use of a gel as theseparation medium; a liquid medium forelectrophoretic separation may offer significantadvantages due to reduced loss of proteins. Avariety of approaches for preparative-scale IEFhave been developed. Bio-Rad’s Rotofor cell wasdeveloped for preparative-scale, free-solution(liquid-phase) IEF applications.

Methods and ResultsTo study neural proteins, some alternativeproteomic methods have been developed whichprovide important information complementary to that derived from 2-D gels. Analytical andpreparative methods, including direct 2-Delectrophoresis on mini gels, liquid-phase IEF in the Rotofor cell combined with 2-D gels,immunoblotting, SDS-PAGE in the Model 491prep cell, and 1-D SDS-PAGE and electroelution in the mini gel eluter (Figure 1), each provide adifferent analytical “window” through which proteinexpression in biological system can be followed.

Combination of 2-D Gel and Liquid-Phase ElectrophoreticSeparations as Proteomic Tools in NeurosciencePia Davidsson, Department of Clinical Neuroscience, Experimental Neuroscience Section, Göteborg University, Sahlgrenska University Hospital/Mölndal, Mölndal, Sweden

Fig. 1. Possible combinations of analytical and preparative 2-Delectrophoretic methods.

Direct 2-DElectrophoresis

Analytical 2-DElectrophoresis

Liquid-Phase IEF in Rotofor Cell

Prefractionated orPreparative 2-DElectrophoresis

Immunoblotting

Preparative SDS-PAGE in

Preparative Cell

SDS-PAGE +Electroelution in Gel Eluter

➞ ➞

➞

➞

➞➞

reportstechnical

– kD––––

––

–

–

–

–


Direct Analytical 2-D Electrophoresis of Human CSFWe have used mini-gel 2-D electrophoresis,SYPRO Ruby protein staining, and MS forclinical screening of disease-influenced CSFproteins in AD patients (Davidsson et al. 2002).The first-dimension separation was carried outusing ReadyStrip™ immobilized pH gradient(IPG) strips (pH 4–7) in the PROTEAN® IEFsystem. In the second dimension, the proteinswere separated on small vertical gels (NOVEXNuPAGE system). Image acquisition and analysiswere performed on a Fluor-S Max™ multi-imagersystem. The gels were analyzed digitally withPDQuest™ software. The criterion for a successfulprotein match was that the PDQuest softwarecould detect and quantitate the protein in all CSFcontrols. The mean intensity of each matchedprotein spot in 15 AD samples was statisticallycompared with the mean intensity of the sameprotein spot in 12 controls. By comparing theintensity of spots between AD samples andnormal controls, 15 spots were found to besignificantly up- or down-regulated (Mann-Whitney U test, p < 0.05 in PDQuest software),and these proteins were identified by MS. Sincemultiple statistical comparisons were made, theBonferroni correction was used for furthercomparisons of the selected protein spots betweenthe groups, which were done using Student’s t test.The levels of ten protein spots were stillsignificantly altered in CSF of AD patients (Figure 2). The average concentration of the identified proteins on the SYPRO Ruby-stained mini 2-D gels was 1–20 mg/L.

Fig. 2. Direct analytical 2-Delectrophoresis of human CSF fromAD patients. A typical image of aSYPRO Ruby-stained 2-D mini gelof CSF proteins. CSF proteins from15 AD patients and 12 controlswere analyzed on pH 4–7ReadyStrip IPG strips, followed byseparation in 10% NuPAGE gels.The gels were stained with SYPRORuby protein gel stain; proteins weredetected and compared usingPDQuest software. Selected spots,representing CSF proteins withdifferent levels in AD patientscompared to controls, are indicated.

Fig. 3. Enrichment of neuron-specific proteins in human CSFusing liquid-phase IEF incombination with immunoblotting.The 50 ml CSF sample wasconcentrated by precipitation in10% TCA. The TCA precipitate was brought to a volume of 10 mlwith 0.1% octylglucoside and 2.5% ampholytes. The CSF proteinsample was loaded onto theRotofor cell and run at 10 Wconstant power. Twenty fractionswere harvested. A, SDS-PAGE(12%) followed by colloidalCoomassie Blue staining of theRotofor fractions. Lanes 1–10correspond to Rotofor fractions1–10. Lane 11 contains molecularweight standards. A 300 µl aliquotof each Rotofor fraction wasconcentrated 5-fold by vacuumcentrifugation. The proteins wereseparated through a 12% SDS minigel followed by immunoblottingusing antibodies to B, tau proteinand C, rab3a protein. Tau proteinwas detected in Rotofor fractions 7and 8 by the antibodies AT120,BT2, AT270, and AT8, respectively(left to right). The protein rab3a wasdetected in Rotofor fractions 4–6using MAbCl 42:2 from mouse.

–70 kD

–50

–35

–30

–15

– 6

We have been able to identify ubiquitin, which ispresent in CSF at 0.050–0.200 mg/L, on 2-D gelsof CSF samples.

Enrichment of Neuron-Specific Proteins inHuman CSF Using Liquid-Phase IEF andImmunoblottingLiquid-phase IEF in combination withimmunoblotting has been used to enrich traceamounts of neuron-specific proteins that areinvolved in AD (Davidsson et al. 1999b, Sjögrenet al. 2001). Biological fluids such as CSF andserum were prepared for prefractionation bysolubilizing them in a neutral detergent (0.1% octylglucoside). Ampholytes were added toa concentration of 2.5%, and 18–55 ml sampleswere loaded into a Rotofor cell for fractionationover a broad pH range (3–10). After IEF, 20separate fractions were rapidly harvested. Theproteins in the IEF fractions were then separatedby SDS-PAGE, stained with colloidal Coomassie

➞

➞

A1 2 3 4 5 6 7 8 9 10 11

200116976655

3631

21

14

6

7 8 7 8 7 8 7 8 7 8 7 8

B Rotofor fraction

4 5 6Rotofor fractionC

2.5

pH 4 pH 7


Fig. 5. Identification of proteinsusing preparative 2-D liquid-phaseelectrophoresis and MS. UndilutedCSF (15 ml) was fractionated in thefirst dimension into defined pHranges using the Rotofor cell. A,Rotofor fraction 8, containingtransthyretin (TTR), was furtherseparated using the Model 491prep cell. B, western blotting andC, silver staining of transthyretinafter SDS-PAGE using the Model491 prep cell. Only the TTR bandwas detectable on the silver-stainedgel. D, MALDI analysis of trypticdigest of TTR. E, direct MALDI MSanalysis of TTR.

Blue (Figure 3A), and detected by immuno-blotting using specific monoclonal antibodies(Figures 3B and 3C). Tau protein, a marker forneurodegeneration, and the synaptic proteinrab3a, a marker for synaptic function, weredetected in nanogram per liter quantities in CSF.Tau protein in CSF was detected as four bandswith molecular weights of 25–80 kD, using fourdifferent types of antibodies that recognize bothphosphorylated and unphosphorylated forms. Ourresults (Figure 3B) show that tau protein is present

Fig. 4. Identification of proteins inhuman CSF using liquid-phase IEFas a prefractionation step followedby 2-D electrophoresis. A, typicalimage of a SYPRO Ruby-stained 2-D mini gel of CSF proteins. TheCSF proteins were analyzed on pH4–7 ReadyStrip IPG strips, followedby separation in 10% NuPAGE gels.B, CSF proteins were prefractionatedin the Rotofor cell. Fractionscorresponding to pH 3.0–3.5 wereseparated on pH 3–6 ReadyStripIPG strips, then run on 2-D mini gelsand stained with SYPRO Ruby. Theglycosylated forms of α−1 acidglycoprotein are indicated withboxes on both the unfractionated (A)and prefractionated (B) CSF 2-D gel. C, Rotofor fractions correspondingto pH 5.0–5.5 were separated onpH 4–7 ReadyStrip IPG strips.

–70 kD

–50

–30

–15

–70 kD

–50

–30

–15

–70 kD

–50

–30

–15

A

B C➞

➞

in both phosphorylated and unphosphorylatedisoforms, and in full-length and truncated forms inCSF (Sjögren et al. 2001). Five synaptic proteins(rab3a, synaptotagmin, GAP-43, SNAP-25, andneurogranin) have been demonstrated in CSFusing this method (Figure 3C showing rab3a inCSF; Davidsson et al. 1999b).

