Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 ·...
Transcript of Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 ·...
![Page 1: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/1.jpg)
Appendix list NOPHO-‐DBH AML 2012 vs 2.0 2012-‐09-‐30
Appendix 1 Contract with treatment centres Appendix 2 SAE registration form Appendix 3 SUSAR/death report Appendix 4 MRD Guidelines Appendix 5 PCR guidelines Appendix 6 Guidelines for CRF DNX study Appendix 7 Guidelines for CRF FLADx study Appendix 8 Biobank referral form Appendix 9 Guidelines for patient information
![Page 2: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/2.jpg)
Appendix 1 Study contract 2011-‐11-‐30
AML2012 study contract Contract of Participation of a Clinical Institution:
Hospital: _______________________________ Principal Investigator (local representative):
Name: ___________________________________________________________________
Phone:________________ Fax:________________ e-‐mail:___________________ Contact person for study affairs and mail:
Name: ___________________________________________________________________
Phone:________________ Fax:________________ e-‐mail:___________________ Laboratory for analysis of MRD-analysis by flow cytometry: Name, address, and telephone number:
___________________________________________________________________ Laboratory for analysis of MRD-analysis by PCR Name, address, and telephone number:
___________________________________________________________________
I have thoroughly read and reviewed the study protocol NOPHO AML2012. Having read and understood the requirements and conditions of the study protocol,
1. I agree to treat the patients according to this Protocol, the international good clinical practice principles, the declaration of Helsinki (version 2000) and regulatory authority requirements for source document verification and inspection of the study.
1. I will archive the study documents in accordance to valid national regulations. 2. I agree to inform the Study Chair and/or the National Principal Investigator on
problems in diagnostic and therapeutic decisions. 3. I agree to report to the NOPHO Leukemia Registry within 48 hours
a. any death during induction or in first remission, and b. any SUSARs (suspected unexpected serious adverse events).
This center will participate in the randomised DNX study for AML
□ yes □ no This center will participate in the randomised FLADx study for AML
□ yes □ no Principal Investigator: ______________________________________________________ The signed contract must be sent or faxed to: Jonas Abrahamsson Children’s Cancer Centre Queen Silvias Childrens and Adolescents Hospital, 416 85 Gothenburg Sweden Tlph: +46 707 695159 Fax: +46 31 215486 Email [email protected]
![Page 3: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/3.jpg)
AML2012 Toxicity registration
After each course it is mandatory to register toxicity online according to this form.
Name:__________________________ NOPHO Nr:______________________ Course:_________________ Category No SAE Grade 3 Grade 4 Additional data Need of intensive care
Number of days in ICU:...........
Hypoxia Decreased O2 sat at rest req O2 therapy
Decreased O2 saturation requiring CPAP or assisted ventilation
Days in ventilator:..................
Multi-‐organ failure Shock with azotemia and acid-‐base disturbances; significant coagulation abnormalities
Life-‐threatening (e.g., vasopressor dependent and oliguric or ischemic colitis or lactic acidosis)
ARDS Present with radiologic findings; intubation not indicated
Life-‐threatening respiratory or hemodynamic compromise; intubation or urgent intervention indicated
Infection Pathogen identified iv antibiotics Septic shock/hypotension
Pathogen ................... Fungal infection yes/no Suspected/probable/proven
Abdominal pain Severe pain strongly interfering with daily life activities
Paralytic ileus or intestinal obstruction
Abdominal symptoms Leading to laparotomy
Typhlitis
Symptomatic (e.g. abdominal pain, fever, change in bowel habits with ileus); peritoneal signs
Life-‐threatening consequences; urgent operative intervention indicated
Congestive heart failure (CHF) Mild CHF compensated with
therapy Severe/refractory CHF
Cardiac arrhythmia Requiring intervention Life-‐threatening Specify arrhythmia: ...................
Allergic reaction Bronchospasm requiring parenteral medication Anaphylaxis
Renal dysfunction Creatinine 3-‐6 x UNL Creatinine > 6 x UNL Bilirubin Bilirubin 3-‐10 x UNL Bilirubin > 10 x UNL
Thrombosis Requiring systemic anticoagulation
Severe thrombosis causing organ dysfunction
Haemorrhage Catastrophic bleeding requiring non-‐elective intervention
Organ:...................
Disseminated intravascular coagulation
Laboratory findings and bleeding
Life-‐threatening consequences; urgent intervention indicated
Central neurotoxicity
Somnolence > 50%/day or severe disorientation or hallucinations
Coma or seizures
![Page 4: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/4.jpg)
Appendix 3 SUSAR/Death report form 2012-‐09-‐30
1
SUSAR / Death Report form AML2012
NOPHO # ___________ Treatment Centre___________________________ Country______________ Name ________________________ Date of birth __________________ Type of report Initial Follow-‐up Category Death SUSAR If death Date ______________ Stage Death in CCR Cause Therapy related
Induction death Disease related Death after relapse Therapy and disease related Death after SMN Unknown Date of onset of symptoms of SAE ________________ Is the event due to/complicated by persisting AML Yes No No data
Other seriousness criteria Congenital anomaly/birth defect Other significant medical defects
Expedited reported criteria Involved or prolonged hospitalisation
(Check all appropriate) Involved persistence of significant disability or incapacity Death
SAE description in medical terms:
Case description (Include related symptoms, treatment, outcome and suspected cause:
![Page 5: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/5.jpg)
Appendix 3 SUSAR/Death report form 2012-‐09-‐30
2
Immediately preceding or ongoing course _________________ Drugs at or before onset of SAE_____________________________________________________________________ Last chemotherapy start date _______________ Drugs given __________________________________
SUSAR/death reports are required to be sent within 48 hours of the occurrence of the event. The report should preferably be submitted online in the NOPHO AML2012 database but can also be sent by fax to the NOPHO leukemia registry. The data centre will immediately forward the report to the study and national coordinators and action will be taken according to section 14.2.1 in the AML2012 protocol.
Action taken
Outcome of event Complete recovery Date recovery _________________
Recovered with sequelae Condition improving Condition still present and unchanged Condition deteriorating
Name email and telephone number of reporter
Date of report _____________________
![Page 6: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/6.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
1
Guidelines for the detection of minimal residual disease
using multiparameter flow cytometry
Background
Monitoring of minimal residual disease (MRD) has been for many
years standard care in ALL (D Campana 2012). Evidence is now
emerging that MRD has also prognostic and therapeutic implications
in AML and could be used for risk-‐adapted treatment (E Coustan-‐
Smith 2003, N Feller 2004, C Langebrake 2006, VHJ van der Velden
2010, GJ Schuurhuis 2010, EJ Rubnitz 2011, Walter 2011, MR Loken
2012; CD DiNardo 2012). A central review of the MRD data of the
AML–NOPHO 2004 protocol revealed that patients with MRD > 0.1 %
had a significantly worse EFS as well as OS compared to patients with
MRD <0.1% on day 15 after first induction and before consolidation
In the NOPHIO-‐DBH AML 2012 study protocol, the MRD results after
the two induction courses will be used as primary endpoints to
evaluate the randomized studies. Furthermore MRD will be used for
risk stratification and a level of MRD > 0.1% before consolidation will
be used as a high-‐risk criterion, allocating patients that become
eligible for transplantation.
The detection of MRD by using multiparameter flow cytometry has
been shown to be applicable in 80-‐90 % of AML (M Vidriales 2003, C
Langebrake 2005, A Al-‐Mawali 2008, A AL-‐Mawali 2009, W Kern
2010; GJ Ossenkoppele 2011). It is applied to detect aberrant
leukemia-‐associated antigen expression (LAIP) that is not or
infrequently present on normal hematopoietic cells. The most
![Page 7: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/7.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
2
relevant aberrant phenotypes include the following: expression of
lymphoid-‐associated antigens on myeloid blasts, the simultaneous or
asynchronous expression of an immature and mature cell marker,
absence as well as increased expression of a myeloid marker and
changes in light scatter.
A standard 8-‐ or 10-‐colour combination antibody panel has been
respectively designed for the MRD analysis on a Facscanto/LSR2 and
Navios (Addendum 1). The MRD antibody combinations are aimed at
the detection of LAIP on the leukemic blasts of the major AML disease
entities and the characterization of the maturation profiles of the
granulocytic and monocytic limeage (EG Van Lochem 2004; GJ
Ossenkoppele 2011; JMM van Dongen 2012). CD45, CD34, CD117 and
HLA-‐DR comprise the backbone markers of the 8-‐colour combination
panel, whereas CD33 was added as a fifth backbone marker in the 10-‐
colour combination panel. By using these backbone markers gating of
the leukemic blasts is feasible in the majority of AML cases (JJM van
Dongen 2012). Cross-‐lineage antigen expression is detected using the
lymphoid-‐associated markers such as CD4, CD7, CD19, and CD56. The
combination of maturation-‐stage specific markers respectively of the
granulocytic and monocytic lineage is aimed at the identification of
asynchronous antigen expression and aberrant maturation profiles.
