Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii...
Transcript of Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii...
![Page 1: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/1.jpg)
Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus: the Role of CAPA Peptides
by
Jean-Paul Paluzzi
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Department of Cell and Systems Biology University of Toronto
© Copyright by Jean-Paul Paluzzi 2010
![Page 2: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/2.jpg)
ii
Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus:
the Role of CAPA Peptides
Jean-Paul Paluzzi
Doctor of Philosophy
Department of Cell and Systems Biology
University of Toronto
2010
Abstract
CAPA-related peptides belong to a family of neuropeptides localized to the central nervous
system that can function in diverse roles in the regulation of water and salt homeostasis in
insects. These peptides are known to stimulate fluid secretion by Malpighian tubules (MTs) in
Dipteran species, thus serving a diuretic function. In contrast, this thesis demonstrates that
members of this family of peptides in Rhodnius prolixus serve an anti-diuretic role and have
multiple tissue targets, whereby they oppose the activity of diuretic hormones such as serotonin
(5-Hydroxytryptamine hydrochloride; 5-HT). I have identified two genes each encoding three
peptides in R. prolixus, suggesting this insect is capable of producing a greater number of
CAPA-peptides compared to other insects that contain only a single CAPA gene. Interestingly,
while the second peptide encoded in each R. prolixus gene (RhoprCAPA-α2/-β2) inhibits the
stimulatory effects of serotonin on tissues such as the anterior midgut and Malpighian tubules, it
appears the other CAPA-related and pyrokinin-related peptides do not play a major role in
inhibiting the effects of serotonin on these tissues. More specifically, serotonin-stimulated fluid
secretion by MTs and fluid absorption by the anterior midgut are reduced by the anti-diuretic
peptide, RhoprCAPA-α2. In addition, I have also identified a G protein-coupled receptor which
likely mediates the anti-diuretic effect associated with RhoprCAPA-α2 and have functionally
characterized this receptor in Chinese hamster ovary cells. Spatial transcript expression analysis
in fifth-instars reveals a wide distribution of the receptor in tissues associated with the rapid post-
gorging diuresis. Thus, my findings suggest that numerous tissues are regulated by the CAPA
![Page 3: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/3.jpg)
iii
peptides in R. prolixus. Gene structure and phylogenetic analyses demonstrate that this receptor
is the orthologue of the D. melanogaster capa receptor (CG14575) with homologs in other
insects. Taken together, my thesis demonstrates that the RhoprCAPA peptides play an integral
role in the coordination and maintenance of anti-diuresis in R. prolixus. This mechanism is
necessary following the rapid diuresis associated with blood-feeding by this medically-important
insect.
![Page 4: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/4.jpg)
iv
Acknowledgments
I would like to thank my supervisor, Dr. Ian Orchard, for the opportunity to work and carry out
my research in his laboratory. This experience has been most rewarding when I consider the
plethora of knowledge that I have gained during my graduate tenure. Opportunities to interact
with many experts in the field of insect neuroendocrinology, as well as related research realms,
have been plentiful and could not have occurred without the guidance and support of Dr.
Orchard. Also, a special thanks to my co-supervisor, Dr. Angela Lange, who first gave me the
opportunity to carry out research in her lab during my undergraduate thesis project. Additional
thanks for allowing me to pursue and fulfill my interests in university administrative and
leadership roles that have helped to enrich my academic and social perspectives.
Sincere thanks to all of my lab mates, including post-doctoral fellows and graduate student peers,
for the guidance, support and input in every aspect of my academic research and professional
development.
To my parents: thank you for always believing in me, for accepting my decision to pursue
research and for your ongoing support of my journey in academia. The love and guidance you
have given me has been much appreciated.
To my family members and close friends – those whom have little idea of what I really do in the
lab and think academic research conferences are nothing more than glorified science fairs!
Thanks for the many enjoyable activities over the years including fishing trips, chalet and cottage
celebrations, and those unforgettable summer barbeques!
Finally, I must thank my biggest aficionado, Christine. This thesis would not have been possible
without the love and support you have given me over these last few years. Thanks for respecting
my dedication and focus during this time and believing in my all my goals and ambitions.
![Page 5: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/5.jpg)
v
Table of Contents
Abstract .......................................................................................................................................... ii
Acknowledgments ........................................................................................................................ iv
Organization of the Thesis ........................................................................................................ viii
List of Figures and Tables ........................................................................................................... ix
List of Appendices ...................................................................................................................... xiii
List of Abbreviations ................................................................................................................. xiv
Chapter 1: General Introduction .................................................................................................1
Rhodnius prolixus ......................................................................................................................1
Osmoregulation .........................................................................................................................2
Diuretic and anti-diuretic hormones .......................................................................................3
G protein-coupled receptors (GPCRs) ....................................................................................6
Overview of the R. prolixus central nervous system (CNS) ...................................................7
Regulation of diuresis in R. prolixus ........................................................................................7
Regulation of anti-diuresis in insects .......................................................................................9
Objectives .................................................................................................................................12
References ................................................................................................................................14
Chapter 2: Distribution, activity and evidence for the release of an anti-diuretic peptide in the kissing bug, Rhodnius prolixus ....................................................................................26
Abstract ....................................................................................................................................27
Introduction .............................................................................................................................28
Materials & Methods ..............................................................................................................30
![Page 6: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/6.jpg)
vi
Results ......................................................................................................................................33
Discussion .................................................................................................................................54
References ................................................................................................................................57
Acknowledgements ..................................................................................................................60
Copyright Acknowledgements ...............................................................................................61
Chapter 3: Isolation, cloning, and expression mapping of a gene encoding an anti-diuretic hormone and other CAPA-related peptides in the disease vector, Rhodnius prolixus .....................................................................................................................................62
Abstract ....................................................................................................................................63
Introduction .............................................................................................................................64
Materials & Methods ..............................................................................................................66
Results ......................................................................................................................................73
Discussion .................................................................................................................................89
References ................................................................................................................................93
Acknowledgments ...................................................................................................................99
Copyright Acknowledgments ...............................................................................................100
Chapter 4: A second gene encodes the anti-diuretic hormone in the insect, Rhodnius prolixus ...................................................................................................................................101
Abstract ..................................................................................................................................102
Introduction ...........................................................................................................................103
Materials & Methods ............................................................................................................106
Results ....................................................................................................................................112
Discussion ...............................................................................................................................134
References ..............................................................................................................................139
![Page 7: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/7.jpg)
vii
Acknowledgments .................................................................................................................144
Copyright Acknowledgments ...............................................................................................145
Chapter 5: Isolation, expression analysis and functional characterization of the first anti-diuretic hormone receptor in insects ...........................................................................146
Abstract ..................................................................................................................................147
Introduction ...........................................................................................................................148
Materials and Methods .........................................................................................................151
Results ....................................................................................................................................156
Discussion ...............................................................................................................................171
Acknowledgments .................................................................................................................181
Appendices .............................................................................................................................182
Copyright Acknowledgments ...............................................................................................185
Chapter 6: General Discussion .................................................................................................186
Linking the chapters .............................................................................................................187
Integrating the whole ............................................................................................................198
Future directions ...................................................................................................................204
References ..............................................................................................................................208
![Page 8: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/8.jpg)
viii
Organization of the Thesis
Chapter 1 of this thesis provides a general introduction into my research topic and area. Chapter 2 was published in the Journal of Experimental Biology (Paluzzi, J.P. and Orchard, I. (2006) J. Exp. Biol. 209(5): 907-15; doi: 10.1242/jeb.02083). Chapter 3 was published in Endocrinology (Paluzzi, J.P., Russell, W.K., Nachman, R.J. and Orchard, I. (2008) Endo. 149(9): 4638-46; doi:10.1210/en.2008-0353). Dr. Russell and Dr. Nachman performed the MALDI-TOF analysis and Dr. Nachman synthesized the peptides encoded by the R. prolixus CAPA genes. Chapter 4 was published in Molecular and Cellular Endocrinology (Paluzzi, J.P. and Orchard, I. (2010) Mol. Cell. Endo. 317(1-2): 53-63; doi:10.1016/j.mce.2009.11.004). Chapter 5 has been accepted for publication in Proceedings of the National Academy of
Sciences and is currently IN PRESS (Manuscript tracking number: 2010-03666R; Paluzzi, J.P., Park, Y., Nachman, R.J. and Orchard, I.). Dr. Park provided the research space and funding for the receptor-ligand functional analysis. Dr. Nachman synthesized the peptides and analogs tested in the functional assay. Unless stated otherwise, all experiments and data analysis were performed by myself. Dr. Orchard rendered invaluable aid in the form of suggestions and comments for each manuscript and in addition funded all of my research. Copyright permission, if required, was granted from each of the publishers to reprint Chapters 2-5. Chapter 6 summarizes chapters 2-5 and provides a general discussion integrating the findings of this thesis in the area of insect physiology.
![Page 9: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/9.jpg)
ix
List of Figures and Tables
Chapter 1: General Introduction ………….....………………………………………………..1
Figure 1. Schematic overview of the osmotic and ionic concentrations, and the movements of
fluid during the rapid post-prandial diuresis in R. prolixus …………………………………..…..5
Chapter 2: Distribution, activity and evidence for the release of an anti-diuretic peptide in
the kissing bug, Rhodnius prolixus ………………………………………………………..…..26
Figure 1. Composite camera lucida drawing of PRXamide-like immunoreactive cells and
processes in the central nervous system of R. prolixus ……………………………………….....35
Figure 2. Dorsal view of PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus
central nervous system………………………………………………………………….………..37
Figure 3. Ventral view of PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus
central nervous system………………………………………………………………….………..39
Figure 4. PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus in frontal
ganglion and abdominal nerves …...…………………………………………………………….42
Figure 5. Time-course immunohistochemical analysis of the ventral paired medial
neurosecretory cells in the MTGM of fifth-instar R. prolixus …………………………………..45
Figure 6. Dose–response curve demonstrating Mas-CAPA-1 inhibition of secretion by
Malpighian tubules stimulated with 50 nmol l–1 5-HT ………………………………………....48
Figure 7. Inhibition of secretion (stimulated with 50 nmol l–1 5-HT) with increasing doses of
Fraction 25 from RP-HPLC ……………………………………………………………………..50
Figure 8. Change in levels of intracellular cGMP in tubules stimulated with 5-HT alone or in
combination with Mas-CAPA-1 (500 nmol l–1) or Fraction 25 (F25; 10 CNS equivalents) vs
saline alone ………………………………………………………………………………………52
![Page 10: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/10.jpg)
x
Chapter 3: Isolation, cloning, and expression mapping of a gene encoding an anti-diuretic
hormone and other CAPA-related peptides in the disease vector, Rhodnius prolixus …….62
Figure 1. Nucleotide cDNA sequence and deduced amino acid prepropeptide of the R. prolixus
CAPA gene ……………………………………………………………………………………...75
Figure 2. Detection of the peptides predicted from the CAPA gene in R. prolixus …………….78
Figure 3. Genomic Southern blot using a RhoprCAPA cDNA as probe .....................................80
Figure 4. RhoprCAPA developmental and spatial expression profile ………………………….82
Figure 5. RhoprCAPA transcript expression mapping via FISH ……………………………….85
Figure 6. Inhibition of 5-HT stimulated secretion from MTs by the anti-diuretic peptide,
RhoprCAPA-α2 ..…………………………..……………………………………………………88
Chapter 4: A second gene encodes the anti-diuretic hormone in the insect, Rhodnius
prolixus .......................................................................................................................................101
Table 1. Sequences deduced from the RhoprCAPA genes …………………..……………….113
Figure 1. Nucleotide and deduced amino acid sequence of the R. prolixus CAPA-β
(RhoprCAPA-β) gene and genomic organization …………………...................................……115
Figure 2. ClustalW2 alignment and phylogenetic analysis of known and predicted insect CAPA
encoding prepropeptide sequences …………………………………………………………….118
Figure 3. Expression analysis of RhoprCAPA genes in fifth-instar R. prolixus ………………121
Figure 4. Quantitative reverse transcriptase PCR in central nervous system following a blood
meal for RhoprCAPA-α and RhoprCAPA-β transcripts ………………………………………123
Figure 5. Tissue expression analysis of RhoprCAPA genes in adult R. prolixus and comparison
between fifth-instar and adult neuronal and reproductive tissues ……………………………...127
![Page 11: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/11.jpg)
xi
Figure 6. CAPA transcript expression and PRX-amide-like immunoreactivity in the brain,
suboesophageal ganglion (SOG) and prothoracic ganglion (PRO) of adult R. prolixus ………129
Figure 7. CAPA transcript expression and PRX-amide-like immunoreactivity in the
mesothoracic ganglionic mass (MTGM) of adult R. prolixus …………………………………131
Chapter 5: Isolation, expression analysis and functional characterization of the first anti-
diuretic hormone receptor in insects ……………………………...…………………………146
Figure 1. Rhodnius prolixus cDNA for the CAPA receptor and deduced translation ………...158
Figure 2. Predicted membrane topology of the R. prolixus CAPA receptor ………………….160
Figure 3. Sequence and phylogenetic analysis of CAPA receptors in insects ………………...163
Figure 4. CAPA receptor expression profile in fifth-instar tissues ……………………………165
Figure 5. Ligand-receptor interaction analysis of the R. prolixus CAPA receptor by heterologous
expression assay in CHO-K1 cells ……………………………………………………………..168
Table 1. Summary of peptides and analogs structurally related to the CAPA peptides in R.
prolixus tested in the functional expression assays ……………………………………………169
Figure 6. Schematic overview of the proposed CAPA peptide/receptor signaling system in R.
prolixus ………………………………………………………………………………………...176
Table S1. Degenerate primers designed based on conserved regions of previously identified
CAPA receptors used for screening fifth instar R. prolixus upper Malpighian tubules cDNA
library ………………………………………………………………………………………..…182
Table S2. Gene-specific primers for the R. prolixus CAPA receptor ………………………....183
Chapter 6: General Discussion ……………………………………………………………...186
![Page 12: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/12.jpg)
xii
Figure 1. Schematic overview of the diuretic and anti-diuretic regulation of tissues associated
with the rapid post-prandial diuresis in R. prolixus ..…………………………………….…….200
![Page 13: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/13.jpg)
xiii
List of Appendices
Chapter 5: Isolation, expression analysis and functional characterization of the first anti-
diuretic hormone receptor in insects
Appendices:
Table S1. Degenerate primers designed based on conserved regions of previously
identified CAPA receptors used for screening fifth instar R. prolixus upper Malpighian
tubules cDNA library ………………………………………………………………..…182
Table S2. Gene-specific primers for the R. prolixus CAPA receptor ………………....183
![Page 14: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/14.jpg)
xiv
List of Abbreviations
Note: Only abbreviations frequently utilized in this dissertation are included in this list. In addition, each initial use of an abbreviation is noted in the text where appropriate. 5-HT: 5-hydroxytryptamine hydrochloride (or serotonin) ABN: abdominal nerves ADF: anti-diuretic factor cAMP: adenosine 3′,5′-cyclic monophosphate CAPA: capability-gene encoded peptide CAP2b: cadioacceleratory peptide 2b cGMP: guanosine 3′,5′-cyclic monophosphate CNS: central nervous system CRF: corticotropin releasing factor CTSH: chloride transport stimulating hormone DH: diuretic hormone ETH: ecdysis triggering horone ELISA: enzyme-linked immunosorbent assay FISH: fluorescent in situ hybridization GPCR: G protein-coupled receptor ITP: ion transport peptide MALDI-TOF MS/MS: matrix assisted laser desorption ionization time-of-flight tandem
mass spectrometry MT: Malpighian tubules MTGM: mesothoracic ganglionic mass PETH: pre-ecdysis triggering hormone PRO: prothoracic ganglion PRXa-LI: PRXamide-like immunoreactivity PVK: periviscerokinin RACE: rapid amplification of cDNA ends RIA: radioimmunoassay RP-HPLC: reversed phase high performance liquid chromatography SOG: suboesophageal ganglio
![Page 15: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/15.jpg)
Chapter 1: General Introduction
![Page 16: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/16.jpg)
2
Rhodnius prolixus
All post-embryonic stages of Rhodnius prolixus are obligate blood feeders, and fifth instars
consume a blood meal equivalent to or greater than 10 times their unfed body mass. This
increase in body mass leaves the insects more susceptible to predation or detection by their
vertebrate hosts. Therefore, beginning immediately upon blood meal engorgement is a rapid
diuresis that quickly removes the excess salts and water present in the blood meal (mainly from
the plasma) and concentrates the nutritive components (mainly the red blood cells). It is during
excretion of this urine that R. prolixus transmits the protozoan parasite, Trypanosoma cruzi,
which is the etiological agent of Chagas’ disease, also known as American trypanosomiasis (De
Souza, 2002). The human host acquires the parasite unknowingly when they rub the excreted
faeces containing the parasitic protozoan into their eyes, mouth or directly into the bite wound.
Although substantial progress has been made in the control of the main Triatominae species
acting as a vector of Chagas’ disease, it remains a substantial threat in several countries of Latin
America with greatest risks in poor rural areas (Costa and Lorenzo, 2009). Alarmingly, 15-19
million people worldwide are infected with Chagas’ disease, with 1-6% of the Latin American
population afflicted and about 50,000 new cases diagnosed each year (Lima et al., 2010). A
century after this disease was first discovered by Dr. Carlos Chagas, it remains among the most
neglected tropical diseases (Morris, 2009). Therefore, R. prolixus has considerable medical
importance, but in addition, has been the model of choice by pioneers of insect physiology and
endocrinology such as Sir Vincent Wigglesworth. Renewed interest in this insect arose recently
following announcement of the sequencing of the R. prolixus genome, which will be of immense
importance in acquiring knowledge of this important insect disease-vector.
Osmoregulation
Maintenance of osmotic and ionic levels in insects represents an essential physiological activity
that allows them to succeed in many environmental and ecological niches, and to utilize a variety
of feeding strategies. Terrestrial insects that reside in arid environments, or which consume dry
materials, must ensure that water loss is minimized or absolutely prevented. In contrast, aquatic
insects living in wet habitats or insects which engorge liquid meals must eliminate excess water
![Page 17: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/17.jpg)
3
and/or salts, but maintain osmotic balance and essential salts. Thus, insects challenged with
excess water and salts undergo diuresis, whereas insects faced with limited intake of dietary
water and salts must prevent their loss, and have anti-diuretic strategies.
In R. prolixus, the rapid diuresis involves the anterior midgut, Malpighian tubules (MTs), and
hindgut, and lasts several hours, producing urine excreted from the anus that is hypo-osmotic to
both the haemolymph and the engorged blood meal (Maddrell, 1964a; 1976). In fact over 50%
of the blood-meal volume is excreted within the first few hours following feeding (Maddrell,
1964b; 1966a; 1966b). Initially, the blood enters the anterior midgut, where excess water and
ions (Na+ and Cl-) are absorbed into the haemolymph. This absorption is matched by the
excretion of water and ions (Na+, K+ and Cl-) by the upper segments of the MTs. Importantly,
the lower segments of the MTs are responsible for the reabsorption of K+ and Cl-, which would
otherwise be quickly depleted in the haemolymph. This urine is then emptied into the hindgut
and is subsequently excreted with no significant reabsorption during the rapid diuresis (for a
review, see Coast, 2009). The movement of the principal ions and water across the various
tissues involved in the rapid diuresis is summarized in Figure 1.
Diuretic and anti-diuretic hormones
Historically, the successful purification, identification, and characterization of diuretic and anti-
diuretic hormones have involved a variety of techniques. These include in vivo and in vitro
biological assays investigating the physiological or behavioral effects of a given factor (peptide
or amine) on a target tissue. One such assay is the Ramsay assay (Ramsay, 1954), or a derived
version of this assay (Donini et al., 2008; Ianowski and O'Donnell, 2001; O'Donnell and
Maddrell, 1995;1984; Te Brugge et al., 2002), where Malpighian tubule (MT) fluid secretion
rates and/or composition can be measured following treatment with a particular peptide or amine.
Other assays have involved measuring putative second messenger levels with radioimmunoassay
(RIA), or enzyme-linked immunosorbent assay (ELISA) for cyclic AMP or cyclic GMP. Of
particular importance for peptides, has been the tissue fractionation via reversed-phase high-
performance liquid chromatography (RP-HPLC), beginning in the mid 1980s (see Coast et al.,
2002). Using such methods, peptides have been isolated to purity, making their subsequent
![Page 18: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/18.jpg)
4
Figure 1. Schematic overview of the osmotic and ionic concentrations, and the movements of
water and ions (direction of movement denoted by arrows) during the rapid post-prandial
diuresis in R. prolixus. In addition, a summary of the biological activity of diuretic factors on the
principal tissues associated with the rapid diuresis that follows engorgement on a blood meal in
R. prolixus is provided (see text for details). Based on data reviewed in Coast et al., 2002;
Orchard, 2006; 2009; and Coast, 2009. Adapted figure of alimentary canal drawn by Zach
McLaughlin.
![Page 19: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/19.jpg)
5
![Page 20: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/20.jpg)
6
usage in biological assays more convincing compared to assays using crude extracts, and also
facilitating their sequencing via Edman degradation. In recent times, however, with the
emergence of the peptidomics era, the structural identity of a large number of peptides from
neuronal tissues (Baggerman et al., 2002; Li et al., 2008; Nachman et al., 2006; Neupert et al.,
2009; Ons et al., 2009; Predel et al., 2004, 2006; Schoofs and Baggerman, 2003) or even single
cells (Neupert et al., 2005; 2007) has been accomplished. These studies have made use of
genome-predicted sequences, predicted peptide masses, and predicted post-translational
processing, coupled to MALDI-TOF MS/MS or comparable methods.
A number of (neuro)endocrine factors have been identified that regulate tissues of the insect
excretory system which is composed of the MTs, midgut and hindgut (Coast et al., 2002; Coast,
2009; Farmer et al., 1981; Orchard, 2009; Te Brugge et al., 2002; 2009 ). These factors are
responsible for maintenance of fluid and salt homeostasis within a normal physiological range
(see Coast, 2007). Factors that stimulate the removal of excess water and salts (diuretic factors)
include the biogenic amines tyramine (Blumenthal, 2003; 2005) and serotonin (Orchard, 2006;
2009), as well as several families of peptides such as the corticotropin-releasing factor (CRF)-
related peptides (Baldwin et al., 2001; Blackburn et al., 1991; Furuya et al., 2000a; Kataoka et
al., 1989; Kay et al., 1991; Patel et al., 1995), insect kinins (Blackburn et al., 1995; Coast et al.,
1990; Hayes et al., 1989; Holman et al., 1999; Terhzaz et al., 1999; Veenstra et al., 1997),
calcitonin-like peptides (Coast et al., 2005; Furuya et al., 2000b) and the CAPA family of
peptides (Davies et al., 1995; Kean et al., 2002; Pollock et al., 2004). Generally speaking, few of
these have been shown to be true diuretic hormones (i.e. actually shown to be present in the
haemolymph at appropriate times). Currently, true diuretic hormones include Locusta DH in
locust (Patel et al., 1995) and serotonin in R. prolixus (Lange et al., 1989).
G protein-coupled receptors (GPCRs)
In a number of cases, the diuretic factors have been shown to work via GPCRs, which are
characterized by the presence of seven transmembrane domains which traverse the plasma
membrane and facilitate coupling with various signaling pathways (for a review, see Coast et al.,
2002). For example, the DH peptides utilize GPCRs that generally couple positively with
![Page 21: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/21.jpg)
7
adenylate cylase (Reagen, 1994; 1996) which satisfies the observed physiological data (MTs
fluid secretion) and second messenger assays for cyclic AMP (Coast et al., 1994; Audsley et al.,
1995).
Overview of the R. prolixus central nervous system (CNS)
The anatomy of the CNS and retrocerebral complex of R. prolixus has been described previously
(Tsang and Orchard, 1991). Briefly, the CNS consists of a dorsally-located brain, connected to
the ventral suboesophageal ganglion (SOG) via circum-oesophageal connectives. This ganglion
is connected to the prothoracic ganglion (PRO), which in turn is connected to the mesothoracic,
metathoracic and abdominal neuromeres that are condensed into a mesothoracic ganglionic mass
(MTGM). The retrocerebral complex consists of a set of ganglia associated with the anterior
digestive system. The retrocerebral complex consists of a frontal ganglion that is found
connected via a pair of nerves to the frontal part of the brain. A recurrent nerve then projects
from the frontal ganglion posteriorly to a hypocerebral ganglion that lies on the dorsal surface of
the oesophagus. Paired nerves from the hypocerebral ganglion then project posteriorly along the
oesophagus to paired ingluvial ganglia that again lie on the dorsal surface of the oesophagus.
Regulation of diuresis in R. prolixus
In R. prolixus, it is now well established that at least two diuretic hormones are involved in the
regulation of the rapid post-prandial diuresis. One hormone has been identified as serotonin
(Lange et al., 1989; Maddrell et al., 1991), which is present in five dorsal unpaired medial
(DUM) neurons in the mesothoracic ganglionic mass (MTGM) that form neurohemal sites on
each of the abdominal nerves (Orchard et al., 1989; Orchard, 1989). The intensity of
immunoreactive staining at these neurohemal sites is decreased after feeding (Orchard, 1989)
and haemolymph levels have been shown to increase immediately following engorgement on a
blood meal (Lange et al., 1989). This diuretic hormone stimulates secretion by MTs (Maddrell,
1969; Maddrell et al., 1971; Te Brugge et al., 2002) and fluid absorption by the anterior midgut
(Farmer et al., 1981; Te Brugge et al., 2009). Thus, the circulating titers in the haemolymph are
capable of stimulating substantial fluid transport by these two tissues (Lange et al., 1989).
Another important diuretic hormone is the CRF-related peptide, RhoprDH, which has been
![Page 22: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/22.jpg)
8
identified (Te Brugge & Orchard, personal communication). Cross-species assays with insect
CRF-related peptides have shown them to be potent stimulators of fluid secretion by MTs (Te
Brugge and Orchard, 2002; Te Brugge et al., 2002) and of fluid absorption by the anterior
midgut (Te Brugge et al., 2009) in R. prolixus. Although haemolymph titers of RhoprDH are not
known, immunoreactivity in the CNS and associated neurohemal sites indicates that this peptide
is released into the haemolymph after the start of feeding (Te Brugge et al., 1999) and appears to
be co-released with kinin-related peptides (Te Brugge et al., 2001). Some neurons (e.g. posterior
lateral neurosecretory cells in the MTGM) contain immunoreactivity for both peptides (Te
Brugge et al., 2001). Interestingly, colocalization of serotonin and calcitonin-related peptides
has also been shown in DUM neurons in the MTGM, and these factors may also be co-released
during feeding (Te Brugge et al., 2005). In R. prolixus, however, the kinin-related and
calcitonin-related peptides do not appear to play a major role in stimulation of fluid secretion by
the MTs; however, the latter do elicit small increases equivalent to 14-fold over basal secretion
rates (Te Brugge et al., 2002; 2005) relative to the 1000-fold increase in secretion rates elicited
by serotonin (Maddrell, 1963). Thus, although calcitonin- and kinin-related peptides are potent
diuretic hormones in other insects (see Coast et al., 2002), they have minimal or no effect on
fluid secretion by MTs (Donini et al., 2008; Te Brugge et al., 2002) or absorption by the anterior
midgut in R. prolixus (Te Brugge et al., 2009); however, these peptides likely play other
important roles in the control of feeding-related tissues, such as the salivary glands, anterior
midgut and hindgut, where they are known to have myotropic activity (see Orchard, 2009; Te
Brugge et al., 2009). The diuretic hormones in R. prolixus have both been shown to act through
cAMP (Te Brugge et al., 2002), leading to a potent increase in fluid absorption by the anterior
midgut (Farmer et al., 1981; Te Brugge et al., 2009) and fluid secretion by MTs. Both serotonin
and the CRF-related peptides elicit similar effects on upper Malpighian tubules where they lead
to a characteristic triphasic response in transepithelial potential (TEP). This triphasic TEP
response has been attributed to the sequential activation of apical Cl- channels, an apical V-type
ATPase, and a basolateral Na+:K+:2Cl- (NKCC) cotransporter (Donini et al., 2008; Ianowski and
O'Donnell, 2001; O'Donnell and Maddrell, 1984). Interestingly, only serotonin leads to
reabsorption of K+ and Cl- by the lower MTs (Donini et al., 2008; Maddrell et al., 1993); an
important feature of R. prolixus MTs that prevents the loss of K+ ions. An overview of the
![Page 23: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/23.jpg)
9
biological activity of diuretic factors on the principal tissues involved in the rapid post-gorging
diuresis in R. prolixus is presented in Figure 1.
Regulation of anti-diuresis in insects
In contrast to the breadth of factors identified as being diuretic in insects, identification of insect
anti-diuretic strategies has been limited. Anti-diuresis is of great importance in insects, since this
is the normal physiological state sustained by the majority of terrestrial insects, interrupted only
occasionally by diuresis associated with increased water intake from dietary or metabolic sources
(see Coast et al., 2002).
Three factors contributing to an anti-diuretic strategy in locusts act on the hindgut: Cl- transport
stimulating hormone (CTSH), ion transport peptide (ITP) and neuroparsins (Fournier and
Girardie, 1988; Phillips et al., 1980, 1996; Spring and Phillips, 1980). Only the latter two have
been amino acid sequenced, and in addition, the neuroparsin’s stimulatory role on the locust
hindgut is not well understood, and data has been conflicting (see Coast et al., 2002; Jeffs and
Phillips, 1996). CTSH (Spring and Phillips, 1980) acts on specific ion transport mechanisms via
cAMP (Chamberlin and Phillips, 1988), and leads to reabsorption of fluid and ions by the
rectum. The third factor known to regulate absorption by the locust hindgut, ITP, was originally
identified and purified from the locust corpus cardiacum (Audsley et al., 1992; Phillips et al.,
1996) and the 72 residue full length peptide was determined following cDNA cloning (Meredith
et al., 1996). Similar to CTSH, ITP is also known to utilize cAMP as a second messenger and
this leads to an increase in apical cation conductance and stimulation of an apical electrogenic
Cl- pump, while simultaneously acting via another, unidentified, second messenger to inhibit
apical acid secretion (see Phillips et al., 1998).
An endogenous factor capable of inhibiting fluid secretion of MTs was first described in the
forest ant, Formica polyctena (Laenen et al., 2001); however this factor has not been sequenced.
Native anti-diuretic factors, ADF-a and ADF-b, have been identified in Tenebrio molitor, with
![Page 24: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/24.jpg)
10
potent inhibitory effects on MT secretion rates, via increases in cGMP levels (Eigenheer et al.,
2002; 2003). The ADF-stimulated increases in cGMP are independent of nitric oxide signaling,
and so a soluble guanylate cyclase is unlikely (Eigenheer et al., 2003). In addition, cAMP levels
stimulated with the native CRF-related DH, T. molitor DH37, are decreased in MTs treated with
ADFs (Eigenheer et al., 2003). Thus, these ADFs provide the first examples of endogenous
peptides, along with their cognate intracellular mediators, which antagonistically regulate fluid
secretion of MTs in insects (Wiehart et al., 2002b). However, there is no evidence that the ADF
neuropeptides are released as neurohormones, since immunohistochemical analysis has not
revealed any staining associated with classical neurohemal storage sites (Eigenheer et al., 2003;
Wiehart et al., 2002a), although this has been shown for the endogenous diuretic peptide
(Wiehart et al., 2002a). Interestingly, in cross-species assays, TenmoADFa has been shown to
inhibit fluid secretion by MTs via cGMP in Aedes aegypti (Massaro et al., 2004), but this peptide
has no stimulatory or inhibitory effect on Acheta domesticus MTs (Coast et al., 2007).
Surprisingly, TenmoADFb has been shown to stimulate fluid secretion with activity similar to
native kinin-related peptides in A. domesticus (Coast et al., 2007). Finally, in a Coleopteran
relative, a factor with similar hydrophobicity and presumed molecular weight to T. molitor ADF-
a and ADF-b was partially isolated in the Colorado potato beetle, Leptinotarsa decemlineata
(Lavigne et al., 2001), although the sequence of this factor has not been resolved.
The Lepidopteran cardioacceleratory peptide, ManseCAP2b, which belongs to the CAPA peptide
family (i.e. peptides coded on the capability gene in D. melanogaster), was originally sequenced
in the tobacco hornworm, Manduca sexta (Huesmann et al., 1995), and was shown to be a potent
inhibitor of fluid secretion in R. prolixus (Quinlan et al., 1997; Quinlan and O'Donnell, 1998),
with cGMP proposed as a possible intracellular messenger (Quinlan et al., 1997; Quinlan and
O'Donnell, 1998). However, the endogenous peptide remained unknown. Genes that encode the
CAPA peptides are named capability and identified originally in the fruit fly, D. melanogaster
(Kean et al., 2002) and subsequently in the tobacco hornworm, M. sexta (Loi and Tublitz, 2004).
It was proposed that the CAPA peptide-induced inhibition of secretion by MTs in R. prolixus
resulted from activation of a cGMP-dependent phosphodiesterase that degrades cAMP (Quinlan
et al., 1997; Quinlan and O'Donnell, 1998), the second messenger of the diuretic hormones
![Page 25: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/25.jpg)
11
(Aston, 1975; Montoreano et al., 1990; Te Brugge et al., 2002). Quinlan & O’Donnell also
demonstrated that at higher doses of cGMP, the ratio of the primary secreted ions, Na+ and K+,
reverted to an unstimulated state with K+ being the dominant ion secreted (Quinlan et al., 1997;
Quinlan and O'Donnell, 1998). The physiological relevance of this reversal in the ratio of
secreted ions has not yet been determined for any anti-diuretic factors, including the CAPA-
related peptides, which are involved in inhibiting fluid secretion by R. prolixus MTs (Quinlan et
al., 1997; Quinlan and O'Donnell, 1998). CAPA peptides, which usually have a conserved
FPRV-NH2 carboxy terminus, are also referred to as periviscerokinins in some insect species,
due to their abundance in perivisceral organs, and their described myotropic activities (see Predel
and Wegener, 2006). These peptides are produced within the CNS and are released at
neurohemal sites where they function as neuroendocrine factors regulating visceral tissues
(Wegener et al., 2001). Although an anti-diuretic function has been proposed in R. prolixus
(Quinlan et al., 1997; Quinlan and O'Donnell, 1998), the CAPA peptides in Dipterans activate
fluid secretion by principal cells of MTs via nitric oxide, cGMP and Ca2+ intracellular signaling
(Davies et al., 1995; Davies et al., 1997; Pollock et al., 2004). Interestingly, neither an anti-
diuretic nor diuretic function has been demonstrated for CAPA-related peptides in other insects,
such as locust, Schistocerca gregaria (Pollock et al., 2004) or the house cricket, A. domesticus
(Coast et al., 2007).
Receptors for insect CAPA-related peptides also belong to the GPCR super family and have been
characterized in D. melanogaster (Cazzamali et al., 2005; Iversen et al., 2002; Park et al., 2002),
Anopheles gambiae (Olsen et al., 2007) and predicted in T. castaneum (Li et al., 2008).
Expression of CAPA receptor transcripts has been localized to the MTs in Diptera (Pollock et al.,
2004), and more specifically in principal cells in D. melanogaster where activation of the
receptor leads to increased mitochondrial membrane polarization and elevated cellular ATP
levels (Terhzaz et al., 2006). This ultimately leads to activation of an apical membrane proton
pump (vacuolar-type H+-ATPase) that energizes the epithelium (Terhzaz et al., 2006) and
provides the necessary gradient for transport of ions from cell to lumen through a K+ or Na+/H+
exchanger and the subsequent passive movement of osmotically-obliged water (Linton and
O'Donnell, 1999; Maddrell and O'Donnell, 1992; O'Donnell et al., 1982). Aside from expression
![Page 26: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/26.jpg)
12
in Dipteran MTs, it is unknown if other insect visceral tissues express the CAPA receptor;
however, such information might reveal novel physiological roles for these neuropeptides.
In R. prolixus, it was previously believed that anti-diuresis was facilitated by a reduction in the
circulating levels of diuretic hormones in the haemolymph (Maddrell, 1964b). However, it was
subsequently suggested that this mechanism would be unlikely since diuretic hormone titers
would be increased as the haemolymph volume declines over the progression of the rapid
diuresis (Quinlan et al., 1997). In addition, the mechanical properties of the plasticized cuticle,
stimulated by serotonin (Orchard et al., 1988), and the associated abdominal distention leading to
activation of stretch receptors (Maddrell, 1964b), would likely not permit a sufficiently-precise
detection of reduced distention leading to inhibition of diuretic hormone release (Quinlan et al.,
1997; Maddrell and Phillips, 1975). Thus, as shown in other insects, it was suggested that R.
prolixus may also contain endogenous peptides that control the cessation of diuresis. This would
ensure that essential water and salts are maintained and desiccation avoided. However, no native
anti-diuretic factor has been identified in R. prolixus. Of specific importance in this regard is the
fact that there is no significant absorption by the hindgut during the rapid diuresis following a
blood meal in R. prolixus (Maddrell and Phillips, 1975). Thus, any anti-diuretic factor would
have to act elsewhere, possibly by having a dual inhibitory role on fluid secretion by MTs and
absorption by the anterior midgut.