Identification of Proteins in Human CSF Using Liquid-Phase IEF Prefractionation, 2-D Electrophoresis, and MSWe have developed a method for prefractionatingproteins from individual CSF samples by liquid-phase IEF in the Rotofor cell andsubsequent analysis of selected fractions by 2-Delectrophoresis on mini gels. Human CSF (3 ml)was diluted with 9 ml of distilled water, and theproteins were separated using the Rotofor cell asdescribed above. Selected IEF fractions werepooled prior to 2-D electrophoresis, and theproteins were precipitated with ice-cold acetone.The first-dimension separation was carried outusing narrow-range ReadyStrip IPG strips, and thesecond-dimension on NuPAGE mini gels. Whencomparing 2-D gels of prefractionated andunfractionated CSF samples, more protein spotswere detected in the 2-D gels of prefractionatedCSF than in direct 2-D electrophoresis ofunfractionated CSF (Figure 4). Furthermore,variation in glycosylation states of different

TTR–

➞ ➞

50 55 60 65 70 75 80 85 90

50 55 57 60 62 64 66 68 70 72 76

A

B

C E

D

13 kD–

13 kD–

Prep cell fraction

Prep cell fraction

reportstechnical


proteins, for example, α1-acid glycoprotein, waseasily visualized using this method (Figure 4B).We have also shown that 2-D electrophoresis withliquid-phase IEF prefractionation improved thesequence coverage of transthyretin compared to conventional 2-D electrophoresis alone(Westman-Brinkmalm and Davidsson 2002).Furthermore, tryptic peptides from post-translationally modified forms of transthyretinwere not detected in matrix-assisted laserdesorption/ionization (MALDI) analysis from gelspots, but only in the gel spots from the combinedliquid-phase IEF/2-D electrophoresis procedure(Westman-Brinkmalm and Davidsson 2002). The prefractionation step prior to 2-Delectrophoresis thus enhanced the detection of less abundant proteins and the visualization of posttranslationally modified proteins.

Identification of Proteins Using Preparative 2-D Liquid-Phase Electrophoresis and MSA strategy employing 2-D liquid-phaseelectrophoresis and MALDI time-of-flight MS was used to characterize tryptic digests of low-abundance proteins in human CSF (Davidsson et al. 1999a). 2-D liquid-phase electrophoresis isbased on the same IEF and gel electrophoresisprinciples as the widely used analytical 2-Delectrophoresis, except that analytes remain insolution throughout the separation process. In 2-D liquid-phase electrophoresis, the first stepfractionates proteins by liquid-phase IEF intodefined pH ranges in the Rotofor cell as describedabove. In the second purification step, theproteins from the Rotofor fractions were appliedto the Model 491 prep cell for separation by SDS-PAGE on the basis of molecular weight.Individual fractions, each highly enriched for asingle protein band and virtually free of otherproteins, can be selected for MS analysis. Three

Fig. 6. Identification of proteinsusing preparative 2-D liquid-phaseelectrophoresis, NuPAGE systemplus mini whole gel eluter, and MS.CSF (15 ml) was fractionated in the first dimension into defined pHranges using the Rotofor cell. A,Rotofor fraction 2 was used forfurther purification by molecularweight using SDS-PAGE andelectroelution in the seconddimension. B, colloidal CoomassieBlue staining of whole gel eluterfraction 13, which was selected forMS analysis. C, fragment ionanalysis of a doubly charged trypticpeptide from the human proteinchromogranin A.

– kD––––

––

––

1 2 3 4 5 6 7 8 9 10 111213 1415

➞ ➞

A B C

CSF proteins, transthyretin, cystatin C, and β(2)-microglobulin, with concentrations of 3–20 mg/L, have been isolated and characterized(shown for transthyretin in Figure 5). Analysis ofintact proteins using this method has also beenperformed (Puchades et al. 1999a).

Alternatively, in the second dimension, theproteins from the Rotofor fractions were separatedby 1-D SDS-PAGE with the NuPAGE system andelectroeluted in Bio-Rad’s mini whole gel eluter.This method has been used to purify proteins fromhuman CSF and brain tissue (Davidsson andNilsson 1999, Davidsson et al. 2001). Elutedproteins were precipitated with ice-cold acetone,trypsinized, and purified with ZipTip samplepreparation tips prior to MS. We have identifiedseveral neuron-related proteins in CSF, such asamyloid precursor-like protein, chromogranin A(Figure 6), chromogranin B, glial fibrillary acidicprotein, β-trace, transthyretin, ubiquitin, andcystatin C. Proteins from a detergent-solubilizedhuman frontal cortex homogenate have also beencharacterized, including membrane proteins suchas synaptophysin, syntaxin, and Na+/K+ ATPase.One-third of the identified proteins had notpreviously been identified in human CSF orhuman frontal cortex using proteomic techniques.Advantages of this method compared to 2-Dliquid-phase electrophoresis are the speed ofanalysis and the easy handling. The wholeprocess, from dialysis of CSF to MALDI analysis,can be completed in 18 hr.

Preparative 2-D liquid-phase electrophoresisallows high protein loads (up to 1 g) and larger

Rotofor fraction

200116976655

3631

2114


volumes of sample (up to 55 ml), thus yieldingsufficient amounts of low-abundance proteins forfurther characterization by MS. Removal of SDSwith chloroform/methanol/water or ice-coldacetone easily interfaces electrophoresis withMALDI-MS (Puchades et al. 1999b).

DiscussionGiven the complexity of protein expressionpatterns in living organisms, it is difficult to claimthat a single type of separation is ideal for globalprotein analysis. Analytical 2-D electrophoresiswill continue to be a cornerstone in the field ofproteomics in the near future, because of thetechnique’s ability to resolve and visualize severalthousand proteins. But because standard 2-Delectrophoresis fails to resolve some types ofproteins, combinations of 2-D electrophoresis with other methods (preparative liquid-phaseelectrophoretic separations) will continue to be key approaches to studying global proteinexpression, especially in biomedically importantareas such as neuroscience.

The advantages of using liquid IEF to separateand identify proteins from complex biologicalmixtures are the speed of analysis, high loadcapacity in the IEF separation, and retention of very large, small, highly basic, membrane-associated, or low-abundance proteins, yieldingsufficient amounts for characterization by MS. In a proteomic approach, direct 2-Delectrophoresis or a combination of liquid-phaseIEF and 2-D electrophoresis will be used to studythe expression and posttranslational modificationsof disease-related proteins, while preparative 2-D electrophoresis will be used to identify and characterize low-abundance and membrane-associated proteins.

The use of complementary strategies inproteome studies of cerebrospinal fluid and braintissue is expected to offer new perspectives on thepathology of neurodegenerative diseases, andreveal new potential markers for brain disorders.

ReferencesDavidsson P and Nilsson CL, Peptide mapping of proteins incerebrospinal fluid utilizing a rapid preparative two-dimensionalelectrophoretic procedure and matrix-assisted laserdesorption/ionization mass spectrometry, Biochim BiophysActa 1473, 391–399 (1999)

Davidsson P et al., Proteome studies of human cerebrospinalfluid and brain tissue using a preparative two-dimensionalelectrophoresis approach prior to mass spectrometry,Proteomics 1, 444–452 (2001)

Davidsson P et al., Proteome analysis of cerebrospinal fluidproteins in Alzheimer patients, Neuroreport 13, 611–615 (2002)

Davidsson P et al., Characterization of proteins from humancerebrospinal fluid by a combination of preparative two-dimensional liquid-phase electrophoresis and matrix-assistedlaser desorption/ionization time-of-flight mass spectrometry,Anal Chem 71, 642–647 (1999)

Davidsson P et al., Identification of synaptic vesicle, pre- andpostsynaptic proteins in human cerebrospinal fluid usingliquid-phase isoelectric focusing, Electrophoresis 20, 431–437 (1999)

Puchades M et al., Analysis of intact proteins fromcerebrospinal fluid by matrix-assisted laser desorption/ionization mass spectrometry after two-dimensional liquid-phase electrophoresis, Rapid Commun Mass Spectrom 13,2450–2455 (1999)

Puchades M et al., Removal of sodium dodecyl sulfate fromprotein samples prior to matrix-assisted laser desorption/ionization mass spectrometry, Rapid Commun MassSpectrom 13, 344–349 (1999)

Sjögren M et al., Both total and phosphorylated tau areincreased in Alzheimer’s disease, J Neurol NeurosurgPsychiatry 70, 624–630 (2001)

Westman-Brinkmalm A and Davidsson P, Comparison ofpreparative and analytical two-dimensional electrophoresis forisolation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometric analysis of transthyretin incerebrospinal fluid, Anal Biochem 15, 161–167 (2002)

Coomassie is a trademark of Imperial Chemical Industries,PLC. NOVEX NuPAGE is a trademark of InvitrogenCorporation. SYPRO is a trademark of Molecular Probes, Inc.Bio-Rad is licensed by Molecular Probes to sell SYPROproducts for research use only, under US patent 5,616,502.ZipTip is a trademark of the Millipore Corporation.

reportstechnical

Bio-Rad. We’re Serious about Science Education.

BiotechnologyExplorer™

c l a s s r o o m k i t s • c u r r i c u l a • e q u i p m e n t • s u p p o r t

The raw materials of great teaching are information and resources. Bio-Rad makes a difference by offering the finest biotech teaching tools, technical assistance, and teacher training programs available anywhere.

Our inquiry-based Biotechnology Explorer kits and curricula not only provide thorough, current information thatreflects the applications of science and technology in our lives, but also give students hands-on experience with thesame tools and techniques that real researchers use. There is no better way for students to understand today'sbiotechnological advances than this integrated approach.