The expression of the protein NG2 is associated with the
rearrangement of the mixed lineage leukemia (MLL) gene that is
identified in about 20% of childhood leukemia.
Since evidence is emerging that the detection of leukemic stem cells
may have potential clinical significance, one antibody combination
was designed for the identification of leukemia stem cells (LSC) (A
van Rhenen 2007, DS Kraus 2007). In order to study LSC and possibly
![Page 8: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/8.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
3
differentiate LSC from normal HSC, the markers CD123, CD7 and
CD96 are combined with CD38 and CD34. Unlike normal HSC, CD123
and CD96 have been reported being expressed by CD34 positive,
CD38 negative, CD90 negative leukemic stem cells, respectively in
100 and 66 % of AML cases (AB Bakker 2004; N Hosen 2007; A Van
Rhenen 2007; R Majeti 2011). CD96 is also demonstrated being
positive in 30% of AML as shown by an immunohistochemical study
and in a minor subpopulation of normal CD34+ progenitor cells. Of
interest, the LSC antibody combination identifies normal CD34+
precursors expressing CD7 thereby facilitating the MRD detection of
CD7+ leukemic blasts. In regenerating marrows and to a minor
extent also in marrows of normal donors, the CD123 bright positive
dendritic cell precursors as well as the CD96 dim positive precursors
are partly positive for CD7.
It is estimated that in at least 80-‐85 % of AML cases, it will be feasible
to detect LAIP using the standard panels. It is of utmost importance
to search for a specific LAIP on the leukemic blasts. The most specific
LAIP is characterized by the expression of a brightly expressed
progenitor cell marker, at least one myeloid marker and preferably
more than one aberrant marker. The quality of the LAIP for MRD
detection further depends on its specificity (Spe), its sensitivity (Se)
and stability. The specificity depends on the percentage (%) of LAIP
expression on precursors in normal and regenerating bone marrows.
Since the aberrant expression of markers usually doesn’t exceed 10
% on normal precursors, the latter is often defined as the cut-‐off level
for identifying LAIP. The sensitivity is determined by the % LAIP on
the leukemic cell population at diagnosis and the number of cells
analyzed at follow-‐up. Three levels of sensitivity are defined by the
![Page 9: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/9.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
4
European working group on Clinical Cell Analysis: > 50 % LAP
expression (good), > 20% <50% (intermediate) and >10% <20%
(low). Third, phenotypic shifts including loss or gain of aberrantly
expressed markers do occur which may result in false negative MRD.
Loss of aberrant expression is more frequent for markers that are
dimly expressed. In contrast, some markers that are negative at the
time of diagnosis may become positive during follow-‐up or at
relapse. It is also noted that MRD detection in AML with monocytic
differentiation may be challenging since the leukemic blasts often
lack the expression of progenitor cell markers.
Specimen
Either bone marrow aspirates or peripheral blood samples can be
used for AML diagnosis. The MRD analysis is always performed on a
bone marrow sample.
Heparin is the anticoagulant of choice for bone marrow samples.
EDTA or heparin tubes can be used for peripheral blood samples,
It is recommended that the sample is processed within 24 hours after
collection.
MRD time points
MRD analysis must be performed on the following time points
(NOPHO AML-‐2012 protocol):
•After the 1st course: Day 22, last sample before the 2nd course
•After the 2nd course: Day 22 in patients with poor response after the
1st course, and last sample before course 3.
Antibody panel used in diagnostic samples
![Page 10: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/10.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
5
At diagnosis, the sample needs to be stained with cell lineage as well
as myeloid markers that fully characterize the leukemic cell
population according to the recommendations of the WHO
classification of AML (WHO 2008). As a minimum the following
markers must be included in the panel: 1. the lineage markers
cytoplasmic CD3, CD7, cytoplasmic CD79, CD19 and cytoplasmic
myeloperoxidase (MPO) and 2. the myeloid markers CD13, CD14,
CD15, CD33, CD34, CD36, CD41, CD42b, CD64, CD71, CD105,
CD117and HLA-‐DR.
In addition, it is compulsory to analyze the diagnostic sample with
the complete standard MRD panel in order to identify the antibody
combinations showing LAIP. It is recommended to use the antibody
clones proposed by Euroflow where applicable (JMM van Dongen
2012). A list of recommended clones for both panels is provided in
addendum 2. All antibodies need to be titrated before use.
Preliminary experience with the MRD panel has shown that aberrant
phenotypes frequently can be identified in at least 2 different MRD
combinations. If only one or none of the standard tubes reveal LAIP,
the design of a tailored antibody combination needs to be considered
and analyzed on the diagnostic sample. In this instance, it is
recommended to discuss the design of the tailored antibody with the
national coordinator.
Antibody panel used in follow-up samples
The standard or tailored MRD antibody combinations chosen at the
time of diagnosis are analyzed on all follow-‐up samples. In addition,
it is recommended to always stain the cells with tube 1 and/or 2
(granulocytic and monocytic tubes, respectively) of the standard
![Page 11: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/11.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
6
panels in order to identify the distribution of the cell populations. If
the sample has an adequate cell count, it should be considered to
analyze the antibody combination aiming at identifying the leukemic
stem cells.
Instrument setup and fluorescence compensation
For the BD platform users, it is compulsory to use the standardized
procedures for instrument set-‐up and establishing the optimal
compensation settings as outlined by Euroflow (JMM van Dongen
2012; www.euroflow.org). Monitoring of instrument performance is
done using Rainbow 8-‐peak beads (Sperotech) (JMM van Dongen
2012; T Kalina 2012).
For the users of a Navios flow cytometer, instrument set-‐up and
establishing compensation settings are performed according to
Beckman Coulter’s recommendations.
Sample preparation and staining
It is recommended to use a lyse, stain and wash method. Bulk lysis of
the sample is performed using NH4CL as described.
The staining is performed according to standard operating
procedures. Briefly, the respective antibody tubes are prepared with
the pretitrated and diluted antibodies to which 50 microliter of cell
suspension is added. The cells are incubated during 15 minutes in
the dark at room temperature and washed twice using PBS 0.1%
BSA. An extratube can be stained with a living cell dye such as
Syto16 and the backbone markers for acccurate quantification of the
leukemic blasts.
![Page 12: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/12.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
7
The stained cells are kept from the light and at 4 oC until acquisition
on the flow cytometer not later than 4 hours after staining.
Data acquisition
It is recommended to flush the flow cytometer with destilled H20
before starting the acquisition of the diagnostic or MRD sample as
well as between each antibody tube For diagnostic samples 30 000
total cells are required. In case of MRD samples, between 500 000
and preferably 1 million cells need to be acquired. If cells are
acquired until the tube is empty, the time parameter can be included
to gate out events generated by air bubbles.
Data analysis
Data analysis is performed using the software programs available in
the laboratory. The creation of standard dot-‐plots and the gating
strategy is described in addendum 3.
LAIP is determined on the leukemic blasts present in the diagnostic
sample. The leukemic blast population is defined on a CD45 versus
side scatter (ssc) dot-‐plot. It can be localized in one or more of the
following regions in the CD45 /ssc dot-‐plot: 1. CD45 dimly positive or
negative versus low scc. 2. CD45 positive versus low ssc. 3. CD45
brightly positive versus low to intermediate ssc. Subsequently, the
leukemic blast population is further characterized by the expression
of the backbone markers CD34, CD117 and/ or HLA-‐DR antigens. The
expression of the latter markers together with CD45 and light scatter
of the leukemic blasts finally determine the gating strategy to be used
for MRD evaluation in the follow-‐up samples. The majority of
myeloid leukemic blasts can be identified by the expression of CD34
![Page 13: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/13.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
8
and/or CD117. If the former markers are negative, CD133 can be
used if positive on the leukemic blasts. In case of AML with monocytic
differentiation HLA-‐DR expression together with CD33 can be used to
identify the leukemic blasts. Note that CD33 is present in 2 of the
standard MRD antibody tubes in the 8-‐colour combination panel and
in all three standard tubes of the 10-‐colour antibody combination
panel. It is of note that myeloid leukemic blasts may display a
heterogeneous phenotype with respect to the expression of
progenitor cell markers. All subpopulations exceeding 10% of the
total blasts need to be characterized.
Next, the expression of the non-‐backbone markers is evaluated for
each of the major leukemic blast populations in order to identify
LAIP. In this respect, the three major reference populations for
leukemic blasts include the CD34+/CD117+, CD34+/CD33+, CD34-‐
/CD117+ and CD33+/ HLA-‐DR+ cells. An atlas of the expression of all
non-‐backbone markers is compiled for these populations in
regenerating as well as normal bone marrow (NOPHO database). In
addition, normal reference patterns of granulocytic and monocytic
cell maturation have been described (van Lochem 2004).