Objectives
This thesis aims to elucidate the native factors in R. prolixus which function to inactivate the
rapid post-prandial diuresis and ensure the maintenance of physiologically-relevant levels of
water and salts in order to avoid desiccation. The central hypothesis tested in this thesis is as
follows: An endogenous factor with structural and physiological properties similar to
ManseCAP2b is present in R. prolixus and is involved in an anti-diuretic mechanism which
follows the rapid post-prandial diuresis. Use of a number of different experimental techniques
and approaches has enabled for the isolation of the native anti-diuretic peptide, characterization
of its physiological role, and the discovery of a range of target tissues under its regulation. The
role of endogenous anti-diuretic factors on the principal tissues involved in the rapid post-
![Page 27: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/27.jpg)
13
prandial diuresis, namely the anterior midgut and MTs, has also been explored. More
specifically, the second chapter of this thesis provides evidence in support of endogenous
peptides in R. prolixus which are involved in coordinating the cessation of the rapid post-
prandial diuresis. Using an array of molecular biology techniques, the genetic origin of these
anti-diuretic factors has been elucidated and characterized. More specifically, the third chapter
of this thesis identifies the primary structure of the native anti-diuretic peptide along with two
additional peptides arising from the same precursor which is the product of a gene highly
expressed in the CNS. The fourth chapter of this thesis describes data in support of a second
closely related gene encoding the CAPA-related peptides in R. prolixus and investigates the
transcript expression profile of these two paralogs. Similarly, the receptor responsible for
mediating the anti-diuretic effects along with the transcript expression profile on prospective
target tissues has been characterized. This data is included in the fifth chapter of this thesis
where I describe the isolation, functional characterization and transcript expression profile of a
receptor structurally-related to insect CAPA receptors. As a result of this extensive study, this
thesis confirms that R. prolixus contains peptides belonging to the insect CAPA-related family
that are involved in coordination of an anti-diuretic strategy by their inhibitory action on the
primary tissues involved in the rapid post-prandial diuresis. The findings of this research will
greatly advance our knowledge of anti-diuresis in R. prolixus and may serve as a model in other
insects. In addition, this work may be instrumental in the future development of CAPA peptide
mimetics or receptor agonists which could help reduce the transmission of Chagas’ disease that
occurs during the rapid-diuresis following blood-feeding by this medically-important insect.
![Page 28: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/28.jpg)
14
References
Aston, R. J. (1975). The role of adenosine 3′:5′-cyclic monophosphate in relation to the diuretic
hormone of Rhodnius prolixus. J. Insect Physiol. 21, 1873-1877.
Audsley, N., McIntosh, C. and Phillips, J. E. (1992). Isolation of a neuropeptide from locust
corpus cardiacum which influences ileal transport. J. Exp. Biol. 173, 261.
Audsley, N., Kay, I., Hayes, T. K. and Coast, G. M. (1995). Cross reactivity studies of CRF-
related peptides on insect Malpighian tubules. Comp. Biochem. Physiol. Part A. 110(1), 87-93.
Baggerman, G., Cerstiaens, A., De Loof, A. and Schoofs, L. (2002). Peptidomics of the larval
Drosophila melanogaster central nervous system. The Journal of biological chemistry 277,
40368.
Baldwin, D. C., Schegg, K. M., Furuya, K., Lehmberg, E. and Schooley, D. A. (2001).
Isolation and identification of a diuretic hormone from Zootermopsis nevadensis. Peptides 22,
147-152.
Blackburn, M. B., Kingan, T. G., Bodnar, W., Shabanowitz, J., Hunt, D. F., Kempe, T.,
Wagner, R. M., Raina, A. K., Schnee, M. E. and Ma, M. C. (1991). Isolation and
identification of a new diuretic peptide from the tobacco hornworm, Manduca sexta. Biochem.
Biophys. Res. Commun. 181, 927-932.
Blackburn, M. B., Wagner, R. M., Shabanowitz, J., Kochansky, J. P., Hunt, D. F. and
Raina, A. K. (1995). The isolation and identification of three diuretic kinins from the abdominal
ventral nerve cord of adult Helicoverpa zea. J. Insect Physiol. 41, 723-730.
Blumenthal, E. (2003). Regulation of chloride permeability by endogenously produced tyramine
in the Drosophila Malpighian tubule. American journal of physiology. Cell physiology 284,
C718.
Blumenthal, E. (2005). Modulation of tyramine signaling by osmolality in an insect secretory
epithelium. American journal of physiology. Cell physiology 289, C1261.
![Page 29: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/29.jpg)
15
Cazzamali, G., Torp, M., Hauser, F., Williamson, M. and Grimmelikhuijzen, C. J. P.
(2005). The Drosophila gene CG9918 codes for a pyrokinin-1 receptor. Biochem. Biophys. Res.
Commun. 335, 14-19.
Chamberlin, M. and Phillips, J. E. (1988). Effects of stimulants of electrogenic ion-transport
on cyclic AMP and cyclic GMP levels in the locust rectum. J. Exp. Zool. 245, 9.
Coast, G. (2007). The endocrine control of salt balance in insects. General and Comparative
Endocrinology 152, 332-338.
Coast, G. (2009). Neuroendocrine control of ionic homeostasis in blood-sucking insects. J. Exp.
Biol. 212, 378.
Coast, G. M., Holman, G. M. and Nachman, R. J. (1990). The diuretic activity of a series of
cephalomyotropic neuropeptides, the Achetakinins, on isolated Malpighian tubules of the house
cricket, Acheta domesticus. J. Insect Physiol. 36, 481-488.
Coast, G. M. and Kay, I. (1994). The effects of Acheta diuretic peptide on isolated Malpighian
tubules from the house cricket Acheta domesticus. J. Exp. Biol. 187, 225-243.
Coast, G. M., Nachman, R. J. and Schooley, D. A. (2007). An anti-diuretic peptide (Tenmo-
ADFb) with kinin-like diuretic activity on Malpighian tubules of the house cricket, Acheta
domesticus (L.). J. Exp. Biol. 210, 3979-3989.
Coast, G. M., Orchard, I., Phillips, J. E. and Schooley, D. A. (2002). Insect diuretic and anti-
diuretic hormones. In Advances in Insect Physiology, pp. 279-409: Academic Press.
Coast, G., Garside, C., Webster, S., Schegg, K. and Schooley, D. (2005). Mosquito natriuretic
peptide identified as a calcitonin-like diuretic hormone in Anopheles gambiae (Giles). J. Exp.
Biol. 208, 3281.
Costa, J. and Lorenzo, M. (2009). Biology, diversity and strategies for the monitoring and
control of Triatomines - Chagas disease vectors. Mem. Inst. Oswaldo Cruz 104, 46-51.
![Page 30: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/30.jpg)
16
Davies, S. A., Huesmann, G. R., Maddrell, S. H., O'Donnell, M. J., Skaer, N. J., Dow, J. A.
and Tublitz, N. J. (1995). CAP2b, a cardioacceleratory peptide, is present in Drosophila and
stimulates tubule fluid secretion via cGMP. Am J Physiol Regul Integr Comp Physiol 269,
R1321-1326.
Davies, S. A., Stewart, E. J., Huesmann, G. R., Skaer, N. J. V., Maddrell, S. H. P., Tublitz,
N. J. and Dow, J. A. T. (1997). Neuropeptide stimulation of the nitric oxide signaling pathway
in Drosophila melanogaster Malpighian tubules. American Journal of Physiology-Regulatory
Integrative and Comparative Physiology 42, R823-R827.
De Souza, W. (2002). Basic Cell biology of Trypanosoma cruzi. Curr. Pharm. Des. 8, 269-285.
Donini, A., O'Donnell, M. J. and Orchard, I. (2008). Differential actions of diuretic factors on
the Malpighian tubules of Rhodnius prolixus. J. Exp. Biol. 211, 42-48.
Eigenheer, R. A., Wiehart, U. M., Nicolson, S. W., Schoofs, L., Schegg, K. M., Hull, J. J.
and Schooley, D. A. (2003). Isolation, identification and localization of a second beetle anti-
diuretic peptide. Peptides 24, 27-34.
Eigenheer, R., Nicolson, S., Schegg, K., Hull, J. J. and Schooley, D. (2002). Identification of a
potent anti-diuretic factor acting on beetle Malpighian tubules. Proceedings of the National
Academy of Sciences 99, 84-89.
Farmer, J., Maddrell, S. H. P. and Spring, J. H. (1981). Absorption of fluid by the midgut of
Rhodnius. J. Exp. Biol. 94, 301-316.
Fournier, B. and Girardie, J. (1988). A new function for the Locust neuroparsins - stimulation
of water reabsorption. J. Insect Physiol. 34, 309.
Furuya, K., Harper, M. A., Schegg, K. M. and Schooley, D. A. (2000a). Isolation and
characterization of CRF-related diuretic hormones from the whitelined sphinx moth Hyles
lineata. Insect Biochem. Mol. Biol. 30, 127-133.
Furuya, K., Milchak, R. J., Schegg, K. M., Zhang, J., Tobe, S. S., Coast, G. M. and
Schooley, D. A. (2000b). Cockroach diuretic hormones: characterization of a calcitonin-like
![Page 31: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/31.jpg)
17
peptide in insects. Proceedings of the National Academy of Sciences of the United States of
America 97, 6469-6474.
Hayes, T. K., Pannabecker, T. L., Hinckley, D. J., Holman, G. M., Nachman, R. J., Petzel,
D. H. and Beyenbach, K. W. (1989). Leucokinins, a new family of ion transport stimulators and
inhibitors in insect Malpighian tubules. Life Sci. 44, 1259-1266.
Holman, G. M., Nachman, R. J. and Coast, G. M. (1999). Isolation, characterization and
biological activity of a diuretic myokinin neuropeptide from the housefly, Musca domestica.
Peptides 20, 1-10.
Huesmann, G. R., Cheung, C. C., Loi, P. K., Lee, T. D., Swiderek, K. M. and Tublitz, N. J.
(1995). Amino acid sequence of CAP2b, an insect cardioacceleratory peptide from the tobacco
hawkmoth Manduca sexta. FEBS Lett. 371, 311-314.
Ianowski, J. P. and O'Donnell, M. J. (2001). Transepithelial potential in Malpighian tubules of
Rhodnius prolixus: lumen-negative voltages and the triphasic response to serotonin. J. Insect
Physiol. 47, 411-421.
Iversen, A., Cazzamali, G., Williamson, M., Hauser, F. and Grimmelikhuijzen, C. J. P.
(2002). Molecular cloning and functional expression of a Drosophila receptor for the
neuropeptides capa-1 and -2. Biochem. Biophys. Res. Commun. 299, 628.
Jeffs, L. and Phillips, J. (1996). Pharmacological study of the second messengers that control
rectal ion and fluid transport in the desert locust (Schistocerca gregaria). Arch. Insect Biochem.
Physiol. 31, 169.
Kataoka, H., Troetschler, R., Li, J., Kramer, S., Carney, R. and Schooley, D. (1989).
Isolation and identification of a diuretic hormone from the tobacco hornworm, Manduca sexta.
Proc. Natl. Acad. Sci. U. S. A. 86, 2976.
Kay, I., Coast, G. M., Cusinato, O., Wheeler, C. H., Totty, N. F. and Goldsworthy, G. J.
(1991). Isolation and characterization of a diuretic peptide from Acheta domesticus. Evidence for
a family of insect diuretic peptides. Biol. Chem. Hoppe-Seyler 372, 505.
![Page 32: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/32.jpg)
18
Kean, L., Cazenave, W., Costes, L., Broderick, K. E., Graham, S., Pollock, V. P., Davies, S.
A., Veenstra, J. A. and Dow, J. A. T. (2002). Two nitridergic peptides are encoded by the gene
capability in Drosophila melanogaster. Am J Physiol Regul Integr Comp Physiol 282, R1297-
1307.
Laenen, B., De Decker, N., Steels, P., Van Kerkhove, E. and Nicolson, S. (2001). An anti-
diuretic factor in the forest ant: purification and physiological effects on the Malpighian tubules.
J. Insect Physiol. 47, 185-193.
Lange, A. B., Orchard, I. and Barrett, F. M. (1989). Changes in hemolymph serotonin levels
associated with feeding in the bloodsucking bug, Rhodnius prolixus. J. Insect Physiol. 35, 393-
399.
Lavigne, C., Embleton, J., Audy, P., King, R. R. and Pelletier, Y. (2001). Partial purification
of a novel insect anti-diuretic factor from the Colorado potato beetle, Leptinotarsa decemlineata
(Say) (Coleoptera: Chrysomelidae), which acts on Malpighian tubules. Insect Biochemistry and
Molecular Biology 31, 339-347.
Li, B., Predel, R., Neupert, S., Hauser, F., Tanaka, Y., Cazzamali, G., Williamson, M.,
Arakane, Y., Verleyen, P., Schoofs, L. et al. (2008). Genomics, transcriptomics, and
peptidomics of neuropeptides and protein hormones in the red flour beetle Tribolium castaneum
Genome Res. 18, 113-122.
Lima, F. M., Oliveira, P., Mortara, R. A., Silveira, J. F. and Bahia, D. (2010). The challenge
of Chagas’ disease: has the human pathogen, Trypanosoma cruzi, learned how to modulate
signaling events to subvert host cells? N Biotechnol IN PRESS
Linton, S. and O'Donnell, M. (1999). Contributions of K+:Cl- cotransport and Na+/K+-ATPase
to basolateral ion transport in Malpighian tubules of Drosophila melanogaster. J. Exp. Biol. 202,
1561-1570.
Loi, P. K. and Tublitz, N. J. (2004). Sequence and expression of the CAPA/CAP2b gene in the
tobacco hawkmoth, Manduca sexta. J. Exp. Biol. 207, 3681-3691.
![Page 33: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/33.jpg)
19
Maddrell, S. H. (1963). Excretion in the blood-sucking bug, Rhodnius prolixus Stal. 1. The
control of diuresis. J. Exp. Biol. 40, 247-256.
Maddrell, S. H. (1964a). Excretion in the blood-sucking bug, Rhodnius prolixus Stal. 2. The
normal course of diuresis and the effect of temperature. J. Exp. Biol. 41, 163-176.
Maddrell, S. H. (1964b). Excretion in the blood-sucking bug Rhodnius prolixus Stal. 3. The
control of release of diuretic hormone. J. Exp. Biol. 41, 459-472.
Maddrell, S. H. (1966a). Nervous control of the mechanical properties of the abdominal wall at
feeding in Rhodnius. J. Exp. Biol. 44, 59-68.
Maddrell, S. H. (1966b). The site of release of the diuretic hormone in Rhodnius - a new
neurohemal system in insects. J. Exp. Biol. 45, 499-508.
Maddrell, S. H. (1969). Secretion by the Malpighian tubules of Rhodnius. The movements of
ions and water. J. Exp. Biol. 51, 71-97.
Maddrell, S. H., Pilcher, D. E. M. and Gardiner, B. O. (1971). Pharmacology of the
Malpighian tubules of Rhodnius and Carausius - The structure-activity relationship of
tryptamine analogues and the role of cyclic AMP. J. Exp. Biol. 54, 779-804.
Maddrell, S. H. P. (1976). Functional design of neurosecretory-system controlling diuresis in
Rhodnius prolixus. Am. Zool. 16, 131-139.
Maddrell, S. H. P., O'Donnell, M. J. and Caffrey, R. (1993). The regulation of hemolymph
potassium activity during initiation and maintenance of diuresis in fed Rhodnius prolixus. J. Exp.
Biol. 177, 273-285.
Maddrell, S. H. P. and Phillips, J. E. (1975). Secretion of hypo-osmotic fluid by the lower
Malpighian tubules of Rhodnius prolixus. J. Exp. Biol. 62, 671-683.
Maddrell, S., Herman, W., Mooney, R. and Overton, J. (1991). 5-Hydroxytryptamine: A
second diuretic hormone in Rhodnius prolixus. J Exp Biol 156, 557-566.
![Page 34: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/34.jpg)
20
Maddrell, S. and O'Donnell, M. (1992). Insect Malpighian tubules: V-ATPase action in ion and
fluid transport. J. Exp. Biol. 172, 417-429.
Massaro, R. C., Lee, L. W., Patel, A. B., Wu, D. S., Yu, M., Scott, B. N., Schooley, D. A.,
Schegg, K. M. and Beyenbach, K. W. (2004). The mechanism of action of the anti-diuretic
peptide Tenmo ADFa in Malpighian tubules of Aedes aegypti. J. Exp. Biol. 207, 2877-2888.
Meredith, J., Ring, M., Macins, A., Marschall, J., Cheng, N. N., Theilmann, D., Brock, H.
W. and Phillips, J. E. (1996). Locust ion transport peptide (ITP): Primary structure, cDNA and
expression in a baculovirus system. J. Exp. Biol. 199, 1053.
Montoreano, R., Triana, F., Abate, T. and Rangel-Aldao, R. (1990). Cyclic AMP in the
Malpighian tubule fluid and in the urine of Rhodnius prolixus. Gen. Comp. Endocrinol. 77, 136-
142.
Morris, K. (2009). After 100 years, time to break silence on Chagas disease. The Lancet
Infectious Diseases 9, 468-468.
Nachman, R. J., Russell, W. K., Coast, G. M., Russell, D. H., Miller, J. A. and Predel, R.
(2006). Identification of PVK/CAP2b neuropeptides from single neurohemal organs of the stable
fly and horn fly via MALDI-TOF/TOF tandem mass spectrometry. Peptides 27, 521-526.
Neupert, S., Predel, R., Russell, W. K., Davies, R., Pietrantonio, P. V. and Nachman, R. J.
(2005). Identification of tick periviscerokinin, the first neurohormone of Ixodidae: single cell
analysis by means of MALDI-TOF/TOF mass spectrometry. Biochem. Biophys. Res. Commun.
338, 1860-1864.
Neupert, S., Johard, H. A. D., Nassel, D. and Predel, R. (2007). Single-cell peptidomics of
Drosophila melanogaster neurons identified by Gal4-driven fluorescence. Anal. Chem. 79, 3690.
Neupert, S., Russell, W. K., Russell, D. H., López Jr., J. D., Predel, R. and Nachman, R. J.
(2009). Neuropeptides in Heteroptera: identification of allatotropin-related peptide and
tachykinin-related peptides using MALDI-TOF mass spectrometry. Peptides 30, 483-488.
![Page 35: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/35.jpg)
21
O'Donnell, M.,J., Aldis, G.,K. and Maddrell, S. H.,P. (1982). Measurements of osmotic
permeability in the Malpighian tubules of an insect, Rhodnius prolixus Stal. Proc. R. Soc. Lond.
B 216, 267-277.
O'Donnell, M.,J. and Maddrell, S. H. (1995). Fluid reabsorption and ion transport by the lower
Malpighian tubules of adult female Drosophila. J Exp Biol 198, 1647-1653.
O'Donnell, M. J. and Maddrell, S. H. P. (1984). Secretion by the Malpighian tubules of
Rhodnius prolixus Stal - electrical events. J. Exp. Biol. 110, 275-290.
Olsen, S. S., Cazzamali, G., Williamson, M., Grimmelikhuijzen, C. J. P. and Hauser, F.
(2007). Identification of one capa and two pyrokinin receptors from the malaria mosquito
Anopheles gambiae. Biochemical and biophysical research communications 362, 245-251.
Ons, S., Richter, F., Urlaub, H. and Pomar, R. (2009). The neuropeptidome of Rhodnius
prolixus brain. Proteomics 9, 788.
Orchard, I. (1989). Serotonergic neurohemal tissue in Rhodnius prolixus - synthesis, release and
uptake of serotonin. J. Insect Physiol. 35, 943-947.
Orchard, I. (2006). Serotonin: a coordinator of feeding-related physiological events in the
blood-gorging bug, Rhodnius prolixus. Comparative Biochemistry and Physiology A-Molecular
& Integrative Physiology 144, 316-324.
Orchard, I. (2009). Peptides and serotonin control feeding-related events in Rhodnius prolixus
Front. Biosci. (Elite Ed) 1, 250-262.
Orchard, I., Lange, A. B., Cook, H. and Ramirez, J. M. (1989). A subpopulation of dorsal
unpaired median neurons in the blood-feeding insect Rhodnius prolixus displays serotonin-like
immunoreactivity. J. Comp. Neurol. 289, 118-128.
Orchard, I., Lange, A. B. and Barrett, F. M. (1988). Serotonergic supply to the epidermis of
Rhodnius prolixus: evidence for serotonin as the plasticising factor. Journal of Insect Physiology
34, 873-879.
![Page 36: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/36.jpg)
22
Park, Y., Kim, Y. and Adams, M. E. (2002). Identification of G protein-coupled receptors for
Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-
receptor coevolution. Proc. Natl. Acad. Sci. U. S. A. 99, 11423-11428.
Patel, M., Hayes, T. and Coast, G. (1995). Evidence for the hormonal function of a CRF-
related diuretic peptide (Locusta-DP) in Locusta migratoria. J. Exp. Biol. 198, 793.
Phillips, J. E., Mordue, W., Meredith, J. and Spring, J. (1980). Purification and
characteristics of the chloride transport stimulating factor from locust corpora cardiaca - a new
peptide. Can. J. Zool. 58, 1851-1860.
Phillips, J., Meredith, J., Audsley, N., Richardson, N., Macins, A. and Ring, M. (1998).
Locust ion transport peptide (ITP): A putative hormone controlling water and ionic balance in
terrestrial insects. Am. Zool. 38, 461.
Phillips, J. E., Wiens, C., Audsley, N., Jeffs, L., Bilgen, T. and Meredith, J. (1996). Nature
and control of chloride transport in insect absorptive epithelia. J. Exp. Zool. 275, 292-299.
Pollock, V. P., McGettigan, J., Cabrero, P., Maudlin, I. M., Dow, J. A. T. and Davies, S. A.
(2004). Conservation of capa peptide-induced nitric oxide signaling in Diptera. J. Exp. Biol. 207,
4135-4145.
Predel, R., Russell, W. K., Neupert, S., Russell, D. H., Esquivel, J. F. and Nachman, R. J.
(2006). Identification of the first neuropeptides from the CNS of Hemiptera: CAPA peptides of
the southern green Stinkbug Nezara viridula (L.). Peptides 27, 2670-2677.
Predel, R. and Wegener, C. (2006). Biology of the CAPA peptides in insects. Cell Mol Life Sci
63, 2477-2490.
Predel, R., Wegener, C., Russell, W. K., Tichy, S. E., Russell, D. H. and Nachman, R. J.
(2004). Peptidomics of CNS-associated neurohemal systems of adult Drosophila melanogaster:
A mass spectrometric survey of peptides from individual flies. J. Comp. Neurol. 474, 379-392.
![Page 37: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/37.jpg)
23
Quinlan, M., Tublitz, N. and O'Donnell, M. (1997). Anti-diuresis in the blood-feeding insect
Rhodnius prolixus Stal: the peptide CAP2b and cyclic GMP inhibit Malpighian tubule fluid
secretion. J Exp Biol 200, 2363-2367.
Quinlan, M. C. and O'Donnell, M. J. (1998). Anti-diuresis in the blood-feeding insect
Rhodnius prolixus Stal: antagonistic actions of cAMP and cGMP and the role of organic acid
transport. Journal of Insect Physiology 44, 561-568.
Ramsay, J. A. (1954). Active transport of water by the Malpighian tubules of the stick insect,
Dixippus morosus (Orthoptera, Phasmidae). J. Exp. Biol. 31, 104-113.
Reagan, J. D. (1994). Expression cloning of an insect diuretic hormone receptor: a member of
the calcitonin/secretin receptor family. J. Biol. Chem. 269, 9-12.
Reagan, J. D. (1996). Molecular cloning and function expression of a diuretic hormone receptor
from the house cricket, Acheta domesticus. Insect Biochem. Mol. Biol. 26, 1-6.
Schoofs, L. and Baggerman, G. (2003). Peptidomics in Drosophila melanogaster. Briefings in
Functional Genomics Proteomics 2, 114.
Spring, J. H. and Phillips, J. E. (1980). Studies on locust rectum. 2. Identification of specific
ion-transport processes regulated by corpora cardiaca and cyclic AMP. J. Exp. Biol. 86, 225-236.
Te Brugge, V. A. and Orchard, I. (2002). Evidence for CRF-like and kinin-like peptides as
neurohormones in the blood-feeding bug, Rhodnius prolixus. Peptides 23, 1967-1979.
Te Brugge, V., Ianowski, J. P. and Orchard, I. (2009). Biological activity of diuretic factors
on the anterior midgut of the blood-feeding bug, Rhodnius prolixus. Gen. Comp. Endocrinol.
162, 105-112.
Te Brugge, V. A., Lombardi, V. C., Schooley, D. A. and Orchard, I. (2005). Presence and
activity of a Dippu-DH31-like peptide in the blood-feeding bug, Rhodnius prolixus. Peptides 26,
29-42.
![Page 38: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/38.jpg)
24
Te Brugge, V. A., Miksys, S. M., Coast, G. M., Schooley, D. A. and Orchard, I. (1999). The
distribution of a CRF-like diuretic peptide in the blood-feeding bug Rhodnius prolixus. J. Exp.
Biol. 202, 2017-2027.
Te Brugge, V. A., Nassel, D. R., Coast, G. M., Schooley, D. A. and Orchard, I. (2001). The
distribution of a kinin-like peptide and its co-localization with a CRF-like peptide in the blood-
feeding bug, Rhodnius prolixus. Peptides 22, 161-173.
Te Brugge, V. A., Schooley, D. A. and Orchard, I. (2002). The biological activity of diuretic
factors in Rhodnius prolixus. Peptides 23, 671-681.
Terhzaz, S., O'Connell, F., Pollock, V., Kean, L., Davies, S., Veenstra, J. and Dow, J.
(1999). Isolation and characterization of a leucokinin-like peptide of Drosophila melanogaster.
J. Exp. Biol. 202, 3667-3676.
Terhzaz, S., Southall, T., Lilley, K., Kean, L., Allan, A., Davies, S. and Dow, J. A. T. (2006).
Differential gel electrophoresis and transgenic mitochondrial calcium reporters demonstrate
spatiotemporal filtering in calcium control of mitochondria. The Journal of biological chemistry
281, 18849.
Tsang, P. W. and Orchard, I. (1991). Distribution of FMRFamide-related peptides in the
blood-feeding bug, Rhodnius prolixus. J Comp Neurol 311, 17-32.
Veenstra, J. A., Pattillo, J. M. and Petzel, D. H. (1997). A single cDNA encodes all three
Aedes leucokinins, which stimulate both fluid secretion by the Malpighian tubules and hindgut
contractions. Journal of Biological Chemistry 272, 10402-10407.
Wegener, C., Linde, D. and Eckert, M. (2001). Periviscerokinins in cockroaches: release,
localization, and taxon-specific action on the hyperneural muscle. Gen. Comp. Endocrinol. 121,
1-12.
Wiehart, U., Torfs, P., Van Lommel, A., Nicolson, S. and Schoofs, L. (2002a).
Immunocytochemical localization of a diuretic hormone of the beetle Tenebrio molitor, Tenmo-
DH37, in nervous system and midgut. Cell Tissue Res. 308, 421-429.
![Page 39: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/39.jpg)
25
Wiehart, U. I. M., Nicolson, S. W., Eigenheer, R. A. and Schooley, D. A. (2002b).
Antagonistic control of fluid secretion by the Malpighian tubules of Tenebrio molitor: effects of
diuretic and anti-diuretic peptides and their second messengers. J Exp Biol 205, 493-501.
![Page 40: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/40.jpg)
26
Chapter 2:
Distribution, activity and evidence for the release of an anti-diuretic
peptide in the kissing bug, Rhodnius prolixus
![Page 41: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/41.jpg)
27
Abstract
In the haematophagous insect Rhodnius prolixus, diuresis is accomplished through the combined
actions of peptidergic diuretic hormones and 5-HT released from neurohemal sites on the
abdominal nerves. Preliminary work on anti-diuresis in this blood-feeder, previously believed to
occur through a decrease in the levels of the diuretic factors, indicates that an anti-diuretic
hormone, with properties similar to CAP2b (pELYAFPRVamide; recently renamed Mas-CAPA-
1), might also be present in R. prolixus. Here, we present evidence from immunohistochemical
analysis that suggests a PRXamide-like neuropeptide may be released from the abdominal
neurohemal sites beginning 3–4 h following feeding; a time that coincides with the cessation of
diuresis. We also show evidence for an endogenous factor, isolated from the central nervous
system using reversed-phase high performance liquid chromatography, which mimics the effects
of Mas-CAPA-1. Specifically, this endogenous anti-diuretic factor inhibits rates of 5-HT-
stimulated secretion in a dose-dependent manner and elevates intracellular cGMP levels of
Malpighian tubules stimulated with 5-HT.
![Page 42: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/42.jpg)
28
Introduction
In the haematophagous insect Rhodnius prolixus tubule fluid secretion is accomplished through
the combined actions of peptidergic diuretic hormones and serotonin (5-hydroxytryptamine
hydrochloride; 5-HT) (see Maddrell et al., 1971; 1993; Te Brugge et al., 1999; 2005) acting
through the intracellular second messenger, cyclic 3',5'-adenosine monophosphate (cAMP) (see
Barrett and Orchard, 1990; Montoreano et al., 1990; Te Brugge et al., 1999). Similar mechanisms
controlling diuresis exist in other insect species (see Coast et al., 2002) but, in addition, in
Drosophila melanogaster and Manduca sexta, another second messenger, cyclic 3',5'-guanosine
monophosphate (cGMP) has also been shown to be involved in increasing the rate of tubule fluid
secretion (Skaer et al., 2002; Davies et al., 1995).
Anti-diuresis in R. prolixus, or the cessation of diuresis, has typically been considered to occur
through a decrease in the levels of diuretic hormones 3–4 h following feeding (Maddrell, 1964).
More recent studies on R. prolixus have identified ManseCAP2b (M. sexta cardioactive peptide
2b) and cGMP as components of an anti-diuretic mechanism (Quinlan et al., 1997). Specifically,
cGMP was identified as an intracellular second messenger to ManseCAP2b, and Malpighian
tubule cGMP levels were shown to increase in response to ManseCAP2b and also as tubule
secretion rates declined in vivo (Quinlan et al., 1997). In addition, application of cGMP to tubules
elicited effects that were antagonistic to the secretory effects of cAMP (Quinlan and O'Donnell,
1998). It has been proposed that cGMP activates a cAMP phosphodiesterase that degrades
cAMP, thus lowering the level of the second messenger that stimulates diuresis (O'Donnell and
Spring, 2000).
ManseCAP2b (pELYAFPRVamide, recently renamed Mas-CAPA-1, see later) is a cardioactive
peptide first isolated in M. sexta (Huesmann et al., 1995). It is now known that ManseCAP2b is a
member of a family of peptides sharing the C-terminal PRVamide motif (Loi and Tublitz, 2004).
In the central nervous system (CNS) these include some periviscerokinins (see Wegener et al.,
2002) and CAP2b-related peptides in D. melanogaster and M. sexta (Kean et al., 2002; Loi and
Tublitz, 2004). In the periphery, the PRVamide motif is retained by M. sexta pre-ecdysis-
triggering hormone (MansePETH) from the peripheral endocrine Inka cells. Some other related
peptides have a C-terminal PRXamide motif (where X=I, L, M or V). For example, in
![Page 43: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/43.jpg)
29
Lepidopteran species, these include the pheromone biosynthesis activating neuropeptides
(PBAN) (see Teal et al., 1996) within the central nervous system, and peripherally include
ecdysis-triggering hormone (ETH) (Žitnaň et al., 2002).
Recent studies have isolated and sequenced the gene coding for ManseCAP2b (Loi and Tublitz,
2004). Owing to its high degree of homology with the capability gene in D. melanogaster (Kean
et al., 2002), it was named the Manduca CAPA gene (Loi and Tublitz, 2004). This gene encodes
three propeptides, a CAP2b propeptide and two CAP2b-related propeptides referred to as Mas-
CAPA-1, Mas-CAPA-2 and Mas-pyrokinin-1 (Mas-PK-1), respectively (Loi and Tublitz, 2004).
The capability gene in D. melanogaster encodes three neuropeptides termed CAPA-1 and
CAPA-2, which are CAP2b related, while CAPA-3 is PBAN/PK related (Kean et al., 2002). To
avoid confusion, we will follow the more recent nomenclature and subsequently refer to
ManseCAP2b as Mas-CAPA-1.
Given the recent finding suggesting a novel anti-diuretic mechanism in R. prolixus involving a
Mas-CAPA-1-like peptide and the intracellular second messenger, cyclic GMP (Quinlan et al.,
1997), we sought to map the location of putative Mas-CAPA-1-like immunoreactive cells and to
seek evidence for an endogenous Mas-CAPA-1-like neuropeptide in R. prolixus with anti-
diuretic properties. Here we describe the distribution of PRXamide-like immunoreactive neurons
and neurohemal sites in R. prolixus using an antiserum against MansePETH that recognizes Mas-
CAPA-1. In addition, we provide evidence for the presence of an endogenous Mas-CAPA-1-like
factor from the central nervous system (CNS) of R. prolixus that inhibits 5-HT-stimulated
diuresis and elevates cGMP levels in 5-HT-stimulated tubules.
![Page 44: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/44.jpg)
30
Materials & Methods
Animals
Fifth-instar Rhodnius prolixus Stål were reared at high relative humidity in incubators at 25°C
and routinely fed on rabbits' blood. Experiments were conducted on tissues of the CNS in both
unfed animals (approximately 6 weeks post-ecdysis) and recently fed animals of both sexes.
Immunohistochemical staining
The insects were pinned ventral surface down, and the dorsal cuticle, dorsal diaphragm and
digestive tissue removed under physiological saline (NaCl, 150 mmol l–1; KCl, 8.6 mmol l–1;
CaCl2, 2 mmol l–1; NaHCO3, 4 mmol l–1; glucose, 34 mmol l–1; MgCl2, 8.5 mmol l–1; Hepes pH
7.0, 5 mmol l–1). The nervous tissue was fixed in situ with 2% paraformaldehyde (pH 7.0) at 4°C
overnight (16–18 h). Following fixation, the tissues were washed and the CNS and short stretches
of peripheral nerves removed under phosphate-buffered saline (PBS) (Lange et al., 1988). The
nervous tissue was incubated in 4% Triton X-100, 2% bovine serum albumin (BSA) and 10%
normal sheep serum (NSS) in PBS for 1 h at room temperature followed by several washings
with PBS. The polyclonal rabbit antiserum to MasPETH (generously provided by Dr Dusan
Žitnaň and Dr Mike Adams) diluted 1:1000 was preincubated in 0.4% Triton X-100, 2% bovine
serum albumin (BSA) and 2% normal sheep serum (NSS) in PBS at 4°C overnight (16–18 h)
prior to use. The nervous tissue was then incubated in the antiserum for 48 h on a flatbed shaker
at 4°C. Following this, tissues were washed several times in PBS, including an overnight
washing at 4°C with shaking. Tissues were subsequently incubated overnight (16–18 h) with
Cy3-labelled sheep anti-rabbit immunoglobulin G (IgG; Sigma-Aldrich, St Louis, MO, USA)
diluted 1:200 with 10% NSS in PBS at 4°C with shaking and then washed numerous times at
room temperature. Tissues were mounted in glycerol on microscope slides and observed under a
Nikon epifluorescence microscope. PRXamide-like immunoreactivity (PRXa-LI) was mapped
with the aid of a drawing tube attachment and images were obtained using confocal microscopy
consisting of a helium-neon laser (543 nm line) and Zeiss LSM Image Browser software.
Tissues from fed and unfed insects, of identical age, were compared for intensity of staining,
keeping settings on the confocal microscope constant. All insects, fed or unfed, were kept at
room temperature until they were dissected. To ensure consistency in measurement of intensity
![Page 45: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/45.jpg)
31
of staining, images of individual immunoreactive cell bodies were taken keeping the nucleus of
the cell in focus. Several post-feeding time points were compared to insects that had been
exposed to the rabbit but not allowed to feed. Staining intensity was converted into grayscale
values using the ImageJ Software (Rasband, 2005) and then subjected to statistical analyses
including analysis of variance (ANOVA) and Tukey post-test. Grayscale values of confocal
images were analyzed over an intensity scale from 0 to 255 (minimum to maximum intensity
threshold for an 8-bit image, respectively).
Reverse phase high performance liquid chromatography (RP-HPLC)
Central nervous systems were dissected under saline and pooled in a 500 µl volume of
methanol:acetic acid:water (90:9:1, by volume) and stored at –20°C for later use. The CNS tissue
from 250 insects was then sonicated and centrifuged at 10 000 g for 10 min. The supernatant was
collected and dried in a Speed Vac concentrator (Savant, Farmingdale, NY, USA) and then
reconstituted in 0.1% trifluoroacetic acid (TFA). This sample was then applied to a C18 Sep-Pak
cartridge (Waters Associates, Mississauga, ON, Canada) that had been sequentially equilibrated
with 8 ml of methanol, 8 ml ddH2O, 8 ml 0.1% TFA, and finally 5 ml 0.1% TFA containing 1 µg
protease-free bovine serum albumin (BSA; Sigma, Mississauga, ON, Canada). Once the sample
was loaded, the cartridge was first washed with 0.1% TFA and subsequently extracts were
collected by eluting with 5 ml of 60% acetonitrile (ACN; Burdick and Jackson, Muskegon, MI,
USA) with 0.1% TFA. The eluant was dried in a Speed Vac concentrator and then resuspended in
high performance liquid chromatography (HPLC) start buffer (9% acetonitrile, 0.1% TFA) to be
fractionated by reverse phase HPLC (RP-HPLC) using a Brownlee C18 column (Mandel/Alltech,
Guelph, ON, Canada) with a linear gradient of 9–60% ACN over 34 min, beginning 5 min after
injection. Fractions with Mas-CAPA-1-like biological activity were identified by tubule secretion
assays and cGMP RIA.
Malpighian tubule fluid secretion assay
Rhodnius prolixus have four Malpighian tubules (two bilateral pairs) composed of both upper
and lower segments. Whole tubules from fifth instars were dissected under saline and transferred
on glass probes to a Sylgard-coated Petri dish containing 20 µl drops of saline overlaid with
water-saturated mineral oil. Two tubules were mounted in each 20 µl bathing droplet. The
proximal end of the tubule was pulled out of the saline droplet and wrapped around a nearby
![Page 46: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/46.jpg)
32
minuten pin. The equilibrating saline was removed and replaced with saline containing 50 nmol
l–1 5-hydroxytryptamine (5-HT; Sigma, Oakville, ON, Canada) alone or combined with different
concentrations of Mas-CAPA-1 (custom synthesized by GenScript Corp., Piscataway, NJ, USA)
or CNS RP-HPLC fractions. Tubules were allowed to secrete for 30 min. Droplets of secreted
fluid from the nicked end of the tubule were then collected using an oil-filled micropipette tip.