Bio-Rad is committed to preparing teachers and students for the demands of tomorrow and supports implementationand standardization of biotech activities in the classroom. Discover Biotechnology Explorer.

Visit us on the Web at explorer.bio-rad.comCall toll free at 1-800-4BIORAD (1-800-424-6723);outside the US, call your local Bio-Rad sales office.

Request bulletin 2112 on the reader response card.

Some people are wary of the phrase “Contactcustomer service”. Bio-Rad, however, aims to

make customer service a positive experience foryou. Besides creating some of the most effectiveinstruments and products for your research, Bio-Rad wants you to get the best use out ofthem. If you have questions or problems, Bio-Radencourages you to avail yourself of its variouscustomer services.

“At Bio-Rad, we strive to provide efficiency, in-depth technical support, and a human interaction,”says David Greenwood, PhD, Customer Operationsmanager. “If you have a question about one of ourproducts, not only will we provide the answer, butwe will do it quickly, and provide some otherinsights as well. We don’t only represent Bio-Rad,we represent your research.”

Bio-Rad Laboratories’ Life Science Groupprides itself on the quality of its customer service.Its instruments, equipment, and reagents have

been used to advancescientific research worldwide.Bio-Rad knows that thosetools, and the company’sname, gain value from goodpartnerships with the peoplewho use them.

“Our customer servicestaff is on the front line,” saysGreenwood. “They are the

ones who have to not only know our tools, butmake sure they can be used effectively in ourcustomers’ research — whether it is in a largepharmaceutical company or a university lab. Thesefront-line specialists can become a real asset toyour research team.”

Bio-Rad’s clients can access customer servicesin many ways. The appropriate service to contactwill depend on your specific need, your location,


and when you need the information. How do youreach customer services? If you don’t already knowhow to contact your local customer servicerepresentatives, you can find this information onthe inside front cover of this magazine, or fromBio-Rad’s web site at discover.bio-rad.com. Hereis a glimpse of the services that are offered.

Field Sales:At Your Doorstep, Ready to HelpThe Field Sales representatives are the face of Bio-Rad, people who meet you in person andtailor their services to your needs. This group hasseveral hundred highly trained professionalsaround the world who are specialized in specificproduct subgroups. They understand the differentrequirements of a small research laboratory and alarge drug manufacturer, and can assist bothaccordingly.

Working closely with Field Sales representatives,field application specialists offer support for newtechnologies such as the iCycler iQ™ real-timePCR detection system or the Bio-Plex™ proteinarray system. These sophisticated products require

“At Bio-Rad, we strive toprovide efficiency, in-

depth technical support,and a human interaction”

Two-thirds of Bio-Radheadquarters’ Technical Supportconsultants have advanceddegrees, mostly PhDs. Theirbackground and training allow themto talk to customers as colleagues.

Experience, Efficiency,and a Human Touch

Accessing Customer

Services


“Our agents understand that a majority ofcustomers prefer human interaction,” says Torres.“People feel better hearing a human voiceanswering questions about their account orhelping them with their order. It’s just anotherway that we can give personal assistance, build

specialized attention so that customers can quicklylearn the new technologies. Field applicationspecialists may visit a customer’s laboratory forinstallation and training, and return later for morein-depth support.

Sales Operations:You’re More Than Just an Order NumberThe Sales Operations group provides easy orderingwith a human touch.

“In the call center we are committed toanswering all calls within 30 seconds,” says ZenTorres, Sales Operations manager for the US. “Inaddition, we offer quick confirmations on fax ande-mail orders.”

Sales Operations is central to customer service,providing bids and quotes while you areconsidering a purchase, and processing the ordersthat come in. Sales staff can be contacted byphone and fax, and in selected countries, onlineaccess is also available (see sidebar, page 34).Online services are provided by the same localsales staff and Field Sales account managers whohandle phone and fax orders, bids, and quotes.

Customer Mind Readers

Anthony Alburo, a Technical Support supervisor, isn’t clairvoyant, but sometimescallers almost believe he is. “I was talking to a customer about some softwarefeatures over the phone, and I must have been describing her screen and followingher actions so accurately that she asked, ‘How can you tell what I’m doing?’ Ijokingly replied, ‘I can see you through your computer monitor.’ ‘Really?’ she asked.I quickly assured her that I was kidding, but because I had the same software open,and understood the nature of her questions so well, it almost seemed as if I couldsee her computer.”

Alburo may have been teasing his customer, but his story illustrates Bio-Rad’scommitment to establishing strong customer relationships. Whether you’re talking to aTechnical Support consultant over the phone or handling a new instrument with yoursales representative, you get more than just hardware advice. You get someone whocares about your research needs — so much so that they seem to read your mind.

Bio-Rad’s field engineers (left) andTechnical Support consultants (right)train constantly so that they canresolve problems efficiently.

Pho

tos

by L

enny

Gon

zale

z


relationships, and ensure satisfaction.”The US operation has four subgroups: the

Order Call Center, the Support Team thathandles special accounts and transactions, theBids and Quotes team, and Global Expeditingthat manages subsidiary orders and its inherentcomplexities, as well as customized orders andsoftware registration.

Customers in other countries interact withsubsidiaries that are owned wholly by Bio-Rad,instead of third parties. Regional subsidiariesthroughout the world, which often combine localsales and distribution services, mean better localaccess to product ordering and related services.

Technical Support:We Speak Your LanguageIf you have a question or problem regarding aspecific instrument, Bio-Rad headquarters has 25 qualified Technical Support specialists inchromatography, protein electrophoresis, imaging,and nucleic acids ready to receive your phone call.With their expertise, they are usually able toanswer your questions quickly and thoroughly.

“We have a high proportion of advanceddegrees among our staff,” says Andy Shaw, PhD,Technical Support manager. “They are extremelyknowledgeable, and they love helping people.When we hire to fill technical support positions,not only do we look at the applicants’ academicresumes, we look at how well they work withpeople.”

In addition, Technical Support consultantsspeak the same language as the research clients —literally and figuratively. “We have eight differentlanguages spoken among our personnel,” saysGreenwood, “so not only are they extremelyqualified technical experts, but they cancommunicate with a variety of customers fromaround the world.” Customers worldwide can alsoreach Bio-Rad’s Technical Support headquartersthrough the Internet (see sidebar below).Customers outside the US also have the option tocontact local technical support staff. “Thesesubsidiaries can provide live technical support forcustomers in the same time zones where theywork, and can often respond to certain problems— such as local instrument service calls or quick

Online Resources

Bio-Rad’s web site offers convenient meansof accessing personalized customer services.

Customer Service Contact InformationAn easy way to find contact information foryour local customer service representatives isto go to discover.bio-rad.com and selectyour country from the pull-down menu.

Online Ordering (for Selected Countries)Bio-Rad now offers online ordering tocustomers in the US, the UK, Belgium,Luxembourg, the Netherlands, and Israel.When you register as an online user, you gaingreater ordering convenience as well asaccess to sales representatives, bids andquotes, and information on order status.

Technical SupportDon’t worry about lost time if you’re workinglate at night or are far away from Bio-Rad’sheadquarters, and need immediate informationabout a Bio-Rad product. Via the Internet,you can access Bio-Rad’s technical supportservice at consult.bio-rad.com. This serviceallows you to get answers to questionsabout products, techniques, or applicationsfrom Technical Support staff at Bio-Rad's LifeScience Group headquarters. Anyone iseligible for this service. All questions arepersonally answered by e-mail within onebusiness day. In addition, Bio-Rad's literaturelibrary is accessible from anywhere in theworld. The library includes more than 300

instruction manuals, dozens of technical andapplication notes, information about specificproducts, Material Safety Data Sheets, andsoftware demos. Most literature is available indownloadable PDF format. Bio-Rad can alsomail or fax copies of literature on request.

In addition, several thousand frequentlyasked questions (FAQs) are posted online.These searchable FAQs are a valuable collectionof technical information and troubleshooting tips.

Providing Your FeedbackIf you have comments about our customerservices, please let us know. Go todiscover.bio-rad.com, click on “visitorfeedback”, and send us a note.

If Technical Support consultantscan't resolve problems over thephone, they frequently bring theinstrument in for evaluation, usingthe customer’s conditions toduplicate the problem.


replacement requests — more quickly,” saysTrevor Brown, Technical Support specialist at Bio-Rad Laboratories Canada.

Like all Bio-Rad customer service professionals,the technical support staff is trained to ask theright questions, Shaw says. And that includeswhen they don’t know an answer. “Usually theyknow the answers, but if they don’t, they will askwhoever they need to, to find out what you need,”Greenwood says. “We even help out customers whoare using competitors’ products so the customer’sresearch can continue.”

Distribution and Literature Fulfillment:What You Need, When You Need It“Distribution of our instruments and products isthe heart of our business,” says Greenwood. “Ifthere is a problem there, our shipments won’t getto their destinations, or will take too long.”