LAIP expressions that exceed > 10% of the leukemic cell populations
are analyzed in the follow-‐up samples.
Data analysis for the screening of residual leukemic cells in follow-‐up
samples is performed according to the gating strategy identified for
the leukemic blasts in the diagnostic sample. A cluster of > 100
events with a leukemic phenotype are considered as minimal
residual disease. In addition, a standardized gating strategy is
performed in the follow-‐up sample for the identification of the
following cell populations: the normal CD34 positive cells, CD34
![Page 14: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/14.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
9
positive/CD19 positive B-‐lymphoblasts, granulocytes, monocytes,
erytroblasts as well as lymphocytes (Addendum 3).
Data reporting
There are two report forms respectively one for reporting the results
on the diagnostic sample and one for reporting the MRD result.
Reporting of the data is done as outlined in the NOPHO database.
At diagnosis, the following data are reported: the percentage and the
complete phenotype of the leukemic blasts as well as a detailed
description of the LAIP. The Bethesda guidelines should be used
when reporting a marker expression (cfr NOPHO database for
specifications).
The following categories of markers will be reported for the major
leukemic cell population
(a) CD45
(b) Backbone and progenitor cell markers: CD34, CD117, CD133,
HLA-‐DR
(c) Myeloid markers: CD11a, CD11b, CD13, CD14, CD15, CD16,
CD35, CD36, CD41, CD42b, CD64, CD71, CD105, IREM2, MPO
(d) Lymphocyte markers: CD2, CD3, CD4, CD5, CD7, CD19, CD56
(e) Other markers: CD38, CD96, CD99, CD123, NG2,
Finally, the number of LAIP is recorded for each of the standard
antibody tubes that are analyzed.
For the MRD samples, the level of residual leukemic cells as well as
their phenotype is reported as outlined in the MRD report form.
Residual leukemic cells are quantified as percentage of total as well
as of CD45 positive cells. In addition, it is recommended to report the
major cell populations described above.
![Page 15: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/15.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
10
If the levels of MRD differ between the antibody tubes, the highest
level of MRD is the result used for clinical decision. The MRD level is
divided in five categories: 1. MRD <0.1 %, negative; 2. MRD <0.1%,
positive; 3. MRD > 0.1% and < 5%; 4. MRD >5% and < 15%; 5. MRD
>15 %.
The data files of the diagnostic samples as well as of the follow-‐up
samples will be evaluated by 2 independent laboratories. If no
consensus on the MRD level is reached, the expertise of a member of
the AML-‐NOPHO coordinator group will be sought. The MRD result is
reported to the clinician 48-‐72 hours after sample collection.
A consensus result will be reported in the NOPHO database and to
the clinician treating the patient.
The data files of all samples will be submitted to a NOPHO-‐AML
server.
References
1. Al-‐Mawali A, D Gilis, and I. Lewis I The role of multiparameter flow
cytometry for detection of minimal residual disease in acute myeloid
leukemia. Am J Clin Pathol. 2009; 131: 16-‐26
2. Al-‐Mawali A, D Gilis, P Hissaria, and I Lewis. Incidence, sensitivity, and
specificity of leukemia-‐associated phenotypes in acute myeloid leukemia
using specific five-‐color multiparameter flow cytometry. Am J Clin Pathol.
2008; 129:934-‐945.
3. Bakker AB, S Van den Oudenrijn, AQ Bakker, et al. C-‐type lectin-‐like
molecule-‐1: a novel myeloid cell surface marker associated with acute
myeloid leukemia. Cancer Res 2004, 64: 8443-‐8450.
4. Campana D. Should Minimal residual disease monitoring in acute
lymphoblastic leukemia be standard of care? Curr Hematol Malig Rep
2012; 7: 170 -‐177.
![Page 16: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/16.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
11
5. Coustan-‐Smith E, Ribeiro RC, Rubnitz JE et al. Clinical significance of
residual disease during treatment in childhood acute myeloid leukemia.
Br J Haematology 2003; 123: 243-‐252
6. DiNArdo CD, and SM Luger. Beyond morphology: minimal residual
disease detection in acute myeloid leukema. Curr Opin Hematology 2012;
19: 82-‐88.
7. Feller N, MA van der Pol, A van Stijn GWD Weijers, AH Westra, BW
Evertse, GJ Ossenkoppele, and GJ Schuurhuis. MRD parameters using
immunophenotypic detection methods are highly reliable in predicting
survival in acute myeloid leukemia. Leukemia 2004; 18: 1380-‐1390.
8. Hosen N, CY Park, N Tatsumi, Y Oji, H Sugiyama, M Gramatzki, AM
Krensky, and IL Weissman. CD96 is a leukemi stem cell-‐specific marker in
human acute myeloid leukemia. PNAS 2007; 104: 11008-‐11013.
9. Kern W, U. Bacher, C Haferlach, S. Schnittger and T Haferlach. The role of
multiparameter flow cytometry for disease monitoring in AML. Best
Practice & Research Clinical Haematology 2010; 23: 379-‐390.
10. Krause DS and RA Van Etten. Right on target: eradicating leukemic stem
cells. Trends in Molecular Medicine 2007; 13: 470-‐481.
11. Langebrake C, U Creutzig, M. Dworzak, O Hrusak, E. Mejstrikova, F.
Griesinger, M Zimmerman, and D Reinhardt. Residual disease monitoring
in childhood myeloid leukemia by multiparameter flow cytometry: The
MRD-‐AML-‐BFM Study group. J Clin Oncol 2006; 24. 3686-‐3692.
12. Langebrake C, I. Brinkman, A Teigler-‐Schliegel, U. Creutzig, F. Griesinger
and D. Reinhardt. Immunophenotypic differences between diagnosis and
relapse in childhood AML. Implications for MRD monitoring. Cytometry
Part B (Clinical Cytometry) 2005; 63B: 1-‐9.
13. MR Loken, Todd A. Alonnzo, Laura Pardo, Robert B. Gerbing, Susana C.
Raimondo, Betsy A. Hirsch, Phoenix A. Ho, Janet Franklin, Todd M.Cooper,
Alan S Gamis and Soheil Messhinchi. Residual diasease detected by
multidimensional flow cytometry signifies high relapse risk in patients
with de novo acute myeloid leukemia: a report from Children’s Oncology
Group Blood 2012; 120: 1581-‐1588.
![Page 17: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/17.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
12
14. Majeti R. Monoclonal antibody therapy directed against human acute
myeloid leukemia stem cells. Oncogene 2011, 30: 1009-‐1019.
15. Ossenkoppele GJ, van de Loosdrecht A, and GJ Schuurhuis. Review of the
relevance of aberrant antigen expression by flow cytometry in myeloid
neoplasms. Br J Haematology 2011; 153: 421-‐436
16. Rubnitz JE, H Inaba, GV Dahl et al. Minimal residual disease-‐ directed
therapy for childhood acute myeloid leukemia: results of the AML02
multicentre trial. Lancet Oncology 2010; 11: 543-‐552
17. Shuurhuis GJ and G Ossenkoppele. Minimal residual disease in acute
myeloid leukemia: already predicting a safe haven. Expert Rev Hematol
2010; 3: 1-‐5.
18. Van der Velden VHJ, A. van der Sluijs-‐ Geling, Bes Gibson, JG te Marvelde,
PG Hoogveen, WCJ Hop, K. Wheatly, MB Bierings, GJ Schuurhuis, SSN de
Graaf, ER van Wering and JJM van Dongen. Clinical significance of
flowcytometric minimal residual disease detection in pediatric acute
myeloid leukemia patients treated according to the DCOG ANLL97/ MRC
AML12 protocol. Leukemia 2010; 24: 1599-‐1606.
19. Van Dongen JMM, L Hermitte, S. Böttcher, J Almeida, VHJ van der Velden, J
Flores-‐Montero, A Rawstron, V Asnafi, Q Lécrevisse, P Lucio, E
Mejstrikova, T Szczepanski, R de Tute, M Cullen, M Brüggeman, L Sedek, M
Cullen, AW Langerak, A Mendonca, E Macyntire, M Martin-‐Ayuso, MB
Vidriales, and A Orfao. Euroflow antibody panels for n-‐standardized n-‐
dimensional flow cytometric immunophenotyping of normal, reactive and
malignant leukocytes. Leukemia 2012; 26: 1908-‐1975.
20. T Kalina, J Flores-‐Montero, VHJ van der Velden, M Martin-‐Ayuso, S.
Böttcher, M Ritgen, J Almeida, L Hermitte, V Asnafi, A Mendonca, R de
Tute, M Cullen, L Sedek, MB Vidriales, JJ Perez, JG Marvelde, E Mejstrikova,
O Hrusak, T Szczepanski, JMM van Dongen and A Orfao. Euroflow
standardization of flow cytometer instrument settings and
immunophenotyping protocols. Leukemia 2012, 26: 1986-‐2010.