The droplet was then blown out under oil to be measured on the bottom of the Sylgard-coated
Petri dish. The droplet volume was calculated using the equation V=(π/6)d3, where d is the
droplet diameter measured using an eyepiece micrometer. At the end of the experiment, a
maximal rate of secretion was established by stimulating with 1 µmol l–1 5-HT to check on the
viability of the tubules. Values, expressed as mean ± standard errors of the mean (s.e.m.), were
then subjected to statistical analysis using Student's t-test.
Malpighian tubule cyclic GMP radioimmunoassay
Malpighian tubules were dissected under saline and tested as a set, including all four tubules
from fifth instars, and transferred to a microcentrifuge tube containing saline, 50 nmol l–1 5-HT
alone or 50 nmol l–1 5-HT combined with either Mas-CAPA-1 or CNS RP-HPLC fractions in a
total volume of 50 µl. Tubules were incubated for 10 min and the experiment terminated by
adding 250 µl of boiling 50 mmol l–1 sodium acetate (pH 6.2). The incubation tubes were then
immediately placed in a boiling water bath for 5 min and then stored at –20°C. To prepare the
samples for the assay, tubes were thawed, sonicated briefly on ice and centrifuged at 4°C for 10
min at 8800 g. The supernatant was then collected and assayed using a cyclic GMP RIA kit
(PerkinElmer/NEN, Boston, MA, USA). Assays were performed according to the manufacturer's
instructions except for some minor changes in volumes and ratio of reagents.
![Page 47: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/47.jpg)
33
Results
PRXamide-like immunoreactivity
Overview
In general, PRXamide-like immunoreactivity (PRXa-LI) in the central nervous system of R.
prolixus is present in bilaterally paired cells and processes, as illustrated in the composite camera
lucida drawings (Figure 1). With the exception of strongly staining cells in the posterior-ventral
mesothoracic ganglionic mass (MTGM), most processes could only be traced a short distance
within the CNS. The processes, excluding those associated with the dorsal vessel and abdominal
nerves, did not appear to exit the CNS. There were no differences observed in PRXa-LI between
male and female fifth instar R. prolixus; however the intensity of immunoreactive staining
differed greatly following a blood meal (see later). Overnight preincubation of the antiserum with
Mas-CAPA-1 (50 µmol l–1) eliminated all immunoreactivity of cells and processes within the
CNS with the exception of the very intensely staining cells of the posterior-ventral MTGM,
which were greatly reduced in intensity.
Brain and retrocerebral complex
On the dorsal surface of the brain, two main groups of cells showed PRXa-LI (Figure 2A). The
first group consists of a bilateral pair of lateral neurosecretory cells (LNCs) prominently
identified in the border region of the optic lobe and brain, which have processes projecting
medially through the brain. A second group of cells consists of five pairs of medial
neurosecretory cells (MNCs) arranged as a cluster along the boundary between the protocerebral
lobes. Immunoreactive varicosities were also present along the periphery of the protocerebral
lobes originating at the optic lobe/brain boundary and also present anterior to the MNCs. Some
immunoreactivity appeared to be associated with the corpus cardiacum, however, extensive
PRXamide-like immunoreactive processes were present along the walls of the aorta, decreasing
in intensity as they proceed posteriorly (Figure 2B).
The ventral surface of the brain contains two sets of bilaterally paired cells (Figure 3A), which
are located posterior to the LNCs. These cells project processes posteriorly. Varicosities similar
![Page 48: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/48.jpg)
34
Figure 1. Composite camera lucida drawing of PRXamide-like immunoreactive cells and
processes in the central nervous system of R. prolixus. Left, dorsal view; right, ventral view.
Filled cells indicate strong PRXamide-like immunoreactivity (PRXa-LI) and open cells indicate
weak PRXa-LI. Within the mesothoracic ganglionic mass (MTGM), the ventral paired median
cells give rise to immunoreactive processes which project dorsally and then exit the CNS via the
second, third and fourth abdominal nerves (ABN) where they develop neurohemal sites. PRO,
prothoracic ganglion; SOG, sub-oesophageal ganglion. Scale bar, 200 µm.
![Page 49: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/49.jpg)
35
![Page 50: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/50.jpg)
36
Figure 2. PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus. Dorsal views
of (A) brain, (B) sub-oesophageal ganglion (SOG), (C) prothoracic ganglion and (D) the
mesothoracic ganglionic mass (MTGM). In A, putative lateral neurosecretory cells and medial
neurosecretory cells are indicated by open and filled arrows, respectively. In B, note the strong
immunoreactivity in putative neurohemal sites on the dorsal vessel (open arrows) and light
staining over the corpus cardiacum (filled arrow). In C, note the numerous medial processes with
PRXa-LI that originate in the SOG and project into the MTGM. In D, note the lateral paired cells
(open arrows) and the processes originating from the ventral paired neurosecretory cells (filled
arrows). Scale bar, 100 µm.
![Page 51: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/51.jpg)
37
![Page 52: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/52.jpg)
38
Figure 3. PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus. Ventral views
of (A) brain, (B) sub-oesophageal ganglion, (C) prothoracic ganglion (PRO) and (D) the
mesothoracic ganglionic mass. In A, note the lateral immunoreactive cells (open arrows). In B,
note the numerous bilaterally paired cell bodies (open arrows) lying medially. In C, note the
lightly staining immunoreactive varicosities over the ventral PRO. In D, note the
immunoreactive cell bodies (open arrows) and extensive neurohemal-like immunoreactivity on
the abdominal nerves (closed arrows). The intensity of staining of these cells is greatly reduced
3–4 h following feeding (see later). Scale bar, 100 µm.
![Page 53: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/53.jpg)
39
![Page 54: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/54.jpg)
40
to the pattern visible on the dorsal surface of the brain were also observed on the ventral surface
of the brain. Immunoreactive processes were also seen in the recurrent nerve with numerous cell
bodies staining for PRXa-LI in the frontal ganglion (Figure 4A).
Sub-oesophageal ganglion (SOG)
The dorsal sub-oesophageal ganglion (SOG) did not contain any PRXamide-like immunoreactive
cell bodies; however, two bilaterally paired immunoreactive processes were observed passing in
the medial and lateral margins of the SOG (Figure 2B). On the ventral SOG, several bilaterally
paired cells demonstrate strong PRXa-LI. Some of these cells can be seen projecting processes
posteriorly in Figure 3B. PRXamide-like immunoreactive processes were present at the posterior
margin of the SOG and within the connectives of the SOG and prothoracic ganglion.
Prothoracic ganglion (PRO)
Processes originating from the SOG are observed in the dorsal prothoracic ganglion (PRO). The
medial processes continue through to the posterior of the PRO whereas some lateral processes
arborise in the central neuropile (Figure 2C). On the ventral surface of the PRO, some faint PRX-
amide immunoreactive staining was observed in the central neuropile (Figure 3C).
Mesothoracic ganglionic mass (MTGM)
On the dorsal surface of the mesothoracic ganglionic mass (MTGM), a small number of cell
bodies showed faint PRXa-LI in both the mesothoracic and the abdominal neuromeres (Figure
2D). Specifically, in the mesothoracic neuromere there were two cells (bilaterally paired) with
posteriorly projecting processes. In the abdominal neuromeres, there are four cells (two
bilaterally paired) along the lateral margins with processes projecting medially. The processes
originating from the SOG and passing through the PRO continue into the MTGM where they
arborise in the metathoracic neuromere. Processes from three pairs of strongly staining cell
bodies located on the ventral MTGM project dorsally and then posteriorly continue into the
![Page 55: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/55.jpg)
41
Figure 4. PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus. (A) Frontal
ganglion (FG) with numerous immunoreactive cell bodies; (B) immunoreactive neurohemal sites
on the second (ABN2), third (ABN3) and fourth (ABN4) abdominal nerves. In B, note that
abdominal nerves two and three contain more elaborate immunoreactive neurohemal sites. Scale
bar, 100 µm.
![Page 56: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/56.jpg)
42
![Page 57: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/57.jpg)
43
second, third and fourth abdominal nerves that stem from the abdominal neuromeres in the
posterior MTGM (Figure 2D, Figure 3D). These immunoreactive processes form extensive
neurohemal sites over the proximal portion of the nerves and distally continue as fine processes
(Figure 3D, Figure 4B).
Cell bodies with variable PRXa-LI were observed on the ventral surface of the MTGM.
Beginning anteriorly, there was a ventral unpaired medial (VUM) neuron within the
mesothoracic neuromere, which had strong PRXa-LI. Moving posteriorly, within the
metathoracic neuromere, a bilateral pair of cells showed weak PRXa-LI. Finally, within the
midline of the abdominal neuromeres, the six (three bilaterally paired) strongly staining cells,
referred to earlier, were consistently seen with their processes projecting dorsally and then
posteriorly out of corresponding abdominal nerves. Of this strongly staining group, the most
anterior pair projects through the second abdominal nerve, whereas the second pair project to the
third abdominal nerves, and the last strongly staining pair, and most posterior, project processes
through the fourth abdominal nerves. Each cell of the most posterior pair have a diameter of 29
µm, which is considerably larger than the two more anterior pairs of cells (16 µm).
Time-course immunohistochemical analysis
Following a blood meal, extensive changes in the intensity of staining of PRXamide-like cells
and processes are observed. Specifically, over the MTGM, the staining of the six strongly
staining cells within the abdominal neuromeres becomes weaker in intensity, beginning as early
as 3 h following a blood meal (Figure 5). These cells project into the abdominal nerves, and form
neurohemal sites, suggesting a location for release into the haemolymph. Changes in PRXa-LI
post-feeding were analyzed by evaluating staining intensity of the six strongly staining cell
bodies over the MTGM using the ImageJ software package. No significant changes in staining
intensity were seen in unfed control animals across all time points analyzed. In contrast, staining
intensity appears to weaken as early as 3 h following feeding (see Figure 5). As time post-feeding
progresses, significant decreases in staining intensity were observed. Interestingly, the largest and
most posterior pair of cells regained staining before the two smaller and more anterior pairs of
cells. This last pair of cells projects processes into the fourth abdominal nerves, which has
![Page 58: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/58.jpg)
44
Figure 5. Time-course immunohistochemical analysis of the ventral paired medial
neurosecretory cells in the MTGM of fifth-instar R. prolixus. Immunohistochemical analysis was
conducted on a group of animals that were either fed for 20 min on rabbit's blood (hatched bars)
or not fed (white bars). (A–G) PRXamide-like immunoreactivity (PRXa-LI) was examined at 1,
2, 3, 4, 5, 24 and 48 h post feeding, respectively. (H) Confocal image of the ventral paired
median neurosecretory cells showing the labelling scheme utilized in A–G. Scale bar, 50 µm.
*PRXa-LI that differs significantly from controls (unfed) (P<0.05, ANOVA and Tukey post-
test).
![Page 59: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/59.jpg)
45
![Page 60: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/60.jpg)
46
notably fewer neurohemal sites than the second and third abdominal nerves. Nonetheless, the
intensity of staining of the neurohemal sites and processes over the abdominal nerves was visibly
assessed and was reduced at the same time points.
Malpighian tubule fluid secretion assay
To better characterize the anti-diuretic mechanism in R. prolixus, we tested various
concentrations of Mas-CAPA-1 on 5-HT-stimulated tubules and observed a dose-dependent
inhibition on tubule secretion (Figure 6). Threshold was observed at approximately 0.1 nmol l–1
Mas-CAPA-1 and maximal inhibition at a dose of 1 µmol l–1 Mas-CAPA-1. In order to provide
further empirical evidence for the presence of a Mas-CAPA-1-like neuropeptide in R. prolixus,
we tested individual fractions from RP-HPLC against 5-HT-stimulated tubules and identified an
anti-diuretic fraction. This fraction (fraction 25) ran in close proximity to synthetic Mas-CAPA-
1, which eluted from the C18 column at 24.5 min (an acetonitrile concentration of 38.25%).
Tubules incubated in this fraction, in the presence of 50 nmol l–1 5-HT, showed a dose-dependent
decrease in secretion rate (Figure 7). Thus, tubules stimulated with 50 nmol l–1 5-HT and this
anti-diuretic fraction from 1 CNS equivalent inhibited secretion by 11%, from 5 CNS equivalents
by 27% and from 10 CNS equivalents by 74%. The ability of a single CNS equivalent to decrease
secretion by only 11% could be due to the combined influence of losses associated with
sonication of tissues and preparatory steps prior to HPLC as well as impurity of the factor. Since
CNS extracts were run only through a single column, other factors eluting within this fraction
could be contributing to the biological activity observed.
Malpighian tubule cyclic GMP radioimmunoassay
To further understand the mechanism of action of this endogenous Mas-CAPA-1-like anti-
diuretic neuropeptide in R. prolixus, cyclic GMP radioimmunoassays were conducted on fifth
instars to confirm the previous observation of an elevation of intracellular cGMP in response to
Mas-CAPA-1 in third-instar tubules stimulated with 5-HT. 5-HT (50 nmol l–1) lowered cGMP
![Page 61: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/61.jpg)
47
levels of fifth-instar tubules and these levels were restored to control values by Mas-CAPA-1 at
500 nmol l–1 (Figure 8). Similarly, fraction 25 at 10 CNS equivalents also increased the cGMP
Figure 6. Dose–response curve demonstrating Mas-CAPA-1 inhibition of secretion by
Malpighian tubules stimulated with 50 nmol l–1 5-HT. Control tubules received 50 nmol l–1 5-
HT. Values are mean ± s.e.m., N=8 or more tubules.
![Page 62: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/62.jpg)
48
![Page 63: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/63.jpg)
49
Figure 7. Inhibition of secretion (stimulated with 50 nmol l–1 5-HT) with increasing doses of
Fraction 25 from RP-HPLC. Values are expressed as a percentage of control (normal secretion of
tubules stimulated with 50 nmol l–1 5-HT). Values are mean ± s.e.m., N=8 or more tubules.
*Statistically significant inhibition (P<0.001).
![Page 64: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/64.jpg)
50
![Page 65: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/65.jpg)
51
Figure 8. Change in levels of intracellular cGMP in tubules stimulated with 5-HT alone or in
combination with Mas-CAPA-1 (500 nmol l–1) or Fraction 25 (F25; 10 CNS equivalents) vs
saline alone. 5-HT lowers cGMP levels, and these levels can be restored to those with saline
alone or above by Mas-CAPA-1 or Fraction 25 (* significantly different from 5-HT alone at
P<0.05). In addition, levels of intracellular cGMP in tubules stimulated with Fraction 25 were
also significantly higher (†) than tubules stimulated with Mas-CAPA-1 or saline alone (P<0.05).
![Page 66: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/66.jpg)
52
![Page 67: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/67.jpg)
53
levels of 5-HT-stimulated tubules (Figure 8). The levels of cGMP in tubules stimulated with
fraction 25, in the presence of 50 nmol l–1 5-HT, were found to be significantly higher than
unstimulated tubules, suggesting that the actions of this endogenous Mas-CAPA-1-like factor
involve augmenting levels of intracellular cGMP.
![Page 68: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/68.jpg)
54
Discussion
Using a polyclonal antiserum to MasPETH, which identifies peptides sharing a common C-
terminal tripeptide motif PRXamide [X=I, L, M or V (Žitnaň et al., 2003)], we have
demonstrated the presence of cell bodies and processes having PRXa-LI throughout the central
and peripheral nervous system of fifth-instar R. prolixus. Several insect neuropeptides sharing
this common C-terminal motif have been identified and the CAPA gene encodes three extended
PRXamides, including CAPA-1 (a PRVamide). Of these closely related neuropeptides, the
PRXa-LI observed in fifth-instar R. prolixus closely resembles the immunocytochemical
localization of the CAPA gene peptides in D. melanogaster (Kean et al., 2002). More
specifically, the strongly immunoreactive ventral medial cells over the abdominal neuromeres in
the posterior MTGM closely resemble three pairs of abdominal neurosecretory cells in D.
melanogaster, which stain for the CAPA precursor protein, and thus provides evidence that these
cell types produce CAP2b-related peptides (Kean et al., 2002). In addition, the distribution in R.
prolixus of PRXamide-like immunoreactive cells over the MTGM resembles CAPA gene-
expressing cells in the abdominal ganglia of larval and adult M. sexta (Loi and Tublitz, 2004).
Medial neurosecretory cells showing PRXa-LI over the dorsal brain of fifth-instar R. prolixus
resemble cells over the dorsal brain of M. sexta larvae that express CAPA transcripts (Loi and
Tublitz, 2004). Taken together, these similarities in immunoreactivity along with the abolition of
immunoreactivity following preincubation of the antiserum with Mas-CAPA-1, suggests that the
immunoreactivity observed indicates the presence of Mas-CAPA-1-like neuropeptides in the
CNS of R. prolixus. More importantly, the medial ventral cell bodies in the MTGM project
processes into the abdominal nerves, well-known neurohemal release sites (Miksys and Orchard,
1994), and thus provides a location for release of these peptides into the haemolymph.
Furthermore, the intensity of staining of immunoreactivity in these cell bodies and their
neurohemal release sites is greatly reduced 3–4 h post feeding – a time when the cessation of
diuresis is observed (Maddrell, 1964), suggesting the release of an anti-diuretic factor.
We suggest that the strong PRXa-LI observed over the MTGM and abdominal nerves provides
evidence for a CAPA-like neuropeptide in the CNS of R. prolixus, which includes a Mas-CAPA-
1-like peptide. The presence of PRXamide-like immunoreactive cell bodies in addition to
![Page 69: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/69.jpg)
55
processes and neuropiles over the length of the CNS suggest additional roles as neurotransmitters
and/or neuromodulators. Future studies will help elucidate whether the PRXamide-like peptide
functions as a neurotransmitter and/or neuromodulator in R. prolixus. Certainly, the results
indicate that the PRXamide-like neuropeptide in R. prolixus acts as a neurohormone since there is
evidence of release from the MTGM and abdominal nerves as well as activity on a non-
innervated visceral tissue (Malpighian tubules).
Previous analyses on third-instar R. prolixus tubules showed dose-dependent effects of Mas-
CAPA-1in the nanomolar range (Quinlan et al., 1997). To better understand the response of
tubules to Mas-CAPA-1-like peptides in fifth-instar R. prolixus, we tested a broad range of
physiological doses of Mas-CAPA-1 to determine the dose-dependency on isolated tubules. At
0.1 nmol l–1, the lowest dose tested, Mas-CAPA-1 caused a 5% decrease in secretion. This
neuropeptide had a maximal effect on tubules at 1 µmol l–1, inhibiting secretion by over 75%. A
higher dose (10 µmol l–1) of this neuropeptide was slightly less effective at inhibiting fluid
secretion, possibly indicating the beginning of receptor desensitization.
Further evidence for the presence of a Mas-CAPA-1-like neuropeptide in R. prolixus sharing
similar characteristics to Mas-CAPA-1 was revealed by bioassay of native material. Analysis of
RP-HPLC fractions from 250 CNSs revealed a factor with anti-diuretic effects on Malpighian
tubules stimulated with 5-HT. This factor eluted from the C18 column at a similar time and
acetonitrile concentration to Mas-CAPA-1, suggesting that this factor shares similar
chromatographic properties to Mas-CAPA-1. Doses as low as a single CNS equivalent were
adequate in eliciting an anti-diuretic effect on tubules. Furthermore, tubules stimulated with
higher doses of this factor demonstrated a greater inhibition of secretion, indicating the effects of
this factor are dose dependent. To our knowledge, this is the first study to show direct evidence
for the presence of an endogenous anti-diuretic factor in R. prolixus, which significantly inhibits
5-HT-stimulated secretion in a dose-dependent manner.
This same fraction elevated intracellular cyclic GMP levels in tubules stimulated with 5-HT,
indicating that this second messenger may be exploited by the native Mas-CAPA-1-like anti-
diuretic peptide in R. prolixus. Moreover, this fraction not only reversed the effects of 5-HT on
cGMP, but at this dose also increased cGMP above its original saline control values. This result
![Page 70: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/70.jpg)
56
implies that this factor is actively involved in the synthesis of intracellular cGMP, which, as
suggested previously, may involve the actions of a guanylate cyclase belonging to the class of
membrane-bound enzymes (Quinlan et al., 1997). Interestingly, Mas-CAPA-1 has been shown to
increase the synthesis of nitric oxide and cGMP leading to an increase in fluid production in D.
melanogaster tubules (Davies et al., 1995; Davies et al., 1997). Expression of the receptor for
Mas-CAPA-1 in tubules has been shown in a number of Dipterans (see Pollock et al., 2004). It is
interesting that there has been a divergence in signaling between these organisms.
In conclusion, this study investigated the distribution of PRXa-LI throughout the CNS of R.
prolixus. It is probable that many of these cells, especially those in the abdominal neuromeres,
are Mas-CAPA-1-like since: (1) preincubation of the antiserum with Mas-CAPA-1 peptide
eliminated all immunoreactivity within the CNS; (2) immunoreactivity was significantly reduced
beginning 3–4 h post-feeding in accordance with the time of anti-diuretic behaviour (Maddrell,
1964), which suggests the release of an anti-diuretic peptide from the putative neurohemal release
sites on the abdominal nerves; (3) this study, as well as previous studies on third-instar R.
prolixus, have shown that Mas-CAPA-1 elicits an anti-diuretic effect on R. prolixus tubules
(Quinlan et al., 1997); (4) tubule secretion assay utilizing CNS fractions from a C18 HPLC run
identified a factor with Mas-CAPA-1-like biological activity, which inhibits 5-HT-induced
tubule secretion; lastly, (5) this same RP-HPLC fraction containing an anti-diuretic factor was
also effective at increasing levels of intracellular cGMP in Malpighian tubules.
![Page 71: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/71.jpg)
57
References
Barrett, F. M. and Orchard, I. (1990). Serotonin-induced elevation of cyclic AMP levels in the
epidermis of the blood-sucking bug, Rhodnius prolixus. J. Insect Physiol. 36, 625 -633.
Coast, G. M., Orchard, I., Phillips, J. E. and Schooley, D. A. (2002). Insect diuretic and anti-
diuretic hormones. Adv. Insect Physiol. 29, 279 -409.
Davies, S. A., Huesmann, G. R., Maddrell, S. H. P., O'Donnell, M. J., Skaer, N. J. V., Dow,
J. A. T. and Tublitz, N. J. (1995). CAP2b, a cardioacceleratory peptide, is present in
Drosophila and stimulates tubule fluid secretion via cGMP. Am. J. Physiol. 269, R1321 -
R1326.
Davies, S. A., Stewart, E. J., Huesmann, G. R., Skaer, N. J., Maddrell, S. H., Tublitz, N. J.
and Dow, J. A. (1997). Neuropeptide stimulation of the nitric oxide signaling pathway in
Drosophila melanogaster Malpighian tubules. Am. J. Physiol. 273, R823 -R827.
Huesmann, G. R., Cheung, C. C., Loi, P. K., Lee, T. D., Swiderek, K. M. and Tublitz, N. J.
(1995). Amino acid sequence of CAP2b, an insect cardioacceleratory peptide from the
tobacco hawkmoth Manduca sexta. FEBS Lett. 371, 311 -314.
Kean, L., Cazenave, W., Costes, L., Broderick, K. E., Graham, S., Pollock, V. P., Davies, S.
A., Veenstra, J. A. and Dow, J. A. (2002). Two nitridergic peptides are encoded by the
gene capability in Drosophila melanogaster. Am. J. Physiol. 269, R1297 -R1307.
Lange, A. B., Orchard, I. and Llyod, R. J. (1988). Immunohistochemical and electrochemical
detection of serotonin in the nervous system of the blood-feeding bug, Rhodnius prolixus.
Arch. Insect Biochem. Physiol. 8, 187-201.
Loi, P. K. and Tublitz, N. J. (2004). Sequence and expression of the CAPA/CAP2b gene in the
tobacco hawkmoth, Manduca sexta. J. Exp. Biol. 207, 3681 -3691.
Maddrell, S. H. P. (1964). Excretion in the blood-sucking bug, Rhodnius prolixus Stål. II. The
normal course of diuresis and the effect of temperature. J. Exp. Biol. 41, 163 -176.
Maddrell, S. H. P., Pilcher, D. E. M. and Gardiner, B. O. C. (1971). Pharmacology of the
Malpighian tubules of Rhodnius and Carausius: the structure-activity relationship of
tryptamine analogues and the role of cyclic AMP. J. Exp. Biol. 54, 779 -804.
![Page 72: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/72.jpg)
58
Maddrell, S. H. P., Herman, W. S., Farndale, R. W. and Riegel, J. A. (1993). Synergism of
hormones controlling epithelial fluid transport in an insect. J. Exp. Biol. 174, 65-80.
Miksys, S. and Orchard, I. (1994). Immunogold labelling of serotonin-like and FMRFamide-
like immunoreactive material in neurohemal areas on abdominal nerves of Rhodnius
prolixus. Cell Tissue Res. 278, 145 -151.
Montoreano, R., Triana, F., Abate, T. and Rangel-Aldao, R. (1990). Cyclic AMP in the
Malpighian tubule fluid and in the urine of Rhodnius prolixus. Gen. Comp. Endocrinol.
77, 136 -142.
O'Donnell, M. J. and Spring, J. H. (2000). Modes of control of insect Malpighian tubules:
synergism, antagonism, cooperation and autonomous regulation. J. Insect Physiol. 46,
107 -117.
Pollock, V. P., McGettigan, J., Cabrero, P., Maudlin, I. M., Dow, J. A. T. and Davies, S. A.
(2004). Conservation of capa peptide-induced nitric oxide signaling in Diptera. J. Exp.
Biol. 207, 4135 -4145.
Quinlan, M. C. and O'Donnell, M. J. (1998). Anti-diuresis in the blood-sucking insect
Rhodnius prolixus Stål: antagonistic actions of cAMP and cGMP and the role of organic
acid transport. J. Insect Physiol. 44, 561 -568.
Quinlan, M. C., Tublitz, N. J. and O'Donnell, M. J. (1997). Anti-diuresis in the blood-sucking
insect Rhodnius prolixus Stål: the peptide CAP2b and cyclic GMP inhibit Malpighian
tubule fluid secretion. J. Exp. Biol. 200, 2363 -2367.
Rasband, W. S. (2005). ImageJ, US National Institutes of Health, Bethesda, Maryland, USA.
Skaer, N. J. V., Nässel, D. R., Maddrell, S. H. P. and Tublitz, N. J. (2002). Neurochemical
fine tuning of a peripheral tissue: peptidergic and aminergic regulation of fluid secretion
by Malpighian tubules in the tobacco hawkmoth M. sexta. J. Exp. Biol. 205, 1869 -1880.
Teal., P. E., Abernathy, R. L., Nachman, R. J., Fang, N., Meredith, J. A. and Tumlinson, J.
H. (1996). Pheromone biosynthesis activating neuropeptides: Functions and chemistry.
Peptides 17, 337 -344.
![Page 73: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/73.jpg)
59
Te Brugge, V. A., Miksys, S. M., Coast, G. M., Schooley, D. A. and Orchard, I. (1999). The
distribution of a CRF-like diuretic peptide in the blood-feeding bug Rhodnius prolixus. J.
Exp. Biol. 202, 2017 -2027.
Te Brugge, V. A., Lombardi, V. C., Schooley, D. A. and Orchard, I. (2005). Presence and
activity of a Dippu-DH31-like peptide in the blood-feeding bug, Rhodnius prolixus.
Peptides 26, 29-42.
Wegener, C., Herbert, Z., Eckert, M. and Predel, R. (2002). The periviscerokinin (PVK)
peptide family in insects: evidence for the inclusion of CAP(2b) as a PVK family
member. Peptides 23, 605 -611.
Žitnaň, D., Hollar, L., Spalovská, I., Takác, P., Zitnanová, I., Gill, S. S. and Adams, M. E.
(2002). Molecular cloning and function of ecdysis-triggering hormones in the silkworm
Bombyx mori. J. Exp. Biol. 205, 3459 -3473.
Žitnaň, D., Zitnanová, I., Spalovská, I., Takác, P., Park, Y. and Adams, M. E. (2003).
Conservation of ecdysis-triggering hormone signaling in insects. J. Exp. Biol. 206, 1275 -
1289.
![Page 74: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/74.jpg)
60
Acknowledgements
We are grateful to Dr Mike Adams and Dr Dusan Žitnaň for their generous gift of the anti-PETH
antiserum. This research was supported through an NSERC grant to I.O.
![Page 75: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/75.jpg)
61
Copyright Acknowledgements
The preceeding chapter was reproduced / adapted with permission from The Company of
Biologists.
Full citation details:
Distribution, activity and evidence for the release of an anti-diuretic peptide in the kissing bug Rhodnius prolixus. Paluzzi JP, Orchard I. J Exp Biol. 2006 Mar;209(Pt 5):907-15. doi: 10.1242/jeb.02083
![Page 76: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/76.jpg)
62
Chapter 3:
Isolation, cloning, and expression mapping of a gene encoding an anti-
diuretic hormone and other CAPA-related peptides in the disease
vector, Rhodnius prolixus
![Page 77: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/77.jpg)
63
Abstract
After a blood meal, Rhodnius prolixus undergoes a rapid diuresis to eliminate excess water and
salts. During the voiding of this primary urine, R. prolixus acts as a vector of Chagas’ disease,
with the causative agent, Trypanosoma cruzi, infecting the human host via the urine. Diuresis in
R. prolixus is under the neurohormonal control of serotonin and peptidergic diuretic hormones,
and thus, diuretic hormones play an important role in the transmission of Chagas’ disease.
Although diuretic hormones may be degraded or excreted, resulting in the termination of diuresis,
it would also seem appropriate, given the high rates of secretion, that a potent anti-diuretic factor
could be present and act to prevent excessive loss of water and salts after the postgorging
diuresis. Despite the medical importance of R. prolixus, no genes for any neuropeptides have
been cloned, including obviously, those that control diuresis. Here, using molecular biology in
combination with matrix-assisted laser desorption ionization-time of flight-tandem mass
spectrometry, we determined the sequence of the CAPA gene and CAPA-related peptides in R.
prolixus, which includes a peptide with anti-diuretic activity. We have characterized the
expression of mRNA encoding these peptides in various developmental stages and also examined
the tissue-specific distribution in fifth-instars. The expression is localized to numerous bilaterally
paired cell bodies within the central nervous system. In addition, our results show that
RhoprCAPA gene expression is also associated with the testes, suggesting a novel role for this
family of peptides in reproduction.
![Page 78: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/78.jpg)
64
Introduction
The hematophagous insect, Rhodnius prolixus, can transmit Chagas’ disease after feeding on
humans in Central and South America where the insects are endemic (Rabinovich and
Himschoot, 1990; Ramsey et al., 2000; Monroy et al., 2003; Feliciangeli et al., 2004). The
parasite, Trypanosoma cruzi, infects humans when it is passed out of the insect in the primary
urine produced as a result of the large blood meal imbibed. The parasite often enters the human
host through the wound left after the blood meal. The postprandial diuresis is under the
neurohormonal control of serotonin [5-hydroxytryptamine (5-HT)] and various peptidergic
diuretic hormone (DH) families acting on the Malpighian tubules (MTs) (Maddrell, 1963; 1964;
Maddrell et al., 1991; Te Brugge et al., 1999; 2002; 2005; Orchard, 2006). In this regard, it might
be stated that serotonin and the DHs aid in the transmission of Chagas’ disease; disrupting
diuresis would therefore disrupt the transmission of the parasite. Despite the medical importance
of R. prolixus, no genes have been cloned for any neuropeptides, although with the
announcement of National Institutes of Health funding the R. prolixus genome project, prospects
for the future are positive (http://www.genome.gov/13014443).
Much is known about the neurohormonal control of diuresis in insects, including R. prolixus, and
a number of DH families have been identified. These peptide families include the corticotropin-
releasing factor-related DHs, calcitonin-related DHs, kinin-related DHs, and cardioacceleratory
peptide 2b (CAP2b)-related DHs (Maddrell, 1963; 1964; Maddrell et al., 1991; Te Brugge et al.,
1999; 2002; 2005; Orchard, 2006; Coast et al., 2002; Coast, 2007).
In contrast to these diuretic factors that stimulate MT secretion, only a few anti-diuretic factors
that specifically inhibit MT secretion have been identified. Two peptides have been isolated from
the yellow mealworm beetle, Tenebrio molitor, anti-diuretic factor (ADF)-a and ADFb, which
act via cGMP to inhibit basal as well as native corticotropin-releasing factor-stimulated secretion
of tubules (Eigenheer et al., 2002; 2003; Wiehart et al., 2002). Additional factors have been
partially isolated from other insects such as the cricket, Acheta domesticus (Spring et al., 1988);
the mosquito, Aedes aegypti (Petzel and Conlon, 1991); the forest ant, Formica polyctena (de
Decker et al., 1994); and the Colorado potato beetle, Leptinotarsa decemlineata (Lavigne et al.,
2001). Interestingly, CAP2b, originally identified in Manduca sexta, has been shown to have
![Page 79: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/79.jpg)
65
anti-diuretic activity in R. prolixus and appears to use cGMP as a second messenger (Quinlan et
al., 1997). This is surprising because CAP2b-related peptides are potent stimulators of MT
secretion in some other insects, including Drosophila melanogaster. Using a combination of
immunohistochemical, physiological, and chromatographic methods, we recently partially
isolated a native CAP2b-related peptide from the central nervous system (CNS) of R. prolixus
that has anti-diuretic activity. This endogenous anti-diuretic factor appears to be released at a
time when the cessation of diuresis is observed naturally and has a potent inhibitory effect on
serotonin-stimulated fluid secretion and elevates levels of its cognate intracellular mediator,
cGMP (Paluzzi and Orchard, 2006). For a blood-gorging insect such as R. prolixus, which
undergoes a very rapid diuresis after a blood meal, it is of importance to understand the efficient
anti-diuretic mechanism acting to prevent excessive loss of water and salts.
Here, using molecular biology in combination with matrix-assisted laser desorption ionization-
time of flight (MALDI-TOF) tandem mass spectrometry, we determined the sequence of the
capability (CAPA) gene in R. prolixus, which encodes the peptidergic anti-diuretic peptide,
CAP2b. This peptide inhibits serotonin-stimulated diuresis and elevates cGMP content of
serotonin-stimulated MTs. We characterized the expression of mRNA encoding these peptides in
all postembryonic developmental stages and have examined the spatial expression pattern in
various tissues of fifth-instars using RT-PCR. In addition, fluorescent in situ hybridization
(FISH) using peroxidase-mediated tyramide signal amplification was used to monitor the cell-
specific expression of the R. prolixus CAPA gene in fifth-instars. With the identification of this
potent endogenous anti-diuretic peptide, future investigations may focus on the design of
mimetic analogs of this peptide that would serve as prospective pest management agents to
inhibit the rapid production of primary urine that immediately follows blood gorging, thereby
impeding the transmission of Chagas’ disease by this human blood-feeding disease vector.
![Page 80: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/80.jpg)
66
Materials & Methods
Animals
Fifth-instar R. prolixus Stål were reared at high relative humidity in incubators at 25°C and
routinely fed on rabbits’ blood. Tissues were dissected from insects under physiological saline
prepared as described previously (Paluzzi and Orchard, 2006) in diethyl pyrocarbonate-treated
double distilled water to remove contaminating nucleases.
Degenerate primer design over conserved regions of insect CAPA precursors
Previously identified CAPA precursor sequences from D. melanogaster (Kean et al., 2002) and
Manduca sexta (Loi and Tublitz, 2004) along with putative sequences from online genome
databases for Anopheles gambiae, Bombyx mori, and Tribolium castaneum, identified by
TBLASTN search using the D. melanogaster precursor sequence (accession no. NP_524552.1),
were aligned with ClustalW and conserved regions were used to design degenerate primers to
amplify the CAPA precursor in R. prolixus. The amino acid sequence FPRVGR corresponding to
the C-terminal region of the first commonly encoded peptide was chosen for design of the
forward degenerate primers FPRVGR for1a and FPRVGR for1b with sequences of
TTYCCNCGNGTNGGRCG and TTYCCNCGNGTNGGYCG, respectively. The amino acid
sequence WFGPRLG corresponding to the C-terminal region of the third encoded peptide was
chosen for design of the reverse degenerate primers WFGPRLG rev1a and WFGPRLG rev1b
with sequences of CCNARNCKNGGRCCRAACCA and CCNARNCKNGGYCCRAACCA,
respectively. Two primer variants were designed to lower the degeneracy and reduce
amplification of nonspecific products.
Two-step RT-PCR methods
Using R. prolixus fifth instar CNS total RNA, synthesis of first-strand cDNA was carried out
using the RevertAid H Minus first strand cDNA synthesis kit (Fermentas, Burlington, Ontario,
Canada) following manufacturer recommendations. An aliquot of this first-strand synthesis
reaction was used as a template for the subsequent PCR using the degenerate primers indicated
above. Conditions for PCR were as follows: initial denaturation for 3 min at 95°C, 40 cycles of
denaturation at 94°C for 45 sec, annealing at 57°C for 45 sec, and extension at 72°C for 1 min
and a final extension at 72°C for 10 min. Based on CAP2b/CAPA encoding nucleotide sequences
![Page 81: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/81.jpg)
67
identified in other orders, the predicted size of the PCR product would be in the range of 100–300
bp.
Construction and screening of fifth-instar CNS cDNA library
The Creator SMART cDNA library construction kit (CLONTECH, Mountain View, CA) was
used to produce a cDNA library from CNS tissues of fifth-instar R. prolixus. Briefly, 400 central
nervous systems (CNSs) from insects fed 7–8 wk previously were dissected and mRNA isolated
using the Quickprep micro-mRNA purification kit (GE Healthcare, Piscataway, NJ). Library
construction followed a PCR-based protocol following the manufacturer’s recommendations with
some minor modifications. Specifically, 1.5 µg mRNA was used in the first-strand synthesis
reaction and second-strand synthesis (cDNA amplification) was carried out using long-distance
PCR with the fewest number of cycles recommended to reduce the number of nonspecific PCR
products. Once cycling was complete, amplified transcripts were prepared for ligation to the
supplied library cloning vector, pDNR-LIB. Transformation of recombinant plasmids into
Escherichia coli was carried out using ElectroMAX DH5α-E cells (Invitrogen, Burlington,
Ontario, Canada) and electroporator set at 1.8 kV. The final amplified library had a titer of
greater than 1010 cfu/ml and recombinant efficiency of more than 90%.