Luckily for Greenwood and Distributionmanager Scott Mangini, that hasn’t been an issue:Bio-Rad’s distribution headquarters has a 99.9%service level, which means that virtually everyitem ordered and in stock is shipped out that sameday. That is sometimes as many as 1,100 packages,but Mangini’s staff of more than thirty does itsbest to ensure that nothing is left behind. Thedistribution center also coordinates shipments tosubsidiaries, which then distribute orders locally.

Another aspect of distribution that Manginiand Greenwood are proud of is the packagingrecycling program. Bio-Rad encourages customersto recycle reusable foam containers by including apostage-paid return label with such containers.

All of Bio-Rad’s products come with instructionmanuals and other helpful publications. You canrequest additional publications by phone, fax, orthe Internet, and have them sent to you by mail orfax. Customers can also browse or search Bio-Rad’sliterature library at discover.bio-rad.com. Mostpublications are downloadable (sidebar, page 34).

Repair:Keeping You Up and RunningCoordination of services becomes especiallyimportant in repair. “Whether an instrument isrepaired in-house or by field service technicians, it is important that the technician, TechnicalSupport, Parts, and Sales departments worktogether as a team,” Greenwood says. Each has arole to play when an instrument is down. TechnicalSupport needs to ask the right questions so the

field engineer is prepared, Parts needs to get theparts there in time, and Sales needs to coordinatewith any training or demonstration activity. Fieldengineers will not only help repair a product, butalso help customers use it more efficiently.

If an instrument can’t be repaired on-site, it issent back to Bio-Rad Laboratories and fixedthere. In the meantime, if the turnaround time islonger than the customer cares to wait, Bio-Radwill provide the customer with a “loaner,” areplacement instrument, until the other one isrepaired. “Our goal is to have our customers saythat they enjoy working with Bio-Rad.”

From the moment a client decides to purchase aBio-Rad product until the day it’s no longerneeded, Bio-Rad’s customer services will be there. It is a relationship that is as important as theproducts themselves. So if you’re thinking aboutpurchasing a Bio-Rad product, or if you alreadyown one, remember that customer services arepart of the package.

Bio-Rad’s 40,000 ft2 distributionheadquarters runs like clockwork,getting your package into theshippers’ hands within minutes ofyour placing an order.

Helping Tomorrow’s Scientists Today

Bio-Rad’s Technical Support group is one of the mosteducated in the industry. Almost everyone who answers acall for help has a PhD, and many have had postdoctoralexperience. Those credentials allow them to wear a varietyof different “hats” when helping customers with theirresearch. Still, Dr. Ingrid Hermanson-Miller, a TechnicalSupport consultant in the electrophoresis group, didn’texpect to become a high school science fair project advisor.

That’s the role she found herself in when she answered a call from Pat Appel ofAlbuquerque, NM. Appel’s son, Daniel, was designing a science fair project, and heneeded some advice.

Daniel’s question wasn’t trivial, as the 15-year-old freshman at El Dorado HighSchool has won national awards for his scientific research. This particular ideainvolved biocatalytic composites, and looking at unique enzymes and the factorsthat facilitate adaptability under extreme conditions. Unfortunately, his school didn’thave the appropriate instruments to help him, but Bio-Rad did. Not only didHermanson-Miller spend time giving Daniel advice on his project, she recommendedsome instruments, compounds, and the correct electrophoresis kit he would need tofinish the research.

In the course of their work together, both she and Daniel decided that the scopeof the research was too big, so Hermanson-Miller helped Daniel scale down hisresearch topic, and take it one step at a time.

“Ingrid was great,” Pat Appel says. “I am an engineer, but in no way did I know thetechnical details of what they were talking about. She was able to explain the issuesto me in layman’s terms. She was extremely patient and knowledgeable, and shehelped Daniel save time and focus his research. I have spoken with other companies’tech support units, and been treated like a number. That doesn’t happen at Bio-Rad.”


IntroductionFast and efficient protein purification is essential to explore the structure and function of proteinsin the human proteome. Successful proteinpurification strategies use experimental conditionswhere proteins of interest are stable and havechromatographic properties different fromcontaminating proteins. Significant time is oftenrequired to optimize chromatography parameters,such as buffer pH and gradient characteristics.Furthermore, purification strategies need to beeasily scaled as the amount of protein requiredincreases from milligram to gram quantities.

The new Maximizer buffer blending system, a component of the BioLogic DuoFlow™

chromatography system, significantly decreases the time and resources required for chromato-graphy method development. With a single set of three salt solutions, the system can performseveral chromatography experiments, varying thepH or gradient characteristics, or both, for eachrun. It is not necessary to prepare separate buffersfor each chromatography experiment, and thesystem performs the experiments unattended.Data from the experiments are easily viewed andcompared using the new Trace Compare feature ofthe BioLogic DuoFlow software.

ApplicationWe were interested in purifying a recombinantprotein in milligram quantities, anticipating futurescale-up to preparative quantities. The 25 kDprotein of interest is overexpressed as an E. coliinclusion body. Information from similar proteinssuggested a stability range of pH 6.0–9.0. Theprotein was solubilized and clarified from cellpaste using standard techniques. We used the pHscouting capability of the BioLogic DuoFlowMaximizer™ system to determine the pH thatprovides the best resolution.

Methods We selected a Bio-Scale™ Q2 column for thechromatography, and Bis-Tris/Tris from the menuof buffer systems because its buffering rangematched the stability range of the protein. Wedecided to run separations at pH 6.0, 7.0, 8.0 and8.9, using a 50 ml, 0–75% buffer B (1 M NaCl)gradient for our preliminary experiments. Theprotein solution was diluted 1:10 with Bis-Tris/Trisloading buffer. The 5 ml sample loop was filledusing an Econo™ gradient pump controlled by theautomatic loop fill/inject function. Samples werecollected by a BioFrac™ fraction collector, usingThreshold collection to minimize the number of

Rapid Chromatography Optimization by pH Scouting Usingthe New BioLogic Maximizer™ Valve SystemChris Moran, Bio-Rad Laboratories, Inc., 2000 Alfred Nobel Dr., Hercules, CA 94547

Fig. 1. Chromatograms from fourscouting runs, pH 6.0 to 8.9.

A200

100

000

1 3 4 5 6 7 8 10 12 14 17 20 22 25 27 29 3110.0

7.5

5.0

2.5

00

Fractions

A28

0

B200

100

000

67 69 74 77 80 82 84 86 89 91 9310.0

7.5

5.0

2.5

00

A28

0

Run time, min

C200

100

000

33 36 38 41 43 47 51 53 55 56 59 61 6310.0

7.5

5.0

2.5

00

Fractions

pH

200

100

000

97 99 102 106 108 110 112 115 11710.0

7.5

5.0

2.5

00

Run time, min

D

pH

reportstechnical

pH 6.0 pH 7.0

pH 8.9pH 8.0


tubes required. As coldroom space is limited in thelab, the collected samples were kept on ice usingthe BioFrac fraction collector’s ice bath/microplaterack feature. Between experiments, the system wasequilibrated to a new pH using the Hold Untilfunction of BioLogic DuoFlow version 4.0software. This function monitors the pH of thecolumn effluent, and continues the run as soon asthe desired pH is reached, reducing run time andvolume of buffer required.

ResultsChromatograms from the four runs are shown inFigure 1, and a Trace Compare overlay of the UVtraces is shown in Figure 2. The separation at pH 6shows a single peak, which is believed to containthe protein of interest, and a second peak groupcontaining contaminants. The separations at pH 7and 8 show increasing resolution of the peaks ofinterest, with the best resolution at pH 8.9.

The run reports were printed automatically and the samples were stored in the BioFrac icebath collection rack. The BioLogic DuoFlowsoftware handled everything from automated sampleloop loading and injection to comparison of results.

The buffer blending and pH scouting capabilitiesof the Maximizer system allowed execution of thisexperiment with minimal attendance. The totaltime for the set of four separations was 5 hours. Theexperiment was started at the end of the day, andran unattended during the evening. Eliminating the need to make up three extra sets of bufferssaved an estimated additional 1.5 hours of labor.The reduced waste from unused buffers was anadditional cost savings.

Peak IdentificationSamples from the first set of peaks were run on aCriterion gel, using Precision Protein™ prestainedstandards to identify the proteins by molecularweight. In the gel (Figure 3), the protein of interestappears in fractions 105–110, with the highestconcentration found in fractions 106 and 107.

Scale-Up PlansWe are now scaling up the recombinant proteinseparation. A larger column will be required toproduce sufficient protein for the next phase ofdevelopment. This will require approximately 70 ml/min of flow at a total system pressure of 500 psi. We will install F40 pumpheads on ourexisting DuoFlow system to increase the maximumflow rate to 80 ml/min at 1,000 psi. A preparative

Fig. 2. Comparison of separationsusing “Trace Compare” feature.Green trace, pH 6.0; red, pH 7.0;yellow, pH 8.0; blue, pH 8.9. Greentrace is set to scale; other tracesoffset vertically for comparison.