21. Van Lochem EG, van der Velden VH, Wind HK, te Marvelde JG, Westerdaal
NA, van Dongen JJ. Immunophenotypic differentiation patterns of normal
hematopoiesis in human bone marrow: reference patterns for age-‐related
![Page 18: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/18.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
13
changes and disease-‐induced shifts. Cytometry B Clin Cytom 2004; 60:1-‐
13.
22. Van Rhenen A, GA van Dongen, A Kelder, EJ Rombouts, N Feller, B
Moshaver et al. The novel stem cell associated antigen CLL-‐1 aids in
discrimination between normal and leukemic stem cells. Blood 2007;
110: 2659-‐2666.
23. Vidriales M, JF Miguel, A Orfao, E Coustan-‐Smith, D Campana. Minimal
residual disease monitoring by flow cytometry. Best Practice & Research
Clinical Haematology 2003; 4: 599-‐612.
24. Walter RB, TA Gooley, BL Wood et al. Impact of pretransplantation
minimal residual disease as detected by multiparametric flow cytometry
on outcome of myeloablative hematopoietic cell transplantation for acute
myeloid leukemia. J Clin Oncol 2011; 29: 1190-‐1197.
![Page 19: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/19.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
14
Addendum 1: Antibody panels
8-‐colour combination antibody panel (BD platform)
Fitc Pe PerCPCy5.5 PeCy7 APC APC H7
APC Cy7
APC-
A750
HV450
Pacific
Blue
HV500
Pacific Orange
KO
1 CD56 CD13 CD34 CD117 CD33 CD11b HLA-‐DR CD45
2 CD36 CD64 CD34 CD117 CD33 CD14 HLA-‐DR CD45
3 CD15 NG2 CD34 CD117 CD2 CD19 HLA-‐DR CD45
4 CD7 CD96 CD34 CD117 CD123 CD38 HLA-‐DR CD45
5 CD99 CD11a CD34 CD117 CD133 CD4 HLA-‐DR CD45
10-‐colour combination antibody panel (BC platform)
Fitc Pe ECD PC5.5 PeCy7 APC APC -
A700
APC-
A750
BV421
KO
1 CD15 CD13 CD16 CD33 CD117 CD19 CD34 CD45 CD11b HLA-‐DR
2 CD36 CD64 CD56 CD33 CD117 IREM2 CD34 CD45 CD14 HLA-‐DR
3 CD7 CD96 CD45RA CD33 CD117 CD123 CD34 CD45 CD38 HLA-‐DR
4
5
CD99
CD11a
NG2
CD3
CD33
CD33
CD117
CD117
CD133
CD2
CD34
CD34
CD45
CD45
CD4 HLA-‐DR
HLA-‐DR
![Page 20: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/20.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
15
Addendum 2: List of antibodies /clones
CD2 APC S5.2 (BD)
CD3 ECD A07748 (BC)
CD4 APC H7 SK3 (BD )
CD4 BV421 RPA-‐T4 (BD)
CD7 Fitc 4H9 (BD)
CD7 Fitc 8H1 (BC Immunotech)
CD11a Pe Biolegend
CD11b APC H7 ICRF44 (BD)
CD11b BV421 ICRF44 (Biolegend)
CD13 Pe L138 (BD)
CD14 APC H7 MøP9 (BD)
CD14 BV421 M5E2 (Biolegend)
CD15 Fitc MMA (BD)
CD15 Fitc MCS-‐1 (Cytognos)
CD16 ECD 3G8 (BC)
CD19 APC 13-‐119 (BC)
CD19 APC H7 SJ25C1 (BD)
CD19 APC J3119 (BC)
CD22 APC S5.2 (BD)
CD33 APC P67.6 (BD )
CD33 PeCy5.5 D3HL60 251 (BC)
CD34 PercP Cy5.5 8G12 (BD)
CD34 APC-‐A700 581 (BC)
CD36 Fitc CLB -‐IVC7 (Sanquin)
CD38 APC H7 HB7 (BD)
CD38 BV421 HIT2 (BD)
CD45 APC –A750 1.33 (BC)
CD45 KO 7.33 (BC )
CD45 PO H130 (Invitrogen)
CD45 RA ECD 2H4 (BC)
CD56 ECD N901 (NKH-‐1) (BC)
![Page 21: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/21.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
16
CD56 Fitc NCAM 16.2 (BD)
CD64 Pe 10.1 (Caltag)
CD96 Pe NK 92.39 (eBioscience)
CD99 Fitc DN16 (Serotec)
CD117 PeCy7 104D2D1 (BC)
CD123 APC AC145 (Miltenyi Biotec)
CD123 APC 7G3 (BD 560087)
CD133 APC AC133 (Miltenyi Biotec)
HLA-‐DR PB L243 (Biolegend)
HLA-‐DR KO Immu-‐357 (BC)
Irem2 APC UP-‐H2 (Immunostep IREM2A-‐T100)
NG2 Pe 7.1 (BC)
![Page 22: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/22.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
17
Addendum 3 Protocol for the creation of gating regions and data analysis (the principles are outlined for the 8-colour antibody combination panel using the Infinicyt software; the strategy is equally applicable for the 10-colour antibody combination panel and use of the Facsdiva or Kaluza software with minor modifications)
A. Generate the following two-dimensional dot-plots (X-axis versus Y-axis)
1. Common 2-dimensional dot-plots for all tubes a. Forward scatter (FSC) versus side scatter (SSC) (to exclude dead cells,
platelets and debris) b. FSC versus CD45 (to exclude dead cells, platelets and debris) c. FSC–H versus FSC-‐A (to exclude double events) d. CD45 versus SSC (to select the blast region, lymphocytes, monocytes and
granulocytes and to redefine the CD34 positive progenitor cells and the CD117 positive / CD34 negative precursor cells)
e. CD45 versus CD34 (to redefine the CD34 positive progenitor cells) f. CD117 versus CD34 (to evaluate the expression pattern of the CD34 positive
progenitor cells as well as the CD117 positive precursor cells) g. HLA-‐DR versus CD117 (to evaluate the expression pattern of CD34 positive
progenitor cells and CD117 positive /CD34 negative precursor cells) h. CD34 versus SSC (to select the CD34+ progenitor cells) i. CD117 versus SSC (to select the CD117 positive precursor cells)
2. 2-dimensional dot-plots for tube 1 (8-colour combination panel)
a. CD11b versus CD13 (to identify leukemia-‐associated phenotypes on the
leukemic cells-‐ to evaluate the maturation pattern of granulocytes and monocytes)
b. CD13 versus CD33 (to identify leukemia-‐associated phenotypes on the leukemic cells -‐ to evaluate the expression pattern of CD13 versus CD33 by granulocytes)
c. CD56 versus CD11b (to identify leukemia-‐associated phenotypes on the leukemic cells and background staining of CD56 and/or CD11b by CD34 positive progenitor cells and CD117 positive / CD34 negative precursorcells)
d. HLA-‐DR versus CD33 (to select the CD33 positive / CD34positive progenitor cells and to select the CD33 bright-‐positive /HLA-‐DR positive monocytes and CD33 dim-‐positive granulocytes)
![Page 23: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/23.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
18
3. 2-dimensional dot-plots for tube 2 (8-colour combination panel)
a. CD36 versus CD64 (to identify leukemia-‐associated phenotypes on the
leukemic cells – to evaluate the maturation pattern of monocytes) b. CD36 versus CD14 (to identify leukemia-‐associated phenotypes on the
leukemic cells – to evaluate the maturation pattern of monocytes) c. HLA-‐DR versus CD14 (to identify leukemia-‐associated phenotypes on the
leukemic cells – to evaluate the maturation pattern of monocytes) d. HLA-‐DR versus CD33 (to select the CD33 positive / CD34positive progenitor
cells and to select the CD33 bright-‐positive /HLA-‐DR positive monocytes and CD33 dim-‐positive granulocytes)
4. 2-dimensional dot-plots for tube 3 (8-colour combination panel)
a. CD15 versus NG2 (to identify leukemia-‐associated phenotypes on the leukemic cells)
b. CD15 versus CD2 (to identify leukemia-‐associated phenotypes on the leukemic cells)
c. NG2 versus CD19 (to identify leukemia-‐associated phenotypes on the leukemic cells)
d. HLA-‐DR versus CD19 (to select CD19 positive B-‐cells)
5. 2-dimensional dot-plots for tube 4 (8-colour combination panel)
a. CD123 versus CD7 (to identify leukemia-‐associated phenotypes on the leukemic cells –to select T and /or NK-‐cells)
b. CD38 versus CD96 (to select the CD96 positive /CD34 positive progenitor cells and to select CD38 negative /CD34 positive progenitor cells)
c. CD96 versus CD7 (to identify leukemia-‐associated phenotypes on the leukemic cells)
d. CD123 versus CD38 (to identify leukemia-‐associated phenotypes on the leukemic cells and to select CD123 bright-‐positive dendritic cells)
e. HLA-‐DR versus CD123 (to select dendritic cells-‐basophils)
6. 2-dimensional dot-plots for tube 5 (8-colour combination panel)
a. CD4 versus CD11a (to identify leukemia-‐associated phenotypes on the leukemic cells)
b. CD99 versus CD11a (to identify leukemia-‐associated phenotypes on the leukemic cells)
c. CD99 versus CD133 (to identify leukemia-‐associated phenotypes on the leukemic cells)
![Page 24: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/24.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
19
d. CD99 versus CD4 (to identify leukemia-‐associated phenotypes on the leukemic cells)
B. Generate the following standard table of cell populations (example is given for the Infinicyt software)
C. Data analysis 1. Analysis of the diagnostic sample. The following analysis is performed for all
antibody combinations a. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events
![Page 25: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/25.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
20
b. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐plot to exclude dead cells, platelets and debris and annotate these gated events as ‘viable cells’
c. Use the SSC versus CD45 dot-‐plot to select the leukemic events: 3 possible regions may be selected:
i. CD45 negative-‐low/intermediate SSC ii. CD45 positive –low/intermediate SSC iii. CD45 bright positive – low/intermediate SSC
d. Redefine the gated blast population in a FSC versus SSC dot-‐plot as a clustered population of cells and annotate these events as the leukemic cell population
e. Determine the percentage of the leukemic cell population identified from the total cell population excluding dead cells, platelets, debris, and double events
f. Determine the expression of the backbone markers CD34, CD117 and HLA-‐DR on the leukemic cell populations. The following conditions may be encountered:
i. The progenitor cell markers CD34 and/or CD117 in combination with CD45 identify the leukemic cells.