Library plasmid DNA prepared by standard maxiprep procedure was used as template for 5' and
3' rapid amplification of cDNA ends (RACE) PCR. Gene-specific primers (gsp) were designed
based on the partial sequence encoding a R. prolixus CAPA precursor obtained in the two-step
RT-PCR using degenerate primers (see Results). 3' RACE gsp were as follows: CAPA FOR1,
TGCAAGAAATTTCCCAGCC; CAPA FOR2, TTGGGGGATGATAGTCGG; and CAPA
FOR3, CAAGAGGAACGGAGGTGG. These 3' RACE gsp were used successively combined
with the plasmid reverse primer (pDNR-LIB REV1, with the sequence
GCCAAACGAATGGTCTAGAAAG) in a seminested PCR approach to increase the specificity
of the amplified 3' RACE products. Similarly, 5' RACE gsp were designed as follows: CAPA
REV1, ATAGGCCTCCACCGTTTCC; CAPA REV2, CTTGGGGCCAGATCTTCC; and
CAPA REV3, CTATCATCCCCCAAGTGGC. These 5' RACE gsp were used successively
combined with the plasmid forward primer (pDNR-LIB FOR1, with the sequence
GTGGATAACCGTATTACCGCC) in a seminested PCR approach to increase the specificity of
the amplified 5' RACE products. Conditions for both 5' and 3' RACE PCR were as follows: 3
![Page 82: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/82.jpg)
68
min initial denaturation at 95°C, 40 cycles of denaturation for 30 sec at 94°C, annealing for 30
sec at 61°C, extension for 1 min at 72°C, and a final extension for 10 min at 72°C. Amplified
fragments were visualized on an agarose gel-stained with ethidium bromide, extracted, and
cloned using the pGEM-T Easy Vector System (Promega, Madison, WI). Sequencing was carried
out at the Centre for Applied Genomics at the Hospital for Sick Children (MaRS Centre,
Toronto, Ontario, Canada), and sequences were confirmed from at least three independent clones
to ensure base accuracy.
Genomic Southern blot analysis
High-molecular-weight genomic DNA was isolated from various tissues of fifth-instar R.
prolixus and digested with a selection of restriction endonucleases. The digest reactions were
carried out in a total volume of 500 µl, and additional enzyme was added every 6 h for a total
incubation of 24 h to ensure complete digestion of genomic DNA. Fragmented DNA was then
purified, electrophoresed on a 1% agarose gel for 4 h at 10 V/cm (2 µg per lane), and transferred
to a positively charged nylon membrane (Roche, Mannheim, Germany) via downward capillary
transfer. The membrane was then baked at 80°C for 2 h to bind the DNA and subsequently stored
in a sealed plastic bag at room temperature until hybridization. Southern hybridization was
carried out using the Gene Images AlkPhos direct labeling and detection system (GE Healthcare).
Manufacturer recommendations were followed with some minor modifications and user-defined
conditions. Specifically, hybridization included an alkaline phosphatase-labeled RhoprCAPA
675bp cDNA (nucleotide ranging 12–687) at a probe concentration of 25 ng/ml hybridization
solution containing 4% block and 0.5M NaCl and 60°C overnight (~18–20 h) incubation.
Stringency washes and signal generation with ECF substrate were carried out following
manufacturer recommendations. Signal development was monitored at various time points and
detected using fluorescence scanning instrumentation (STORM 840; Molecular Dynamics, GE
Healthcare, Piscataway, NJ) and analyzed using ImageQuant TL software (Amersham
Biosciences, Piscataway, NJ).
Developmental and tissue-specific expression profile monitored with RT-PCR
Insects from each postembryonic developmental stage of R. prolixus subjected to similar feeding
regimens were flash frozen in liquid nitrogen and ground using a mortar and pestle. The ground
tissues were then used in mRNA isolation as discussed above. RhoprCAPA gene expression
![Page 83: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/83.jpg)
69
associated with each stage examined was monitored using a OneStep RT-PCR approach
(QIAGEN, Mississauga, Ontario, Canada). The reaction parameters were as follows: forward,
CAPA FOR2 (see above) and reverse primer, CAPA REVII
(CAAGTATTACATAAAATGAAACGAGTGC); 20 ng template mRNA from each stage (first
to fifth-instar and adult); reverse transcription for 30 min at 50°C followed directly by the initial
PCR activation step for 15 min at 95°C, 33 cycles of denaturation for 30 sec at 94°C, annealing
for 30 sec at 59°C, and extension for 1 min at 72°C. Lastly, the reaction included a final
extension step for 10 min at 72°C. Similar experimental parameters were used for monitoring the
spatial expression profile in various tissues of fifth-instar R. prolixus. Tissues were dissected
from insects and stored in RNAlater solution (Ambion, Austin, TX) until mRNA was isolated as
discussed above. Again, 20 ng mRNA from each tissue source were used as a template in RT-
PCR, and all parameters were maintained as above with the following exceptions: a reduction to
30 cycles and different forward and reverse primers: RhoprSPISSfor,
GCATGCGACATTGTTTTTTC and CAPA REV1 (see sequence above), respectively. For both
the developmental and tissue-specific expression analysis, a Rhopr β-actin 317-bp fragment was
amplified using forward and reverse primers, RhoprACTIN for1,
ACACCCAGTTTTGCTTACGG and RhoprACTIN rev1, GTTCGGCTGTGGTGATGA,
respectively, which served as a positive control to monitor the integrity of template mRNA.
Expression localization using FISH
Assessment of cell-specific spatial expression was accomplished using methods modeled on the
FISH protocols optimized for D. melanogaster embryos and tissues using peroxidase-mediated
tyramide signal amplification (Saunders and Cohen, 1999; Hughes and Krause, 1998; Lecuyer et
al., 2008). Digoxigenin (DIG)-labeled RNA was synthesized from a linearized recombinant
plasmid DNA containing a 716-bp RhoprCAPA cDNA fragment by in vitro transcription using
the DIG RNA labeling kit SP6/T7 (Roche Applied Science, Mannheim, Germany) following
manufacturer recommendations. Once DIG-labeled RNA synthesis was complete, template DNA
was removed with deoxyribonuclease I, and the probe was precipitated by adding 0.1 vol 3M
sodium acetate and 2.5 vol 100% ice-cold ethanol and placed at –80°C overnight. The next day,
precipitated labeled-RNA probe was pelleted by centrifugation, washed with ice-cold 70%
ethanol, resuspended in 40 µl of ribonuclease-free double-distilled H2O, and stored at –80°C.
Tissues were dissected in PBS and stored briefly (<5 min) in a microcentrifuge tube containing
![Page 84: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/84.jpg)
70
the same solution. Once enough tissue was dissected, the PBS was replaced with freshly prepared
working-stock fixation solution (40% paraformaldehyde-PBS, 1:9) and incubated for 30 min at
room temperature. After this primary fixation, tissues were washed five times with PBS and
0.1% Tween 20 (PBT) and subsequently incubated in 4% Triton X-100 (Sigma Aldrich,
Oakville, Ontario, Canada) in PBT for 10 min at room temperature and an extended incubation
on ice for 30 min. The detergent solution was then removed and tissues were washed several
times in PBT for 5 min each to terminate digestion, with the final wash in PBT extended for 15
min.
Tissues were subsequently incubated at room temperature in working-stock fixation solution (see
above). After this secondary fixation, tissues were washed five times with PBT for 2 min each to
remove all remaining fixative. The tissues were then rinsed in a 1:1 mixture of PBT-RNA
hybridization solution (50% formamide, 5x saline sodium citrate, 100 µg/ml heparin, 100 µg/ml
sonicated salmon sperm DNA, and 0.1% Tween 20; filter sterilized through a 0.2-µm filter, and
stored in aliquots at –20°C), which was then replaced by 100% RNA hybridization solution in
which tissues were stored at –20°C for several days. An aliquot (300 µl/sample) of hybridization
solution was boiled at 100°C for 5 min and then cooled on ice for a minimum of 5 min and used
as the prehybridization solution. Samples were transferred to 0.5-ml microcentrifuge tubes and
incubated with prehybridization solution in an incubator set at 56°C for a minimum of 1.5–2 h.
Toward the end of the prehybridization incubation, an additional aliquot as above of
hybridization solution plus 200 ng of antisense probe (or sense probe for controls) was incubated
at 75°C for 3–4 min to denature the probe and cooled on ice for at least 5 min or until
prehybridization was completed. At the end of the prehybridization, the solution was removed
and replaced with hybridization solution containing labeled probe and incubated overnight (16–
18 h) at 56°C. Wash solutions were preheated to 56°C and the hybridization solution-containing
probe was removed and tissues rinsed twice with 400 µl fresh hybridization solution and
incubated at 56°C for 10 min. The samples were then washed with 400 µl of prewarmed 3:1, 1:1,
and 1:3 (vol/vol) mixtures of hybridization solution-PBT for 10 min each. The samples were then
washed three times with prewarmed PBT and acclimatized to room temperature. Samples were
then processed for signal development using PBT with 1% blocking reagent (PBTB) containing
primary or secondary antibodies or tyramide substrate. PBT was removed from samples and
![Page 85: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/85.jpg)
71
replaced with 400 µl of PBTB and incubated at room temperature with constant mixing for 15
min.
After this initial block, tissue samples were incubated with biotin-SP-conjugated IgG fraction
monoclonal mouse antidigoxin (Jackson ImmunoResearch Laboratories Inc., West Grove, PA) at
a dilution of 1:400 for 2 h with constant mixing and protected from light. After this primary
antibody incubation, tissues were washed for 2 h with several changes of PBTB. Tissues were
then transferred to a 1:100 dilution of horseradish peroxidase-streptavidin stock solution
(Molecular Probes, Eugene, OR) in PBTB and incubated for 1 h with constant mixing and
protected from light. Tissue samples were then washed for 2 h with several changes of PBTB
followed by two brief washes in PBT and three 5-min washes in PBS. Toward the end of the
final wash, Alexa Fluor 568 tyramide working solution was prepared by diluting stock solution
1:100 in working stock amplification buffer containing 0.015% H2O2. The last PBS wash
solution was removed from the samples and replaced with 50–100 µl of tyramide substrate and
incubated in the dark for 2 h at room temperature with constant mixing. Once incubation was
complete, the samples were rinsed three times with PBS and then washed at room temperature
with constant mixing for 1 h, changing the wash buffer every 15 min. Tissues were then mounted
onto slides in glycerol and viewed under a laser-scanning confocal microscope consisting of a
helium-neon laser (543 nm line) and LSM Image browser software (Zeiss, Jena, Germany).
Sample preparation for MALDI TOF/TOF tandem mass spectrometry
The CNSs from 50 insects were dissected under saline, pooled in a 500-µl volume of methanol-
acetic acid-water (90:9:1, by volume), and stored overnight at –20°C. Samples were then
sonicated and centrifuged at 10,000 x g for 10 min. The supernatant was collected and dried in a
Speed Vac concentrator (Savant, Farmingdale, NY) and then reconstituted in 0.1% trifluoroacetic
acid (TFA). This sample was then applied to a C18 Sep-Pak cartridge (Waters Associates,
Mississauga, Ontario, Canada) prepared as described previously (Paluzzi and Orchard, 2006).
The loaded sample was initially washed with 0.1% TFA and subsequently eluted with 5 ml of
60% acetonitrile (Burdick and Jackson, Muskegon, MI) with 0.1% TFA. The eluant was dried in
a Speed Vac concentrator, reconstituted in a small volume of pure water and transferred directly
to a stainless steel MALDI plate insert (Applied Biosystems, Foster City, CA). Once the samples
were dried, a small aliquot of -cyano-4-hydroxycinnamic acid matrix solution (Agilent
![Page 86: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/86.jpg)
72
Technologies, New Castle, DE) was added on the dried samples and allowed to dry again. Mass
spectrometric analysis was performed on the ABI 4800 proteomics analyzer (Applied
Biosystems, Framingham, MA). Due to the nature of the samples, all acquisitions were taken in
manual mode. Initially the instrument was operated in reflectron mode to determine the parent
masses. For the tandem MS experiments, the collision-induced dissociation acceleration was 2
kV in all cases. An internal standard [des-Arg1-bradykinin (904.47)] was used to calibrate the
masses. To change the net amount of activation energy imparted to the primary ions, the collision
gas (atmospheric air) pressure was increased. Two gas pressures were used by selecting the
following two instrument settings: none and high. The fragmentation patterns from these
different settings were used to determine the sequence of the peptide with MH+ at 1107.58, the
only one to have sufficient intensity to yield fragmentation data. An unambiguous assignment of
internal Leu/Ile was achieved by means of collision-induced dissociation under high gas pressure
that revealed unique and distinct patterns for the side chains of Leu and Ile (Nachman et al.,
2005). RhoprCAPA-2 was synthesized and purified according to previous methods (Nachman
and Coast, 2007).
Malpighian tubule fluid secretion assay and intracellular cGMP RIA
Anti-diuretic activity of RhoprCAPA-2 was tested at various doses on upper segments of MTs
stimulated with 5-HT and cGMP RIA performed as previously described (Paluzzi and Orchard,
2006). Values are expressed as mean ± SEM and, where appropriate, were analyzed using
Student’s t test or one-way ANOVA with Tukey multiple comparison post test.
![Page 87: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/87.jpg)
73
Results
Preliminary sequence and cloning of full-length cDNA of RhoprCAPA
Using degenerate primers designed against conserved C-terminal residues of peptides processed
from CAPA precursor proteins in other insects, a 177-bp partial sequence encoding an
incomplete CAPA prepropeptide was isolated from R. prolixus. This partial sequence was then
used for design of gene-specific primers used in 5' and 3' RACE that yielded the full-length
sequence of the R. prolixus CAPA cDNA (RhoprCAPA cDNA) shown in Figure 1 (GenBank
accession no. EF989016). The cDNA is 789 nucleotides long with an 85-nucleotide 5'
untranslated region (UTR), a single open reading frame of 473 nucleotides (bases 86–559), and a
229-nucleotide 3' UTR. A putative polyadenylyation signal (AATAA) is present between bases
747 and 752. The single open reading frame encodes a prepropeptide of 157 amino acids
containing a predicted signal peptide with likely cleavage occurring between residue 23 and 24
(Ser23 and Ala24; SignalP3.0, ExPASy Server) (Bendtsen et al., 2004). The prepropeptide
sequence encodes three deduced propeptides: two CAP2b-related peptides numbered in the order
they appear on the gene, RhoprCAPA-1 (SPISSVGLFPFLRA, bases 206–247) and RhoprCAPA-
2 (EGGFISFPRV, bases 311–340), and a third pyrokinin-related propeptide common to other
insect CAPA prepropeptides, RhoprCAPA-PK1 (NGGGGNGGGLWFGPRL, bases 362–409).
Each of these three deduced propeptides are flanked at their N terminus by dibasic (Lys-Arg)
residues and at their C terminus by a monobasic (Arg) residue necessary for posttranslational
proteolytic processing after cleavage of the signal peptide. In addition, each of the predicted
peptides are flanked at their C terminus by a glycine residue, which is well known to provide the
amino group for amidation, thus suggesting the mature peptides are amidated. Based on these
proposed processing steps, the mature RhoprCAPA-1, RhoprCAPA-2, and RhoprCAPA-PK1
peptides would have predicted monoisotopic masses of 1489.83, 1107.58, and 1514.74 Da
(PeptideMass, ExPASy Server) (Wilkins et al., 1997), respectively.
Detection of predicted peptides from the R. prolixus CAPA gene
To confirm the presence of peptides predicted from the RhoprCAPA gene, extracts from CNS
were directly analyzed using MALDI-TOF mass spectrometry. These preparations revealed the
presence of three substances with mass of 1107.58, 1489.83, and 1514.74 Da, corresponding to
![Page 88: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/88.jpg)
74
Figure 1. Nucleotide cDNA sequence and deduced amino acid prepropeptide of the R. prolixus
CAPA gene (GenBank accession: EF989016). Sequences are numbered on the right starting with
the first nucleotide in the 5' UTR and initial methionine start codon (capitalized), respectively.
The three encoded peptides are shown in bold, with N-terminal dibasic and C-terminal
monobasic posttranslational cleavage sites shaded, and glycine residues required for amidation
boxed. The highly predicted signal peptide required for processing in the secretory pathway is
double underlined with predicted cleavage occurring between serine23 and alanine24. The
predicted polyadenylation signal sequence is bold underlined in the 3' UTR.
![Page 89: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/89.jpg)
75
![Page 90: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/90.jpg)
76
the masses of RhoprCAPA-2, RhoprCAPA-1, and RhoprCAPA-PK1 predicted from the
molecular data (see Figure 2, A and B). One of the peaks (1107.58) was of sufficient intensity to
allow for further fragmentation experiments (see Figure 2A) and produced clear fragments under
conditions of low energy fragmentation. Deduced sequence fragmentation data for RhoprCAPA-
2 is shown in Figure 2C along with a comparison of the fragmentation pattern of a synthetic
replicate of RhoprCAPA-2. The sequence, as predicted by the translation and subsequent
processing of the RhoprCAPA-2 prepropeptide, was manually reconstructed from its fragment
series, EGGFISFPRV-NH2 (1107.58 Da). The internal Ile could be unambiguously determined
over the isosteric residue Leu (Nachman et al., 2005).
Genomic Southern blot analysis
Analysis of restriction fragments generated with restriction endonucleases lacking recognition
sites over the RhoprCAPA cDNA used as a probe showed the presence of two or more positive
bands in genomic Southern blot analysis (Figure 3). This suggests there might be at least two
copies or paralogs of the RhoprCAPA gene per haploid genome of R. prolixus.
Developmental and spatial expression profile of the RhoprCAPA gene in R. prolixus
Insects from each postembyronic developmental stage (first-instar to adult) were analyzed for
expression of the CAPA gene by RT-PCR. The CAPA gene is expressed in all postembryonic
developmental stages of R. prolixus (Figure 4A), indicating a role in all juvenile and mature
forms. To better understand the spatial localization of CAPA gene expression, mRNA was
isolated from male fifth-instar tissues including CNS, MTs, anterior midgut, posterior midgut,
hindgut, dorsal vessel, testes, and salivary glands. Expression was observed in CNS and,
surprisingly, also in the testes; however, expression was absent in the other tissues examined
(Figure 4B). Samples that lacked the reverse transcription step were negative, as were samples
deficient in template mRNA.
![Page 91: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/91.jpg)
77
Figure 2. Detection of the peptides predicted from the CAPA gene in R. prolixus. MALDI-TOF
mass spectrum of a central nervous system extract from R. prolixus fifth-instars. Focus is on the
peptide with greatest intensity at MH+ 1107.58, RhoprCAPA-2 (A) and the other two predicted
peptides at MH+ 1489.83 and 1514.74 (B), corresponding to RhoprCAPA-1 and RhoprCAPA-
PK1, respectively. C, The peptide with MH+ at 1107.58 was selected for further fragmentation
experiments. Prominent y- and b-type fragments of ion signal 1107.58 are labeled, analyzed
manually, and the deduced sequence, an exact match to RhoprCAPA-2, is shown above the
labeled fragments. A comparison with the fragmentation pattern of the synthetic replicate of
RhoprCAPA-2 is depicted in the bottom half of C.
![Page 92: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/92.jpg)
78
![Page 93: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/93.jpg)
79
Figure 3. Genomic Southern blot using a RhoprCAPA cDNA fragment (12–687) as probe. Each
lane contains 2 µg of R. prolixus genomic DNA digested with restriction enzymes lacking
recognition sites over the length of the cDNA sequence used as a probe. DNA fragments were
electrophoresed, transferred onto a nylon membrane overnight, and hybridized with alkaline
phosphatase-labeled RhoprCAPA cDNA. Lanes 1–3: EcoRI, HindIII, and PstI, respectively.
![Page 94: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/94.jpg)
80
![Page 95: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/95.jpg)
81
Figure 4. RhoprCAPA developmental and spatial expression profile. A, Expression of the
RhoprCAPA gene assessed in each developmental stage from first- to fifth-instars and adults.
Primers were designed to generate a 413-bp fragment, which covered the majority of the coding
region and 3' UTR. B, RhoprCAPA gene expression in different R. prolixus fifth-instar tissues:
CNS, anterior midgut (AMG), posterior midgut (PMG), hindgut (HG), MT, dorsal vessel (DV),
testes (TST), and salivary glands (SG). Primers were chosen to amplify a 341-bp fragment,
which included the 5' UTR and a sizable region of the coding region of the precursor. For both
the developmental and spatial expression profile, Rhopr β-actin primers were designed to
amplify a 317-bp fragment to serve as a control for quality and integrity of RNA template.
![Page 96: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/96.jpg)
82
![Page 97: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/97.jpg)
83
Localization of RhoprCAPA gene expression using FISH
Full-length antisense DIG-labeled RNA probes were used to determine the spatial cell-specific
expression pattern of the RhoprCAPA gene in fifth-instar R. prolixus. RhoprCAPA gene
expression was observed in 26 cells of the CNS of starved fifth-instars (fed as fourth-instars 6–8
wk previously). In the brain, RhoprCAPA gene expression was detected in one bilateral pair of
lateral cells located dorsally in the border region of the optic lobe and brain (Figure 5A).
RhoprCAPA gene-expressing cells were also observed in the subesophageal ganglion (SOG;
Figure 5B). Here two pairs of cells are both located along the ventral midline of the SOG. These
pairs of cells differ substantially in size, with the more posterior pair of cells being much larger
(75 µm) than the anterior pair (35 µm). Additional cells were observed lying immediately
posterior of the esophageal foramen; however, these cells stained less intensely (Figure 5B).
Within the prothoracic ganglion, RhoprCAPA gene expression was detected in two bilateral pairs
of cells located centrally on the ventral surface (Figure 5C). The mesothoracic ganglionic mass
(MTGM) also contained cells positive for expression of the RhoprCAPA gene. Specifically,
three bilateral pairs of cells were observed on the ventral surface of the MTGM in the abdominal
neuromeres, with the most posterior pair of cells being larger in size ( 25 µm) relative to the two
anterior pairs of cells (15 µm) (Figure 5D). More anteriorly within the meso- and metathoracic
neuromere, another two pairs of cells demonstrated RhoprCAPA expression; however, these cells
were less intensely stained than the three pairs of cells mentioned earlier within the abdominal
neuromeres (Figure 5, D and E). To verify the specificity of the detection, control experiments
were carried out in parallel in which tissues were hybridized with sense-labeled probe, which did
not identify any cells (results not shown), thus demonstrating that the cells identified using
antisense probe are indeed expressing RhoprCAPA mRNA. In view of the fact that our RT-PCR
findings also demonstrated expression of RhoprCAPA within testes of fifth-instar males, FISH
techniques were again used to determine the localization of expression associated with this
tissue. Unlike the CNS, in which distinct cells were identified expressing the transcript, no
specific cell bodies were detected expressing the RhoprCAPA transcript in testes.
![Page 98: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/98.jpg)
84
Figure 5. RhoprCAPA transcript expression in dorsal brain (A), ventral SOG (B), ventral
prothoracic ganglion (C), and ventral MTGM (D) of R. prolixus fifth-instars. A, A single
bilateral pair of cells are situated in the border region between the optic lobe and brain proper.
Over the ventral surface of the SOG (B), two pairs of cells with prominent expression are
observed located medially and an additional three pairs of cells, which stained more weakly, are
observed just posterior of the esophageal foramen. C, Two small pairs of cells are observed lying
medially in the ventral surface of the prothoracic ganglion. D, The posterior segment of the
ventral MTGM contains three bilaterally paired RhoprCAPA-expressing cells within the
abdominal neuromeres. In the more anterior segment of the ventral MTGM (the meso- and
metathoracic neuromeres), two additional pairs of weakly stained cells are positive for
RhoprCAPA expression. E, Cells in the anterior region of the MTGM within the mesothoracic
neuromere that stained weakly for RhoprCAPA gene expression are shown at a higher
magnification. In A–D, arrows and arrowheads denote strong and weak RhoprCAPA-expressing
cells, respectively; in all figures. Scale bars, 100 µm.
![Page 99: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/99.jpg)
85
![Page 100: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/100.jpg)
86
Malpighian tubule fluid secretion assay and intracellular cGMP RIA
To confirm biological activity of the predicted anti-diuretic peptide from the RhoprCAPA gene,
RhoprCAPA-2, it was tested on 5-HT-stimulated MTs because unstimulated tubules in this
species secrete at very low levels (~0.1 nl/min; Te Brugge et al., 2002). RhoprCAPA-2 (1 µM)
significantly inhibited 5-HT-stimulated secretion by MTs (Figure 6A). RhoprCAPA-2
demonstrated a dose-dependent inhibition of 50 nM 5-HT-stimulated Malpighian tubule
secretion rate, with a threshold below the nanomolar range, maximal inhibition at a dose of 1 µM,
an IC50 of 4.16 nM, and 95% confidence interval of 0.88–19.77 nM (Figure 6B). Thus, as
predicted from the structural data, RhoprCAPA-2 indeed demonstrates potent anti-diuretic
activity on MTs stimulated with 5-HT. We then sought to confirm that RhoprCAPA-2 elevated
levels of intracellular cGMP in tubules stimulated by 5-HT. In agreement with previous reports
using M. sexta CAP2b or semipurified CNS extracts (Paluzzi and Orchard, 2006), 1 µM
RhoprCAPA-2 elevates levels of intracellular cGMP in Malpighian tubules stimulated with 50
nM 5-HT (Figure 6C).
![Page 101: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/101.jpg)
87
Figure 6. A, Inhibition of 5-HT (50 nM) stimulated secretion from MTs by the anti-diuretic
peptide, RhoprCAPA-2 (1 µM; EGGFISFPRV-NH2). B, Dose-dependent inhibition of 5-HT (50
nM) stimulated secretion from MTs by the anti-diuretic peptide, RhoprCAPA-2. Data fitted by
nonlinear regression using GraphPad Prism (version 3.02; San Diego, CA). The IC50 is 4.16 nM
with 95% confidence interval = 0.88–19.77 nM. Secretion by unstimulated tubules in saline
alone is very small (~0.1 nl/min; Te Brugge et al., 2002) and is not shown here. C, RhoprCAPA-
2 elevates levels of the intracellular messenger, cGMP, in tubules stimulated with 50 nM 5-HT.
Tubules receiving 50 nM 5-HT alone show a significant decrease in cGMP levels. Values are
mean ± SE for n = 8 (A), n = 8–20 (B), and n = 8–10 (C). In A, significant inhibition denoted by
*, where P < 0.0001, and in C, statistically different levels of cGMP from tubules treated with
saline alone are denoted by *, where P < 0.05.
![Page 102: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/102.jpg)
88
![Page 103: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/103.jpg)
89
Discussion
This is the first study to isolate and characterize a gene encoding neuropeptides in the species-
rich order, Hemiptera. The RhoprCAPA gene encodes three novel peptides from a single
prepropeptide, which, through posttranslational modification and processing, generates the
mature biologically active forms: RhoprCAPA-1 (SPISSVGLFPFLRA-NH2), RhoprCAPA-2
(EGGFISFPRV-NH2), and a third pyrokinin-related peptide, RhoprCAPA-PK1
(NGGGGNGGGLWFGPRL-NH2). The first gene encoding the peptide CAP2b in insects was
identified in the fruit fly, D. melanogaster and called capability (CAPA) owing to its clear ability
to encode neuropeptides belonging to the CAP2b family (Kean et al., 2002). Subsequently in the
hawk moth M. sexta, in which the original Leptidopteran CAP2b peptide was first sequenced
(Huesmann et al., 1995), the gene encoding two CAP2b-related peptides, Mas-CAPA-1 and -2,
as well as a pyrokinin (PK)-related peptide, Mas-PK-1, was isolated and sequenced (Loi and
Tublitz, 2004). Interestingly, the first two peptides encoded in analogous transcripts identified in
other species all share the PRV-NH2 C-terminal motif, whereas in R. prolixus, only the second
encoded peptide, RhoprCAPA-2, shares this motif; RhoprCAPA-1 contains a LRA-NH2 C-
terminal sequence. This is quite surprising, considering the amino acid sequence characteristics
of the CAP2b-related peptides recently identified in neurohemal organs of the more closely
related southern green stink bug, Nezara viridula (Predel et al., 2006). In this Hemipteran, the
two CAP2b-related peptides each contain the PRV-NH2 C terminus common to CAP2b-related
peptides found in other insects. The implications of this varied C terminus on the first encoded
peptide, RhoprCAPA-1, are at this time, unknown but will be pursued in future investigations
during which the physiological role of this unique peptide is studied. One could postulate,
however, that this peptide lacks any involvement in the cessation of diuresis because it is known
from previous studies (Quinlan et al., 1997; Paluzzi and Orchard, 2006) that CAP2b-related
peptides ending with a PRV-NH2 C terminus are anti-diuretic in R. prolixus.
In support of this prediction, structure-activity analysis in a Dipteran species, Musca domestica,
during which alanine-replacement CAP2b analogs were tested, showed that replacement of the
arginine or valine at the C terminus resulted in greatly reduced efficacy of diuretic activity on
MTs (Nachman and Coast, 2007). Moreover, the significant finding here, demonstrating
![Page 104: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/104.jpg)
90
expression associated with a peripheral source, the testes, suggests that one or more of the
RhoprCAPA peptides are involved in reproduction. It is worth emphasizing, though, that no cell
bodies expressing RhoprCAPA mRNA were detected in the testes. Testes samples assessed by
nonquantitative RT-PCR, however, required many more amplification cycles than did the CNS
samples (data not shown), indicating that RhoproCAPA expression in the testes is much lower
than that found in the CNS, so in situ hybridization may not be sufficiently sensitive to reveal low
expression levels in these immature reproductive tissues at this developmental stage. Thus, future
experiments investigating expression in other developmental stages such as adults, in which
reproductive tissues are fully developed, may reveal more clearly the source of this expression.
Alternatively, it is possible that RhoprCAPA expression detected in RT-PCR experiments may
originate in the axonal domain of abdominal nerves originating from the MTGM, in which
extensive CAP2b-like immunoreactivity has been recently identified (Paluzzi and Orchard,
2006). This would not be unusual because it is now well established that many RNA species,
including those encoding neuropeptides, are localized to the axonal domain in addition to the cell
bodies in both vertebrates and invertebrates (Van Minnen et al., 1988; 1989; Van Minnen, 1994;
Mohr and Richter, 2000; Barth and Grossmann, 2000; Garside et al., 2002; Lee and Hollenbeck,
2003). Nonetheless, the identification of cell bodies expressing the RhoprCAPA gene within the
CNS is consistent with previously identified cells bodies expressing CAP2b-related peptides in R.
prolixus (Paluzzi and Orchard, 2006) and other insects (for review see Predel and Wegener,
2006). For R. prolixus, all of the cells expressing the RhoprCAPA gene revealed
immunohistochemical staining for CAP2b-related peptides except the cells localized within the
PRO. These were not identified in previous studies and may contain peptides that are not
immunologically detected using the antibody or may not undergo the appropriate processing
steps to produce the mature peptides.
The occurrence of a varied C terminus on RhoprCAPA-1 suggests that RhoprCAPA-1 and
RhoprCAPA-2 could facilitate their effects via unique receptors. Two independent studies have
shown in D. melanogaster that DroCAPA-1 and DroCAPA-2, which share the PRV-NH2 C
terminus, activate the same G protein-coupled receptor (GPCR) coded by the gene CG14575
(AF522193/AF505865) and with similar affinities (Iversen et al., 2002; Park et al., 2002).
However, the third CAPA peptide, DroPK-1, has its own unique GPCR coded by the D.
melanogaster gene CG9918 (AF368273), which does not bind the CAP2b-related peptides
![Page 105: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/105.jpg)
91
(Cazzamali et al., 2005). With the completion of sequencing and annotation of the R. prolixus
genome in the near future, the database will serve as a tremendous tool to identify candidate
GPCRs for many of the peptides and additional factors that are involved in diuresis and other
feeding-related behaviors. Similar to studies carried out with Dipteran counterparts, expression
and affinity analyses to determine natural ligands will be necessary, as will tissue and cell-
specific expression studies, to determine target tissues of these peptides.
In Dipterans, CAP2b-related peptides stimulate secretion through a pathway involving a nitric
oxide-dependent soluble guanylate cyclase (Davies et al., 1997; Broderick et al., 2003).
Interestingly, both CAP2b and ADF peptides inhibit secretion and elevate levels of cGMP but in
a nitric oxide-independent manner (Eigenheer et al., 2002; Quinlan et al., 1997; Paluzzi and
Orchard, 2006). Here we show that RhoprCAPA-2 has potent anti-diuretic activity inhibiting
secretion and elevating levels of intracellular cGMP in MTs stimulated with the diuretic
hormone, 5-HT. It remains to be seen whether this in vitro activity can be confirmed in vivo. Our
future studies will focus on elucidating the target sites and physiological significance and
deducing the signal transduction pathways involved. For example, it is known that levels of
cGMP increase in MTs stimulated with CAP2b-related peptides (Quinlan et al., 1997; Paluzzi
and Orchard, 2006); however, the source of this increase, a membrane-bound or atypical
guanylate cyclase, is not known. In other insects, CAP2b-related peptides influence the activity
of other tissues, such as the dorsal vessel (heart) in Lepidoptera and Diptera (Huesmann et al.,
1995), and in addition, other myostimulatory effects have been demonstrated in several visceral
muscle preparations in Blattaria (Predel et al., 2001). Studies conducted on Blattarian species
have identified a number of CAPA orthologs termed the periviscerokinins (PVKs), which have
been shown to exert myotropic effects on a number of different visceral tissues in insects
(reviewed in Predel and Wegener, 2006). The designation as a PVK reflects the high abundance
of these orthologs observed within the abdominal perivisceral/neurohemal organ systems of some
insects (Predel and Wegener, 2006); however, in R. prolixus (Paluzzi and Orchard, 2006) and
similarly in other species (Kean et al., 2002; Loi and Tublitz, 2004), these peptides are also
associated with other neurohemal regions; thus, we avoid the PVK nomenclature.
The availability of the synthetic RhoprCAPA peptides should help in the determination of the
physiological relevance of these neuropeptides. A comparison across Insecta reveals that these
![Page 106: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/106.jpg)
92
peptides have evolved unique and remarkably opposite functions: stimulation vs. inhibition of
secretion by MTs. Here our results also suggest a novel function for these peptides, a role in
sexual maturation or reproduction, because expression of the RhoprCAPA gene was localized to
the testes. In addition, the identification of the native peptide, RhoprCAPA-2, which inhibits the
rapid diuresis in this disease vector, may guide future studies focused on development of mimetic
analogs (Nachman et al., 1993; 1995; 2002; Taneja-Bageshwar et al., 2008) for use in novel pest
management strategies for interrupting the transmission of Chagas’ disease, which takes place as
a result of the rapid diuresis after blood gorging.
![Page 107: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/107.jpg)
93
References
Barth, S. and Grossmann, R. (2000). Localization of arginine vasotocin (AVT) mRNA in
extrasomal compartments of magnocellular neurons in the chicken hypothalamo-
neurohypophysial system. Comp. Biochem. Physiol. Part B: Biochem Mol Bio 125, 189-
195.
Bendtsen, J. D., Nielsen, H., von Heijne, G. and Brunak, S. (2004). Improved prediction of
signal peptides: SignalP 3.0. J. Molecular Biology 340, 783-795.
Broderick, K., MacPherson, M., Regulski, M., Tully, T., Dow, J. T. and Davies, S. (2003).
Interactions between epithelial nitric oxide signaling and phosphodiesterase activity in
Drosophila. Am J Physiol Cell Physiol 285, C1207-1218.
Cazzamali, G., Torp, M., Hauser, F., Williamson, M. and Grimmelikhuijzen, C. J. P.
(2005). The Drosophila gene CG9918 codes for a pyrokinin-1 receptor. Biochem.
Biophys. Res. Commun. 335, 14-19.
Coast, G. (2007). The endocrine control of salt balance in insects. Gen. Comp. Endo. 152, 332-
338.
Coast, G. M., Orchard, I., Phillips, J. E. and Schooley, D. A. (2002). Insect diuretic and anti-
diuretic hormones. In Advances in Insect Physiology, pp. 279-409: Academic Press.
Davies, S. A., Stewart, E. J., Huesmann, G. R., Skaer, N. J. V., Maddrell, S. H. P., Tublitz,
N. J. and Dow, J. A. T. (1997). Neuropeptide stimulation of the nitric oxide signaling
pathway in Drosophila melanogaster Malpighian tubules. American Journal of
Physiology-Regulatory Integrative and Comparative Physiology 42, R823-R827.
de Decker, N., Hayes, T. K., Vankerkhove, E. and Steels, P. (1994). Stimulatory and
inhibitory effects of endogenous factors in head extracts of Formica polyctena
(Hymenoptera) on the fluid secretion of Malpighian tubules. J. Insect Physiol. 40, 1025-
1036.
Eigenheer, R. A., Wiehart, U. M., Nicolson, S. W., Schoofs, L., Schegg, K. M., Hull, J. J.
and Schooley, D. A. (2003). Isolation, identification and localization of a second beetle
anti-diuretic peptide. Peptides 24, 27-34.
![Page 108: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/108.jpg)
94
Eigenheer, R., Nicolson, S., Schegg, K., Hull, J. J. and Schooley, D. (2002). Identification of a
potent anti-diuretic factor acting on beetle Malpighian tubules. Proceedings of the
National Academy of Sciences 99, 84-89.
Feliciangeli, M. D., Carrasco, H., Patterson, J. S., Suarez, B., Martinez, C. and Medina, M.