100 101 102 103 105 106 107 108 109 110 113 114 115 116

peak 2 peak 3peak 1

➞

Fig. 3. Criterion™ gel separation ofpeaks of interest. Arrow indicatesthe protein of interest.

200

100

000

40 5030

Run time, minAU pH

A28

0

rack for the BioFrac fraction collector will allowcollection of the larger fractions involved.

ConclusionThe optimum pH for this separation on the Bio-Scale Q2 was pH 8.9, at the high end of theprotein’s stability range. Gel electrophoresisconfirmed the presence of the protein of interest.The purity of the recovered protein was good,with faint bands indicating that some otherproteins were present. We will experiment withother gradient slopes, using the queueing functionof the software to attempt to resolve the smallshoulder peaks on each side of the main peak onthe chromatogram.

The Maximizer system, with its buffer blendingcapability, allowed us to determine the pH foroptimum separation in an automated pH scoutingexperiment. Using this system, we reduced thetime required to purify the protein and were ableto proceed to the next phase of the project morequickly and easily than we would have by mixingeight buffer solutions and moving tubing manuallybetween runs.

For more information, request bulletin 2700 onthe reader response card.

Now you’re only 24 hours away from raising your productivity to an even higher level, because 2-D in a Day

lets you run more electrophoresis separations in less time.

2-D in a Day, with the Criterion™ system of gels and cells, offers the optimal combination of speed and

resolution for high-throughput screening, protocol development, or rapid analysis. Criterion’s unique size

maximizes separation in the first dimension and maintains the speed of a mini in the second dimension.

Using the Criterion Dodeca™ cell, you get results from 12 gels in the same time it takes to run one. Add

new micro-range ReadyStrip™ IPG strips, and you can zoom in on a smaller pH range to reveal additional

proteins for identification.

2-D in a Day. A complete suite of hardworking, innovative tools provides the high-quality, reproducible

2-D results you need — on a daily basis. To find out more, visit our web site at www.proteomeworks.com

2-Dinaday

Visit us on the Web at discover.bio-rad.com Call toll free at 1-800-4BIORAD (1-800-4246723); outside the US,contact your local sales office.

IncreaseYour Daily DosageBoost your productivity and 2-D output with these powerful tools from Bio-Rad.

PROTEAN® IEF Cell Criterion Dodeca CellReadyStrip IPG Strips Criterion Precast Gelwith IPG+1 Comb

Request bulletin 2112 on the reader response card.

Req

uest

bul

letin

256

8 on

the

read

er re

spon

se c

ard.


OverviewVersaDoc systems correct the nonuniformity that is inherent in sample imaging by using unique flatfielding technology, which compensates fornonuniformities of both the light source and thelens. This superior dynamic correction methodworks for both UV and white light imaging. Image variability is 30-fold less than a competitor'ssystem, with a 1.1% coefficient of variation.

IntroductionBio-Rad has developed a method of dynamiccorrection for image nonuniformity that issuperior to traditional static image correction.Several sources of nonuniformity are inherent inall imaging systems. These include the detector,the lens, and the light source. By careful designand manufacturing, the sources of nonuniformitycan be minimized but not eliminated. To furtherimprove the ability of an imaging system togenerate an accurate and quantitatable image,software can be used to correct for the physicallimitations of the instrument.

Lenses are typically positioned over the centerof the sample to be imaged and therefore mustcapture light that originates at different distancesfrom the lens. This positioning leads to differentlight intensities collected from the center to theperiphery of the image. The differences inintensity are most pronounced when the field of view is large. Intensity differences can becompensated for mathematically but thecorrection values change with the aperture, focalplane, and zoom position of the lens. Therefore,using a single correction factor is an impracticalsolution and a dynamic means of generating acorrection factor is preferable.

Lens correction does not account forillumination variables. Light sources emit light ofvariable intensity along the length of the bulb,

The VersaDoc™ Imaging Systems Eliminate Nonuniformitieswith Patent-Pending Flat Fielding Technology

focusproduct

and the intensity also decreases with distance fromthe bulb. Reflections from within or around thelight source are further sources of variability. Ascanning light source, such as a flat-bed scanner,can correct for this problem along the scanningdirection, but nonuniform intensity along the axisof the bulb is still present.

Bio-Rad has introduced the family of VersaDocimaging systems, which has addressed the issues ofnonuniformity in digital image acquisition. Thedesign of these systems minimizes introduction of nonuniformity through the lens by employinghigh-efficiency F-mount lenses. The transmittedlight source has a unique design that utilizes onlyreflected light from the bulbs in order to generatea particularly uniform field of illumination.Finally, to remove the remaining hardware-relatednonuniformity, the VersaDoc imaging systems usea reference illumination plate and acquisitionsoftware to mathematically adjust the acquiredsample image to generate a virtually flat field of intensity.

Illumination Flat Fielding Technology CorrectsLens and Light Source NonuniformitiesThe VersaDoc imaging systems use a dynamiccorrection file to account for image nonuniformityrather than using a static correction factor, which istypically employed. The Bio-Rad method correctsfor both lens and light source nonuniformity sincethe correction factor is generated with lens andlighting conditions identical to the sample image.After capturing an image of a sample, theacquisition window in Quantity One® softwareprompts the researcher to place a reference plate onthe transilluminator in order to acquire a referenceimage (Figure 1). The reference plate is a materialthat serves as an approximationof a uniform field of lightemitted from a typical sample

Fig. 1. VersaDoc acquisitionwindow in Quantity One software.


focusproduct

matrix. An image generated from the referenceplate using the current light source and lens settings in the VersaDoc instrument will record anynonuniformities caused by the system. Softwareanalyzes the reference image and quantitates anydeviation from the theoretical homogeneous lightintensity for every pixel. Any nonuniformity causedby the physical limitations of the instrument is thencorrected in each pixel of the sample image toproduce a flat field.

MethodsImaging was done on VersaDoc Model 1000 and3000 imaging systems (catalog #170-8010 and170-8030) and an Alpha Innotech FluorChem8000 system. Data were analyzed with QuantityOne software version 4.2.3 (catalog #170-8601)and Microsoft Excel 97.

Fig. 2. Comparison of VersaDocsystem to competitor’s system byvolume analysis of platen images.Images are of a VersaDocfluorescent reference plate. A,VersaDoc Model 1000 image,without flat fielding (11% CV). B,Alpha Innotech FluorChem 8000image (32.2% CV). No saturationwas detected in either image. The images have been transformedwith Quantity One software to showthe areas of nonuniform intensityacross the platens. The softwareplaced an array of 96 equalvolumes (blue circles) over eachimage for analysis of field intensityvariance. The volume report wasexported to Excel for statisticalanalysis. Relative intensity profilesfor the horizontal center (C) andvertical center (D) of each imagecompare the images acquired usingthe VersaDoc (blue lines) and theFluorChem (pink lines).

1.6

1.2

0.80.8

0.4

0Position on platen

Rel

ativ

e in

tens

ity

1.6

1.2

0.8

0.4

0Position on platen

Rel

ativ

e in

tens

ity

A

B

C

D

ResultsThe Fluorescent Reference Plate Emits a Uniform Field of Light IntensityIllumination flat fielding of an image assumesthat the reference image is generated from aknown material that emits a uniform field oflight. The assumptions were verified for aVersaDoc imaging system by analyzing theuniformity of images from the fluorescentreference plates in two orientations that differedin orientation by 90°. Both images showedvirtually identical uniformity at each point in theimage. A similar experiment performed with thewhite light conversion screen, which is placed onthe UV transilluminator to convert UV to visiblelight, resulted in low variability as well (data notshown). These results indicate that thefluorescent reference plate and white lightconversion screen generate a uniform lightintensity regardless of orientation, and thereforeare excellent reference materials to use forillumination flat fielding that approximatesexperimental samples.


The VersaDoc Imaging System Has SuperiorUniformity Compared to the CompetitionThe nonuniformity of the VersaDoc imagingsystem is low even before flat field correction, witha coefficient of variance (CV) of approximately11% (Figure 2A). The low nonuniformity is aresult of the high-quality F-mount optics and theunique design of the transmitted light source. Incontrast, the image nonuniformity of the AlphaInnotech FluorChem 8000 system, a representativecompetitor system, is far greater than that of theVersaDoc, with a CV of 32% over the entire imagearea (Figure 2B).

The variability in the FluorChem system ismost pronounced along the horizontal axis (Figure2C, pink line), showing a dramatic reduction inintensity with increasing distance from the centerof the image. At the most extreme, the intensity

deviates by 80% from the average. Without usingillumination flat fielding, the VersaDoc also showssome variability along this axis, but deviates fromthe average by only 10% at most (Figure 2C, blueline). Both systems show better uniformity alongthe vertical axis, but again the VersaDoc exhibitssmaller deviations from the average (Figure 2D).

Illumination Flat Fielding Improves ImageUniformity 10-FoldA 10-fold reduction in the coefficient of variance,to approximately 1%, occurs after applying Bio-Rad’s illumination flat fielding algorithm tothe platen image (Figure 3A). This is greater thana 30-fold reduction in variability compared to thesame image acquired by the Alpha Innotechimaging system (Figure 3B).