a. The leukemic cells are positive for CD34 and CD117 b. The leukemic cells are only positive for CD34 c. The leukemic cells are only positive for CD117
ii. HLA-‐DR in combination with CD45 identify the leukemic cells (in case of monocytic leukemia)
g. Determine whether the leukemic cell population can be further characterized by the expression of additional myeloid markers in case it is negative for CD117
h. Determine the expression of the tube-‐specific markers for each of the leukemic subpopulations and identify the leukemia-‐associated immunophenotypes (LAIP)
i. Define all leukemic subpopulations identified by either the backbone or tube-‐specific markers exceeding > 10 % of total leukemic cell population
j. Identify the antibody tubes showing LAIP of the leukemic cell population (hereafter called MRD tube) and determine the two-‐dimensional dot-‐plots for each of the chosen tubes that clearly discriminate the leukemic cells from the normal counterparts. If more informative, other two-‐dimensional dot-‐plots than the default dot-‐plots described above or three-‐dimensional dot-‐plots must be evaluated and added. F.e Two-‐dimensional dot-‐plots combining two aberrant markers better discriminate residual leukemic cells from normal counterparts
k. Save the reference image of the leukemic cell populations l. Save the analyzed file
![Page 26: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/26.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
21
2. Analysis of follow- up samples: analysis of residual leukemic cells
a. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events b. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells’
c. Use the SSC versus CD45 dot-‐plot to select the blast region of interest (see 1.3) d. Select the events positive for the backbone marker (s) as well as the myeloid marker identified on the leukemic cell population in the diagnostic sample.
e. Fine tune the gated blast population in a FSC versus SSC dot-‐plot as a clustered population of events
f. Determine whether the LAIP are present on the selected blast population and compare with the reference image and normal reference background. Note that the immunophenotype may have changed
3. Analysis of follow-up samples: analysis of normal CD34 positive progenitor
cells, CD117 positive /CD34 negative precursor cells and other leukocytes or erytroblasts. This analysis is performed if of interest for the reporting.
a. CD34 positive myeloid progenitor cells identified as CD34 positive / CD33 positive (tubes 1 and 2) i. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events ii. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐
plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells’
iii. Select the CD34 positive events in a CD34 versus SSC dot-‐plot iv. Fine tune the gated events on the CD45 versus SSC dot-‐plot being
identified as a population with dim expression of CD45 and low to intermediate side scatter bordering mature granulocytes as well as on the the FSC versus SSC dot-‐plot being a homogenous population and annotate these events as CD34 positive progenitor cells
v. Determine the percentage of the CD34 positive progenitor cells from the total cells
vi. Select the CD33 positive events on the HLA-‐DR versus CD33 dot-‐plot and determine the percentage of CD33 positive /CD34 positive myeloid progenitor cells from the total cells as well as from the CD34 positive progenitor cells. The remaining CD33 negative /CD117 negative / CD34 positive events correspond to the B-‐cell precursor cells.
vii. Compare the patterns of expression of CD117 versus HLA-‐DR as well as those from the tube-‐specific markers of the myeloid
![Page 27: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/27.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
22
progenitor cells with their patterns in normal / regenerating marrows.
b. CD34 positive ’myeloid’ precursors (leukemia stem cell tube)(optional- if chosen as MRD tube or to determine leukemic stem cells). This is a stepwise gating to identify the normal CD7+ /CD34+ myeloid subpopulations i. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events ii. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐
plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells’
iii. Select the CD123 bright positive /HLA-‐DR positive events on the HLA-‐DR versus CD123 dot-‐plot
iv. Redefine the gated CD123 positive dendritic cells on the CD45 versus SSC dot-‐plot as well as on the FSC and SSC dot-‐plot as a homogenous cell population. Note that a subpopulation of the dendritic cells is dim positive for CD34 as well as for CD7. A small population of the CD34 positive /CD123 positive population is positive for CD7
v. Make the dendritic cells invisible vi. Select the CD34 positive events in a CD34 versus SSC dot-‐plot vii. Fine tune the gated events on the CD45 versus SSC dot-‐plot being
identified as a population with dim expression of CD45 and low to intermediate side scatter bordering mature granulocytes as well as on the FSC versus SSC dot-‐plot being a homogenous population and annotate these events as CD34 positive progenitor cells
viii. Select the CD38 bright positive /CD96 dim positive events on the CD38 versus CD96 dot-‐plot. The CD96 positive /CD34 positive cell population comprises a very small population in normal bone marrows, whereas it is somewhat larger in regenerating marrows. It is dim positive for CD117. It might also be partly dim positive for CD7 (see presentation)
ix. Make the CD96 positive /CD34 positive progenitor cells invisible. x. Select the CD117+ /CD34+ positive events on the remaining CD34
positive cells on the CD117 versus SSC dot-‐plot, these cells represent the remaining myeloid precursors and are largely CD7 negative and show a heterogeneous expression of CD123
xi. Leukemic stem cells are identified as CD38 negative / CD34 positive events. They are CD96, CD123 and CD7 negative.