(2004). Mixed domestic infestation by Rhodnius prolixus Stal, 1859 and Panstrongylus
geniculatus latreille, 1811, Vector incrimination, and seroprevalence for Trypanosoma
cruzi among inhabitants in El Guamito, Lara State, Venezuela. Am. J. Trop. Med. Hyg.
71, 501-505.
Garside, C. S., Koladich, P. M., Bendena, W. G. and Tobe, S. S. (2002). Expression of
allatostatin in the oviducts of the cockroach Diploptera punctata. Insect Biochemistry and
Molecular Biology 32, 1089-1099.
Huesmann, G. R., Cheung, C. C., Loi, P. K., Lee, T. D., Swiderek, K. M. and Tublitz, N. J.
(1995). Amino acid sequence of CAP2b, an insect cardioacceleratory peptide from the
tobacco hawkmoth Manduca sexta. FEBS Lett. 371, 311-314.
Hughes, S. C. and Krause, H. M. (1998). Double labeling with fluorescence in situ
hybridization in Drosophila whole-mount embryos. BIOTECHNIQUES 24, 530-532.
Iversen, A., Cazzamali, G., Williamson, M., Hauser, F. and Grimmelikhuijzen, C. J. P.
(2002). Molecular cloning and functional expression of a Drosophila receptor for the
neuropeptides capa-1 and -2. Biochem. Biophys. Res. Commun. 299, 628.
Kean, L., Cazenave, W., Costes, L., Broderick, K. E., Graham, S., Pollock, V. P., Davies, S.
A., Veenstra, J. A. and Dow, J. A. T. (2002). Two nitridergic peptides are encoded by
the gene capability in Drosophila melanogaster. Am J Physiol Regul Integr Comp
Physiol 282, R1297-1307.
Lavigne, C., Embleton, J., Audy, P., King, R. R. and Pelletier, Y. (2001). Partial purification
of a novel insect anti-diuretic factor from the Colorado potato beetle, Leptinotarsa
decemlineata (Say) (Coleoptera: Chrysomelidae), which acts on Malpighian tubules.
Insect Biochemistry and Molecular Biology 31, 339-347.
Lecuyer, E., Parthasarathy, N. and Krause, H. (2008). Fluorescent in situ hybridization
protocols in Drosophila embryos and tissues. Methods in molecular biology 420, 289.
![Page 109: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/109.jpg)
95
Lee, S. and Hollenbeck, P. (2003). Organization and translation of mRNA in sympathetic
axons. J Cell Sci 116, 4467-4478.
Loi, P. K. and Tublitz, N. J. (2004). Sequence and expression of the CAPA/CAP2b gene in the
tobacco hawkmoth, Manduca sexta. J. Exp. Biol. 207, 3681-3691.
Maddrell, S. H. (1963). Excretion in blood-sucking bug, Rhodnius prolixus Stal .1. Control of
diuresis. J. Exp. Biol. 40, 247-256.
Maddrell, S. H. (1964). Excretion in blood-sucking bug Rhodnius prolixus Stal .3. Control of
release of diuretic hormone. J. Exp. Biol. 41, 459-472.
Maddrell, S., Herman, W., Mooney, R. and Overton, J. (1991). 5-Hydroxytryptamine: A
second diuretic hormone in Rhodnius prolixus. J Exp Biol 156, 557-566.
Mohr, E. and Richter, D. (2000). Axonal mRNAs: Functional significance in vertebrates and
invertebrates. Journal of Neurocytology 29, 783-791.
Monroy, C., Rodas, A., Mejia, M., Rosales, R. and Tabaru, Y. (2003). Epidemiology of
Chagas disease in Guatemala: Infection rate of Triatoma dimidiata, Triatoma nitida and
Rhodnius prolixus (Hemiptera, Reduviidae) with Trypanosoma cruzi and Trypanosoma
rangeli (Kinetoplastida, Trypanosomatidae). Mem. Inst. Oswaldo Cruz 98, 305-310.
Nachman, R. J., Holman, G. M. and Haddon, W. F. (1993). Leads for insect neuropeptide
mimetic development. Arch. Insect Biochem. Physiol. 22, 181.
Nachman, R. J., Roberts, V. A., Holman, G. M. and Beier, R. C. (1995). Pseudodipeptide
analogs of the pyrokinin/PBAN (FXPRLa) insect neuropeptide family containing
carbocyclic pro-mimetic conformational components. Regul. Pept. 57, 359.
Nachman, R. J., Russell, W. K., Coast, G. M., Russell, D. H. and Predel, R. (2005). Mass
spectrometric assignment of Leu/Ile in neuropeptides from single neurohemal organ
preparations of insects. Peptides 26, 2151-2156.
Nachman, R., Zabrocki, J., Olczak, J., Williams, H., Moyna, G., Scott, A. I. and Coast, G.
(2002). Cis-peptide bond mimetic tetrazole analogs of the insect kinins identify the active
conformation. Peptides 23, 709.
![Page 110: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/110.jpg)
96
Nachman, R. and Coast, G. (2007). Structure-activity relationships for in vitro diuretic activity
of CAP2b in the housefly. Peptides 28, 57-61.
Orchard, I. (2006). Serotonin: A coordinator of feeding-related physiological events in the
blood-gorging bug, Rhodnius prolixus. Comparative Biochemistry and Physiology A-
Molecular & Integrative Physiology 144, 316-324.
Paluzzi, J. P. and Orchard, I. (2006). Distribution, activity and evidence for the release of an
anti-diuretic peptide in the kissing bug Rhodnius prolixus. J. Exp. Biol. 209, 907-915.
Park, Y., Kim, Y. and Adams, M. E. (2002). Identification of G protein-coupled receptors for
Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-
receptor coevolution. Proc. Natl. Acad. Sci. U. S. A. 99, 11423-11428.
Petzel, D. and Conlon, J. M. (1991). Evidence for an anti-diuretic factor affecting fluid
secretion in mosquito Malpighian tubules. Faseb Journal 5, A1059-A1059.
Predel, R., Russell, W. K., Neupert, S., Russell, D. H., Esquivel, J. F. and Nachman, R. J.
(2006). Identification of the first neuropeptides from the CNS of Hemiptera: CAPA
peptides of the southern green stinkbug Nezara viridula (L.). Peptides 27, 2670-2677.
Predel, R., Nachman, R. J. and Gade, G. (2001). Myostimulatory neuropeptides in
cockroaches: Structures, distribution, pharmacological activities, and mimetic analogs. J.
Insect Physiol. 47, 311-324.
Predel, R. and Wegener, C. (2006). Biology of the CAPA peptides in insects. Cellular and
molecular life sciences 63, 2477.
Quinlan, M., Tublitz, N. and O'Donnell, M. (1997). Anti-diuresis in the blood-feeding insect
Rhodnius prolixus Stal: The peptide CAP2b and cyclic GMP inhibit Malpighian tubule
fluid secretion. J Exp Biol 200, 2363-2367.
Rabinovich, J. E. and Himschoot, P. (1990). A population-dynamics simulation-model of the
main vectors of Chagas-disease transmission, Rhodnius prolixus and Triatoma infestans.
Ecol. Model. 52, 249-266.
Ramsey, J. M., Ordonez, R., Cruz-Celis, A., Alvear, A. L., Chavez, V., Lopez, R., Pintor, J.
R., Gama, F. and Carrillo, S. (2000). Distribution of domestic Triatominae and
![Page 111: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/111.jpg)
97
stratification of Chagas disease transmission in Oaxaca, Mexico. Med. Vet. Entomol. 14,
19-30.
Saunders, C. and Cohen, R. S. (1999). Double FISH and FISH-fluorescence
immunolocalization procedures for whole-mount Drosophila ovaries. Biotechniques 26,
186-188.
Spring, J. H., Morgan, A. and Hazelton, S. R. (1988). A novel target for anti-diuretic hormone
in insects. Science 241, 1096-1098.
Taneja-Bageshwar, S., Strey, A., Kaczmarek, K., Zabrocki, J., Pietrantonio, P. V. and
Nachman, R. J. (2008). Comparison of insect kinin analogs with cis-peptide bond, type
VI-turn motifs identifies optimal stereochemistry for interaction with a recombinant
arthropod kinin receptor from the southern cattle tick Boophilus microplus. Peptides 29,
295.
Te Brugge, V. A., Lombardi, V. C., Schooley, D. A. and Orchard, I. (2005). Presence and
activity of a Dippu-DH31-like peptide in the blood-feeding bug, Rhodnius prolixus.
Peptides 26, 29-42.
Te Brugge, V. A., Miksys, S. M., Coast, G. M., Schooley, D. A. and Orchard, I. (1999). The
Distribution of a CRF-like diuretic peptide in the blood-feeding bug Rhodnius prolixus. J.
Exp. Biol. 202, 2017-2027.
Te Brugge, V. A., Schooley, D. A. and Orchard, I. (2002). The biological activity of diuretic
factors in Rhodnius prolixus. Peptides 23, 671-681.
Van Minnen, J. (1994). RNA in the axonal domain – a new dimension in neuronal functioning.
The Histochemical Journal 26, 377.
Van Minnen, J., Smit, A. B. and Joosse, J. (1989). Central and peripheral expression of genes-
coding for egg-laying inducing and insulin-related peptides in a snail. Arch. Histol. Cytol.
52, 241-252.
Van Minnen, J., Vanderhaar, C., Raap, A. K. and Vreugdenhil, E. (1988). Localization of
ovulation hormone-like neuropeptide in the central nervous system of the snail Lymnaea
stagnalis by means of immunocytochemistry and in situ hybridization. Cell Tissue Res.
251, 477-484.
![Page 112: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/112.jpg)
98
Wiehart, U. I. M., Nicolson, S. W., Eigenheer, R. A. and Schooley, D. A. (2002). Antagonistic
control of fluid secretion by the Malpighian tubules of Tenebrio molitor: Effects of
diuretic and anti-diuretic peptides and their second messengers. J Exp Biol 205, 493-501.
Wilkins, M. R., Lindskog, I., Gasteiger, E., Bairoch, A., Sanchez, J. C., Hochstrasser, D. F.
and Appel, R. D. (1997). Detailed peptide characterization using PEPTIDEMASS – a
World-Wide-Web-Accessible Tool. Electrophoresis 18, 403-408.
![Page 113: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/113.jpg)
99
Acknowledgments
This work was supported by a Natural Sciences and Engineering Research Council of Canada
discovery grant (to I.O.) and in part by Grant 0500-32000-001-01R from the Department of
Agriculture/Department of Defense Deployed War Fighter Protection (DWFP) Initiative (R.J.N.)
and Collaborative Research Grant LST.CLG.979226 from the North Atlantic Treaty
Organization to (R.J.N.).
![Page 114: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/114.jpg)
100
Copyright Acknowledgments
The preceeding chapter was reproduced / adapted with permission from The Endocrine Society.
Full citation details:
Isolation, cloning, and expression mapping of a gene encoding an anti-diuretic hormone and other CAPA-related peptides in the disease vector, Rhodnius prolixus. Paluzzi JP, Russell WK, Nachman RJ, Orchard I. Endocrinology. 2008 Sep;149(9):4638-46. Epub 2008 May 29. doi:10.1210/en.2008-0353
Copyright 2008, The Endocrine Society
![Page 115: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/115.jpg)
101
Chapter 4:
A second gene encodes the anti-diuretic hormone in the insect,
Rhodnius prolixus
![Page 116: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/116.jpg)
102
Abstract
In the haematophagous insect, Rhodnius prolixus, a rapid diuresis following engorgement of
vertebrate blood is under the control of two main diuretic hormones: a corticotropin-releasing
factor (CRF)-related peptide and serotonin (5-HT). A CAP2b (CAPA)-related peptide is
involved in the termination of this diuresis, and we have recently identified a gene, now referred
to as RhoprCAPA-α, encoding CAPA peptides in R. prolixus. Here we identify a second gene,
RhoprCAPA-β, which also encodes CAPA peptides and characterize its expression in fifth-instar
and adults. The RhoprCAPA-β gene is more highly expressed in the CNS than the RhoprCAPA-
α gene, but neither gene is expressed in other tested adult tissues. Both genes are expressed in a
subset of immunoreactive neurons identified using an antisera which recognizes CAP2b-related
peptides. The expression of each paralog is modified by feeding and we propose this to be a
result of requirements of anti-diuretic regulation during salt and water homeostasis.
![Page 117: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/117.jpg)
103
Introduction
Insect diuresis and anti-diuresis typically involves hormonal control of the excretory system,
which includes the Malpighian tubules (MTs) and hindgut (Coast et al., 2002). Specifically,
diuresis is induced by stimulating fluid secretion by the MTs, using peptidergic hormones, and/or
biogenic amines, such as serotonin (5-hydroxytryptamine or 5-HT). In contrast, it has been
demonstrated that anti-diuresis involves fluid reabsorption by the hindgut, whereby essential
salts and water are retrieved, and in some cases a concurrent decrease in action of diuretic
hormones on the MTs. In the blood-feeding reduviid bug, Rhodnius prolixus, there are extended
periods of starvation between successful foraging events in search of an appropriate vertebrate
blood meal. It is well documented that the rapid diuresis in R. prolixus following blood gorging
involves stimulation of MTs by a peptidergic hormone, likely related to corticotropin-releasing
factor (CRF) peptides identified in other insects, and the amine, 5-HT, acting via cAMP
(Maddrell et al., 1993; Lange et al., 1989; Te Brugge et al., 1999; Te Brugge and Orchard, 2002).
In R. prolixus, the anterior midgut (or crop) also plays an essential role in the rapid diuresis
following gorging on a blood meal. The excess salt and water, derived from the plasma portion
of the blood meal, is absorbed into the haemolymph, for subsequent elimination by the MTs,
while the nutritive red blood cell-containing component is stored for eventual digestion.
Serotonin and a CRF-related peptide have also been shown to increase the cAMP levels and
increase absorption by the anterior midgut (Te Brugge et al., 2009).
It was earlier believed that the cessation of diuresis in R. prolixus was the result of decreased
titres of diuretic hormones. Studies by Quinlan et al. (1997) and Quinlan and O’Donnell (1998),
however, suggested that a unique anti-diuretic mechanism might exist in this haematophagous
insect, revealed by the physiological response to exogenously applied Manduca sexta
cardioacceleratory peptide 2b (ManseCAP2b). This peptide inhibits MTs fluid secretion
stimulated by 5-HT (Quinlan et al., 1997), with the intracellular second messenger, cGMP,
possibly playing a role (Quinlan and O’Donnell, 1998; Orchard, 2006). More recently, we
identified the endogenous CAP2b-related peptide in R. prolixus central nervous system (CNS)
that inhibits MT secretion stimulated by 5-HT (Paluzzi and Orchard, 2006; Paluzzi et al., 2008).
In addition, this peptide, RhoprCAPA-α2, also abolishes the decrease in cGMP levels in MTs
stimulated with 5-HT, suggesting that cGMP may be involved in the anti-diuretic effect observed
![Page 118: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/118.jpg)
104
in MTs. Interestingly, RhoprCAPA-α2 also abolishes the 5-HT-stimulated increase in absorption
by the anterior midgut (Orchard and Paluzzi, 2009).
CAP2b-related peptides have also been referred to as periviscerokinins (PVKs) since they are the
most abundant peptide class in the abdominal perivisceral neurohemal system in many insects
and have myotropic effects on visceral muscle such as the heart and gut (for a review, see Predel
and Wegener, 2006). The first genes encoding CAP2b and CAP2b-related peptides, called
capability (CAPA) genes, were identified in Drosophila melanogaster (Kean et al., 2002) and
later in M. sexta (Loi and Tublitz, 2004). These genes each encode two CAP2b-related peptides
and a pyrokinin peptide. With the increase in insect genome projects completed or in progress,
homologous genes have been annotated in other genera such as several Dipteran, Lepidopteran,
and Coleopteran species. In addition, we have observed homologous CAPA genes encoding
CAP2b-related peptides in other organisms such as the human body louse, Pediculus humanus
corporis (EEB10638) and aphids, Acyrthosiphon pisum (XP_001946149) and Myzus persicae
(EE570800.1). Recently it was demonstrated that the CAP2b-related peptides in Bombyx mori
were produced by a single gene, which can undergo alternative splicing to produce an extended
pyrokinin peptide (Roller et al., 2008), although the distribution of these variant peptides within
the CNS has yet to be established.
The RhoprCAPA gene in fifth-instar R. prolixus is expressed primarily in the CNS, consistent
with previous immunological identification of cells containing CAP2b-related peptides (Paluzzi
and Orchard, 2006; Paluzzi et al., 2008), although expression was also observed in immature
male reproductive tissue (Paluzzi et al., 2008). Here, we present data demonstrating that a
second, closely related gene exists in this haematophagous insect and we characterize the
expression levels of these paralogs in fifth-instar and adult insects. In the spatial analysis, we
compare expression levels of each paralog in several different tissues and also examine the
expression level distribution within the CNS. In the temporal analysis we investigate expression
levels over a period of several hours and also over a few weeks following feeding, which we
term as a micro- and macro-temporal time-scale, respectively. Using a combined
immunohistochemical and in situ hybridization approach, we have localized neurons containing
CAP2b-related peptides, and have verified that a considerable subset of these immunopositive
neurons express one or both RhoprCAPA gene paralogs. We rename the first identified paralog
![Page 119: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/119.jpg)
105
gene as RhoprCAPA-α, since this will avoid confusion in future comparison with the second
RhoprCAPA paralog gene, RhoprCAPA-β, identified herein.
![Page 120: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/120.jpg)
106
Materials & Methods
Animals
Fifth-instar R. prolixus Stål were reared at high relative humidity in incubators at 25 °C and
routinely fed on rabbits’ blood. Tissues were dissected from insects under physiological saline
prepared as described previously (Paluzzi et al., 2008) in nuclease-free water.
Screening of fifth-instar CNS cDNA library
A cDNA library from the CNS of fifth-instar R. prolixus (Paluzzi et al., 2008) was screened
using a modified rapid amplification of cDNA ends (RACE) PCR approach. A series of gene-
specific primers (gsp) were designed, based on several initial clones identified during the
isolation of the RhoprCAPA-α gene, and used in combination with the pDNR-LIB plasmid
primers described previously (Paluzzi et al., 2008). These partial cDNA clones although similar,
demonstrated consistent differences from the RhoprCAPA-α gene and thus were pursued in this
study. Amplified fragments were isolated and cloned using the pGEM-T Easy Vector System
(Promega, Madison, WI). Sequencing was carried out at the Centre for Applied Genomics at the
Hospital for Sick Children (MaRS Centre, Toronto, Ontario, Canada), and sequences were
confirmed from several independent clones to ensure base accuracy and differentiate between the
previously identified RhoprCAPA-α gene.
Sequence analysis of RhoprCAPA-β prepropeptide
The deduced RhoprCAPA-β prepropeptide sequence was analyzed for potential processing in the
secretory pathway using online software for signal peptide prediction (SignalP 3.0; Bendtsen et
al., 2004). To confirm the processing and presence of the RhoprCAPA-β peptides, CNS material
was fractionated by RP-HPLC (as described previously, Paluzzi et al., 2008) and collected
fractions were analyzed by mass spectrometry at the Toronto Integrative Proteomics Lab
(Ontario Cancer Biomarker Network, Toronto, ON) and The Advanced Protein Technology
![Page 121: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/121.jpg)
107
Centre (Hospital for Sick Children, Toronto, ON). The two RhoprCAPA prepropeptide
sequences (RhoprCAPA-α, ABS17680; RhoprCAPA-β, ACH70295) and homologs from several
insects (D. melanogaster, AAF56969; Anopheles gambiae, EAL41227; Aedes aegypti,
EAT43089; B. mori, NP_001124357 and AB362228.1; M. sexta, AAT69684; A. pisum,
XP_001946149; M. persicae, EE570800.1; P. humanus corporis, EEB10638; Tribolium
castaneum, GLEAN_08429) were compared using ClustalX (Larkin et al., 2007) and the final
figure prepared using the BOXSHADE 3.21 server
(http://www.ch.embnet.org/software/BOX_form.html). The prepropeptide sequence alignment
was used to produce a phylogenetic tree prepared in MEGA 4.02 using either the neighbor-
joining or parsimony method and bootstrapping with 1000 iterations (Tamura et al., 2007). A
putative CAPA/PVK prepropeptide consensus sequence from the Arachnid, Ixodes scapularis,
was generated from EST data (EW933575.1) and included in the analysis and imposed as the
outgroup.
Northern blot hybridization
Tissues of adult R. prolixus were dissected in nuclease-free PBS and stored at −20 °C in
RNAlater reagent (Ambion, Austin, TX). Total RNA was isolated using the SV Total RNA
Isolation System (Promega, Madison, WI). Once purified, 1 µg of total RNA from each tissue
(anterior midgut; posterior midgut; salivary gland; hindgut; dorsal vessel (DV), fat body and
diaphragm; MTs; testis; and CNS) was prepared with 2× RNA loading dye (Fermentas,
Burlington, ON) and denatured at 75 °C for 5 min and subsequently cooled on ice. The samples
were then run at 5 V/cm on a 1–2% formaldehyde-agarose gel (20 mM MOPS, 5 mM NaOAc,
10 mM EDTA, pH 7.0, 2.2 M formaldehyde) that was precast and allowed to set for at least 1 h.
Once RNA samples were appropriately separated, as determined by brief visualization under UV
transilluminator, gels were rinsed for 30–40 min in nuclease-free water to remove excess
formaldehyde. Gels were then prepared for downward capillary transfer to positively charged
nylon membranes (Roche Applied Science, Laval, QC). Transfer was carried out with 20× SSC
for 12–16 h and blots were then briefly rinsed (<10 s) in nuclease-free water to remove excess
SSC. Blots were then transferred onto dampened blotting paper for UV crosslinking at a setting
of 30 mJ/cm2 (UVP CL-1000, Upland, CA). The blots were then allowed to air-dry for 3–4 h and
![Page 122: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/122.jpg)
108
stored at 4 °C in a sealed plastic bag until used in hybridization. Digoxigenin (DIG)-labelled
RNA anti-sense probes were prepared for each paralog following methods described previously
(Paluzzi et al., 2008). Briefly, using CNS cDNA as template, PCR was used to generate a 713 bp
RhoprCAPA-α fragment using the sense primer, CAPAalpha_GSPfor (5′-
GCATGCGACATTGTTTTTTC-3′) and a 703 bp RhoprCAPA-β fragment using the sense
primer, CAPAbeta_GSPfor (5′-GCATGCGACATTTTTGACC-3′). Both fragments utilized the
same anti-sense primer, CAPArev1 (5′-ATGAAAAGGCACATTTATTGTATGC-3′), designed
over a region with no difference in sequence between the two paralogs. For analysis of RNA
quality and quantity, a fragment specific for actin 5c (beta-actin, FJ851423.1) was generated
using the sense primer, actin_GSPfor (5′-ACTAACTGGGACGACATGG-3′) and anti-sense
primer, actin_GSPrev (5′-GTGGCCATTTCCTGTTC-3′). These products were ligated into the
pGEM-T Easy vector and the directionality of the insert was confirmed via sequencing (as
described above) in order to use the appropriate RNA polymerase (SP6/T7) for in vitro
transcription. Plasmid miniprep DNA for each clone was then linearized using a restriction
enzyme cutting the vector on the 3′ end of the anti-sense strand in order to generate anti-sense-
labeled RNA probes.
Fluorescent in situ hybridization and immunohistochemistry
Cell-specific transcript expression was localized in adult CNS as described previously for fifth-
instars (Paluzzi et al., 2008) with the following changes and adaptations. To reduce non-specific
background staining associated with endogenous peroxidase activity, tissues were incubated in a
1% H2O2 phosphate-buffered saline for 10 min at room temperature following initial tissue
fixation in 4% paraformaldehyde. Following this endogenous peroxidase quenching step, tissues
were washed five times with PBS and 0.1% Tween 20 (PBT) and subsequently incubated in 4%
Triton X-100 (Sigma–Aldrich, Oakville, Ontario, Canada) in PBT for 1 h at room temperature.
The detergent containing buffer was then removed and tissues washed for approximately 30 min
in PBT changing the wash solution every 5 min. The remainder of the in situ hybridization was
carried out as previously described. DIG-labeled RNA probes were prepared as described in the
northern hybridization methods section (see above). For control treatments, restriction enzymes
cutting on the 3′ end of the sense strand were used to generate sense-labeled RNA probe.
![Page 123: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/123.jpg)
109
Following the in situ preparations, tissues were briefly observed under a Nikon epifluorescence
microscope in PBS and were then processed for immunohistochemical localization of CAPA-
related peptides using an antisera described previously (Paluzzi and Orchard, 2006), identifying
peptides containing the C-terminal motif, PRX-amide (where X = I, L, M or V; Žitnaň et al.,
2003). Subsequent incubations were carried out with preparations protected from light exposure
in order to minimize photo-bleaching of in situ hybridization red–orange-fluorescent Alexa
Fluor® 568 (Molecular Probes, Eugene, OR). Since tissues had already been digested for the in
situ preparation, tissues were treated directly with antisera that had been preincubated overnight
at 4 °C in PBS containing 0.4% Triton X-100, 2% bovine serum albumin and 2% normal sheep
serum. This incubation with the primary antisera (1:500) was carried out for 36–48 h at 4 °C
with gentle shaking on a flat bed shaker and tissues were then washed in PBS for a minimum of
6 h at room temperature on a rocking platform. To detect immunolocalization of PRX-amide-
related peptides, FITC-conjugated goat anti-rabbit IgG (BioCan Scientific, Mississauga, ON)
was used at a dilution of 1:200 in PBS containing 10% normal goat serum and preparations were
incubated overnight at 4 °C. The following day, tissues were washed for approximately 2 h at
room temperature changing PBS every 15 min. Tissues were then mounted onto slides in
glycerol and viewed under a laser scanning confocal microscope equipped with a helium-neon
(543 nm line) and Argon laser (488 nm line) for excitation of Alexa Fluor 568 and FITC
fluorescent molecules, respectively. Images were acquired using LSM Image browser software
(LSM 510; Zeiss, Jena, Germany).
Reverse transcriptase quantitative PCR (RT-qPCR) analysis of RhoprCAPA paralog
expression
Tissues were dissected in nuclease-free PBS and stored in RNAlater reagent (Ambion, Austin,
TX). Total RNA was extracted as described above for northern analysis and 100 ng of total RNA
was used as template for first-strand cDNA synthesis using the RevertAid™ H Minus M-MuLV
Reverse Transcriptase and supplied oligo(dT)18 primer (Fermentas, Burlington, ON). Tissues for
temporal expression analysis were staged from the end of a 15 min feeding regime on
defibrinated rabbits blood (time = zero). For the micro-temporal analysis, CNS from six insects
of either sex were dissected within 5 min of each time-point, which consisted of insects
![Page 124: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/124.jpg)
110
immediately prior to feeding (unfed), immediately following feeding (time = 0) and 1, 2, 3, 4, 5,
6, 7 and 8 h post-feeding. For the macro-temporal analysis, CNS tissues from six insects were
dissected at each time-point (at the same time of day, approximately 09:00 ± 0:30), which
consisted of insects immediately prior to feeding (unfed), immediately following feeding
(time = 0) and 4, 7, 11, 14, 18, 21, 25, 28 and 32 days post-feeding. Insects were fed as fifth-
instars in both micro- and macro-temporal analyses; however in the latter, insects dissected at 21
days post-feeding and beyond were adult stage insects that had ecdysed at 19–20 days post-
feeding. For spatial expression quantitative analyses, tissues were dissected from fifth-instar or
adult stage insects of the same age since the last blood meal (approximately 5–6 weeks).
Quantitative PCR (qPCR) analyses were carried out on a Mx4000® Multiplex Quantitative PCR
System (Stratagene, La Jolla, CA) using the Maxima™ SYBR Green qPCR Master Mix
(Fermentas, Burlington, ON). Primers were optimized to amplify target fragments of similar size
across all experimental (RhoprCAPA paralogs) and housekeeping control genes (rp49 and actin
5c). In addition, each primer set consisted of at least one primer designed over an exon–exon
splice boundary to ensure target amplification was solely cDNA synthesized from the RNA
isolation. Primers utilized were as follows: RhoprCAPA-α, sense CAPAalpha_GSPfor (5′-
GCATGCGACATTGTTTTTTC-3′) and anti-sense CAPAalpha_qPCRrev (5′-
CGCTTGTTTTTGTCATCACC-3′); RhoprCAPA-β, sense CAPAbeta_GSPfor (5′-
GCATGCGACATTTTTGACC-3′) and anti-sense CAPAbeta_qPCRrev (5′-
TCGTTTGTATTTGTCATCACCG-3′); RhoprRP49, sense rp49_qPCRfor (5′-
GTGAAACTCAGGAGAAATTGGC-3′) and anti-sense rp49_qPCRrev (5′-
AGGACACACCATGCGCTATC-3′); RhoprACTIN-5C, sense actin_qPCRfor (5′-
AGAGAAAAGATGACGCAGATAATGT-3′) and anti-sense actin_qPCRrev (5′-
GTTCGGCTGTGGTGATGA-3′). Cycling conditions for qPCR utilized a typical three-step
protocol as follows: initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for
15 s, annealing at 60°C for 30 s and extension at 72°C for 30 s with data acquisition during the
extension step. To validate the specificity of the SYBR green detected products, a melting curve
analysis along with gel electrophoresis was performed to validate specificity of the products
generated (data not shown). The expression levels were quantified using the standard curve
method and quantities were normalized to either of the housekeeping genes (mentioned above),
with no difference in results obtained based on housekeeping gene chosen. Results are
![Page 125: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/125.jpg)
111
representative of at least two biological replicates with each individual assay measurement
quantified in duplicate or triplicate. In every assay, a no template control was included to assess
reagent contamination or primer dimer generation, and in addition, a no reverse transcriptase
control (RNA not synthesized into cDNA) was included to ensure absence of contaminating
genomic DNA in the samples.
![Page 126: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/126.jpg)
112
Results
Two genes encode the CAPA-related peptides in R. prolixus
We have identified a cDNA, which we refer to as RhoprCAPA-β (GenBank accession number:
EU937527), with high sequence similarity to a gene identified previously, RhoprCAPA-α
(GenBank accession number: EF989016; Paluzzi et al., 2008). In fact, at the nucleotide level, the
R. prolixus paralogs share 88.7% identity in nucleotide sequence. At the amino acid level, both
paralogs encode a prepropeptide of 157 residues sharing 85.4% similarity. The first encoded
peptide, RhoprCAPA-β1 (SPITSIGLLPFLRAA), deviates considerably from its paralog in the
RhoprCAPA-α gene, RhoprCAPA-α1 (73.3% identity, see Table 1). Interestingly, it is modified
on its C-terminus, with an additional alanine residue and lacking the glycine residue required for
amidation of the mature peptide (see Figure 1A). The second peptide is fully conserved with its
related paralog on the RhoprCAPA-α gene; however, to distinguish its location on the
RhoprCAPA-β gene, we give it a unique nomenclature, RhoprCAPA-β2 (EGGFISFPRV-NH2,
see Table 1). The third encoded peptide, RhoprCAPA-βPK-1 (IGGGGNGGGLWFGPRL-NH2),
shares near perfect identity with its paralog from the RhoprCAPA-α gene, nonetheless the N-
terminal most asparagine residue has been substituted by isoleucine (see Figure 1A and Table 1).
All peptide masses predicted by processing of the RhoprCAPA-β prepropeptide were identified
by mass spectrometry (data not shown), as were those for the RhoprCAPA-α prepropeptide (see
also Paluzzi et al., 2008). To our knowledge, this is the first report demonstrating a duplication
event, in any insect species, for the CAPA/CAP2b peptide-encoding genes.
Genomic organization of the R. prolixus CAPA genes
Preliminary genome assembly data from the ongoing R. prolixus genome sequencing project was
screened using a local BLASTN analysis revealing an initial molecular organization of each
paralog (see Figure 1B). The open reading frame of each paralog is encoded by four exons
separated by three introns. The RhoprCAPA-α exons are 153, 144, 174 and 253 bp in length and
the RhoprCAPA-β exons are identical in size with the exception of the first exon which is
![Page 127: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/127.jpg)
113
Table 1. Sequences deduced from the RhoprCAPA genes which arise following post-
translational processing and detected by mass spectrometry (data not shown).
Gene
Peptide name Sequence [M+H]+
RhoprCAPA-α
RhoprCAPA-α1 SPISSVGLFPFLRA-NH2 1489.85
RhoprCAPA-α2 EGGFISFPRV-NH2 1107.59
RhoprCAPA-αPK1 NGGGGNGGGLWFGPRL-NH2 1514.76
RhoprCAPA-β
RhoprCAPA-β1 SPITSIGLLPFLRAA-OH 1555.92
RhoprCAPA-β2 EGGFISFPRV-NH2 1107.59
RhoprCAPA-βPK1 IGGGGNGGGLWFGPRL-NH2 1513.80
![Page 128: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/128.jpg)
114
Figure 1. Deduced amino acid prepropeptide of the R. prolixus CAPA-β (RhoprCAPA-β) gene.
(A) Sequences are numbered on the right starting with the first nucleotide in the 5′ untranslated
region (UTR) and initial methionine start codon (capitalized), respectively. The three encoded
peptides are shown in boxes, with N-terminal dibasic and C-terminal monobasic post-
translational cleavage sites in bold. The highly predicted signal peptide required for processing in
the secretory pathway is underlined with predicted cleavage occurring between alanine24 and
aspartate25. The polyadenylation signal sequences occur within the 3′ UTR (bases 686–692 and
724–730). (B) Preliminary organization of the CAPA genes in the R. prolixus genome. Exons are
represented within boxes with sizes denoted and introns are represented by lines connecting the
exons with sizes also indicated (or predicted) beneath them.
![Page 129: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/129.jpg)
115
A
B
![Page 130: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/130.jpg)
116
142 bp. Although the introns are located at identical positions, they diverge greatly in size and
the RhoprCAPA-α gene spans a greater region of the genome than does the RhoprCAPA-β
paralog. However, given the current stage of the R. prolixus genome sequencing project, it was
not possible to confirm precisely the size of all of the introns (see Figure 1B for predicted intron
sizes).
Sequence and phylogenetic analysis of CAPA-precursors
The CAPA prepropeptide sequences in insects generally share sequence identity on the C-
terminus of each encoded peptide (see Figure 2A). Implementing a 75% conservation threshold
and considering all species where a prepropeptide sequence is known, the region containing the
first peptide has the consensus motif LX1X2FX3RVGR (where X1 = L, I, F, T or Y; X2 = A or P;
X3 = L or P), with some minor exceptions (such as the substitutions observed in both R. prolixus
precursors and that in T. castaneum). The conserved motif in the region producing the second
peptide is FPRVGR, again with some minor exceptions (A. pisum and T. castaneum have
isoleucine substituted for valine). The region producing the pyrokinin-related peptide contains
the conserved motif WFGPRLG, normally followed by a single or dibasic residue (with the
exception of the recently identified ‘CAPA-B’ splice variant in B. mori, which may not be
processed at this site as it lacks basic residues required for propeptide cleavage).
In comparison to other insect species, our phylogenetic analysis indicates the RhoprCAPA
prepropeptide sequences are most similar with the precursor identified in T. castaneum (see
Figure 2B), which together generate a monophyletic group having strong support (90% bootstrap
percentage). The sister group to these taxas’ sequences was one which included all other insect
sequences except the aphid taxa sequences. Interestingly, the Dipteran representatives (the
Drosophilidae and Culicidae) did not form a monophyletic group. Instead, the Culicidae formed
a sister taxa to a monophyletic group including the Drosophilidae, Lepidopteran and
Hymenopteran sequences. A second group of Hemipteran representatives (the Aphidoidea), are
placed at the basal position of all insect representatives having the greatest difference to all the
insect CAPA-precursors known.
![Page 131: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/131.jpg)
117
Figure 2. ClustalW2 alignment and phylogenetic analysis of known and predicted insect CAPA
encoding prepropeptide sequences. (B) The phylogenetic relationship of the prepropeptide
sequences of CAPA-related peptides of R. prolixus with representatives of the insect
Coleopteran, Dipteran, Lepidopteran, Hemipteran, Phthirapteran and Hymenopteran orders as
well as a species of the arachnid order, Acari. The tree was constructed using neighbor-joining
method. Numbers at the nodes are for percent support in 1000 bootstrapping iterations. A
parsimonious tree provided a similar tree topology.
![Page 132: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/132.jpg)
118
![Page 133: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/133.jpg)
119
CAPA paralog spatial expression profile in fifth-instars
Expression of the RhoprCAPA paralogs in fifth-instar tissues was assessed by Northern blot
hybridization. A band was detected in lanes containing CNS RNA at an approximate size of 0.7-
0.8 kb after hybridization with a DIG-labelled anti-sense RNA probe generated using either the
RhoprCAPA-α (data not shown) or RhoprCAPA-β cDNA (Figure 3A). With the exception of a
faint, similarly sized, band in the testis RNA sample, no other tissues displayed presence of
RhoprCAPA paralog transcript. A probe for beta-actin (actin 5c) was used as a control to verify
the quantity and integrity of RNA samples loaded in each lane.
To corroborate these findings and more accurately measure the expression levels of each paralog,
a two-step RT-qPCR approach was utilized. Both paralogs are expressed in the CNS, while only
the RhoprCAPA-α transcript is detected in testis samples (Figure 3B). The expression of the
RhoprCAPA-α transcript in the testis represents only a marginal level compared to the total
neuronal expression levels of both paralogs, but it is interesting that only the one transcript
(RhoprCAPA-α) was detected in this non-neuronal tissue. When comparing expression levels
within the CNS however, the RhoprCAPA-β transcript shows approximately 30% higher levels.
Within the different regions of the CNS, divided as the brain and suboesophageal ganglion
(SOG), prothoracic ganglion (PRO), and mesothoracic ganglionic mass (MTGM), RhoprCAPA-
β expression is consistently higher than that of RhoprCAPA-α transcript (Figure 3C), albeit
highest levels are observed in the MTGM and lowest levels in the PRO.