Comparing the horizontal intensity profile in Figure 3C to the corresponding profile in Figure 2C shows the extent of improvement by the illumination flat fielding algorithm. The entire length of the profile is now virtually homogeneous.

Images Are Visibly Improved by Illumination Flat FieldingNot only does a VersaDoc with image correctiongive better quantitative analysis, it also generates a better visual image. This is best demonstratedusing a large area of the platen, which shows theextremes of the imaging system hardwarenonuniformities. As seen in Figure 4, areas thatwould have displayed nonuniform background and

1.6

1.2

0.8

0.4

0

Position on platen

Rel

ativ

e in

tens

ity

A

B

CFig. 3. Comparison of VersaDocsystem with flat fielding correctionto competitor’s system by volumeanalysis of platen images. A,VersaDoc imaging system; theVersaDoc achieves a 1.1% CV with illumination flat fielding. Thereference plate imaged in Figure 2Bwas left in place and imaged asecond time using the flat fieldingoption. The same 96-volume arraywas copied from the initialuncorrected image to maintainexact pixel registration. B,reacquisition of same image withthe Alpha Innotech FluorChemimaging system, with a 32% CV. C, a horizontal lane profile acrossthe center of the images, whichcompares the image intensitiesacquired using the VersaDoc (blueline) and the FluorChem (pink line).


sample staining due to illumination and lenslimitations without correction become veryuniform when illumination flat fielding is appliedto the image.

ConclusionIllumination flat fielding is a mathematicaladjustment of the intensity of each pixel in animage to accurately represent the data as it wouldappear if imaged using optimal hardware. Inreality, no hardware is perfect, so use of a dynamiccorrection factor allows quantitative data to be more accurately recorded by digital images.

Both the fluorescent reference plate and thewhite light conversion screen used to generate areference image for illumination flat fielding emituniform light regardless of orientation on theplaten. However, these materials must beundamaged to avoid introduction of error into thecorrected image. Even though illumination flatfielding can compensate for intensity variationsacross a given image, it cannot compensate fordifferences in intensities between twoindependent images, regardless of whether thesame lens settings and light source are used.Therefore, each gel being imaged needs to haveinternal standards for reference to allowquantitation between images.

With Bio-Rad’s patent-pending illuminationflat fielding technology, you can remove asignificant variable in the use of digital imageacquisition to quantitate biological samples.Direct comparison of data generated from aFluorChem imaging system and a VersaDoc

Fig. 4. VersaDoc Model 3000 white light image of a 20 cm 2-Dgel using illumination flat fielding.Pseudomonas putida extract wasfocused on a pH 4–7 ReadyStrip™

IPG strip, then separated on a 20 x 20 cm Tris-HCl 8–16%gradient polyacrylamide gel. The gelwas stained with Bio-Safe™

Coomassie stain. The destainedwet gel was imaged on the whitelight conversion screen. Imageswere transformed to display theintensity levels for data distributedover 256 gray levels. Samplecourtesy of Michael Kertesz,University of Manchester, UK.

show that variability of image intensity, alreadyimproved about 3-fold with VersaDoc hardware, is improved approximately 30-fold whenillumination flat fielding is used.

The tested FluorChem system is typical of mostavailable systems that utilize C-mount lenses,which exhibit a high amount of nonuniformity.Therefore, the results shown here are expected to approximate competitor systems in general. By utilizing an F-mount lens, a uniquely designedtransmitted light source, and dynamic flat fieldcorrection, VersaDoc imaging systems generate an image that is quantitatively and visually betterthan the competition.

Ordering InformationCatalog # Description170-8010 VersaDoc Imaging System Model 1000, PC170-8011 VersaDoc Imaging System Model 1000, Mac170-8030 VersaDoc Imaging System Model 3000, PC170-8031 VersaDoc Imaging System Model 3000, Mac170-8050 VersaDoc Imaging System Model 5000, PC170-8051 VersaDoc Imaging System Model 5000, Mac

Coomassie is a trademark of Imperial Chemical Industries,PLC. Excel is a trademark of Microsoft Corp. Mac is a trade-mark of Apple Computer.

For additional copies of this article, requestbulletin 2753 on the reader response card.

The ProteomeWorks system is the global alliance between Bio-Rad Laboratories, Inc. and Micromass-Waters, Ltd.,dedicated to furthering proteomics research.

focusproduct


What Contributes to Long Focusing Timesor Inability to Reach Desired Voltage?Conductivity affects the focusing time and finalvoltage reached during IEF of IPG strips. Forexample, the sample/rehydration buffer (includingampholyte concentration), amount of proteinloaded, and pH range of the IPG strip allcontribute to the total conductivity. Conductivityis inversely proportional to resistance, so toincrease the resistance (and therefore voltage),the conductivity must be lowered. According toOhm’s Law, if current is held constant as theresistance increases, voltage will increase. Becausethe current must be limited to avoid overheatingor burning of the strips, in practice the voltagewill be controlled by the conductivity, which if itis high equates to a lower final voltage or a longerfocusing time to reach the desired volt-hours.

During the course of a run the initial voltage isrestricted by the recommended limit of 50 mA perstrip, and over time salts and other contaminantsin the sample move out of the strip and thedesired voltage is approached. Actually achievingthe desired voltage depends on the IPG pH rangeof the strip, and the sample’s composition.

The optimum salt concentration is about 10 mM,although 40 mM can be tolerated. Highconductivity can result from buffer salts in thesample, or from an inherently high conductivity of the sample (e.g., serum). We suggest desaltingor diluting the sample so that the totalconductivity is as low as possible. Ampholytes can often be substituted for salts in the samplesolution. We recommend a final concentration of not more than 0.2% (w/v) ampholytes. If thesample has a high ionic strength, the ions can

2-D Electrophoresis: Troubleshooting Isoelectric Focusing

be removed with a Micro Bio-Spin™ 6 or MicroBio-Spin 30 columns for samples of ≤75 µl, andwith an Econo-Pac™ 10DG desalting column forsamples of 1–3 ml. These columns, which contain10 mM Tris, will remove small molecules and ionsfrom a protein sample with excellent proteinrecovery and no dilution.

The time required for the voltage ramp varieswith strip length, pH range, sample, and samplebuffer due to the 50 mA per strip current limit.Target volt-hours and run times can be shorteneddepending on sample and desired results. If thefinal voltage is not achieved during the setramping time, the ramp time should be increased.The figure below illustrates that voltagesachievable with strips covering a lower pH rangeare not as high as with other strips, because lowpH range strips are more conductive.

The simplest approach to focusing highlyconductive samples is to be patient. Use electrode wicks as a reservoir for salts and othercontaminants, and give the system sufficient timeto reach high voltage.

Arcing or Burned IPG Strips DuringFocusing RunElectrode wicks should be used to absorb ioniccontaminants that migrate to the ends of IPGstrips during the run. Otherwise, the ions willcollect at the electrodes and create regions of lowresistance. Regions of low resistance cause highcurrent and high heat, leading to waterevaporation, which may result in arcing orburning of the strip. This problem is indicated bythe variable resistance error message when usingthe PROTEAN® IEF cell. Incomplete or uneven

tipsand techniques

The relationship between IPG pHrange and final voltage using E. colisample from Bio-Rad’s ReadyPrep™

2-D starter kit.

Ohm’s Law (V = IR)

Voltage = 50 mA/strip (Limit) x Resistance

and Conductivity Affects Resistance

12

10

8

6

4

2

Fina

l vol

tage

, kV

pH 3–6

• 7 cm strip

• 11 cm strip

• 17 cm strip

pH 4–7 pH 5–8 pH 7–10 pH 3–10Strip pH range


Determining What Went WrongTo troubleshoot poor results, it is often helpful torecord a run’s progress. Linking the PROTEANIEF cell to an optional thermal printer provides arecord of the voltage and current every 5 minutes.The PROTEAN IEF cell can also be connected to a computer for data collection.

Ordering informationCatalog # Description165-4080 Thermal Printer, 100 V, includes cable and

power adaptor165-4082 Thermal Printer, 120 V165-4085 Thermal Printer, 220 V

For more information on salt effects, focusingstrategies, and connecting the PROTEAN IEFcell to a computer, request bulletin 2778,“Focusing strategy and influence of conductivityon isoelectric focusing in immobilized pHgradients” and bulletin 2651, “2-D electrophoresisfor proteomics: A methods and product manual”.

rehydration can also cause arcing or burned IPGstrips. To avoid poor rehydration:• Pipet the sample evenly along the back edge of the

tray channel, except for about 1 cm at each end• Gently place the strip, gel side down, onto

the sample• Take care not to get the sample on top of the

plastic backing of the strips, because this portion of the sample will not be absorbed bythe gel material

• Also take care not to trap air bubbles beneaththe strip; if this happens, carefully use forceps tolift the strip up and down from one end until theair bubbles move to the end and out from underthe strip

Detailed instructions and accompanyingillustrations to improve strip rehydration are inthe ReadyPrep 2-D starter kit instruction manual,available online at www.bio-rad.com.