c. CD34 positive /CD19 positive precursors (tube 3)
i. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events
![Page 28: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/28.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
23
ii. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells’
iii. Select the HLA-‐DR and CD19 positive events on the HLA-‐DR versus CD19 dot-‐plot
iv. Redefine CD19/HAL-‐DR double positive B-‐cells on the FSC versus SSC dot-‐plot as a homogeneous cell population and annotate these events as B-‐cells
v. Select CD34 positive /CD19 positive event on the CD45 versus CD34 dot-‐plot and determine its percentage of the CD34 positive progenitor cells as well as of total cells
d. CD117 positive/CD34 negative precursors (if of interest to evaluate their normal expression patterns- determined of viable cells excluding the CD34+ precursor) i. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events ii. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐
plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells’
iii. Use the above described gating for CD34 positive progenitor cells and make this population invisible (see 3a)
iv. Select the CD117 positive events on the CD117 versus SSC dot-‐plot (exclude the CD117 bright positive events which are mast cells)
v. Select the CD34 negative events on the CD34 versus CD45 dot-‐plot vi. Select the CD45 dim positive events on the CD45 versus SSC dot-‐
plot. 2 groups of clustered events can be discriminated: CD117 positive erytroblasts and CD117 positive neutrophilic and monocytic precursor cells
vii. Compare the patterns of expression of the tube-‐specific markers for the CD117 positive neutrophilic /monocytic precursor cells with their patterns in normal /regenerating marrows)
e. Monocytes (tubes with CD33 antibody) i. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events ii. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐
plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells
iii. Select the CD33 bright positive /HLA-‐DR positive events on the HLA-‐DR versus SSC dot-‐plot
iv. Select the CD34 negative events on the CD45 versus CD34 dot-‐plot
![Page 29: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/29.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
24
v. Fine tune by gating on the mature monocyte gate identified as the CD45 bright and intermediate SSC region on the CD45 versus SSC dot-‐plot and annotate as monocytes
vi. Compare the patterns of expression of the tube-‐specific markers with their pattern in normal / regenerating marrows (optional-‐ it is of importance in case of follow up of monocytic leukemia)
f. Granulocytes (tubes with CD33 antibody)
i. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events ii. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐
plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells’
iii. Select the CD33 dim positive /HLA-‐DR negative events on the HLA-‐DR versus SSC dot-‐plot
iv. Fine tune the clustered events in the granulocyte gate identified as CD45 dim positive and high SSC region on the CD45 versus SSC dot-‐plot and annotate these events as granulocytes
v. Compare the patterns of expression of the tube-‐specific specific markers of interest with their pattern in normal/regenerating marrows (optional-‐ if of interest)
g. Lymphocytes i. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events ii. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐
plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells’
iii. Select the CD45 bright positive / low SCC events on the CD45 versus SSC dot-‐plot
iv. Redefine the selected lymphocytes as a homogenous population on the FSC versus SSC
h. Erythroblasts
If the tube with CD36 is analysed: i. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events ii. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐
plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells’
iii. Select CD36 positive and CD45 negative/dim positive events on the CD45 versus CD36 dot-‐plot
iv. Redefine the CD36 positive erytoblasts as a homogenous population on the CD45 versus SSC dot-‐plot being CD45 negative/dim positive and low SSC and annotate these events as erytroblasts
![Page 30: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/30.jpg)
Appendix 4 NOPHO-‐DBH AML 2012 2012-‐11-‐21
25
If tubes without CD36 are analyzed: v. Use the FSC-‐A versus FSC-‐H dot-‐plot to exclude the double events vi. Use the FSC versus SSC dot-‐plot and FSC or SSC versus CD45 dot-‐
plot to exclude dead cells, platelets and debris and annotate the remaining events as ‘viable cells’
vii. Select the CD45 negative /dim positive and low SSC events on the CD45 versus SSC dot-‐plot
![Page 31: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/31.jpg)
Appendix 5. Guidelines for PCR quantification. 2012-09-30
Analysis of mRNA transcripts for quantification of gene fusion transcripts Determination of MRD Variation in reagent choice, protocols and laboratory platforms will lead to slightly different values when monitoring Minimal Residual Disease (MRD) by the detection of fusion transcripts by real time quantitative polymerase chain reaction (qPCR). Therefore, the same laboratory should analyse both initial and follow-up samples from the same patient for an accurate determination of MRD. Sample collection Two samples with at least 5 ml of peripheral blood (PB) and/or 1 ml of bone marrow (BM) aspirate is recommended for MRD analysis. However, the analysis is based on the occurrence of nucleated cells rather than the volume. Therefore, a larger quantity may be needed if the leukocyte count is low in order to achieve adequate sensitivity. EDTA should be used as an anticoagulant. The samples are sent uncentrifuged to the laboratory. Since it is important to reduce degradation of mRNA transcripts before analysis, the sample should ideally reach the laboratory within 24 hours. Alternatively; PAX gene tubes (PreAnalytiX) which conserves the RNA at the sampling procedure may be used. Pre-purification Whole blood/bone marrow (buffy coat) or isolation of mononuclear cells (MNC) can be used for RNA purification. Erythrocytes need to be removed before extraction of RNA. Various techniques can be used to separate MNC, the most commonly used is separation with ficoll (Ficoll, Lymphoprep, Histopaque), a technique used by most molecular biology labs. Purification of RNA The buffy coat or isolated MNC should be lysed in RLT or RLT+ buffer (Qiagen), TRIzol (Invitrogen) or other equivalents and purification of RNA should be performed according to protocols corresponding to each lysis buffer. RNA from blood collected in PAX gene tubes is extracted using a specific protocol with reagents from PreAnalytix/Qiagen. In all cases, great care should be taken in order to avoid RNA degradation. Preparation of cDNA Following RNA extraction, complementary DNA (cDNA) is synthesised, preferably using random hexamer primers. This may a critical step and an optimized protocol should be used [2,4] qPCR assay For quantitative measurements, real-time quantitative PCR (qPCR) is used. For increased specificity, labelled hydrolysis probes, which are designed to hybridize to a region between the PCR-primers, is recommended. Alternatively, double strand DNA intercalating dyes, e.g. SYBR Green, could be used. According to the EAC-program, the following primer and probe sets have been recommended for detection of CBFb-MYH11 in cases with inv(16)(p13q22) or t(16;16)(p13;q22) and RUNX1-RUNX1T1 in cases with t(8;21)(q22;q22)[1, 2]:
![Page 32: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/32.jpg)
Appendix 5. Guidelines for PCR quantification. 2012-09-30
CBFb-MYH11 ENF803 (forward primer) 5´- CATTAGCACAACAGGCCTTTGA -3´ ENPr843 (probe) 5´- Fam-TCGCGTGTCCTTCTCCGAGCCT-Tamra -3´ ENR862 (reverse primer A) 5´- AGGGCCCGCTTGGACTT -3´ ENR863 (reverse primer D) 5´- CCTCGTTAAGCATCCCTGTGA -3´ ENR865 (reverse primer E) 5´- CTCTTTCTCCAGCGTCTGCTTAT -3´ RUNX1-RUNX1T1 ENF701 (forward primer) 5´-CACCTACCACAGAGCCATCAAA -3´ ENP747 (probe) 5´-Fam-AACCTCGAAATCGTACTGAGAAGCACTCCA-Tamra -3´ ENR761 (reverse primer) 5´-ATCCACAGGTGAGTCTGGCATT -3´ For detection of MLL-MLLT3 (MLL-AF9) in cases with t(9;11)(p22;q23) the following primer and probe sets have been recommended [3]: MLL-MLLT3 MLL-F1 exon 8 (forward primer) 5´-CGCCTCAGCCACCTACTACAG-3´ MLL-F2 exon 9 (forward primer) 5´-AGGAGAATGCAGGCACTTTGA-3´ MLLT3-R1 exon 9 (reverse primer) 5´- TCACGATCGCTGCAGAATGT-3´ MLLT3-R2 exon 5 (reverse primer) 5´- TGGCAGGACTGGGTTGTTC-3´ MLLT3-R3 exon 4 (reverse primer) 5´- GCTGCTGCTGCTGGTATGAAT-3´ MLL-T1 (probe) 5´-Fam-CGCCAAGAAAAGAAGTTCCCAAAACCACT-Tamra-3´ MLL-T2 (probe) 5´-Fam-CATCCTCAGCACTCTCTCCAATGGCAATA-Tamra-3´ Specific protocols for the qPCR assay may vary depending on the platform used. In all cases, strict precautions should be undertaken in order to avoid contamination. Moreover, positive and negative controls should be included in all experiments. For quantification, standards which span the dynamic range of the assay should be used. To certify linearity of the assay, the correlation coefficient of a standard curve should be at least 0.98. In addition to the genes of interest, the samples should also be assayed for at least one internal reference gene. The transcript value obtained from these(is) gene is used to normalize the expression of fusion gene analyzed. As reference gene(s) c-abl oncogene 1 (ABL1) or glucuronidase beta (GUSB) are recommended. The following primers and probe have been recommended [4]: ABL1 ENF1003(forward primer) 5´-TGGAGATAACACTCTAAGCATAACTAAAGGT -3´ ENPr1043 (probe) 5´-Fam-CCATTTTTGGTTTGGGCTTCACACCATT-Tamra-3´ ENR1063 reverse primer) 5´- GATGTAGTTGCTTGGGACCCA-3´ GUSB ENF1102 (forward primer) 5´-GAAAATATGTGGTTGGAGAGCTCATT-3´ ENPr1142 (probe) 5´-Fam-CCAGCACTCTCGTCGGTGACTGTTCA-Tamra-3´ ENR1162 (reverse primer) 5´-CCGAGTGAAGATCCCCTTTTTA-3´ Calculations The obtained copy number of fusion transcripts are divided by the copy number of the internal reference gene. The resulting ratio is multiplied by 100 to be expressed as percentage. MRD is
![Page 33: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/33.jpg)
Appendix 5. Guidelines for PCR quantification. 2012-09-30
calculated by dividing the present value with the value obtained at diagnosis and presented as the fraction of remaining transcripts. References 1. van Dongen, J.J., et al., Standardized RT-PCR analysis of fusion gene transcripts from
chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia, 1999. 13(12): p. 1901-28.
2. Gabert, J., et al., Standardization and quality control studies of 'real-time' quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - a Europe Against Cancer program. Leukemia, 2003. 17(12): p. 2318-57.
3. Jansen, M.W., V.H. van der Velden, and J.J. van Dongen, Efficient and easy detection of MLL-AF4, MLL-AF9 and MLL-ENL fusion gene transcripts by multiplex real-time quantitative RT-PCR in TaqMan and LightCycler. Leukemia, 2005. 19(11): p. 2016-8.