CAPA paralog temporal expression profile relative to blood meal
Upon engorging a blood meal, R. prolixus undergoes a rapid diuresis whereby the excess water
and salt loads are excreted. In order to better understand the role of CAPA peptides in serving to
regulate the termination of this rapid diuresis, we investigated expression levels of the
RhoprCAPA genes following a blood meal. The analysis was carried out in both a micro (hours)
and macro (days/weeks) time-scale (see Figure 4).
The outcome of the micro-temporal analysis reveals that both genes undergo an immediate
decrease in expression levels following blood gorging. Transcript levels in CNS dissected
![Page 134: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/134.jpg)
120
Figure 3. Expression analysis of RhoprCAPA genes in fifth-instar R. prolixus. (A) Northern blot
analysis demonstrates RhoprCAPA genes are expressed primarily in the central nervous system.
Detection of transcript size and abundance was similar in experiments using digoxigenin-labelled
anti-sense RNA probes for RhoprCAPA-α or RhoprCAPA-β. (B) Quantitative RT-PCR analysis
of transcript levels in fifth-instar tissues. (C) Transcript levels in regions of the central nervous
system were assessed to determine spatial expression profile of the two CAPA gene paralogs.
![Page 135: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/135.jpg)
121
![Page 136: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/136.jpg)
122
Figure 4. Quantitative reverse transcriptase PCR in central nervous system following a blood
meal for RhoprCAPA-α and RhoprCAPA-β. Pools of tissues dissected from 5 to 6 insects were
used for total RNA isolation and subsequent cDNA synthesis. The averages and standard
deviations of three biological replicates are shown. (A) Micro-temporal analysis of RhoprCAPA-
α and RhoprCAPA-β expression during the hours following a blood meal (t = 0). (B)
Macrotemporal analysis of RhoprCAPA-α and RhoprCAPA-β expression following a blood
meal (t = 0) during development from fifth-instar to adults. Triangles and squares denote
RhoprCAPA-α and RhoprCAPA-β expression, respectively.
![Page 137: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/137.jpg)
123
![Page 138: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/138.jpg)
124
immediately following feeding show an approximate 25% reduction in expression for both
paralogs and the levels remain lower than those prior to feeding over the next couple of hours
(Figure 4A). The RhoprCAPA-α transcript has its lowest levels at 2 h post-feeding, reaching a
level 40% lower than that prior to feeding. Subsequent to this, levels of RhoprCAPA-α begin to
increase, reaching a titer similar to the unfed state at 4 h post-feeding. However, at 5 and 6 h
after feeding, the RhoprCAPA-α levels are again 20% lower, and are then restored to near-unfed
levels at 7 h. At 8 h, the transcript level of RhoprCAPA-α is again lower by about 20% and
remains low up to 24 h post-feeding. For the most part, the RhoprCAPA-β transcript level
changes mirror those of RhoprCAPA-α, but levels are consistently higher by a range of 20–40%
at each time-point (a ratio similar to that observed in the spatial expression profile, see Figure 3).
Similar to its paralog, the RhoprCAPA-β transcript had lowest levels at 2 and 3 h after feeding,
and levels begin increasing thereafter reaching levels comparable to the unfed state at 5–7 h after
the blood meal (Figure 4A). As shown for RhoprCAPA-α, a decrease in RhoprCAPA-β
transcript level is also observed at 8 h post-feeding with a small increase occurring 24 h post-
feeding.
The macro-temporal analysis reveals that both RhoprCAPA paralogs undergo fluctuations during
the days/weeks following a blood meal (Figure 4B). As observed in the micro-temporal analysis,
expression immediately following feeding is lower relative to the levels in the unfed insect.
Transcript levels of both paralogs reach lowest levels at 12 days post-feeding and subsequently
increase, whereby they reach their highest levels at time-points subsequent to the nymph-adult
ecdysis (21, 25, 28 and 32 days post-feeding), which occurs on days 19–20 post-feeding. As
observed in other quantitative analyses of these two paralogs in CNS, the changes in expression
are generally mirrored between the two paralogs – again, the RhoprCAPA-β transcript has levels
ranging approximately 20–40% higher than the RhoprCAPA-α transcript.
CAPA paralog expression in adult R. prolixus
Investigation of the expression distribution of the two transcripts in various adult tissues (CNS,
thoracic muscle, hindgut, reproductive tissue, anterior midgut, salivary gland, dorsal vessel,
MTs, posterior midgut and a combined sample composed of fat body, diaphragm and trachea) in
![Page 139: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/139.jpg)
125
male (Figure 5A) and female (Figure 5B) R. prolixus demonstrates that transcript expression is
confined to the CNS in both sexes. Since we found that the RhoprCAPA-α transcript was also
expressed in fifth-instar male reproductive tissues, and that expression levels of the transcripts
fluctuated during development following a blood meal, we sought to quantitate transcript levels
in tissue types that had demonstrated expression of one or both transcripts. This analysis (Figure
5C) reveals that in fifth-instars, transcript levels are similar in male and female CNS; however
outside of the CNS, male reproductive tissue (testis) also contains low levels of the RhoprCAPA-
α transcript. In adult male CNS tissues, expression levels are similar to those found in fifth-
instars (regardless of gender). Conversely, in adult female CNS, transcript levels are
approximately half those levels observed in their male counterparts. Neither paralog is detected
in adult reproductive tissues.
Immunohistochemical localization of CAPA-related peptides and CAPA gene expression in
R. prolixus adult central nervous system
We have previously determined the distribution of PRX-amide-like immunoreactivity in fifth-
instar R. prolixus and located cells expressing the RhoprCAPA-α transcript in CNS (and
presumably, given the high sequence identity between these two paralogs, the RhoprCAPA-β
transcript expression). Since we observed some differences in expression within the CNS of male
and female adults (see Figure 5C), we performed combined fluorescent in situ hybridization and
immunohistochemical assays to determine which cells might be expressing higher or lower
levels of these transcripts. A comparison of adult male and female CNS reveals no difference in
cell number or location; however, cell staining-intensity was noticeably greater in adult male
CNS. We have not observed any differences in cell distribution with regard to the paralog
(RhoprCAPA-α or RhoprCAPA-β) that was utilized as a probe.
The cells expressing RhoprCAPA transcript and those positive for PRX-amide-like
immunoreactivity are shown in Figure 6 and Figure 7. The double-labelling reveals that all cells
positive for RhoprCAPA transcript expression are also positive for PRX-amide-like
immunoreactivity. However, as might be expected for an antiserum that recognizes families of
peptides with similar C-termini, there are PRX-amide-like immunoreactive cells that are negative
![Page 140: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/140.jpg)
126
Figure 5. Tissue expression analysis of RhoprCAPA genes in adult male (A) and female (B) R.
prolixus and comparison of expression between fifth-instar and adult neuronal and reproductive
tissues (C). Regardless the sex and stage of the insect, expression was primarily identified in the
central nervous system. Pools of tissues dissected from 5 to 6 insects were used for total RNA
isolation and subsequent cDNA synthesis. In (A) and (B) numbers denote as follows: 1, CNS; 2,
thoracic muscle; 3, hindgut; 4, reproductive tissue; 5, anterior midgut; 6, salivary gland; 7, dorsal
vessel; 8, Malpighian tubules; 9, posterior midgut; and 10, fat body, diaphragm and trachea. In
(C) numbers denote the following: 1, fifth male CNS; 2, fifth female CNS; 3, fifth male
reproductive; 4, fifth female reproductive; 5, adult male CNS; 6, adult female CNS; 7, adult male
reproductive; and 8, adult female reproductive.
![Page 141: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/141.jpg)
127
![Page 142: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/142.jpg)
128
Figure 6. RhoprCAPA-α and RhoprCAPA-β transcript expression (Alexa568/red) and PRX-
amide-like immunoreactivity (FITC/green) in the brain, suboesophageal ganglion (SOG) and
prothoracic ganglion (PRO) of adult R. prolixus. Over the dorsal surface of the brain, a pair of
lateral neurosecretory cells show PRX-amide-like immunoreactivity and RhoprCAPA transcript
expression (A–C). In addition, a number of medial neurosecretory cells show PRX-amide-like
immunoreactivity; however, they do not show any RhoprCAPA transcript expression. Over the
ventral surface of the SOG (D–F), two pairs of cells with prominent expression are observed
located medially and an additional three pairs of cells, which stained more weakly, are observed
just posterior of the oesophageal foramen. Over the ventral prothoracic ganglion (G–I), two
small pairs of cells are observed lying medially. A schematic diagram (J) summarizes the cells
within the brain, SOG and PRO which show both PRX-amide-like immunoreactivity and
RhoprCAPA transcript expression. Outlined cells are located on the ventral surface while filled
cells are located on the dorsal surface. Scale bar in A–I is 50 µm and in J is 200 µm.
![Page 143: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/143.jpg)
129
![Page 144: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/144.jpg)
130
Figure 7. RhoprCAPA-α and RhoprCAPA-β transcript expression (Alexa568/red) and PRX-
amide immunoreactivity (FITC/green) in the mesothoracic ganglionic mass (MTGM) of adult R.
prolixus. The ventral posterior segment of the MTGM (A–C) contains three bilaterally paired
RhoprCAPA gene-expressing cells within the abdominal neuromeres. In the more anterior
segment of the ventral MTGM (the meso- and metathoracic neuromeres), two additional pairs of
cells are positive for PRX-amide-like immunoreactivity but RhoprCAPA transcript expression
was not detected. In the dorsal region of the posterior MTGM, two pairs of lateral neurosecretory
cells were immunopositive for PRX-amide like peptides (D–F), however, these cells did not
show any RhoprCAPA transcript expression. A schematic diagram (G) summarizes the cells
within the MTGM on the ventral surface which show both PRX-amide-like immunoreactivity
and RhoprCAPA transcript expression. Scale bar in A–F is 50 µm and in G is 200 µm.
![Page 145: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/145.jpg)
131
![Page 146: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/146.jpg)
132
for RhoprCAPA transcript expression. These cells probably express the PBAN family or
pyrokinin family of neuropeptides which share some sequence similarity to the CAPA-related
neuropeptide family (see Rafaeli, 2009).
A bilateral pair of cells is present in the dorsal-lateral region of the brain bordering the optic lobe
(Figure 6A), which are positive for RhoprCAPA transcript and PRX-amide-like
immunoreactivity. The PRX-amide-like immunoreactivity reveals processes arising from the
cell bodies that enter the central neuropile of the brain (Figure 6B). Additional PRX-amide-like
positive cells, but lacking RhoprCAPA transcript expression, are found within the central region
of the brain, and these are consistent with being the medial neurosecretory cells identified in
fifth-instars. The colocalization of transcript expression and the peptide products within the adult
brain using merged images is shown in Figure 6C. In the SOG, two pairs of cells (Figure 6D and
F) demonstrate strong transcript abundance with the more posterior pair being approximately
twice the diameter of the anterior pair. Another group of cells displaying RhoprCAPA transcript
expression lie adjacent to the oesophageal foramen, but are less strongly stained. Both groups of
cells are PRX-amide-like immunoreactive; however a number of other immunoreactive-positive
cells do not show RhoprCAPA transcript expression (Figure 6E and F). The central region of the
PRO contains two pairs of cells on the ventral surface which exhibit RhoprCAPA transcript
expression (Figure 6G and I) and are also positive for PRX-amide-like immunoreactivity (Figure
6H and I). A schematic of cells which colocalize for RhoprCAPA transcript expression and
PRX-amide-like immunoreactivity in the adult brain, SOG and PRO is illustrated in Figure 6J.
Within the MTGM, three pairs of strongly staining cells are present within the abdominal
neuromeres on the posterior ventral surface that express RhoprCAPA transcript (Figure 7A and
C) and these same cells demonstrate PRX-amide-like immunoreactive staining (Figure 7B and
C). More anteriorly, two additional pairs of cells and one ventral unpaired median neuron lie
within the meso- and metathoracic neuromeres and contain PRX-amide-like immunoreactivity,
but these cells show no RhoprCAPA transcript expression (Figure 7B and C). No cells on the
dorsal surface of the MTGM have RhoprCAPA transcript expression (Figure 7D).
Immunoreactive processes that arise from the three pairs of strongly stained and double-labelled
![Page 147: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/147.jpg)
133
neurosecretory cells on the ventral surface are however observed (Figure 7E and F). These
processes continue posteriorly and produce extensive neurohemal sites on abdominal nerves two,
three and four (as previously shown for fifth-instars). Two lateral pairs of cells which are PRX-
amide-like immunoreactive, but negative for RhoprCAPA transcript expression, lie on the dorsal
surface of the MTGM (Figure 7E and F). A schematic of cells which colocalize for RhoprCAPA
transcript expression and PRX-amide-like immunoreactivity in the adult MTGM is illustrated in
Figure 7G.
![Page 148: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/148.jpg)
134
Discussion
CAPA gene peptides include the CAP2b-related/periviscerokinins and pyrokinins and are an
important family of peptides which appear to regulate central and peripheral physiological
processes in insects. In Dipteran species, the CAP2b-related peptides stimulate fluid secretion by
the MTs through increasing levels of nitric oxide and cyclic GMP, which in turn elevates
calcium levels by opening cyclic-nucleotide gated calcium channels (Pollock et al., 2004). In
contrast, while members of this family may have no effect on MTs in insects such as the
Orthopteran, Schistocerca gregaria, these peptides are known for their anti-diuretic role in R.
prolixus (Quinlan et al., 1997; Paluzzi and Orchard, 2006; Paluzzi et al., 2008), where they
inhibit tubule secretion stimulated by 5-HT. In addition, unlike the increase in cGMP over
unstimulated levels that is induced in Dipteran MTs by CAPA-related peptides (Pollock et al.,
2004), resting R. prolixus tubules do not exhibit an increase in cGMP in response to CAPA-
related peptides (Quinlan et al., 1997; Paluzzi and Orchard, 2006; Paluzzi et al., 2008).
Importantly, however, the decrease in cGMP levels that is observed when tubules are stimulated
with 5-HT, is abolished in the presence of CAPA-related peptides (Quinlan et al., 1997; Paluzzi
and Orchard, 2006; Paluzzi et al., 2008).
CAPA-related peptides have been identified in a number of insect species including Dipterans
(Kean et al., 2002; Pollock et al., 2004; Riehle et al., 2002; Predel et al., 2003a; 2003b; Nachman
et al., 2006), at least two Lepidopterans (Loi and Tublitz, 2004, Huesmann et al., 1995; Predel et
al., 2003a; 2003b), Blattarian species (Predel et al., 1998; 2000; Predel and Gade, 2005; Roth et
al., 2009), the Coleopteran, T. castaneum (Li et al., 2008), four polyphagous Hemipteran species
(Predel et al., 2006; 2008) and the haematophagous Hemipteran, R. prolixus (Paluzzi et al., 2008
and this study).
Genes encoding CAPA-related peptides have not been abundantly resolved in insects, however
they have been identified in Dipterans (Kean et al., 2002), Lepidopterans (Loi and Tublitz,
![Page 149: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/149.jpg)
135
2004), Hemipterans (Paluzzi et al., 2008) and Coleopterans (Li et al., 2008). Genome sequencing
of the human body louse, P. humanus corporis (EEB10638), and the pea aphid, A. pisum
(XP_001946149), as well as EST data of the green peach aphid, M. persicae (EE570800.1),
reveals the presence of CAPA genes in these additional insects of medical and agricultural
importance. Interestingly, a putative CAPA gene exists in the genome of the Arachnid, I.
scapularis (EW933575.1), although the resulting prepropeptide lacks many of the conserved
motifs seen in the Insecta sequences. In support of the above gene prediction, the first
neuropeptide in ticks was identified using a combined immunocytochemical and mass
spectrometric approach where a CAPA-related peptide was sequenced from analysis of single
cells from two species, Ixodes ricinus and Boophilus microplus (Neupert et al., 2005).
In the current study, we show that R. prolixus contains a second gene, RhoprCAPA-β, encoding
CAPA-related peptides. This gene shares high sequence identity (88.7%) with the previously
identified gene, RhoprCAPA-α, and also the prepropeptides demonstrate strong similarity
(85.4%). The RhoprCAPA-β gene produces peptides that share exact or near-identical sequence
to the products of the RhoprCAPA-α paralog; however, the first encoded peptide contains the
greatest variation and lacks a glycine residue at its carboxyl terminus required for amidation. The
predicted peptides in the RhoprCAPA-β prepropeptide are flanked on their amino termini by a
dibasic cleavage site and a monobasic site on their carboxyl termini, thus providing the necessary
sites for post-translation processing into biologically active forms (Veenstra, 2000). In support of
this predicted processing, molecular masses matching these novel peptides have been confirmed
by mass spectrometry (data not shown).
Phylogenetic analysis of CAPA prepropeptide sequences and those predicted from EST
databases reveals the R. prolixus sequences share the closest similarity with the T. castaneum
precursor. Interestingly, precursors from the more evolutionary-related Aphidoidean species, are
not grouped closely with their haematophagous relatives, suggesting the CAPA genes may
undergo divergent species-specific selection. A similar phenomenon is observed between
representatives of the Dipteran order, where the Culicidea group more closely with non-Dipteran
![Page 150: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/150.jpg)
136
insects, as opposed to the more closely related Drosophilidae. Thus, this suggests the CAPA
prepropeptides may not be a good representative for determining phylogenetic relationships
above the species level in all insects. Nonetheless, a recent phylogenetic analysis using CAPA
peptides from numerous cockroaches and the termite, Mastotermes darwiniensis, demonstrated
mature peptides from species within the Dictyopteran group may be suitable for reconstruction
of phylogenetic relationships (Roth et al., 2009).
Previously we demonstrated the expression of the RhoprCAPA-α paralog in various tissues in
fifth-instar R. prolixus as well as all post-embryonic stages using a non-quantitative RT-PCR
approach (Paluzzi et al., 2008). Using northern blot hybridization, we demonstrate strong CAPA
gene expression within the CNS of R. prolixus, regardless of which paralog was used to
synthesize the anti-sense RNA probe. In order to differentiate between the expression levels of
the two paralogs and quantify the levels identified in the CNS and testis tissues, we designed
gene-specific primers taking advantage of a 10 bp sequence (‘TGTTTTTTCT’, residue 63–72)
that was present in the RhoprCAPA-α transcript, but absent in RhoprCAPA-β. We confirmed
that both paralogs are expressed within the CNS, with the RhoprCAPA-β gene having
moderately higher levels (~30%). Expression outside of the CNS was restricted to the fifth-instar
male reproductive tissue, where only the RhoprCAPA-α transcript was detected. This is
consistent with that found previously (Paluzzi et al., 2008), albeit a level greatly lower than
expression levels found in the CNS. Within each region of the CNS, relative expression levels
between the two paralogs was consistent with that found for the CNS as a whole, where the
RhoprCAPA-β transcript was approximately 30–40% more highly expressed. Expression of both
paralogs was highest in the MTGM, followed by the brain and SOG and lowest levels were
localized to the PRO. The neuronal expression patterns corroborate well with that described for
other insects where the CAPA genes have been studied. In D. melanogaster, the CAPA gene
peptides were immunolocalized in the larval and adult CNS to three pairs of ventral
neuroendocrine cells in the abdominal neuromeres, as well as a number of cells in the SOG and
brain (Kean et al., 2002). In M. sexta, in situ hybridization identified cells expressing the CAPA
gene in similar midline cells within the abdominal ganglia; however, many additional cells were
identified in the larval brain (Loi and Tublitz, 2004) that were not found in D. melangaster (Kean
![Page 151: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/151.jpg)
137
et al., 2002) nor in R. prolixus (Paluzzi et al., 2008). CAPA-related peptides have also been
identified via immunolocalization or mass spectrometric analyses of neuroendocrine cells in the
abdominal ganglia, or analogous regions, in other insects (Predel et al., 1998; 2003a; 2003b;
2004; 2008; Clynen et al., 2003; Verleyen et al., 2004) and two tick species (Neupert et al.,
2005). The appearance of PRX-amide-like immunoreactive neurons in R. prolixus CNS that do
not show RhoprCAPA gene expression illustrates the cross-reactivity of the anti-PRX-amide
antiserum with some other insect peptide families such as PBAN family of peptides, which
contain similar C-terminal sequences (Žitnaň et al., 2003), but are not encoded by CAPA genes.
The temporal expression profile of CAPA genes has not previously been comprehensively
studied. Given the importance of a subset of the R. prolixus CAPA peptides in regulating anti-
diuresis (Paluzzi et al., 2008), we questioned if gene expression was altered following feeding.
Interestingly, both R. prolixus CAPA paralogs show a decrease immediately following feeding,
but levels are soon recovered in the hours that follow the rapid diuresis. Thus, this suggests that
the CAPA genes may undergo transcriptional regulation associated with feeding, although
admittedly, little is known of the transcriptional control of regulators of diuresis in R. prolixus.
Previously we showed that immunoreactivity within neuroendocrine cells in abdominal
neuromeres of the MTGM, and their associated neurohemal release sites, is greatly decreased at
3–4 h post-feeding (Paluzzi and Orchard, 2006). Thus, one possible explanation for the recovery
of gene expression observed between 4 and 7 h post-feeding may be to facilitate the restocking
of these peptides that have been depleted by release into the haemolymph in order to cease
diuresis. The expression profile observed over the days following feeding and leading up to and
beyond the nymph-adult ecdysis suggest that the R. prolixus CAPA genes may also undergo
regulation beyond the rapid diuresis following engorgement. The decrease observed in the early
days that follow a blood meal (a fed state) could be indicative of the insect not requiring starved-
state amounts of anti-diuretic peptide, where the insect must ensure maintenance of water and
essential salts since the previous blood meal has been fully digested. Instead, as the insect
prepares for the nymph-adult ecdysis, our results suggest that increases in CAPA gene transcripts
may reflect the need to synthesize higher amounts of anti-diuretic peptides to ensure osmotic
balance during the nymph-adult ecdysis, where the insect is susceptible to desiccation. Naturally,
![Page 152: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/152.jpg)
138
we must also recognize that the quantification of gene expression may not correlate directly with
levels of biologically mature peptides.
We also assessed the expression of the two paralogs in various adult tissues and determined that
expression is exclusively localized to the CNS in both female and male insects. Expression was
not localized to reproductive tissues in either male or female adults. The role of the fifth-instar
male-specific expression of the RhoprCAPA-α paralog remains unclear.
Two genes encode the CAPA-related peptides in the haematophagous Chagas’ disease vector, R.
prolixus. From our combined immunohistochemical and in situ hybridization analysis, it is
evident that the neurons in the CNS of R. prolixus synthesize at least a two-fold greater number
of CAPA-related peptides than that known in other insects. In addition, given the sequence
variation that has occurred over the first encoded peptide in each prepropeptide, it is unlikely that
the first peptide will elicit the same anti-diuretic effect as shown by RhoprCAPA-α2 (-β2).
Physiological studies utilizing these peptides clearly demonstrate that the first encoded peptides
do not inhibit serotonin-stimulated Malpighian tubule secretion nor do they abolish absorption by
the anterior midgut (data not shown). Thus, one or both of the first encoded peptides, namely
RhoprCAPA-α1 (-β1), in these paralogous genes may have a distinct role, and utilize a unique
receptor, in accordance with the theory of ligand-receptor coevolution (Park et al., 2002). Our
results suggest that expression levels of the CAPA genes in R. prolixus are modified following
gorging on a blood meal, which we suspect allows the restocking of peptide stores that are
depleted from the neuroendocrine cells (and associated neurohemal sites) during the termination
of the rapid diuresis. Finally, the RhoprCAPA genes undergo changes in expression as the fifth-
instar digests the blood meal for a period of days and weeks following feeding and prepares for
the nymph-adult ecdysis. At times when water must be conserved in R. prolixus (such as the end
of the rapid diuresis and nymph-adult ecdysis), our results indicate the CAPA genes may be
activated to ensure sufficient anti-diuretic peptide is present to meet that physiological demand.
![Page 153: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/153.jpg)
139
References
Bendtsen, J. D., Nielsen, H., von Heijne, G. and Brunak, S. (2004). Improved prediction of
signal peptides: SignalP 3.0. Journal of Molecular Biology 340, 783-795.
Clynen, E., Huybrechts, J., De Loof, A. and Schoofs, L. (2003). Mass spectrometric analysis
of the perisympathetic organs in locusts: Identification of novel periviscerokinins
Biochem. Biophys. Res. Commun. 300, 422-428.
Coast, G. M., Orchard, I., Phillips, J. E. and Schooley, D. A. (2002). Insect diuretic and anti-
diuretic hormones. In Advances in Insect Physiology, pp. 279-409: Academic Press.
Huesmann, G. R., Cheung, C. C., Loi, P. K., Lee, T. D., Swiderek, K. M. and Tublitz, N. J.
(1995). Amino acid sequence of CAP2b, an insect cardioacceleratory peptide from the
tobacco hawkmoth Manduca sexta. FEBS Lett. 371, 311-314.
Kean, L., Cazenave, W., Costes, L., Broderick, K. E., Graham, S., Pollock, V. P., Davies, S.
A., Veenstra, J. A. and Dow, J. A. T. (2002). Two nitridergic peptides are encoded by
the gene capability in Drosophila melanogaster. Am J Physiol Regul Integr Comp
Physiol 282, R1297-1307.
Lange, A. B., Orchard, I. and Barrett, F. M. (1989). Changes in hemolymph serotonin levels
associated with feeding in the bloodsucking bug, Rhodnius prolixus. J. Insect Physiol. 35,
393-399.
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam,
H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R. et al. (2007). Clustal W and
Clustal X Version 2.0 Bioinformatics 23, 2947-2948.
Li, B., Predel, R., Neupert, S., Hauser, F., Tanaka, Y., Cazzamali, G., Williamson, M.,
Arakane, Y., Verleyen, P., Schoofs, L. et al. (2008). Genomics, transcriptomics, and
peptidomics of neuropeptides and protein hormones in the red flour beetle Tribolium
castaneum Genome Res. 18, 113-122.
Loi, P. K. and Tublitz, N. J. (2004). Sequence and expression of the CAPA/CAP2b gene in the
tobacco hawkmoth, Manduca sexta. J. Exp. Biol. 207, 3681-3691.
![Page 154: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/154.jpg)
140
Maddrell, S. H. P., Herman, W. S., Farndale, R. W. and Riegel, J. A. (1993). Synergism of
hormones controlling epithelial fluid transport in an insect. J. Exp. Biol. 174, 65-80.
Nachman, R. J., Russell, W. K., Coast, G. M., Russell, D. H., Miller, J. A. and Predel, R.
(2006). Identification of PVK/CAP2b neuropeptides from single neurohemal organs of
the stable fly and horn fly via MALDI-TOF/TOF tandem mass spectrometry. Peptides
27, 521-526.
Neupert, S., Predel, R., Russell, W. K., Davies, R., Pietrantonio, P. V. and Nachman, R. J.
(2005). Identification of tick periviscerokinin, the first neurohormone of Ixodidae: Single
cell analysis by means of MALDI-TOF/TOF mass spectrometry. Biochem. Biophys. Res.
Commun. 338, 1860-1864.
Orchard, I. (2006). Serotonin: A coordinator of feeding-related physiological events in the
blood-gorging bug, Rhodnius prolixus. Comparative Biochemistry and Physiology A-
Molecular & Integrative Physiology 144, 316-324.
Orchard, I. and Paluzzi, J. P. (2009). Diuretic and anti-diuretic hormones in the blood-gorging
bug Rhodnius prolixus. Ann. N. Y. Acad. Sci. 1163, 501-503.
Paluzzi, J. P. and Orchard, I. (2006). Distribution, activity and evidence for the release of an
anti-diuretic peptide in the kissing bug Rhodnius prolixus. J. Exp. Biol. 209, 907-915.
Paluzzi, J. P., Russell, W. K., Nachman, R. J. and Orchard, I. (2008). Isolation, cloning, and
expression mapping of a gene encoding an anti-diuretic hormone and other CAPA-related
peptides in the disease vector, Rhodnius prolixus. Endocrinology 149, 4638-4646.
Park, Y., Kim, Y. and Adams, M. E. (2002). Identification of G protein-coupled receptors for
Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-
receptor coevolution. Proc. Natl. Acad. Sci. U. S. A. 99, 11423-11428.
Pollock, V. P., McGettigan, J., Cabrero, P., Maudlin, I. M., Dow, J. A. T. and Davies, S. A.
(2004). Conservation of capa peptide-induced nitric oxide signaling in Diptera. J. Exp.
Biol. 207, 4135-4145.
Predel, R. and Gade, G. (2005). Peptidomics of neurohemal organs from species of the
cockroach family Blattidae: How do neuropeptides of closely related species differ?
Peptides 26, 3-9.
![Page 155: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/155.jpg)
141
Predel, R., Herbert, Z. and Eckert, M. (2003). Neuropeptides in perisympathetic organs of
Manduca sexta: Specific composition and changes during the development. Peptides 24,
1457-1464.
Predel, R., Kellner, R., Baggerman, G., Steinmetzer, T. and Schoofs, L. (2000).
Identification of novel periviscerokinins from single neurohemal release sites in insects
MS/MS fragmentation complemented by Edman degradation. Eur. J. Biochem. 267,
3869-3873.
Predel, R., Rapus, J., Eckert, M., Holman, G. M., Nachman, R. J., Wang, Y. and Penzlin,
H. (1998). Isolation of periviscerokinin-2 from the abdominal perisympathetic organs of
the American cockroach, Periplaneta Americana. Peptides 19, 801-809.
Predel, R., Russell, W. K., Neupert, S., Russell, D. H., Esquivel, J. F. and Nachman, R. J.
(2006). Identification of the first neuropeptides from the CNS of Hemiptera: CAPA
peptides of the southern green stinkbug Nezara viridula (L.). Peptides 27, 2670-2677.
Predel, R., Russell, W. K., Russell, D. H., Lopez, J., Esquivel, J. and Nachman, R. J. (2008).
Comparative peptidomics of four related Hemipteran species: pyrokinins, myosuppressin,
corazonin, adipokinetic hormone, sNPF, and periviscerokinins. Peptides 29, 162-167.
Predel, R., Russell, W. K., Tichy, S. E., Russell, D. H. and Nachman, R. J. (2003). Mass
spectrometric analysis of putative capa-gene products in Musca domestica and
Neobellieria bullata. Peptides 24, 1487-1491.
Predel, R. and Wegener, C. (2006). Biology of the CAPA peptides in insects. Cell Mol Life Sci
63, 2477-2490.
Predel, R., Wegener, C., Russell, W. K., Tichy, S. E., Russell, D. H. and Nachman, R. J.
(2004). Peptidomics of CNS-associated neurohemal systems of adult Drosophila
melanogaster: a mass spectrometric survey of peptides from individual flies. J. Comp.
Neurol. 474, 379-392.
Quinlan, M., Tublitz, N. and O'Donnell, M. (1997). Anti-diuresis in the blood-feeding insect
Rhodnius prolixus Stal: the peptide CAP2b and cyclic GMP inhibit Malpighian tubule
fluid secretion. J Exp Biol 200, 2363-2367.
![Page 156: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/156.jpg)
142
Quinlan, M. C. and O'Donnell, M. J. (1998). Anti-diuresis in the blood-feeding insect
Rhodnius prolixus Stal: antagonistic actions of cAMP and cGMP and the role of organic
acid transport. Journal of Insect Physiology 44, 561-568.
Rafaeli, A. (2009). Pheromone biosynthesis activating neuropeptide (PBAN): regulatory role
and mode of action. Gen. Comp. Endocrinol. 162, 69-78.
Riehle, M. A., Garczynski, S. F., Crim, J. W., Hill, C. A. and Brown, M. R. (2002).
Neuropeptides and peptide hormones in Anopheles gambiae. Science 298, 172-175.
Roller, L., Yamanaka, N., Watanabe, K., Daubnerova, I., Žitnaň, D., Kataoka, H. and
Tanaka, Y. (2008). The unique evolution of neuropeptide genes in the silkworm Bombyx
mori. Insect Biochem. Mol. Biol. 38, 1147-1157.
Roth, S., Fromm, B., Gade, G. and Predel, R. (2009). A proteomic approach for studying
insect phylogeny: CAPA peptides of ancient insect taxa (Dictyoptera, Blattoptera) as a
test case. BMC Evol. Biol. 9, 50.
Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007). MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596-1599.
Te Brugge, V. A. and Orchard, I. (2002). Evidence for CRF-like and kinin-like peptides as
neurohormones in the blood-feeding bug, Rhodnius prolixus. Peptides 23, 1967-1979.
Te Brugge, V., Ianowski, J. P. and Orchard, I. (2009). Biological activity of diuretic factors
on the anterior midgut of the blood-feeding bug, Rhodnius prolixus. Gen. Comp.
Endocrinol. 162, 105-112.
Te Brugge, V. A., Miksys, S. M., Coast, G. M., Schooley, D. A. and Orchard, I. (1999). The
distribution of a CRF-like diuretic peptide in the blood-feeding bug Rhodnius prolixus. J.
Exp. Biol. 202, 2017-2027.
Veenstra, J. A. (2000). Mono- and dibasic proteolytic cleavage sites in insect neuroendocrine
peptide precursors. Arch. Insect Biochem. Physiol. 43, 49-63.
Verleyen, P., Huybrechts, J., Sas, F., Clynen, E., Baggerman, G., De Loof, A. and Schoofs,
L. (2004). Neuropeptidomics of the grey flesh fly, Neobellieria bullata. Biochem.
Biophys. Res. Commun. 316, 763-770.
![Page 157: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/157.jpg)
143
Žitnaň, D., Zitnanova, I., Spalovska, I., Takac, P., Park, Y. and Adams, M. E. (2003).
Conservation of ecdysis-triggering hormone signaling in insects. J. Exp. Biol. 206,
1275-1289.
![Page 158: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/158.jpg)
144
Acknowledgments
The authors wish to thank Nikki Sarkar for assistance in the feeding experiments. This research
was made possible through an NSERC Discovery Grant to I.O. and an NSERC Canada Graduate
Scholarship to J.P.P.
![Page 159: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/159.jpg)
145
Copyright Acknowledgments
The preceeding chapter was reproduced / adapted with permission from Elsevier.
Full citation details:
A second gene encodes the anti-diuretic hormone in the insect, Rhodnius prolixus. Paluzzi JP, Orchard I. Mol Cell Endocrinol. . [Epub ahead of print] Nov 19, 2009 doi:10.1016/j.mce.2009.11.004
Copyright © 2010, Elsevier
![Page 160: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/160.jpg)
146
Chapter 5:
Isolation, expression analysis and functional characterization of the first
anti-diuretic hormone receptor in insects
![Page 161: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/161.jpg)
147
Abstract
Diuresis following blood-gorging in Rhodnius prolixus is the major process leading to the
transmission of Chagas’ disease. We have cloned the cDNA of the first receptor known to be
involved in an anti-diuretic strategy in insects; a strategy that prevents diuresis. More
specifically, this receptor belongs to the insect CAPA receptor family (known in other insects to
be activated by peptides encoded within the capability gene), and in addition, also shares
similarity to the pyrokinin-1 receptor family in insects. We characterize the expression profile
in fifth-instar R. prolixus and find expression is localized to the alimentary canal. Highest
transcript levels are found in Malpighian tubules and the anterior midgut, which are known
targets of the RhoprCAPA-α2 neurohormone. Two transcripts were identified, capa-r1 and
capa-r2; however the latter encodes an atypical GPCR lacking a region ranging between the first
and second transmembrane domain. Our heterologous expression assay revealed the expressed
capa-r1 receptor is activated by the R. prolixus anti-diuretic hormone, RhoprCAPA-α2 (EC50 =
385nM) but not by RhoprCAPA-α1. In addition, this receptor has some sensitivity to the
pyrokinin-related peptide, RhoprCAPA-αPK1, but with an efficacy approximately 40-fold less
than RhoprCAPA-α2. Structural analogs of the inactive RhoprCAPA-α1 were capable of
activating the expressed capa-r1 receptor, confirming the importance of the C-terminal
consensus sequence common to CAPA-related peptides. Other peptides belonging to the
PRXamide superfamily were inactive on the capa-r1 receptor. Taken together, the
neuroendocrinological relevance of this receptor in facilitating the anti-diuretic strategy in R.
prolixus, may make this receptor a useful target for development of agonists or antagonists that
could help influence the transmission of Chagas’ disease that occurs during diuresis in this
medically-important insect disease-vector.
![Page 162: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/162.jpg)
148
Introduction
A major physiological process that allows insects to adopt a variety of feeding strategies and
environmental niches is their ability to regulate water and ion composition in their haemolymph.
This process involves control over primary urine production via the insect kidney equivalent, the
Malpighian (renal) tubules (MTs), and, in a number of insects, the reabsorption of essential salts
and water from the hindgut before the final excretae is voided. Insect neurohormones, including
peptides and biogenic amines, together with their cognate receptors, carry out an essential role in
these and related physiological processes and numerous neuroendocrine factors regulating fluid
and ion balance in insects have been described. These include corticotropin releasing factor-
related peptides, calcitonin-related peptides, kinin-related peptides, CAPA peptides (encoded on
the capability gene) (Kean et al., 2002; Loi and Tublitz, 2004; Paluzzi et al., 2008; Paluzzi and
Orchard, 2010) and the biogenic amine, serotonin (5-hydroxytryptamine, 5-HT) (for a review,
see Coast et al., 2002). One insect which has been used as a model for understanding the control
of this diuresis is the haematophagous bug, Rhodnius prolixus. This insect imbibes enormous
blood meals and must then rapidly eliminate large volumes of excess salts and water (see
Orchard, 2009). The parasitic protozoan, Trypanosoma cruzi, is transmitted to humans in the
urine, and so diuresis controls the transmission of Chagas’ disease. Neurohormones control
haemolymph salt and water homeostasis by acting on the anterior midgut and MTs (Ianowski et
al., 2010; Te Brugge et al., 2009).