Overfocusing can also cause arcing or burning of IPG strips due to movement of water to oneend of the strip, drying out the other end.

Do Your Separations at the Basic RangeLook Like This?

For separation of proteins at extreme pH ranges,cup loading improves sample uptake intorehydrated IPG strips for better resolution duringfirst-dimension IEF. Cup loading is now availablefor the PROTEAN IEF cell. For more informationon the new cup loading tray, see page 4.

E. coli protein extract (300 µg) fromthe ReadyPrep 2-D starter kit wasloaded onto an 11 cm ReadyStrip™

IPG strip (pH 7–10) via conventionalin-gel sample loading protocol.

BioRadiations Volume 108 45BioRadiations Volume 108 45

Help Yourself to Services OnlineOnline OrderingOnline ordering is now available for customers in the US, the UK, Belgium,Luxembourg, the Netherlands, and Israel. In addition to placing orders, you can also access:• Your quotes and pricing• Product content tailored to your interests• Online specials• Order and shipping status• Hot lists for quick reordering • A built-in approval process for purchasing managers• Direct e-mail to your account manager

Need a Quick Answer to a Technical or Product Question? We offer almost 3,000 self-service FAQs online. Our answers to customerquestions are a great source of product and technical information, available any time of the day, anywhere in the world. Visit consult.bio-rad.com for a direct link to our searchable FAQ database.

Access Online Technical SupportDid you know you can submit a technical question to “Consult Bio-Rad”, our professional technicalsupport team, and get a personal response in one business day? Visit consult.bio-rad.com for a directlink to this invaluable service, which is part of our commitment to helping you advance your research —providing you with high-quality product support in addition to the products themselves.

Replace Your Lost Instruction ManualsWe offer over 300 product instruction manuals in downloadable PDF format. Go to discover.bio-rad.comand click on the “Literature” tab under “Life Science Research” to find the manual that you need.

Just One Click to the World of Process SeparationsAt www.bio-rad.com/process/ we’ve created a new online community. After a simple registration process, you can take advantage of:• Bulletin boards — a forum to discuss all things chromatography• Ask the Expert — the direct link to Bio-Rad’s CHT™ ceramic

hydroxyapatite authorities• Consult Bio-Rad — a link to technical support representatives and our database

of technical FAQs • And a lot more… including a direct link to your regional sales representative,

literature and manuals, the latest news, an events calendar, a quote request form,and product information

Join us. Be a part of the process... www.bio-rad.com/process/

discover.bio-rad.com

www.bio-rad.com/process/

web@the


Confocal and Multi-Photon Image GalleryThe image gallery is a new feature of our Cell Science division web site. These inspiring and stunning images have been acquired byscientists all over the world using Bio-Rad confocal and multi-photon systems and show the use of particular fluorophores and biologicalspecimens. They can be viewed and downloaded either for educational use, or to better appreciate their aesthetics. See more beautifulimages by visiting the gallery on the Web at microscopy.bio-rad.com

1. Pupal Drosophila ovary stained with anti-tubulin (red), nanosGa14/UASp-sarcGFP (green),and anti-phosphorylated histone3 (blue). Imagecourtesy of Jorge Bolivar, Laboratorio deBioquímica y Biología Molecular, Facultad deCiencias, Universidad de Cádiz, Spain.

2. NIH3T3 fibroblasts transfected withtau and fyn. FITC labeling (green) correspondsto tubulin; Texas Red (red) corresponds to tau, a microtubule-associated protein, or fyn, a srcfamily nonreceptor tyrosine kinase. Co-transfected cells are round with strikingmicrotubule bundles and rings; untransfectedcells are flat and show typical microtubuleinterphase arrays. Image courtesy of Gloria Leeand David Gard, Department of InternalMedicine, University of Iowa College ofMedicine, Iowa City, IA USA. Reprinted bypermission of Journal of Cell Science.

3. Double-labeled rat cerebellum; FITC-labeled parvalbumin showing Purkinje cells andpropidium iodide-labeled nuclei. Image courtesyof Anna Smallcombe, Bio-Rad Microscience, UK.

4. Confocal image of a slice of mousegastrocnemius muscle showing a group ofneuromuscular junctions. The tissue was stainedwith α-bungarotoxin rhodamine to label acetyl-choline receptors (red), anti-synaptophysinfluorescein to label synaptic vesicles (green), andanti-neuron specific enolase to label the axons(blue). Image courtesy of Thomas Deerinck,National Center for Microscopy and ImagingResearch, Department of Neurosciences,University of California, San Diego, USA.

5. Drosophila egg chamber labeled withgreen NLS-GFP Staufen (green), BODIPY-phalloidin-actin (blue) and Texas Red anti-α-spectrin (red). Image courtesy of HermanLopez-Schier, St. Johnson Laboratory, Wellcome-CRC Institute, University of Cambridge, UK.

6. Developmental expression pattern ofStardust (Sdt) in Drosophila Sdt mutants. A honeycomb-like pattern of Sdt (green) formsat stage 9. Superimposed red staining is DNA(propidium iodide). Left inset, diffuse or absentSdt staining at the cell boundary in cellsundergoing mitosis. Right inset, Sdt enriched at sites of contraction of the apical cell surface

during cell invagination (tracheal pit shownhere). Image courtesy of Yang Hong and YuhNuung Jan, Howard Hughes Medical Institute,Department of Physiology and Biochemistry,University of California San Francisco, USA.Reprinted by permission from Nature.

BODIPY and Texas Red are trademarks ofMolecular Probes, Inc.

1.

2.

3.

4.

5.

6.

web@the

With the emergence of proteomics in the post-genomic era, Bio-Rad has taken the lead in providing a full suite of protein discoverytechnologies called the ProteomeWorks™ system.From sample preparation to protein identification,the ProteomeWorks system enables you to isolate,identify, and characterize complex proteinsignatures easily and quickly. Our informative,educational, and enlightening ProteomeWorkssystem web site complements and supports thesetechnologies and your research in protein discovery.

Informative References and Resource LinksBrowse a wide variety of proteomic information,including references, resources, and news. Theproteomic reference section helps you gatherpublished information about tissue types andorganisms. These references link to the PubMeddatabase, where you can access additionalliterature. From the reference section, keyresource links are accessible via the Web. The site offers a list of key protein databases, softwaretools, and general proteomic web sites. Inaddition, you can get up-to-date information onthe latest proteomic conferences and events, a list of proteomic societies and organizations, anda comprehensive list of academic laboratoriesinvolved in protein discovery.

Educational Literature and Product InformationWhether you’re new to proteomics or anexperienced researcher, you’ll find a wealth ofmaterial on products, applications, and methods.Product information and literature are organizedby technologies within the protein discoveryprocess. The products are highlighted throughliterature, which educates you on relevantapplications in proteomic research, such asprotein profiling in cancer cells, purification ofpollen antigens, and quantitation of proteins. You can download a tutorial for methods in 2-D electrophoresis, or technical notes onmodification of protein assays, total cellularprotein determination, and the many othertechniques fundamental to a variety ofproteomics applications.

Enlightening the Protein Discovery ProcessThe site illustrates steps in the proteomicsworkflow, from sample preparation to proteinidentification, and how they feed into abioinformatic software platform. Understandingthis workflow allows you to visualize the discoveryprocess as a simple progression of steps. Thecollection of available resources on the siteprovides a solid starting point for your proteomicsresearch. Together, these key elements on the web site clarify the process of protein discovery.

This web site will remain an invaluable resourcethrough regular updates of content andinformation. You can contribute, too, ensuringthat the site grows and develops with theproteomics community. Our combined effortshave created this web resource, which provides a knowledge base to enable protein discovery.

We welcome you to the ProteomeWorks systemweb site at www.ProteomeWorksSystem.com

PubMed is a trademark of the US Dept. of Health and Human Services.


A Resource for the Proteomics Community

www.ProteomeWorksSystem.com

The ProteomeWorks system delivers a completesolution for protein discovery, from samplepreparation to bioinformatics. Seamlesslyintegrated technologies enable you to rapidlyresolve, display, characterize, and quantitatecomplex protein arrays. This system delivers the tools you need to get ahead in proteomics.

There are currently five ProteomeWorksdemonstration sites: the European MolecularBiology Laboratory in Heidelberg, Germany, the University of Tokyo in Japan, Micromassworld headquarters in the UK, Micromass USheadquarters in Massachusetts, and Bio-Rad globalheadquarters in California. These facilities offeryou an opportunity to see the entire system, meetwith scientists and technicians who are usingthese tools on a daily basis, and evaluate how thissystem can be applied in your proteomics research.Each of these locations can demonstrate theentire ProteomeWorks system, from tools forsample preparation to 2-D separation, imageanalysis, spot cutting, and mass spectrometry

for identification. You can also learn about thesystem’s integrated information management, from LIMS tracking and PDQuest™ image analysissoftware to Global SERVER protein identification.All this data is managed and seamlessly linkedwith WorksBase™ software for proteomics datamanagement system.