4. Beillard, E., et al., Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using 'real-time' quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) - a Europe against cancer program. Leukemia, 2003. 17(12): p. 2474-86.
![Page 34: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/34.jpg)
Appendix 6. Instruction for CRF DNX study AML2012 2012-‐09-‐30
Instruction for Case Report Form DNX study
The CRF for the DNX study will have five main parts all of which will be reported online.
The toxicity reports after course one and two (see app 2) Bone marrow outcome data D22 BM after ECM/ECDx Cellularity (aplasia/hypoplasia/normal) BM blast count D22 MRD flow data as reported by the clinician and the laboratory MRD flow category (clinician) (<0.1/0.1-‐4.9/5-‐14.9/≥15%/no sensitive LAIP) MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5%
Compliance control and result of last BM prior to course 2 In patients with ≥5% leukaemic cells (LAIP) or ≥ 5% blast cells on d22 (no sensitive LAIP) Was course 2 started immediately (within three days) yes/no If no give reason (patient severely ill/other) If other specify In patients with < 5% leukaemic cells (LAIP) or < 5% blast cells on d22(no sensitive LAIP) Was repeat BM done (yes/no) If no specify reason Result of the last BM prior to course 2 MRD flow category (clinician) (<0.1/0.1-‐4.9/5-‐14.9/≥15%/no LAIP) MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5% All above should be registered no later than two weeks from start of course 2
Overall outcome measures • CR obtained (yes/no ; after which course ; date) • Event registration (resistant disease/relapse/early death/death in CR/SMN)
Events should be registered immediately. • Followup status. This should be updated after each course and subsequently at least twice
yearly until five years from diagnosis
Cardiac toxicity Clinical evaluation and UCG is performed at six time points (at diagnosis, before course 2, before course 3 and one, five and ten years from diagnosis). Results are documented as clinical signs of cardiac dysfunction and fractional shortening or ejection fraction.
![Page 35: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/35.jpg)
Appendix 7. Instruction for CRF FLADx study AML2012 2012-‐09-‐30
Instruction for Case Report Form FLADx study The CRF for the FLADx study will have five main parts all of which will be reported online.
The toxicity report after course two (see app 2) Bone marrow outcome data In patients with <5% leukaemic cells (LAIP) or < 5% blast cells (no sensitive LAIP) after course 1 Result of the BM prior to consolidation or start of salvage therapy MRD flow category (clinician) (<0.1/0.1-‐4.9/≥5%/no LAIP)
MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5% In patients with ≥5% leukaemic cells (LAIP) or ≥ 5% blast cells (no sensitive LAIP) after course 1. D22 BM after ADxE/FLADx Cellularity (aplasia/hypoplasia/normal) BM blast count (percent) D22 MRD flow data as reported by the clinician and the laboratory MRD flow category (clinician) (<0.1/0.1-‐4.9/≥5%/no sensitive LAIP) MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5%
Compliance control in patients with ≥ 5% LC after course one and result of last BM prior to consolidation or salvage In patients who on d22 after course 2 have ≥5% leukaemic cells (LAIP) or ≥ 5% blast cells (no sensitive LAIP) Was salvage therapy given immediately (within three days) yes/no If no give reason (patient severely ill/severe aplasia discussed with PI/other) If other specify In patients who on d22 after course 2 have <5% leukaemic cells (LAIP) or < 5% blast cells (no sensitive LAIP) Was repeat BM done (yes/no) If no specify reason Result of the last BM prior to consolidation or start of salvage therapy MRD flow category (clinician) (<0.1/0.1-‐4.9/≥5%/no LAIP)
MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5%
![Page 36: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/36.jpg)
Appendix 7. Instruction for CRF FLADx study AML2012 2012-‐09-‐30
All above should be registered no later than two weeks from start of consolidation or salvage therapy.
Overall outcome measures • CR obtained (yes/no ; after which course ; date) • Event registration (resistant disease/relapse/early death/death in CR/SMN)
Events should be registered immediately. • Followup status. This should be updated after each course and subsequently at
least twice yearly until five years from diagnosis
Cardiac toxicity Clinical evaluation and UCG is performed at six time points (at diagnosis, before course 2, before course 3 and one, five and ten years from diagnosis). Results are documented as clinical signs of cardiac dysfunction and fractional shortening or ejection fraction.
![Page 37: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/37.jpg)
Appendix 8 AML 2012 Biobank 2012-09-30
1
NOPHO BIOBANKING INSTRUCTIONS The LLC and NOPHO board decided 2006 to build a common biobank for future collaborative NOPHO-studies of childhood ALL and AML. The biobank is located in Uppsala, Sweden. The biobank consists of bone marrow and blood samples frozen as cell pellets and vital frozen cells from children with leukaemia. Samples should be collected: • At diagnosis (all patients) • At relapse(s) (all patients) Sampling Bone marrow: 2-5 ml in 2 heparinized tube containing 2 ml 0,9% NaCl Blood: 7 ml in 1 heparinized test tube, if LPK < 50 2 tubes Referral form is to be filled in and sent with the samples. For further details se “Referral form” and “Samples and Transport instructions”. Responsible persons: Britt-Marie Frost Postal address: Akademiska barnsjukhuset, SE-75185 Uppsala tel 0046 (0)18 611 00 00 (vx), alt 611 58 83 fax 0046 (0)18 50 09 49 [email protected] Josefine Palle Address, tel, fax: see above [email protected] Maria Lindström Uppsala Biobank, Klinisk patologi och cytologi Rudbecklaboratoriet C5 75185 Uppsala tel 0046 (0)18 6113746 [email protected] 20121004
![Page 38: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/38.jpg)
Appendix 8 AML 2012 Biobank 2012-09-30
2
Sampling and Transport instructions for NOPHO Biobanking
Sampling of all patients at diagnosis and relapse: Bone marrow: 2-5 ml in 2 heparinized test tube containing 2 ml 0.9 % saline Blood: 7 ml in 1 (if LPK<50 2 tubes) heparinized test tube Referral form is to be filled in and sent with the samples. Preliminary notification Preliminary notification that a sample is being sent must be made to the laboratory by:
Fax 0046(0)18553354 or E-mail [email protected] or Phone 0046(0)186113746 (always on fridays)
Transportation Transportation has to be arranged and paid by each unit. The sample must be kept at room temperature. Make sure that the sample is delivered to the lab in Uppsala on the following day, preferably before noon. For samples sent on Fridays, make the preliminary notification by telephone AND make sure that the courier will deliver it on Saturday, this might require special arrangements. Address Samples can be sent all days of the week
Klinisk kemi och farmakologi Ingång 61, provinlämningen, 2 trappor Akademiska Sjukhuset SE-751 85 Uppsala Sweden
121004
![Page 39: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/39.jpg)
Appendix 8 AML 2012 Biobank 2012-09-30
3
Referral form for NOPHO BIOBANKING
Send samples to: + Klinisk kemi och farmakologi Ingång 61, provinlämningen, 2 trappor Akademiska Sjukhuset SE - 751 85 Uppsala
Sweden Keep at room temperature.
The sample should reach the laboratory the next day. Address of sender (unit, hospital, phone no.) Name of patient and date of birth
Always notify when a sample is going to be sent to: Fax: 0046 (0)18 55 33 54 or E-mail: [email protected] or phone: 0046 (0) 18 611 37 46 (always telephone on Fridays ) From: Physician: .............................................. Date and time for sampling: .................................... White blood cells (WBC)109/l: ................................ Material for biobanking ¨ Bone marrow tubes…...... ¨ Blood tubes.................... INSTRUCTIONS Bone marrow: 2-5 ml in 2 heparinized tubes containing 2 ml 0.9 % saline Blood: 7 ml in heparinized tube, if LPK < 50 send 2 tubes Arrival date, time:........................ If problems: contact Britt-Marie Frost, Josefine Palle or Maria Lindström (operator) +46 (0)18 611 00 00. 121004
![Page 40: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/40.jpg)
Appendix 9 Guidelines for Patient information 2012-‐09-‐30
Guidelines for patient information This appendix contains a template for information to guardians and a consent form. These documents need to be adapted to national requirements. In particular page 1 of the information to guardians is adapted to Swedish requirements. Both documents should be signed by the national coordinator of each country and no signature from the study chair is required.
![Page 41: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/41.jpg)
Appendix 9 Guidelines for Patient information 2012-‐09-‐30
Information to guardians
NOPHO-DBH AML 2012
Research study for treatment of children and adolescents with acute myeloid leukemia
We would like to ask if you accept that your child participates in a scientific research study. You can read about the purpose and how the study is performed on the next page. It is entirely voluntary to participate and even if you at one time have given consent you are at any time free to change your mind and withdraw the child from the study without having to specify any reason. This applies even if you have signed the written consent form.
If you accept participation it is required that the guardians (usually both parents) sign the written consent form.