The insect CAPA peptides, some of which are also referred to as periviscerokinins, usually
contain the consensus carboxy terminal sequence FPRV-NH2. These peptides are normally
produced within the central nervous system and are known to be released into the haemolymph
from peripheral neurohemal sites where they modify activities of visceral tissues. In Dipterans,
these peptides activate nitric oxide synthase in principal cells of the main segment of the MTs,
leading to increased fluid secretion (Davies et al., 1997; Pollock et al., 2004). Interestingly,
these peptides are not stimulatory on MTs in all insects in which these peptides have been tested.
For example, in the locust, Schistocerca gregaria, this family of peptides does not increase fluid
secretion (Davies et al., 1997; Pollock et al., 2004), nor does it increase levels of nitric oxide. In
addition, CAPA-related peptides are inhibitory on MTs in the haematophagous insect, R.
prolixus (Paluzzi and Orchard, 2006; Quinlan et al., 1997). Recently, we established that R.
![Page 163: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/163.jpg)
149
prolixus contains two CAPA genes. Each gene codes for three peptides, two of them being
CAPA-related peptides and the third being a pyrokinin-related peptide. The second encoded
peptide in each prepropeptide, RhoprCAPA-α2(-β2), is identical in sequence in each paralog
(Paluzzi et al., 2008; Paluzzi and Orchard, 2010). RhoprCAPA-α2 has been shown to directly
inhibit 5-HT-stimulated secretion by the MTs (Paluzzi et al., 2008; Paluzzi and Orchard, 2010)
as well as absorption of water and ions by the anterior midgut (Ianowski et al., 2010; Orchard
and Paluzzi, 2009).
The availability of completed insect genomes has made the identification of receptors for these
neuroendocrine factors more feasible. The first such receptor, belonging to the G protein-
coupled receptor family (having seven transmembrane domains), was annotated in the genome
assembly of the fruit fly, Drosophila melanogaster (Adams et al., 2000), and was subsequently
deorphaned by functional characterization by two separate research groups (Iversen et al., 2002;
Park et al., 2002). This gene, annotated as CG14575, was shown by functional ligand-receptor
interaction assay to have an EC50 value of 150-230nM (Iversen et al., 2002; Park et al., 2002)
and 69-110nM (Iversen et al., 2002; Park et al., 2002) for the D. melanogaster CAPA peptides,
capa-1 and capa-2. Subsequent to these studies, a CAPA receptor was also identified in the
malaria mosquito, Anopheles gambiae (Olsen et al., 2007).
In the present study, we report the isolation, transcript expression profile and functional
interaction analysis of the CAPA receptor in R. prolixus, referred to as RhoprCAPA-r. This
receptor mRNA is localized to tissues of the alimentary canal (foregut, midgut, hindgut and
MTs), and exhibits highest transcript levels in the anterior midgut and MTs; tissues known to be
regulated by the anti-diuretic neurohormone RhoprCAPA-α2 (identical in sequence to
RhoprCAPA-β2). In addition, the upper secretory segment of the Malpighian tubules contains
the majority of the RhoprCAPA-r transcript expression compared to the lower, non-secretory
reabsorptive segment. Functional ligand-receptor interaction assays demonstrate that the
receptor has highest affinity for the anti-diuretic neurohormone, RhoprCAPA-α2, encoded by
both R. prolixus CAPA gene paralogs. In contrast to the functional assay results demonstrated
thus far in other insects (Iversen et al., 2002; Park et al., 2002), a R. prolixus pyrokinin located
on the RhoprCAPA gene, RhoprCAPA-αPK1, partially activates the receptor, albeit at peptide
concentrations 40-fold higher than RhoprCAPA-α2. To our knowledge, this is the first study to
isolate and functionally characterize an anti-diuretic hormone receptor in any insect. The
![Page 164: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/164.jpg)
150
identification of such a receptor, and the knowledge acquired from the neuroendocrinological
effects that it mediates, holds promise for influencing the transmission of Chagas’ disease
associated with blood-feeding by this medically-important pest.
![Page 165: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/165.jpg)
151
Materials and Methods
Animals
Fifth-instar R. prolixus Stål were reared at high relative humidity in incubators at 25°C and
routinely fed on rabbits’ blood. Insect tissues were dissected under physiological saline (Paluzzi
et al., 2008) prepared using nuclease-free water, and tissues were stored in RNAlater solution
(Qiagen, Mississauga) for subsequent RNA isolation.
Isolation of a partial coding sequence of the R. prolixus CAPA receptor gene
CAPA receptor protein sequences identified or predicted in D. melanogaster (AAS65092;
Iversen et al., 2002; Park et al., 2002), Apis mellifera (NP_001091702; Hauser et al., 2006), A.
gambiae (AAX84796; Olsen et al., 2007) and Tribolium castaneum (XP_973937; Li et al., 2008)
were aligned by ClustalW (Larkin et al., 2007) and regions of high conservation were utilized for
design of degenerate primers. A cDNA library from the upper segment of MTs was constructed
following the Creator SMART cDNA Library Synthesis kit as described previously (Paluzzi et
al., 2008). The upper MTs segment cDNA library was utilized as a template for PCR using the
CAPA receptor degenerate primers (see Appendices Table S1). Sequencing of positive
amplicons was carried out at the Centre for Applied Genomics at the Hospital for Sick Children
(MaRS Centre, Toronto, Ontario, Canada).
Rapid Amplification of cDNA Ends (RACE) PCR of the R. prolixus CAPA receptor gene
The partial sequence coding for the R. prolixus CAPA receptor gene obtained through PCR
screening of the upper MT cDNA library using degenerate primers was used to design gene-
specific primers for application in RACE PCR (see Appendices Table S2A). Total RNA from
MTs (1.5µg) was utilized for cDNA synthesis using the 5’/3’ RACE Kit according to
manufacturer instructions (Roche Applied Science, Laval, QC). The first-strand cDNA for 3’
![Page 166: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/166.jpg)
152
RACE was synthesized using the supplied Oligo (dT) anchor primer and the 5’ RACE template
cDNA was synthesized using the gene-specific primer, capaR-5raceREV1 (see Appendices
Table S2A). A series of semi-nested PCR reactions was carried out by gene-specific primers
within the initial partial sequence to enhance the specificity and increase the yield of amplified
RACE products. After the final round of semi-nested RACE PCR, the specific products were
ligated to pGEM-T Easy vector (Promega, Madison, WI) which was used to transform bacteria
to enable downstream sequencing of individual clones. Sequencing was carried out as specified
previously (Paluzzi et al., 2008) and noted above.
Northern blot analysis
Fifth instar alimentary canals (including foregut, midgut, hindgut and MTs) were dissected and
total RNA was isolated using the SV Total RNA Isolation System (Promega, Madison, WI).
This total RNA sample was then further processed for isolation of mRNA using the PolyATtract
mRNA Isolation System III (Promega, Madison, WI). Isolated mRNA was quantified using a
NanoDrop UV Spectrophotometer and 1µg per lane was utilized for northern blot analysis as
described previously (Paluzzi and Orchard, 2010). Digoxigenin (DIG)-labeled RNA antisense
probes were synthesized by in vitro transcription as described previously (Paluzzi and Orchard,
2010) using the sense primer capaR_3raceFOR2 and antisense primer capaR_3endREV1 (see
Appendices Table S2A).
Reverse transcriptase quantitative PCR (RT-qPCR) tissue expression analysis
Fifth-instar R. prolixus fed 7-8 weeks previously as fourth-instars, were dissected under
nuclease-free PBS and tissues were transferred to RNAlater (Ambion, Austin, TX) for
subsequent RNA isolation as described above. First-strand cDNA was synthesized using 100ng
total RNA from each tissue using the iScript Select cDNA synthesis kit (Bio-Rad, Mississauga,
ON). Following cDNA synthesis, reactions were diluted five-fold using nuclease-free water and
subsequently used as template for qPCR. Primers were designed over exon-exon splice
boundaries and sense primers were designed specifically for the transcript variants of the
![Page 167: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/167.jpg)
153
RhoprCAPA-R gene (see Appendices Table S2B) in order to differentiate expression levels
between these alternative transcripts. Quantitative PCR (qPCR) was carried out on a Mx4000
Quantitative PCR System (Stratagene, La Jolla, CA) and cycling conditions and housekeeping
control genes, rp49 and actin 5c, were used as described previously (Paluzzi and Orchard, 2010).
Primer efficiencies were determined for each target and relative expression was determined
following the delta-delta Ct method (Pfaffl, 2001) and fold-differences were normalized to either
of the housekeeping genes (noted above). Experiments were repeated for a total of three
biological replicates with two technical replicates each. Each technical replicate included a no
template control and no reverse transcriptase control to ensure absence of contaminating
template in reagents and possible genomic DNA contaminant amplification, respectively.
Preparation of mammalian expression constructs
The full-length cDNA of the two alternative transcripts of the RhoprCAPA receptor (capa-r1
and capa-r2) were amplified by primers designed at the 5’- and 3’-end (see Appendices Table
S2C) and using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Pickering, ON)
and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Migration of PCR amplified
products from individual clones during gel electrophoresis as well as sequencing of individual
clones was used to differentiate between different splice variants. These clones were
subsequently utilized as a template for a similar PCR reaction as stated above, but using primers
which spanned the complete open-reading frame and which had the 5’ non-coding sequence
modified by introducing a Kozak translation initiation sequence (see Appendices Table S2C)
required for optimal translation by eukaryotic ribosomes (Kozak, 1984; 1986; 1987). The
RhoprCAPA-R ORFs were inserted into the pcDNA 3.1+ (Invitrogen, Carlsbad, CA) for
expression in mammalian cells.
Cell line expression and functional analysis of the RhoprCAPA receptor
Transient expression of the RhoprCAPA-R gene was accomplished using a CHO-K1 cell line.
Cells were grown in complete Ham’s DMEM/F12 medium containing HEPES but no phenol red
![Page 168: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/168.jpg)
154
(Invitrogen, Carlsbad, CA) and supplemented with 0.1% protease-free BSA, Penicillin (10
IU/mL) and Streptomycin (100µg/mL) and grown at 37ºC in 5% CO2. Each RhoprCAPA-R
transcript variant expression construct was cotransfected with a construct carrying the
cytoplasmic luminescent reporter aequorin (cyto-Aeq). Cotranfection of pcDNA3.1+- capa-r1
and pcDNA3.1+-cyto-Aeq or pcDNA3.1+- capa-r2 and pcDNA3.1+-cyto-Aeq was carried out in
serum- and antibiotic-free medium using FuGENE HD (Roche Applied Science, Indianapolis,
IN) following manufacturer guidelines and using a 3:1 DNA to transfection reagent ratio.
Approximately 36-48 hours post-transfection, cell cultures were dislodged using a PBS-EDTA
solution (137mM NaCl; 2.6mM KCl; 8.1mM Na2HPO4; 0.44mM KH2PO4; 5mM EDTA) and
were resuspended in complete Ham’s DMEM/F12 medium (~106-107 cells/mL). Prior to the
functional assay, coelenterazine h (Invitrogen, Carlsbad, CA) was added to the cell suspension at
a final concentration of 5µM and the mixture was incubated for 3-4 hours in the dark on an
automated stirrer at room temperature. Following this incubation, the mixture was diluted ten-
fold by adding additional Ham’s DMEM/F12 medium (final cell titre of 105-106 cells/mL and
0.5µM coelenterazine h) and further incubated for 45-90 minutes in the dark at room
temperature. Luminescence assays were performed in opaque 96-well microplates (Corning,
Lowell, MA) and responses were monitored using an Orion microplate luminometer complete
with an automated injector unit (Berthold Detection Systems, Huntsville, AL). Ligands at
various titers were resuspended in complete Ham’s DMEM/F12 medium (supplemented as
above) and plated in duplicate wells across the 96-well plate (see Table 1 for list of peptides used
in this study). Cells were loaded into each well using the automated injector unit and
luminescence was monitored for 20 seconds and the response normalized to the greatest positive
control response in each plate and corrected for background values obtained from wells receiving
complete Ham’s DMEM/F12 medium alone (negative control). The response for each ligand
concentration in replica wells and from at least two replica plates was averaged for analysis.
Peptides encoded by the RhoprCAPA-α gene and derived analogs were synthesized by following
methods described previously (Paluzzi et al., 2008). The source of human arginine vasopressin
(HomsaAVP) and D. melanogaster hugin γ (Dromehugγ) peptides were as described previously
(Park et al., 2002).
![Page 169: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/169.jpg)
155
Sequence analysis of the RhoprCAPA receptor
The deduced amino acid sequence encoded by the small- and large-transcript variants of the
RhoprCAPA-R gene were analyzed for predicted membrane topology using the TMHMM Server
v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/). Using ClustalX (Larkin et al., 2007), the
sequences were compared to other known or predicted CAPA receptor sequences and pyrokinin-
1 receptors identified in other insects noted above and also including Acyrthosiphon pisum
(XP_001950333), Pediculus humanus corporis (XP_002426611), D. melanogaster (CG9918;
Cazzamali et al., 2005), A. gambiae (AY900218; Olsen et al., 2007) and Aedes aegypti
(XP_001662936). In addition, a human homologue of the insect CAPA and pyrokinin receptors,
neuromedin U receptor-2 (Q9GZQ4; Hosoya et al., 2000), was used for rooting the phylogenetic
tree derived from the multiple alignment. Using MEGA 4.02, both maximum parsimony and
neighbor joining methods were utilized, however both produced trees with highly similar
topology. The reliability of the relationships between taxa was tested using the bootstrap test
with 1000 iterations (Tamura et al., 2007).
![Page 170: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/170.jpg)
156
Results
R. prolixus CAPA receptor
The R. prolixus capa-r gene encodes two mRNA variants, capa-r1 (GenBank accession:
GU734127) and capa-r2 (GenBank accession: GU734128), with cloned transcript sizes of
approximately 1437bp and 1344bp, respectively (Figure 1A). Northern blot hybridization
suggests the full-length transcripts may be slightly larger (Figure 1B), however this is likely an
extension of the 5’UTR since an in-frame stop signal (bases -54 to -52); Figure 1A) is present
upstream of the identified ATG translation start site. Both of these transcripts are encoded by six
exons spanning approximately 10.2kb of the genome as predicted by the R. prolixus preliminary
genome assembly (see Figure 1C). The data suggest the smaller transcript, capa-r2, is the
product of splicing of an optional intron due to cryptic splicing signals located over the second
exon sequence (see Figure 1A and 1C) that reduces the size of this exon from 282bp to 189bp
and reduces the resulting protein by 31 amino acids. The capa-r1 transcript encodes a predicted
seven transmembrane domain protein consistent with features present in G protein-coupled
receptors (GPCR) with an extracellular N-terminal sequence and intracellular C-terminal
sequence (Figure 2A). The capa-r2 transcript produces an atypical GPCR having only six
predicted hydrophobic transmembrane domains, and, in addition, both the N-terminal and C-
terminal ends are predicted to be intracellular (Figure 2B).
Sequence and phylogenetic analysis
Sequence analysis of CAPA-R1 receptor reveals features typifying the G protein-coupled
receptor super family such as seven α -helices forming transmembrane domains connecting an
extracellular N-terminus and intracellular C-terminus. In addition, the CAPA-R1 receptor
demonstrates features characteristic of the rhodopsin-like GPCRs subfamily (or family A
GPCRs). These features include a slight variation of the NSxxNPxxY motif localized to the
seventh α-helix membrane spanning domain and a D/E-R-Y/F at the border between the third
transmembrane and the second intracellular loop (Fredriksson et al., 2003). The putative atypical
![Page 171: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/171.jpg)
157
Figure 1. Rhodnius prolixus cDNA for the CAPA receptor and deduced translation. (A)
Nucleotide and amino acid number are denoted in the left and right margins, respectively. The
predicted α-helices forming the transmembrane domains are box outlined and numbered in the
left margin adjacent to each predicted domain (TM1-7). The smaller variant (capa-r2) is
produced following alternative splicing over nucleotides 164-256 (nucleotide region underlined)
removing a portion of the second exon encoding a region spanning the first and second
transmembrane domains. (B) Northern blot showing approximate size of the RhoprCAPA-R
transcripts as determined by hybridization of alimentary canal mRNA. (C) Predicted gene
structure showing exon/intron size and location based on amplification of cDNA and comparison
with preliminary assembly of R. prolixus genome.
![Page 172: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/172.jpg)
158
![Page 173: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/173.jpg)
159
Figure 2. Predicted membrane topology of the R. prolixus CAPA receptor based on data
obtained from the TMHMM Server v. 2.0. (A) Topology probability plot for the capa-r1
receptor. Note the seven predicted transmembrane domains and the N-terminal extracellular and
C-terminal intracellular regions common of GPCRs. (B) Topology probability plot for CAPA-
R2. Note the lack of seven predicted transmembrane domains and the N-terminal and C-terminal
intracellular regions uncharacteristic of GPCRs.
![Page 174: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/174.jpg)
160
![Page 175: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/175.jpg)
161
CAPA-R2 protein lacks a region spanning between the first and second transmembrane domains,
and consequently, it does not satisfy one of the chief characteristics of the GPCR super family.
Sequence comparison of the resulting translation of capa-r1 and capa-r2 transcripts with
orthologous proteins predicted or identified in other insects revealed some interesting findings
regarding the sequence similarity among the receptors (Figure 3A). Either character-based
maximum parsimony or distance-based neighbor-joining analyses yield similar outcomes in tree
topology (neighbor-joining results are shown). A monophyletic group contains the R. prolixus
CAPA receptor sequences identified herein together with other insect CAPA receptors, while the
pyrokinin-1 receptors form a distinct clade (Figure 3B) with each having high bootstrapping
support. Interestingly, within the CAPA receptor clade, the hemimetabolous CAPA receptor
sequences are grouped within the same subclade; however, the holometabolous species
sequences do not all group together within a common subclade (Figure 3B). Instead, the CAPA
receptor sequences from A. mellifera and T. castaneum are grouped within the hemimetabolous
CAPA receptor subclade. The relationship separating the monophyletic group containing the
receptor sequences of the hemimetabolous insect representatives as well as that of A. mellifera
and T. castaneum and the group containing the Dipteran CAPA receptors is well supported with
high bootstrapping statistics. The clade consisting of the two R. prolixus receptor sequences, and
in addition, that including the D. melanogaster and A. gambiae receptor sequences, also has very
high bootstrapping support. The monophyletic group consisting of two identified pyrokinin-1
receptors from the Dipteran insects, D. melanogaster and A. gambiae as well as an unidentified
closely related receptor from A. aegypti (XP_001662936), which we classify as a pyrokinin
receptor based on sequence analysis, also has high bootstrapping support. All other relationships
among sequences were not highly supported (bootstrapping support ranging between 71-81%).
Expression pattern of CAPA receptor transcript variants
As a method to predict potential physiological targets for the R. prolixus CAPA peptides, we
investigated the spatial expression profile of the two transcript variants encoding the putative
CAPA receptor in R. prolixus. Expression of capa-r1 transcript is predominantly localized to the
alimentary canal (Figure 4A). More specifically, expression is predominantly in the MTs and the
![Page 176: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/176.jpg)
162
Figure 3. Sequence and phylogenetic analysis of CAPA receptors in insects. (A) Protein
alignment of the insect CAPA receptors identified or predicted based on genome sequence data.
The predicted location of the seven transmembrane domains are noted above each row (TM1-
TM7). Dark gray shading denotes sequences identical in greater than 50% of that particular
column while light gray shading denotes similar residue to column-consensus residue. (B) The
phylogenetic relationship of the insect CAPA and PK-1 receptors were deduced using the
Neighbor-Joining method. Branch length units are the number of amino acid substitutions per
site. The closest human homologue to the insect CAPA receptors, the neuromedin U receptor-2,
was included in the analysis and imposed as the out group.
![Page 177: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/177.jpg)
163
![Page 178: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/178.jpg)
164
Figure 4. CAPA receptor expression profile in fifth-instar tissues. The capa-r1 transcript
expression is denoted by open columns while capa-r2 transcript expression is denoted by filled
columns. (A) Expression was detected throughout the alimentary canal. Fold difference in
expression is relative to capa-r1 expression in the hindgut. Abbreviations: central nervous
system (CNS); salivary glands (SG); male reproductive tissue (Male Repro); female reproductive
tissue (Female Repro); Posterior midgut (Post. Midgut); Anterior midgut (Ant. Midgut); trachea,
dorsal vessel, abdominal nerves, diaphragm and fat body (Tr, DV, ABN); and whole Malpighian
tubules (whole MTs). (B) Upper and lower segments of MTs were dissected and separated prior
to RNA isolation and cDNA synthesis. Fold difference in expression is shown relative to the
expression of the capa-r1 transcript in lower tubule segments.
![Page 179: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/179.jpg)
165
![Page 180: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/180.jpg)
166
anterior midgut, however, expression also exists in the oesophagus, posterior midgut and
hindgut, with the latter demonstrating lowest levels. Other tissues, such as the central nervous
system, salivary glands, reproductive tissues, trachea, fat body, dorsal vessel or abdominal
nerves, do not exhibit any detectable levels of either transcript. In all tissues where capa-r1
expression is identified, substantially lower expression of the second transcript variant, capa-r2,
is evident, with values approximately ~350-fold less relative to capa-r1 (Figure 4A and 4B). We
also were interested in analyzing the expression of the two transcript variants encoding the
putative RhoprCAPA receptor in distinct upper secretory and lower reabsorptive regions of the
MTs. The capa-r1 transcript expression is localized almost entirely to the upper lengths of the
tubules, with greater than 60-fold higher levels compared to the lower segment expression
(Figure 4B). Again, the expression of the second transcript variant, capa-r2, demonstrates
extremely low levels relative to capa-r1 (Figure 4B) consistent with the relative values identified
in other tissues where the two transcripts are expressed (see Figure 4A).
Functional ligand-receptor interaction assay
Determination of the endogenous ligand(s) for the two receptor variants was facilitated using a
calcium mobilization assay in heterologously expressed R. prolixus CAPA receptor clones in
CHO-K1 cells. Firstly, we tested the endogenously expressed peptides encoded by the
RhoprCAPA-α gene (Figure 5A). The capa-r1 clone has the greatest activity when tested with
RhoprCAPA-α2 (EC50 = 385nM). Activation of capa-r1 is also evident with the pyrokinin-
related peptide, RhoprCAPA-αPK1 (EC50 > 5µM); however at the highest dose tested, this
accounted for only a 35% activation (approximately 40-fold lower efficacy) compared to the
highest response observed with RhoprCAPA-α2. At all doses tested, the first peptide encoded in
the RhoprCAPA-α gene, RhoprCAPA-α1, did not yield any detectable activation of the capa-r1
receptor. The other receptor variant, capa-r2, was also tested against the peptides encoded by
the RhoprCAPA-α gene; however, no response can be detected against any of the three native
peptides (Figure 5B). Insect CAPA peptides normally contain the consensus C-terminal
sequence FPRV-NH2 and since the non-canonical CAPA peptide, RhoprCAPA- α1, shows no
activation of the capa-r1 receptor, we tested structural analogs (see Table 1) of this native
![Page 181: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/181.jpg)
167
Figure 5. Heterologous expression assay of the R. prolixus CAPA receptor in CHO-K1 cells.
(A) Activity of the native RhoprCAPA-α gene products on the capa-r1 receptor variant. Dose-
response curve demonstrating activity of RhoprCAPA-α2 on the expressed capa-r1 receptor.
The pyrokinin-like peptide, RhoprCAPA-αPK1, also activates the expressed capa-r1 receptor,
but is approximately 40-fold less potent. (B) Using the same ligands on the capa-r2 receptor
variant. None of the native peptides activate capa-r2. (C) Activity of structural analogs of the
first encoded peptide of the RhoprCAPA-α gene, RhoprCAPA-α1. Activity of the RhoprCAPA-
α1∆PRV-NH2 analog closely mimics the efficacy of RhoprCAPA-α2, whereas the RhoprCAPA-
α1∆LRV-NH2 analog demonstrates an intermediate response. (D) Activity of structurally-
related non-native peptides containing the PRXamide motif. Neither human AVP nor D.
melanogaster hugγ (hugin-1) are active on the expressed capa-r1 receptor at the doses tested.
All peptides tested in (C) or (D) are inactive on the expressed capa-R2 receptor (not shown). In
each plot, vertical bars denote standard errors and all values are plotted relative to the maximum
response obtained by RhoprCAPA-α2 in cells expressing the capa-r1 receptor. For (B),
maximum response values were taken from replicate plates done in tandem but challenged with
cells expressing the capa-R1 receptor.
![Page 182: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/182.jpg)
168
![Page 183: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/183.jpg)
169
Table 1. Summary of peptides and analogs structurally related to the CAPA peptides in R.
prolixus tested in the functional expression assays.
Peptide/Analog Name Sequence EC50(M) Rhopr-
capaR1
EC50(M) Rhopr-
capaR2
RhoprCAPA-α1 SPISSVGLFPFLRA-NH2 Not active Not active
RhoprCAPA-α2 EGGFISFPRV-NH2 3.85x10-7 Not active
RhoprCAPA-αPK NGGGGNGGGLWFGPRL-
NH2
>5x10-6 Not active
RhoprCAPA-α1∆LRV-NH2 SPISSVGLFPFLRV-NH2 >5x10-6 Not active
RhoprCAPA-α1 ∆PRV-NH2 SPISSVGLFPFPRV-NH2 3.35x10-7 Not active
HomsaAVP CYFQNCPRG-NH2 Not active Not active
DromeHugin-1(hugγ) pQLQSNGEPAYRVRTPRL-
NH2
Not active Not active
![Page 184: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/184.jpg)
170
peptide in order to identify which residues may have important roles for effective activation of
this receptor. While the native RhoprCAPA-α1 peptide is inactive on the capa-r1 receptor, the
modified analog, RhoprCAPA- α1∆LRV-NH2, with a C-terminal valine substituting the native
alanine residue, shows some activation of the capa-r1 receptor, but at the highest dose tested
(5µM), this activity is approximately 36% of the maximum response with RhoprCAPA-α2. A
second modified analog, RhoprCAPA- α1∆PRV-NH2, having the LRA-NH2 of the native
peptide substituted with the PRV-NH2 C-terminus, demonstrates complete recovery of activity
on the capa-r1 receptor (Figure 5C). In fact, at some intermediate doses (50-500nM), the
RhoprCAPA-α1∆PRV-NH2 analog has greater potency than the RhoprCAPA-α2 peptide,
although not at the highest tested concentrations (>1.25µM). Similar experiments conducted on
cell lines transfected with the capa-r2 receptor variant demonstrate that these peptides/analogs
are all inactive for calcium mobilization (data not shown). We next tested the transfected cell
line with the structurally-related peptides, human AVP (HomsaAVP) and D. melanogaster hugin
γ (Dromehugγ). Neither of these peptides were active on the capa-r1 receptor (Figure 5D), or on
the capa-r2 receptor variant (data not shown). Finally, control cells that were transfected with
empty vector showed no response when challenged with any of the peptides used in this study
(not shown), indicating that the calcium mobilization results were indeed mediated by the
transfected capa-r1 receptor and not the result of activation of any endogenous receptors in the
CHO cells.
![Page 185: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/185.jpg)
171
Discussion
We have isolated and characterized the first anti-diuretic hormone receptor in insects. This
receptor, found in the blood-feeding Chagas’ disease vector, R. prolixus, shows high amino acid
sequence similarity to CAPA receptors identified in other insects such as D. melanogaster
(Iversen et al., 2002; Park et al., 2002), A. gambiae (Olsen et al., 2007) and T. castaneum (Li et
al., 2008) as well as putative CAPA receptors predicted or annotated in the A. pisum, P. humanus
corporis and A. mellifera genomes. The CAPA-related peptides in insects play key roles in
regulating fluid secretion by MTs. In Dipterans, these peptides are described as stimulating fluid
secretion by the principal cells of MTs (Pollock et al., 2004) by way of calcium signaling (Rosay
et al., 1997) and activation of nitric oxide synthase and soluble guanylate cyclase (Kean et al.,
2002; Pollock et al., 2004). Unlike this stimulatory effect in Dipteran MTs, the CAPA-related
peptide in R. prolixus, RhoprCAPA-α2 (-β2), acts as an inhibitor of MTs fluid secretion (Paluzzi
et al., 2008) counteracting the stimulatory effect of the diuretic hormone 5-HT, and thus is
referred to as an anti-diuretic hormone. In Dipterans, it is unknown if these peptides regulate any
other tissue in addition to the MTs. In R. prolixus, we have recently shown that the anti-diuretic
hormone, RhoprCAPA-α2 (-β2), is also a potent inhibitor of anterior midgut absorption
stimulated by 5-HT (Ianowski et al., 2010; Orchard and Paluzzi, 2009).
In this study, we show expression data for a CAPA receptor homolog in R. prolixus that
correlates with the physiological roles identified previously in the MTs (Paluzzi et al., 2008) and
anterior midgut (Ianowski et al., 2010; Orchard and Paluzzi, 2009). Interestingly, we have
identified that additional tissues that comprise the alimentary canal contain appreciable levels of
CAPA receptor expression, namely in oesophagus, posterior midgut and hindgut, suggesting
additional targets for the endogenous CAPA peptides. Future studies will investigate what
physiological roles the native CAPA peptides may facilitate at these newly identified target
tissues, but these tissues are not considered to be involved in the rapid post-prandial diuresis in
R. prolixus.
![Page 186: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/186.jpg)
172
In previous studies where insect CAPA receptors have been identified, little data has been
presented on their spatial expression characteristics (Iversen et al., 2002; Olsen et al., 2007; Park
et al., 2002). Expression has been shown associated with the thorax and abdomen in adult D.
melanogaster (Iversen et al., 2002) and more recently, tubule-specific expression was confirmed
in A. gambiae, A. stephensi and D. melanogaster (Pollock et al., 2004). In this latter study,
attempts at amplifying an orthologous receptor from A. aegypti tubules were unsuccessful.
However, in silico attempts at identifying a CAPA receptor orthologue in the A. aegypti genome
revealed a receptor sequence sharing greatest similarity to the D. melanogaster and A. gambiae
pyrokinin receptor 1 (see Figure 3B); thus, it remains unclear if a CAPA receptor exists in this
insect. Nevertheless, CAPA receptor expression associated with tissues other than the MTs
remains elusive in insects and thus this is the first study to comprehensively examine the tissue
expression profile for this receptor type. In the MTs, we investigated whether the CAPA
receptor transcripts were differentially expressed in the upper and lower tubule segments. We
found the capa-r1 transcript level is substantially greater in the upper secretory segment of the
MTs with relatively little expression in the lower reabsorptive segment. This finding correlates
well with the profound anti-diuretic effect on upper secretory segments stimulated with 5-HT. In
the lower tubules, RhoprCAPA-α2 (-β2) does not appear to modulate reabsorption of K+ and it
remains unclear if this peptide marginally enhances reabsorption of water (Paluzzi & Ianowski,
unpublished). The reabsorption of water by the lower segment of the tubule has not been shown
by any diuretic peptides or 5-HT (Donini et al., 2008), although 5-HT does lead to K+ and Cl-
reabsorption in the lower segment (Haley and O'Donnell, 1997; Maddrell and Phillips, 1975;
O'Donnell et al., 1982). Thus, the greater than 60-fold difference in expression of capa-r1
between these functionally distinct MTs segments parallels the physiological effects previously
documented for RhoprCAPA-α2 on MTs. The effects, if any, of these peptides on the lower
segments will require further investigation. Although expression of the capa-r2 transcript was
detected in similar tissues as the capa-r1 transcript, relative expression levels are substantially
lower (approximately < 350-fold) and thus it is unclear what function, if any, the atypical GPCR
product of this transcript may hold.
![Page 187: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/187.jpg)
173
To support the phylogenetic analysis and expression profile data suggesting the identified
receptor was a CAPA receptor homolog, we tested the receptor clones in a heterologous
expression assay. The capa-r1 expressed receptor was activated by low concentrations of
RhoprCAPA-α2; however, the first encoded peptide, RhoprCAPA-α1, does not activate the
receptor over the range of concentrations tested. This is in contrast to the result shown for
CAPA receptors in other insects where the receptors are activated more or less equally by the
first two peptides produced by the CAPA prepropeptide (Iversen et al., 2002; Olsen et al., 2007;
Park et al., 2002). However, this result is not surprising considering that the sequence of the first
peptide in each of the two R. prolixus CAPA precursors has lost the consensus CAPA peptide C-
terminal FPRV-NH2 sequence. Interestingly, the capa-r1 receptor is also activated by the native
pyrokinin-like peptide, RhoprCAPA-αPK1, although this peptide is about 40-fold less potent
than RhoprCAPA-α2. In studies on the Dipteran CAPA receptors, the pyrokinin-like peptides
encoded by their respective CAPA precursors activate distinctive pyrokinin-1 receptors and do
not activate the CAPA receptors, while the CAPA peptides have no activity on the pyrokinin-1
receptors (Cazzamali et al., 2005; Iversen et al., 2002; Olsen et al., 2007; Park et al., 2002).
Experiments testing structural analogs of the RhoprCAPA-α1 revealed that the lack of the
consensus PRV-NH2 motif is indeed responsible for the loss of activity. Structural analogs with
the consensus motif partially or fully restored demonstrate activity on the expressed capa-r1
receptor, although only the fully restored consensus analog, RhoprCAPA-α1∆PRV-NH2, had
activity closely comparable to RhoprCAPA-α2. In support of these findings, alanine-
replacement analogs of Manduca sexta CAP2b (also known as ManseCAPA-1; (Loi and Tublitz,
2004)) tested for diuretic activity in the housefly, Musca domestica, demonstrated that the C-
terminal residues are critical for biological function (Nachman and Coast, 2007). Exogenous
PRXamide peptides sharing limited structural similarity to the CAPA peptides, namely human
AVP and D. melanogaster hugin-γ peptides, did not activate the capa-r1 receptor. Similar
results regarding the specificity of the insect CAPA receptor orthologs were shown previously
with no response to mammalian AVP (Park et al., 2002) or D. melanogaster hugin-γ (Iversen et
al., 2002; Park et al., 2002). Furthurmore, the A. gambiae homolog of the hugin-γ peptide was
similarly inactive on the mosquito CAPA-receptor (Olsen et al., 2007). In contrast to the results
obtained for the R. prolixus capa-r1 receptor, all the peptides tested in this study were inactive
on the capa-r2 expressed receptor. Although such a result would be expected considering the
![Page 188: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/188.jpg)
174
atypical predicted membrane topology of the CAPA-R2 receptor, the possibility of a functional
role for this protein cannot be dismissed. A schematic overview of the R. prolixus CAPA
neuropeptide/receptor signaling system, with emphasis of the known physiological roles for the
anti-diuretic hormone RhoprCAPA-α2, is presented (see Figure 6) based on the receptor
transcript spatial expression profile and the physiological effects previously identified (Quinlan
et al., 1997; Paluzzi and Orchard, 2006; Paluzzi et al., 2008; Ianowski et al., 2010).
The GPCR super family are very often targets of pharmaceutical research leading to treatment
for malignancies and diseases, and, it has been stated that the potential for future drug discovery
is immense considering many pharmaceuticals target only a handful of GPCRs (Fredriksson et
al., 2003). Rhodnius prolixus is a principal vector of Chagas’ disease and both sexes must gorge
on a blood meal during each nymphal stage for growth and development, and adult females
require a blood meal to increase egg production. Thus, at the level of the individual insect, the
opportunity to transmit disease can be 12 times as great compared to many mosquitoes where
only adult females will gorge on a blood meal. It has been shown that the CAPA peptide,
RhoprCAPA-α2, plays a significant role in coordinating an anti-diuretic strategy in R. prolixus
(Ianowski et al., 2010; Paluzzi et al., 2008). Potentially, the development of biologically stable
mimetic agonists or antagonists affecting the R. prolixus CAPA receptor could disrupt fluid and
salt homeostasis and overall diuresis, and thereby impede the transmission of T. cruzi infection
that occurs during the rapid post-prandial diuresis and excretion in R. prolixus.
![Page 189: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/189.jpg)
175
Figure 6. Schematic overview of the proposed CAPA peptide/receptor signaling system in R.
prolixus. Putative target tissues and proposed in vivo roles based on CAPA receptor spatial
expression profile carried out herein and previous in vitro physiological results for RhoprCAPA-
α2 (Paluzzi and Orchard, 2006; Paluzzi et al., 2008; Ianowski et al., 2010). Adapted figure of
alimentary canal drawn by Zach McLaughlin.
![Page 190: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/190.jpg)
176
![Page 191: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/191.jpg)
177
References
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanatides, P. G.,
Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F. et al. (2000). The Genome
sequence of Drosophila melanogaster. Science 287, 2185-2195.
Cazzamali, G., Torp, M., Hauser, F., Williamson, M. and Grimmelikhuijzen, C. J. P.
(2005). The Drosophila gene CG9918 codes for a pyrokinin-1 receptor. Biochem.
Biophys. Res. Commun. 335, 14-19.
Coast, G. M., Orchard, I., Phillips, J. E. and Schooley, D. A. (2002). Insect diuretic and anti-
diuretic hormones. In Advances in Insect Physiology, pp. 279-409: Academic Press.
Davies, S. A., Stewart, E. J., Huesmann, G. R., Skaer, N. J. V., Maddrell, S. H. P., Tublitz,
N. J. and Dow, J. A. T. (1997). Neuropeptide stimulation of the nitric oxide signaling
pathway in Drosophila melanogaster Malpighian tubules. American Journal of
Physiology-Regulatory Integrative and Comparative Physiology 42, R823-R827.
Donini, A., O'Donnell, M. J. and Orchard, I. (2008). Differential actions of diuretic factors on
the Malpighian tubules of Rhodnius prolixus. J. Exp. Biol. 211, 42-48.
Fredriksson, R., Lagerstrom, M. C., Lundin, L. G. and Schioth, H. B. (2003). The G-protein-
coupled receptors in the human genome form five main families. Phylogenetic analysis,
paralogon groups, and fingerprints. Mol. Pharmacol. 63, 1256-1272.
Haley, C. and O'Donnell, M. J. (1997). K+ reabsorption by the lower Malpighian tubule of
Rhodnius prolixus: Inhibition by Ba2+ and blockers of H+/K+-ATPases. J. Exp. Biol.