If you are interested in proteomics and areplanning to include these technologies in yourresearch, consider visiting one of ourdemonstration facilities. To find out more aboutthis opportunity, contact your local Bio-Radsubsidiary or register your interest on our web siteat ProteomeWorksSystem.com

Global SERVER is a trademark of Micromass-Waters, Ltd.

Locations of our ProteomeWorksdemonstration sites.

The ProteomeWorks™ System Demonstration Sites

HerculesBeverly

ManchesterHeidelberg

Tokyo


literaturenew

Isoelectric Focusing Tech Note“Focusing strategy and influence ofconductivity on isoelectric focusing onimmobilized pH gradients” is a detailedstudy on the effects of water quality, DTT,and salt buffers on first-dimension IEF in 2-D electrophoretic applications. Differentmodes of voltage ramping and anassessment of the effects of activerehydration of IPG strips are explored.This informative paper also describes how

to monitor voltage and current during IEF for troubleshooting byconnecting the PROTEAN® IEF cell to a PC.Request bulletin 2778 on the reader response card.

PROTEAN Plus™ Dodeca™ Cell Tech NoteProteome analysis demands high-quality,reproducible 2-D gels. The PROTEANPlus™ Dodeca™ cell is designed to obtainconsistent, high-resolution results for high-throughput 2-D applications. In thistech note Dr Peter Kilby, formerlyassociated with Roche Discovery Welwynin Welwyn Garden City, Herts, UK,demonstrates the use of the PROTEANPlus Dodeca cell for running 2-D SDS-

PAGE gels with preparative protein loads. The bulletin comparesimages of a set of reproducible, highly resolved second-dimensiongels. These high-quality gels demonstrate the ability to achieve bothhighly resolved spots for precise image analysis and an abundantamount of protein for accurate protein identification by means ofprotein spot excision.Request bulletin 2740 on the reader response card.

Colorimetric Protein Assay GuideWhich protein assay method should youchoose? Bio-Rad offers three choices: theBio-Rad protein assay for general use, theDC™ protein assay for samples solubilizedin detergent, and now the RC DC™ proteinassay for samples in the presence of bothreducing agents and detergents. These aredescribed in detail in this recently updatedtech note.

Get ahead of the curve! Learn aboutselecting the right protein standard for your application, choosingthe right method, reagent compatibility, and assay methods. Request bulletin 1069 on the reader response card.

Ready-to-Run Buffers and Solutions BrochureWith premixed buffers, you standardize yourexperiments while avoiding mistakes withbuffer preparation. Bio-Rad buffers aremade with high-purity water and are 0.4 µm filtered to ensure the highestquality. Bio-Rad offers a full line of buffersfor blot processing, transfer, electrophoresis,and gel casting. These buffers come inconvenient package sizes and formulations. Request bulletin 2317 on the reader response card.

ReadyStrip™ Micro-Range Gradient BrochureNew additions to the ReadyStrip line include micro-range gradients. Learn how these innovative gradients streamline high-resolution 2-D analysis. Also find out how ReadyStrip broad, narrow and micro-range gradients allow you to choose the level of resolution and thestrip length to meet your separation needs and SDS-PAGE format. All ReadyStrip gradients are available in all ReadyStrip lengths! Request bulletin 2739 on the reader response card.


literaturenew

Blotting Membrane BrochureSimplify and optimize your blottingprotocols with Bio-Rad’s completeselection of blotting membranes andmembrane sandwiches. This brochureincludes detailed descriptions of each typeof membrane and all the information youneed to choose the membrane that willwork best for your application.Request bulletin 1939 on the reader response card.

Immun-Star™ Chemiluminescent Western Blotting Kit Literature

Want to learn more about chemi-luminescent detection kits? Bio-Rad offers kits for both AP- andHRP-conjugated secondary antibodies.This product information sheet discussesthe features and benefits of our kits andcompares Immun-Star™ HRP to acompetitor’s kit, showing the superiorityof the Bio-Rad kit both in signal durationand sensitivity. Bio-Rad kits are available

in various convenient configurations to suit your blotting needs.Request bulletin 2050 on the reader response card.

The new Immun-Star HRP kit brochuregives you a brief overview of its featuresand benefits. Chemiluminescent westernblot detection is a highly sensitivealternative to isotopic detection. Instead of radioactively labeled antibodies, enzyme-conjugated antibodies convert achemiluminescent substrate to produce alight signal. This signal can be captured onX-ray film or with dedicated imaging

equipment. Load less, see more!Request bulletin 2714 on the reader response card.

Glycoprotein Analysis Kit Product Information SheetIf you need to know whether your proteinis glycosylated or not, or if you want todeglycosylate your protein, Bio-Rad offerskits to help. This product informationsheet explains the Immun-Blot® kit forglycoprotein detection using western blot technology; the enzymaticdeglycosylation kit, which uses enzymes to remove O-linked carbohydrates; andthe chemical deglycosylation kit, which

chemically removes both O-linked and N-linked carbohydrates. Request bulletin 2709 on the reader response card.

Gene Transfer Tech NotesThis tech note, bulletin 2726, by Andrew Conn, Lindy Durrant,and Ian Spendlove at Nottingham University in the UK, describesimmunization of mice using the Helios® gene gun to introduce a DNA vaccine.Request bulletin 2726 on the reader response card.

Another tech note, bulletin 2768, by Volker Wippersteg, KatjaKapp, Werner Kunz, and Christoph Grevelding of the Institute for Genetics and Heinrich-Heine-University in Germany, describes generation of transgenic schistosomes with the PDS-1000/He™ system.Request bulletin 2768 on the reader response card.

BioFrac™ Fraction Collector BrochureThe BioFrac fraction collector is a menu-driven, programmable microliter toliter fraction collector that offers reliable,accurate operation. Its innovative rackingdesign provides 14 racking options,including both off-the-shelf racks andcustom-designed racks. This brochureshows how this new fraction collector willenhance your lab’s efficiency and expandyour application capabilities. Refer to

pages 10–11 for more information on this addition to theBioLogic™ chromatography product line.Request bulletin 2711 on the reader response card.


Visit us on the Web at discover.bio-rad.comCall toll free at 1-800-4BIORAD (1-800-424-6723); outside the US, contact your local sales office.

Seemorewith lessBio-Rad’s Immun-Star™ HRP Chemiluminescent Detection KitChemiluminescent western blot detection is a highly sensitive alternative to isotopic detection. Instead of radioactivelylabeled antibodies, enzyme-conjugated antibodies convert a chemiluminescent substrate to produce a light signal. This light signal can be captured on film or with dedicated imaging equipment.

Bio-Rad has expanded its Immun-Star line of western blot products to include the Immun-Star HRP kit for HRP-conjugated secondary antibodies. The chemical reaction involves a peroxidase-catalyzed oxidation of Luminol, resulting in the production of light. The addition of an enhancer, included in the kit, intensifies the light signaland increases its duration. With the Immun-Star HRP kit, you get stronger signal with less sample.

Description Substrate Antibody TBS Tween 20 Blocker

Substrate only, 500 ml •Substrate only, 100 ml •GAR detection reagents*, 500 ml substrate • •GAM detection reagents*, 500 ml substrate • •GAM detection kit**, 500 ml substrate • • • • •GAR detection kit**, 500 ml substrate • • • • •GAR HRP conjugate, 2 ml •GAM HRP conjugate, 2 ml •

Conjugates listed above are specially formulated to be compatible with the Immun-Star HRP kit.* Detection reagents also include 2 ml of conjugate.** Detection kits also include 1 L 10x TBS, 75 g nonfat dry milk, and 15 ml Tween 20.

Luminol is a trademark of Petro-Canada. Tween is a trademark of ICI Americas, Inc.

Western Blot Detection

Request bulletins 2714 and 2050 on the reader response card.

Visit us on the Web at discover.bio-rad.com Call toll free at 1-800-4BIORAD (1-800-424-6723); outside the US, contact your local sales office.

Real-Time PCR*

The iCycler iQ™ system offers the collective intelligence of a complete system of reagents, software, and technical support.

New Software• Automated data analysis• Intelligent allelic discrimination• Temperature gradient for assay optimization

New Assay Solutions• Real-time PCR certified iQ™ supermix• Advanced probe and primer design software

Unsurpassed Service• On-site, personalized customer supportFind what you’re looking for about the iCycler iQ system by visiting our web site at www.bio-rad.com/iCycler

The Search Is Over

Bio-Rad’s iCycler iQ System:Amplify Your Expectations

*The polymerase chain reaction (PCR) process is covered by patents owned by Hoffman-LaRoche. Use of the PCR process requires a license.

Applications Tips and Techniques New Products …...AResource for LifeScience Research Number 108...

Documents

Transcript of Applications Tips and Techniques New Products …...AResource for LifeScience Research Number 108...