This consent also means that you accept the collection of data regarding your child and the child’s disease as well as the result of laboratory analyses in a research database which we then use for evaluation of the study results. Blood and bone marrow samples that are taken within the study are kept in a biobank prior to analysis. You can at any time demand that these samples are disposed of. The information concerning your child is kept so that no unauthorized access can occur. All persons who in any way handle the data obey professional secrecy and only a restricted few people involved in the study have access to the database.
In Gothenburg, Sahlgrenska University Hospital, under regulation of the Privacy protection Law (SFS 1998;204), is responsible for handling of personal data. You can contact the Personal Data Compliance Officer at the hospital if you wish to have an extract over registered data and, if warranted, help with corrections.
The consent also signifies that you allow the Swedish Medical Product Agency, Regional ethics committee in Göteborg and the external monitor of the study to access your child’s medical records. These monitors are also under professional secrecy.
In case an injury should occur due to participation in the study your child is covered by The Patient Injury Act.
If You have additional questions please feel free to contact me or your treating physician.
With kind regards
National coordinator
![Page 42: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/42.jpg)
Appendix 9 Guidelines for Patient information 2012-‐09-‐30
NOPHO-DBH AML 2012
Research study for treatment of children and adolescents with acute myeloid leukemia
This study concerns children and adolescents with acute myeloid leukemia who are treated in The Netherlands, Belgium, Hong Kong, Estonia or the Nordic countries. The main purpose of the study is to investigate if the risk of relapse can be reduced by improving the first two courses of chemotherapy (see figure).
Background
Prognosis in acute myeloid leukemia in children has improved but still approximately 1/3 of the patients suffer from relapse. It has been shown that the number of leukemic cells (LC) that remain after the first two treatment courses is the most important factor to predict the risk of relapse. Today, for the majority of children, we have sensitive methods that allow us to detect very low numbers of LC and we use these to measure the number of LC in the bone marrow both after the first and second course. It is very important to detect a poor response to treatment since even these children have a good chance of cure if the treatment is intensified with stem cell transplantation (SCT).
Since the side effects of SCT are more severe than those of conventional therapy it is important to design the first two courses so that as many children as possible have a good treatment response.
AML 2012 is built on the collective world experience of research and treatment of AML. We know that the treatment is effective but now wish to investigate if we can improve both the first and second treatment course.
DaunoXome study course 1. Drugs from the so called anthracycline group are among the most effective in AML but have a downside that they at high cumulative doses can affect heart function. In AML 2012, mitoxantrone is used as the standard anthracycline in the first course. We now want to test if the drug DaunoXome has a better effect with less cardiac side effects. Both drugs have been used extensively in childhood AML with good results but no study has directly compared the two drugs and therefore we do not know if either of the drugs is better.
FLADx study course 2. AML 2012 uses a three-‐drug combination named ADxE as standard therapy in the second arm. Another three-‐drug combination, FLADx has been proven to be very effective in treatment of relapsed AML. Since relapses in general are more resistant to therapy we want to test if FLADx is more effective than ADxE in treatment of newly diagnosed AML. Both combinations are thoroughly tested in children and, although no direct comparative study has been performed, we have no reason to believe that either combination has the risk of more side effects.
![Page 43: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/43.jpg)
Appendix 9 Guidelines for Patient information 2012-‐09-‐30
How is the study performed?
Thus we want to investigate two major things. In the first course we test if DaunoXome is more effective than mitoxantrone and in the second course we test if FLADx is more effective than ADxE. In order to obtain reliable results neither doctor nor guardian or patient can choose which treatment to give. Instead a randomization procedure is used for both studies. Randomization means that a computer, uninfluenced by any person, randomly assigns each patient to which treatment to give. If you do not wish to participate in any of the two studies the standard treatment arm will be given with mitoxantrone in the first course and ADxE as second course.
The administration of the different treatment arms do not differ much. In the first course mitoxantrone is given as a 30 minute infusion on day 6-‐10 whereas DaunoXome is given as a one hour infusion on day 6, 8 and 10. The second course differs a bit more in that ADxE is eight days long whereas FLADx is six days. We do not expect that any of the treatment arms has more side effects either during or after treatment.
The effect of the treatment is evaluated by measuring the number of remaining LC in the bone marrow three weeks after start of the first course and immediately before starting the third treatment course. It is common and normal that additional bone marrow investigations need to be done particularly after the first course. These investigations need to be performed in all children, regardless if they are in the study or not, so that we can steer the treatment correctly. Therefore, participation in the study does not include any extra investigations. We would however wish to take an additional sample of 2 ml of bone marrow. This is used for research purposes to develop even more sensitive methods to measure the number of leukemic cells.
Are there any risks involved in the study?
Treatment for AML needs to be very intensive so all children are expected to have fairly severe side effects. Virtually all children have infections and many also injuries of the mucosal membranes after each of the two first courses. The drugs we are testing in both courses are all well studied in treatment of childhood AML. From these experiences we do not expect that children receiving DaunoXome in the first course or FLADx in the second will have more side effects. We will however document side effects carefully in order to determine if there is any difference between the treatment arms.
We also know that all the treatment alternatives are very effective. What we don’t know is if either of the arms are better and the aim of the study is to find this out.
Are there any advantages of participating in the study?
AML 2012 is a modern and effective treatment protocol for AML. We hope and believe that the protocol strategy will improve prognosis for all children regardless if they participate in the study or not. It may be that the study arms (DaunoXome in course 1 or FLADx in course 2) are even more effective and that children treated with these may benefit. However, I want to emphasize again that we do not know if any arm is more effective and it could be that the standard treatment is better. In all circumstances the study will answer important questions and lead to benefit for future patients with AML
![Page 44: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/44.jpg)
Appendix 9 Guidelines for Patient information 2012-‐09-‐30
The results of the study will be published in international scientific journals.
Finally I would once again want to point out that participation is voluntary. If you do not wish to participate your child will receive the standard arms of the protocol. If you have additional questions feel free to contact me or your treating physician.
City 2012-‐10-‐05
National coordinator
![Page 45: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/45.jpg)
Appendix 9 Guidelines for Patient information 2012-‐09-‐30
Overview of induction therapy
The first randomization is done at the latest on day 5 in the first course. It assigns the patients to either receive mitoxantrone (standard arm – MEC) or DaunoXome (study arm –DxEC) from day 6 in the first course. The second randomization is performed as soon as the results from the day 22 bone marrow are at hand. It assigns patients to either receive the three-‐drug combination ADxE (standard arm) or the three-‐drug combination FLADx (study arm)
![Page 46: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/46.jpg)
Appendix 9 Guidelines for Patient information 2012-‐09-‐30
Course 1
Overview of the two treatment arms in the first randomization (DaunoXome study)
![Page 47: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/47.jpg)
Appendix 9 Guidelines for Patient information 2012-‐09-‐30
Course 2
Overview of the two treatment arms in the second randomization (FLADx study)
![Page 48: Appendix(list(NOPHO0DBH(AML(2012(vs(2.0(2012009030( … · 2015-08-10 · Appendix(4(NOPHO.DBH(AML(2012(2012.11.21(( 1((Guidelines)for)the)detection)of)minimal)residual)disease) using)multiparameter)flow)cytometry)!](https://reader034.fdocuments.us/reader034/viewer/2022042913/5f49f53c6014bd1a961737a2/html5/thumbnails/48.jpg)
Appendix 9 Guidelines for Patient information 2012-‐09-‐30
Declaration of consent for participation in the study NOPHO-‐DBH AML 2012. A research study for treatment of children and adolescents with
acute myeloid leukemia Name of child: ________________ Date of birth:___________ I hereby declare that I, having received both oral and written information, agree to participate or let my child participate in all or parts of the study NOPHO-‐DBH AML 2012 as signed in the three boxes below. I accept that information regarding my/my child’s disease and treatment is registered in the research database and that the competent authority of ..... and an external monitor can take part of my / my child’s medical records. I also accept that some blood and/or bone marrow samples are collected in a biobank. I have received information that I at any time can request that these samples are disposed of. I am also aware that it is entirely voluntary to participate in the study and that I at any time can withdraw from future participation in the study. I hereby give my consent to participating in the randomization for course 1 (DaunoXome study) Date: _______ Signature: __________________
The child Date: _______ Signature ___________________ Date:______ Signature:____________
Guardian Guardian Date: _______ Signature ___________________
Physician I hereby give my consent to participating in the randomization for course 2 (FLADx study) Date: _______ Signature: __________________
The child Date: _______ Signature ___________________ Date:______ Signature:____________
Guardian Guardian Date: _______ Signature ___________________
Physician I hereby give my consent to, at the time of bone marrow punctures necessary for treatment, the collection of a small extra amount of bone marrow for research on characterization and identification of leukemic cells Date: _______ Signature: __________________
The child Date: _______ Signature ___________________ Date:______ Signature:____________
Guardian Guardian Date: _______ Signature ___________________
Physician