200, 139-147.
Hauser, F., Cazzamali, G., Williamson, M., Blenau, W. and Grimmelikhuijzen, C. J. (2006).
A review of neurohormone GPCRs present in the fruitfly Drosophila melanogaster and
the Honey Bee Apis mellifera. Prog. Neurobiol. 80, 1-19.
Hosoya, M., Moriya, T., Kawamata, Y., Ohkubo, S., Fujii, R., Matsui, H., Shintani, Y.,
Fukusumi, S., Habata, Y., Hinuma, S. et al. (2000). Identification and functional
![Page 192: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/192.jpg)
178
characterization of a novel subtype of neuromedin U receptor. J. Biol. Chem. 275,
29528-29532.
Ianowski, J. P., Paluzzi, J. P., Te Brugge, V. A. and Orchard, I. (2010). The anti-diuretic
neurohormone RhoprCAPA-2 down regulates fluid transport across the anterior midgut
in the blood-feeding insect Rhodnius prolixus. Am. J. Physiol. Regul. Integr. Comp.
Physiol. 298(3), R548-57
Iversen, A., Cazzamali, G., Williamson, M., Hauser, F. and Grimmelikhuijzen, C. J. P.
(2002). Molecular cloning and functional expression of a Drosophila receptor for the
neuropeptides capa-1 and -2. Biochem. Biophys. Res. Commun. 299, 628.
Kean, L., Cazenave, W., Costes, L., Broderick, K. E., Graham, S., Pollock, V. P., Davies, S.
A., Veenstra, J. A. and Dow, J. A. T. (2002). Two nitridergic peptides are encoded by
the gene capability in Drosophila melanogaster. Am J Physiol Regul Integr Comp
Physiol 282, R1297-1307.
Kozak, M. (1984). Point mutations close to the AUG initiator codon affect the efficiency of
translation of rat preproinsulin in vivo. Nature 308, 241-246.
Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiator codon that
modulates translation by eukaryotic ribosomes. Cell 44, January.
Kozak, M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger
RNAs. Nucleic Acids Res. 15, 8125-8148.
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam,
H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R. et al. (2007). Clustal W and
Clustal X Version 2.0. Bioinformatics 23, 2947-2948.
Li, B., Predel, R., Neupert, S., Hauser, F., Tanaka, Y., Cazzamali, G., Williamson, M.,
Arakane, Y., Verleyen, P., Schoofs, L. et al. (2008). Genomics, transcriptomics, and
peptidomics of neuropeptides and protein hormones in the red flour beetle Tribolium
castaneum. Genome Res. 18, 113-122.
Loi, P. K. and Tublitz, N. J. (2004). Sequence and expression of the CAPA/CAP2b gene in the
tobacco hawkmoth, Manduca sexta. J. Exp. Biol. 207, 3681-3691.
![Page 193: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/193.jpg)
179
Maddrell, S. H. P. and Phillips, J. E. (1975). Secretion of hypo-osmotic fluid by the lower
Malpighian tubules of Rhodnius prolixus. J. Exp. Biol. 62, 671-683.
Nachman, R. and Coast, G. (2007). Structure-activity relationships for in vitro diuretic activity
of CAP2b in the housefly. Peptides 28, 57-61.
O'Donnell, M.,J., Aldis, G.,K. and Maddrell, S. H.,P. (1982). Measurements of osmotic
permeability in the Malpighian tubules of an insect, Rhodnius prolixus Stal. Proc. R.
Soc. Lond. B 216, 267-277.
Olsen, S. S., Cazzamali, G., Williamson, M., Grimmelikhuijzen, C. J. P. and Hauser, F.
(2007). Identification of one capa and two pyrokinin receptors from the malaria mosquito
Anopheles gambiae. Biochemical and biophysical research communications 362, 245-
251.
Orchard, I. (2009). Peptides and serotonin control feeding-related events in Rhodnius prolixus.
Front. Biosci. (Elite Ed) 1, 250-262.
Orchard, I. and Paluzzi, J. P. (2009). Diuretic and anti-diuretic hormones in the blood-gorging
bug Rhodnius prolixus. Ann. N. Y. Acad. Sci. 1163, 501-503.
Paluzzi, J. P. and Orchard, I. (2006). Distribution, activity and evidence for the release of an
anti-diuretic peptide in the kissing bug Rhodnius prolixus. J. Exp. Biol. 209, 907-915.
Paluzzi, J. P. and Orchard, I. (2010). A second gene encodes the anti-diuretic hormone in the
insect, Rhodnius prolixus. Mol. Cell. Endocrinol. 317, 53.
Paluzzi, J. P., Russell, W. K., Nachman, R. J. and Orchard, I. (2008). Isolation, cloning, and
expression mapping of a gene encoding an anti-diuretic hormone and other CAPA-related
peptides in the disease vector, Rhodnius prolixus. Endocrinology 149, 4638-4646.
Park, Y., Kim, Y. and Adams, M. E. (2002). Identification of G protein-coupled receptors for
Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-
receptor coevolution. Proc. Natl. Acad. Sci. U. S. A. 99, 11423-11428.
Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-
PCR. Nucleic Acids Res. 29, e45.
![Page 194: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/194.jpg)
180
Pollock, V. P., McGettigan, J., Cabrero, P., Maudlin, I. M., Dow, J. A. T. and Davies, S. A.
(2004). Conservation of capa peptide-induced nitric oxide signaling in Diptera. J. Exp.
Biol. 207, 4135-4145.
Quinlan, M., Tublitz, N. and O'Donnell, M. (1997). Anti-diuresis in the blood-feeding insect
Rhodnius prolixus Stal: the peptide CAP2b and cyclic GMP inhibit Malpighian tubule
fluid secretion. J Exp Biol 200, 2363-2367.
Rosay, P., Davies, S. A., Yu, Y., Sozen, M. A., Kaiser, K. and Dow, J. A. (1997). Cell-type
specific calcium signaling in a Drosophila epithelium. J. Cell. Sci. 110 ( Pt 15), 1683-
1692.
Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007). MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596-1599.
Te Brugge, V., Ianowski, J. P. and Orchard, I. (2009). Biological activity of diuretic factors
on the anterior midgut of the blood-feeding bug, Rhodnius prolixus. Gen. Comp.
Endocrinol. 162, 105-112.
![Page 195: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/195.jpg)
181
Acknowledgments
This research was made possible through an NSERC Discovery Grant to I.O., a USDA-NRI-
CSREES 2007-35604-17759 to Y.P. and an NSERC Canada Graduate Scholarship and Michael
Smith Foreign Study Supplement to J.P.P.
![Page 196: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/196.jpg)
182
Appendices
Table S1. Degenerate primers designed from the conserved regions of previously identified
CAPA receptors used for screening fifth instar R. prolixus upper Malpighian tubules cDNA
library.
Oligo Name Oligo Sequence (degeneracy) Amino Acid Sequence
(receptor region)
capaRfor1a1 gcnacnaaytaytayctnttytc (1024)
ATNYYLFS/NLA
(IL1-TM2 boundary)
capaRfor1a2 gcnacnaaytaytayctnttyag (1024)
capaRfor1a3 gcnacnaaytaytayctnttyaa (1024)
capaRfor1b1 gcnacnaaytaytayttrttytc (512)
capaRfor1b2 gcnacnaaytaytayttrttyag (512)
capaRfor1b3 gcnacnaaytaytayttrttyaa (512)
capaRfor2a1 ctncanathgtncgntt (768) YVSVLTIVAF
(TM3) capaRfor2a2 ttrcanathgtncgntt (384)
capaRrev1a raaraangcdatnacnacngc (768) MLS/AAVVIT/AFF
(TM6) capaRrev1b raaraantgdatnacnacngc (768)
![Page 197: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/197.jpg)
183
Table S2. Gene-specific primers for the R. prolixus CAPA receptor. (A) Primers used for 5’ and
3’ rapid amplification of cDNA ends (RACE) of the R. prolixus CAPA-receptor. (B) Transcript-
specific primers used in quantitative reverse transcriptase PCR (RT-qPCR) to determine relative
expression of each transcript variant. (C) Primers which spanned the complete open reading
frame and which had the 5’UTR modified by introducing a Kozak translation initiation sequence
(see methods).
Oligo Name Oligo Sequence
A
5’ RACE primers:
capaRrev1 ggcaaataaagaacagtgtacagga
capaRrev2 gtagtataaattgcgaatggtgctg
capaRrev3 cctaatgatatcaaccaaagtgtgc
capaRrev4 cagaatccatgggtattgttgc
capaRrev5 ttcggcaatcctaacagtaataacac
3’ RACE primers:
capaRfor1 gcacactttggttgatatcattagg
capaRfor2 tttgcagcaccattcgc
capaRfor3 gcgccatgttgaagcag
capaRfor4 gtggaaacgtacatggagagc
capaRfor5 aatgttaatggcggtggtg
![Page 198: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/198.jpg)
184
Table S2. (continued)
B
capa-r1 specific forward primer:
capaR1-qPCRfor tcatttctggactatttggtaatttagc
capa-r2 specific forward primer:
capaR2-qPCRfor tcatttctggactatttgtgttattactg
Common reverse primer over exon boundary:
capaR-qPCRrev gagacgtaggatgacatttctgag
C
Primers to amplify full ORF and
introduce Kozak sequence:
capaR_fullORF_for aaaagactgttaataatgaatagc
capaR_fullORF_rev aatctggtcattttaaagc
![Page 199: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/199.jpg)
185
Copyright Acknowledgments
A modified version of the preceeding chapter was accepted for publication in Proceedings of the National Academy of Sciences (PNAS) with manuscript tracking number 2010-03666R. No permission to reproduce the paper as a part of this dissertation was required as per the PNAS author rights and permissions policy.
Full citation details:
Isolation, expression analysis and functional characterization of the first anti-diuretic hormone receptor in insects. Paluzzi JP, Park, Y, Nachman, RJ and Orchard I. PNAS. IN PRESS (available online in the Early Edition the week of May 17, 2010)
Copyright © 2010, National Academy of Sciences, U.S.A.
![Page 200: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/200.jpg)
186
Chapter 6:
General Discussion
![Page 201: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/201.jpg)
187
Linking the chapters
As discussed in detail in the first chapter and throughout the subsequent chapters that comprise
this thesis, insects contain a number of neuroendocrine-derived factors that regulate the levels of
water and salts present within the haemolymph over a normal homeostatic range. This
physiologically essential mechanism allows insects to adapt to a wide array of ecological niches
and/or feeding strategies where they may be subjected to extremes in water, ion and nutrient
composition as well as intake. In many insects, the excretory system is normally composed of the
Malpighian tubules and hindgut, but in R. prolixus, the anterior midgut also plays a major role in
the rapid post-prandial diuresis (Farmer et al., 1981; Te Brugge et al., 2009). Factors that
regulate the excretory system in insects include a variety of peptide families along with biogenic
amines (Coast et al., 2002; Coast, 2009; Orchard, 2009). The focus of the research carried out
during my graduate tenure was on the isolation, characterization and physiological roles of
factors involved in the anti-diuretic strategy of the haematophagous insect, R. prolixus.
Specifically, my thesis research identified endogenous CAPA-related peptides and investigated
their role in maintenance of water and salts following the post-prandial rapid diuresis.
CAPA-related peptides have been isolated from a wide variety of insects as well as arachnids
(Predel and Wegener, 2006). Many of these peptides have been identified in great abundance
within the abdominal neurohemal organs, also known as perivisceral organs (Predel et al., 1999).
Some of these peptides have been shown to have both cardioacceleratory as well as myotropic
activity in several cockroach species (Eckert et al., 1999; Predel et al., 1995; Predel et al., 1998;
Predel et al., 2001; Wegener et al., 2001). Owing to these physiological roles and their
neurohemal release sites, these peptides have also been referred to as periviscerokinins (Eckert et
al., 1999; Predel et al., 1995; Predel et al., 1998; Predel et al., 2001; Wegener et al., 2001).
However, it is unclear if these peptides hold similar physiological roles in other insects including
R. prolixus. In addition, as I have shown in R. prolixus (Paluzzi and Orchard, 2006; Paluzzi et
al., 2008; Paluzzi and Orchard, 2010) and has been demonstrated in other insects (Kean et al.,
2002; Loi and Tublitz, 2004), these peptides are localized in other tissues in addition to the
abdominal neurohemal organs. These peptides are diuretic in Dipteran species (Pollock et al.,
![Page 202: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/202.jpg)
188
2004), are anti-diuretic in R. prolixus (Paluzzi et al., 2008; Quinlan et al., 1997) and T. molitor
(Wiehart et al., 2002), and are without effect on diuresis in other insects. Therefore, I have
maintained the nomenclature consistent with the first CAPA-gene identification (Kean et al.,
2002; Loi and Tublitz, 2004), which confirms that these peptides are associated within the CAPA
precursor polypeptide.
Isolation and evidence of release of an anti-diuretic factor with physiogical effects similar to
ManseCAP2b
In chapter two of this dissertation (published in the Journal of Experimental Biology, 2006,
209(5): 907-15), my research identified that R. prolixus contains endogenous factors with
biological activity similar to the exogenous peptide, ManseCAP2b. This peptide was previously
demonstrated to contain potent anti-diuretic activity on R. prolixus Malpighian tubules (Paluzzi
et al., 2008; Quinlan et al., 1997). Specifically, fluid secretion by tubules stimulated with the
diuretic hormone, serotonin, were inhibited by increasing doses of ManseCAP2b (Paluzzi et al.,
2008; Quinlan et al., 1997). In addition, the intracellular second messenger cyclic GMP
(cGMP) was proposed as a putative second messenger as it also was capable of inhibiting fluid
secretion stimulated with serotonin, and in addition, was shown to increase coincident with
cessation of the rapid post-gorging diuresis (Paluzzi et al., 2008; Quinlan et al., 1997).
Malpighian tubules stimulated with serotonin had significantly decreased levels of cGMP
compared to unstimulated tubules; however, tubules receiving serotonin and ManseCAP2b did
not have cGMP levels significantly different from unstimulated tubules. Although this suggests
that cGMP may play a role in anti-diuresis in R. prolixus, the data also suggest that
ManseCAP2b may be abolishing the effect of the diuretic hormone by inactivating a cGMP-
specific phosphodiesterase (Paluzzi et al., 2008; Quinlan et al., 1997; Quinlan and O'Donnell,
1998). In my research, using a partially purified peptidergic sample from fifth instar R. prolixus
CNS, an endogenous factor, with chromatographic properties similar to ManseCAP2b, mimicked
the effects of ManseCAP2b and was capable of inhibiting fluid secretion of MTs stimulated with
serotonin and increasing levels of cGMP in MTs treated with serotonin. In addition, the results
of immunohistochemical analysis support the presence of an endogenous CAP2b-like peptide
![Page 203: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/203.jpg)
189
since a number of cells were identified using an antibody that recognizes peptides with a carboxy
terminal PRX amide (where X = I, L, M or V)(Žitnaň et al., 2003). Importantly, control
experiments, in which the antibody was preincubated with commercially synthesized
ManseCAP2b, did not reveal any cells within the CNS (staining abolished), thus demonstrating
the specificity of the antibody. Of specific interest, three pairs of strongly staining
neurosecretory cells localized within the abdominal neuromeres along with their derived
neurohemal release sites along the proximal region of abdominal nerves 2-4, demonstrate
decreased immunohistochemical staining beginning 3-4 hours following blood meal
engorgement. This suggests that the contents of these cells are being released at a time that
coincides with the cessation of the rapid post-gorging diuresis (Maddrell, 1963; Maddrell, 1964).
Although neurosecretory axon terminals containing neurosecretory granules have been identified
associated with the MTs in R. prolixus, such a nervous supply has not been identified in other
insects (Maddrell, 1969). Immunohistochemical analyses did not detect any CAP2b-like
immunoreactivity associated with the MTs in R. prolixus, thus suggesting a neuroendocrine
regulation of this tissue by the endogenous CAP2b-related peptides. Taken together, these
results strongly suggest that the endogenous CAP2b-related peptide(s) in R. prolixus function as
potent anti-diuretic neurohormones which are released into the insect haemolymph to regulate
visceral tissues and reduce diuresis following its rapid post-gorging activation.
Identification of a gene encoding an anti-diuretic hormone in R. prolixus and analysis of cell-
specific expression in fifth instars
In chapter three of this dissertation (published in Endocrinology, 2008, 149(9): 4638-46), using a
molecular approach in conjunction with MALDI-TOF tandem mass spectrometry, my research
confirmed that R. prolixus contains a CAP2b/CAPA-related peptide, named RhoprCAPA-α2
(EGGFISFPRV-NH2), with potent anti-diuretic effects on MTs (IC50 = 4.13nM) stimulated with
serotonin. This peptide is the second encoded peptide in a transcript encoding two other
peptides. The first encoded peptide, which in other insects is also considered a CAPA peptide
due to the conserved carboxy terminal FPRV-NH2 motif (Kean et al., 2002; Loi and Tublitz,
2004), is termed RhoprCAPA-α1 (SPISSVGLFPFLRA-NH2); however, this R. prolixus peptide
![Page 204: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/204.jpg)
190
does not contain the consensus carboxy terminus common in other CAPA peptides. The third
peptide encoded by the precursor peptide has been termed a pyrokinin in other insect CAPA
genes and generally has the consensus octapeptide carboxy terminal sequence GM/LWFGPRL-
NH2 (Kean et al., 2002; Loi and Tublitz, 2004). Therefore, this R. prolixus peptide is called
RhoprCAPA-αPK1 (NGGGGNGGGLWFGPRL-NH2). The presence of the predicted peptide
masses based on post-translation processing of the CAPA prepropeptide was confirmed by
MALDI-TOF tandem mass spectrometry of fifth instar CNS extracts semi-purified using RP-
HPLC techniques (described in Chapter 2)(Paluzzi and Orchard, 2006). Indeed, one such
peptide, RhoprCAPA-α2, was sufficiently abundant for de novo sequencing via fragmentation
and tandem mass spectrometry.
The endogenous anti-diuretic peptide, RhoprCAPA-α2, inhibits serotonin-stimulated fluid
secretion and elevates the intracellular second messenger cGMP in tubules stimulated with
serotonin; however, tubules treated with RhoprCAPA-α2 alone did not show any increase in
cGMP over saline controls, suggesting that the peptide may not directly lead to cGMP
production. Perhaps RhoprCAPAα2 abolishes the decrease in cGMP observed in tubules treated
with serotonin. Anti-diuretic peptides which do stimulate production of cGMP have been
described in T. molitor, ADF-a and ADF-b (Eigenheer et al., 2003; Eigenheer et al., 2002). Thus
it remains unclear how the anti-diuretic peptide in R. prolixus inhibits fluid secretion by MTs,
but the data suggest that cGMP is not synthesized de novo in this tissue and thus a membrane-
bound guanylate cylase / receptor is likely not involved. In T. molitor, however, a membrane
bound guanylate cyclase / receptor is suspected as the source of the cGMP elevation following
treatment with ADF-a and ADF-b (Eigenheer et al., 2003). Finally, unlike the nitric oxide (NO)
-dependent soluble guanylate cylase involved in cGMP elevation in Dipteran MTs (Pollock et
al., 2004), it has been confirmed that such a mechanism is unlikely to be involved in T. molitor
(Eigenheer et al., 2002) and R. prolixus (Quinlan et al., 1997) since data obtained with an
assortment of NO donors, NO acceptors, and NO synthase inhibitors did not modify the response
observed with these anti-diuretic peptides.
The transcript encoding this CAPA prepropeptide was detected in all post-embryonic
![Page 205: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/205.jpg)
191
developmental stages and was predominantly localized in the CNS, and unexpectedly, albeit at
lower levels, was also detected in fifth instar testis. This latter finding suggests that this
immature male reproductive tissue may yield some or all of the peptides encoded by the R.
prolixus CAPA transcript. Although this finding was unexpected, this is not the first instance of
a peptide associated directly with male reproductive tissue. For example, in D. melanogaster, it
has been demonstrated that the male accessory gland produces and secretes a 36 amino acid
peptide, termed sex-peptide, which is transferred to females during copulation and is thought to
alter the behavior of the female (Chen et al., 1988). Such behavioural changes elicited by the
mated females include repression of sexual receptivity and stimulation of oviposition (Chen et
al., 1988). Experiments using RNAi have shown that the sex-peptide is required for the normal
magnitude and longevity of postmating behaviours by females; however, sperm transfer and
usage were normal in females mated with males having “knocked-down” sex-peptide levels
(Chapman et al., 2003). Thus, the male reproductive system in at least some insects is capable of
producing peptides which can alter the reproductive behaviour of the mated female to benefit the
reproductive success of the male. To this end, it is unclear what the role of CAPA gene
expression associated with the immature reproductive tissue may be since expression was not
detected in sexually mature adult males (see Chapter 4)(Paluzzi and Orchard, 2010). In an
attempt to identify whether fifth-instar male reproductive tissue contains biologically-active
forms of the peptides encoded by the R. prolixus CAPA gene, a crude peptidergic extract was
analyzed by mass spectrometry. Unfortunately, this approach failed to resolve any molecular
masses matching the predicted mass of peptides encoded by the R. prolixus CAPA gene;
however, future experiments could be carried out involving chromatographic purification as was
done for the CNS extracts discussed in Chapter 2 (Paluzzi and Orchard, 2006).
Using fluorescent in situ hybridization (FISH), cell-specific expression of the CAPA transcript in
R. prolixus fifth instar CNS was analyzed. This method revealed a number of cells expressing
CAPA transcript which were previously identified to contain peptides with a CAP2b-related
carboxy terminus. Interestingly, this method also clarified that not all cells having PRXamide-
like immunoreactivity were CAPA transcript expressing cells. The greatest discrepancy between
the number of cells detected for PRXamide-like immunoreactivity and CAPA transcript
![Page 206: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/206.jpg)
192
expression was observed in the SOG. In this tissue, many more cells were detected having
PRXamide-like immunoreactivity indicating these additional cells could contain peptides
homologous to products of the D. melanogaster hugin gene (Meng et al., 2002) or the
homologous gene in Lepidopterans and other insects, which encodes the pheromone biosynthesis
activating neuropeptide (PBAN)(Bader et al., 2007a). In D. melanogaster, the hugin gene
peptides are localized to cell bodies lying in the SOG, which are involved in feeding integration
and regulation, including taste differentiation (Gerber et al., 2009; Gordon and Scott, 2009;
Morita and Shiraishi, 1985). These peptides are believed to function in modulating feeding
behavior and hugin gene expression is downregulated in starved insects (Melcher & Pankratz,
2005), whereas hugin overexpression suppresses both growth and feeding (Meng et al., 2002),
and interference of synaptic activity of hugin neurons increases feeding behavior (Melcher and
Pankratz, 2005). More recently, a cell-specific analysis in larval D. melanogaster has revealed
that the 20 cells of the hugin cluster localized to the midline of the SOG can be categorized into
four classes: eight of these neurons project to the protocerebrum, while four neurons each have
axons which project to the ventral nerve cord, ring gland, and anterior pharynx (Bader et al.,
2007b). The cells identified within the SOG in fifth instar R. prolixus that likely contain peptide
homologs of hugin/PBAN also have strongly immunoreactive axon projections. Although it is
unclear which cell each individual axon originates from (due to the very close association of
these dorsally projecting axons), projections are observed directing anteriorly into the brain,
posteriorly into the prothoracic ganglion and continuing into the MTGM where these axons
arborize in the neuropile (see Chapter 2)(Paluzzi and Orchard, 2006). This observation suggests
that a similar arrangement of cells in the SOG may coordinate feeding, growth and metabolism
in R. prolixus, as has been demonstrated in D. melanogaster (Bader et al., 2007a; Bader et al.,
2007b).
Thus, in addition to identifying a subset of cells in the R. prolixus SOG likely to contain
homologous peptides of the PBAN/hugin family in insects, I have discerned that these cells do
not contain CAPA peptides. Nonetheless, the presence of other cell bodies within the SOG,
which do express the CAPA transcript and contain CAPA peptides, suggests these peptides may
![Page 207: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/207.jpg)
193
similarly function in modulating feeding behavior in R. prolixus, as has been shown for the hugin
peptides in D. melanogaster.
Two genes encode the anti-diuretic hormone in R. prolixus and transcripts are constitutively
expressed in the CNS during nymph-adult development
In chapter four of this dissertation (published in Molecular and Cellular Endocrinology, 2010,
317(1-2): 53-63), I describe the isolation of a second gene encoding the CAPA peptides in R.
prolixus. This CAPA gene paralog, termed RhoprCAPA-β, is predicted to encode three peptides
RhoprCAPA-β1 (SPITSIGLLPFLRAA-OH), RhoprCAPA-β2 (EGGFISFPRV-NH2), and
RhoprCAPA-βPK1 (IGGGGNGGGLWFGPRL-NH2). These peptides contain significant
structural similarity to the peptides produced by the first identified R. prolixus CAPA gene,
renamed henceforth as RhoprCAPA-α. Most highly conserved is the second encoded peptide in
each prepropeptide, which is identical in sequence, while the third encoded peptide only has a
single substitution at the amino terminal residue. Therefore, in an attempt to follow a more
intuitive nomenclature, the peptides encoded by the RhoprCAPA-α gene are now referred to as
RhoprCAPA-α1, RhoprCAPA-α2, and RhoprCAPA-αPK1 in order to distinguish their derivation
within the first gene paralog.
Insect genes encoding the CAPA peptides have been identified previously (Kean et al., 2002; Loi
and Tublitz, 2004), however the temporal expression profile has not previously been studied. In
R. prolixus, where one of the CAPA peptides, RhoprCAPA-α2(-β2), plays an integral role in
inhibiting serotonin-stimulated secretion by MTs, a hypothesis was devised to test whether the
expression of the CAPA genes may be altered by feeding. Transcript levels did not change
significantly following a blood-meal with transcript levels fluctuating within a two-fold range.
However, some interesting trends in expression revealed that the two R. prolixus CAPA paralogs
are both constitutively expressed within the CNS, with some changes that may mirror the
physiological requirements associated with fluid and ion balance. Specifically, transcript levels
appeared to have a slight decrease immediately after feeding (over the first couple of hours).
However, expression recovers thereafter and this observation may coincide with the restocking
![Page 208: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/208.jpg)
194
of neurosecretory cells in the MTGM following release of the anti-diuretic hormone and other
CAPA peptides, which is suggested by previous temporal immunohistochemical staining
analysis (see Chapter 2)(Paluzzi and Orchard, 2006). In addition, expression analysis over a
larger time scale revealed the CAPA transcripts may be increased slightly in association with the
nymph-adult ecdysis. This change may reflect a need for the insect to ensure that sufficient
amounts of anti-diuretic peptide are available to prevent the insect from being susceptible to
desiccation during the nymph-adult ecdysis; although, admittedly, the increase/decrease in
CAPA transcripts may not coincide directly with an increase in peptide levels, since biologically-
active forms would require post-translation processing. Thus, caution must be taken in the
interpretation of these data which requires confirmatory analysis by quantification of peptide
levels in these neurosecretory cells and associated neurohemal storage sites. Perhaps a more
dramatic regulatory strategy for the R. prolixus CAPA signaling system may exist at the level of
the post-translational processing involved in biological activation of the peptides or the regulated
release from neurohemal storage sites (Paluzzi and Orchard, 2006). This latter regulatory
mechanism would be supported by the dramatic changes, over the first few hours after feeding,
in immunohistochemical staining within the abdominal neuromere neurosecretory cells and their
associated abdominal nerve neurohemal release sites. This mechanism would also ensure the
insect is always prepared with a reserve of anti-diuretic peptide in the event of an imposed stress
related to feeding, ecdysis, or extended period of starvation. In addition, considering the insect is
normally in a state of water conservation, i.e. anti-diuresis, interrupted by rapid post-gorging
diuresis, the relatively stable levels of CAPA transcripts could help satisfy the physiological
demands that the insect would face over the majority of its’ existence.
Thus, R. prolixus contains two genes which encode the CAPA-related peptides that include the
anti-diuretic peptide, RhoprCAPA-α2(-β2), which has a conserved structure in both paralogs.
This is the first report on a gene duplication within the CAPA-related peptide family in insects
and indicates that the R. prolixus CNS contains at least a greater number of CAPA-related
peptides. Based on the relatively high sequence conservation between the two R. prolixus CAPA
paralogs, and in addition, the lack of any evidence suggesting a greater cohort of CAPA-related
peptides in phytophagous Hemipteran species (Predel et al., 2006; Predel et al., 2008), this would
![Page 209: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/209.jpg)
195
appear to be a moderately recent gene duplication event, possibly associated with a
haematophagous ancestor.
Identification of an anti-diuretic hormone receptor mediating the inhibition of fluid secretion
by MTs and fluid absorption by the anterior midgut in R. prolixus
In chapter five of this dissertation (accepted for publication in Proceedings of the National
Academy of Sciences on April 23rd, 2010), I describe the isolation, spatial expression profile and
functional characterization of the first anti-diuretic hormone receptor in insects, referred to as
RhoprCAPA-r, which is a GPCR. Two transcript variants were identified, capa-r1 and capa-r2;
however the former transcript demonstrates expression levels well over two orders of magnitude
higher than the latter. The receptor transcript was localized to tissues of the alimentary canal,
including the anterior midgut and Malpighian tubules, which are both known to be
physiologically regulated by the anti-diuretic peptide, RhoprCAPA-α2 (Ianowski et al., 2010;
Orchard and Paluzzi, 2009; Paluzzi and Orchard, 2006; Paluzzi et al., 2008). Interestingly,
however, the receptor transcript was also localized to tissues not previously known to be targets
of the anti-diuretic peptide nor to be involved in the rapid post-gorging diuresis. Thus, this
supports the suggestion that the constitutive expression of the CAPA peptide encoding genes
observed during development from fifth instar to adult stage insects (Paluzzi and Orchard, 2010)
may have a role in addition to maintenance of anti-diuresis. One could predict that the receptor
transcript expression over the numerous tissues comprising the alimentary canal may indicate the
CAPA peptides in R. prolixus may function in coordinating feeding, digestion and/or excretion.
Receptor expression associated with the MTs was investigated in greater detail to discern if the
functionally-distinct regions of the tubules, namely the upper secretory segment and lower
reabsorptive segment, elicited any differences in CAPA receptor expression. MTs were
dissected and regions were separated based on the structural morphology of the upper and lower
segments. Indeed, transcript abundance was differential between these two functionally-distinct
regions of the MTs with a greater than 60-fold level associated with the upper secretory segment
relative to the lower segment. The lower third of the lower MTs segment is the sole region
where selected ions are reabsorbed (Haley and O'Donnell, 1997; Maddrell and Phillips, 1975;
O'Donnell et al., 1982) but some defects during development may lead to the presence of isolated
![Page 210: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/210.jpg)
196
upper segment cells sporadically localized in the lower MTs segment (Maddrell and Overton,
1985). Therefore, it remains unclear if the albeit low CAPA receptor transcript level in the lower
MTs segment is physiologically relevant or an artifact due to the occasional presence of upper
MTs segment cells localized within the lower MT segment. Nonetheless, this result supports the
major physiological role of the anti-diuretic hormone in inhibiting fluid secretion by the MTs
without playing a role in modifying the selective reabsorption of ions. This result also brings to
light the possibility that although fluid secretion by the upper MTs would be significantly
reduced (Paluzzi and Orchard, 2006; Paluzzi et al., 2008; Paluzzi and Orchard, 2010), the
absorption of KCl by the lower tubules regulated by serotonin (Haley and O'Donnell, 1997;
Maddrell and Phillips, 1975; O'Donnell et al., 1982), but not by other insect diuretic factors
(Donini et al., 2008), could continue, ensuring these essential ions are not depleted in the
haemolymph.
Phylogenetic analysis of the identified R. prolixus CAPA receptor confirms that this receptor is a
member of the CAPA receptor family in insects and the monophyletic group containing the
insect CAPA receptors is supported with high bootstrapping statistics. Importantly, the
pyrokinin-1 receptor sequences from other insects forms a sister-group to this CAPA-receptor
clade, and are known to be specifically activated by the third encoded peptide of CAPA genes in
insects (see Chapter 5), which will be of interest for future research (see below).
Functional ligand-receptor interaction analyses performed in native CHO-K1 cells demonstrate
the receptor encoded by the capa-r1 transcript has highest affinity for the anti-diuretic hormone,
RhoprCAPA-α2 (EC50 = 385nM). Surprisingly, the receptor is also activated by the pyrokinin
peptide, RhoprCAPA-αPK1; however at the highest dose tested, this led to a receptor activation
of only 35% relative to the response by an equivalent dose of RhoprCAPA-α2. As was expected,
considering the loss of the carboxy terminal consensus sequence, the first encoded peptide in the
RhoprCAPA-α gene, RhoprCAPA-α1, is not able to activate the receptor. However, structural
analogs of this peptide, which do contain the canonical CAPA carboxy terminus, are equally
potent to RhoprCAPA-α2 in activating the calcium mobilization pathway used in the
heterologous assay. Other structurally-related peptides containing a PRXamide motif were
![Page 211: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/211.jpg)
197
tested and found not to activate the receptor for calcium mobilization. In addition, heterologous
expression of the second transcript variant capa-r2, predicted to encode an atypical GPCR, was
not activated by any of the peptides tested. In other species in which the CAPA receptors have
been identified, the first two peptides encoded by the native CAPA gene activate a single
receptor while the third encoded peptide containing a different carboxy terminal sequence,
specifically activates a unique receptor and no cross-activation of receptors has been identified.
Thus, interpretation of these heterologous assay results requires careful consideration since the
post-transcriptional processing of the receptor in the mammalian cells may not mirror that
occurring in the native insect cells. In addition, heterologous assay experiments on CHO cells
stably expressing the promiscuous G-protein (Gα16), which has a remarkable ability to couple a
wide variety of GPCRs to the calcium mobilization pathway (Offermanns and Simon, 1995), did
not facilitate any detectable calcium mobilization by any of the peptides tested. An important
point to make, however, is that heterologous expression of the R. prolixus CAPA receptor was
also attempted in HEK-293 and Drosophila S2 cells, with no detectable response with any of the
peptides tested (data not shown).
As discussed in a subsequent section and published recently (Ianowski et al., 2010), the CAPA
peptides do not appear to utilize calcium (neither intracellular, nor extracellular) in the inhibition
of fluid secretion by MTs (see below) or inhibition of fluid and ion absorption by the anterior
midgut. Therefore, the analysis of the CAPA receptor in the heterologous assay should be
investigated further, by testing in other mammalian or insect cell lines that allow the ligand-
receptor interaction to be monitored using a different reporter technology. Moreover,
physiological assays measuring the effect of RhoprCAPA-αPK1 on tissues known to be
regulated by the anti-diuretic peptide, RhoprCAPA-α2, may also help resolve the significance of
the unexpected finding involving the partial activation of an insect CAPA receptor with a
pyrokinin-related peptide.
Based on the available literature, this is the first study to isolate and functionally characterize an
endogenous anti-diuretic hormone receptor in insects. Transcript distribution throughout tissues
which comprise the alimentary canal suggest this receptor plays an important role in
![Page 212: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/212.jpg)
198
coordinating anti-diuresis following the rapid post-gorging diuresis and may also play a broader
role in feeding, digestion and excretion. Taken together, a better understanding of the signaling
between this receptor and its’ natural ligand, RhoprCAPA-α2, may be of great importance for
interfering with Chagas’ disease transmission associated with this medically-important pest.
Integrating the whole
A model integrating the data described in this thesis with previous models on the control of
diuresis in R. prolixus is shown in Figure 1. The receptor for RhoprCAPA-α2 is expressed in the
foregut, anterior and posterior midgut, MTs and hindgut and corroborates physiological data
indicating RhoprCAPA-α2 is capable of inhibiting serotonin-stimulated fluid secretion by MTs
as well as absorption by the anterior midgut. Taken together, this data indicates that the
RhoprCAPA-α2 peptide and its cognate receptor are chiefly involved in an essential anti-diuretic
strategy ensuring the maintenance of homeostatic levels of ions and water. In addition, the
model and the thesis data also raise further questions regarding this anti-diuretic strategy which
are discussed, along with some preliminary observations, in the following section.
CAPA peptide-induced anti-diuresis in R. prolixus involves a signaling mechanism unlike that
described in D. melanogaster
As presented elsewhere in this thesis, it is obvious that the anti-diuretic peptide, RhoprCAPA-α2,
has an important role in inhibiting serotonin-stimulated fluid secretion (Paluzzi et al., 2008) by
MTs as well as absorption by the anterior midgut in fifth instar and adult R. prolixus (Ianowski et
al., 2010; Orchard and Paluzzi, 2009). However, it remains unclear how this anti-diuretic effect
is mediated since it appears to involve a mechanism that differs from that known in Dipteran
species, which involves extracellular calcium (Rosay et al., 1997), NO and cGMP (Dow et al.,
1994b). Previous studies have demonstrated that cGMP acts antagonistically to cAMP to inhibit
fluid secretion by MTs in R. prolixus (Quinlan and O'Donnell, 1998). However, although cGMP
has been suggested as a possible intracellular mediator of ManseCAP2b (Quinlan et al., 1997)
and the native anti-diuretic peptide, RhoprCAPA-α2 (Paluzzi et al., 2008), these studies have not
![Page 213: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/213.jpg)
199
Figure 1. Schematic overview of the diuretic and anti-diuretic regulation of tissues associated
with the rapid post-prandial diuresis in R. prolixus. For the diuretic strategy (right side), known
osmotic and ionic concentrations are given as are the movements of water and ions (direction of
movement denoted by arrows) during the rapid post-prandial diuresis in R. prolixus. Data
pertaining to the diuretic regulation reviewed in Coast et al., 2002; Orchard, 2006; 2009; and
Coast, 2009. A model integrating the data discussed in this thesis is described under the anti-
diuretic strategy (left side). Adapted figure of alimentary canal drawn by Zach McLaughlin.
![Page 214: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/214.jpg)
200
![Page 215: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/215.jpg)
201
shown any evidence demonstrating cGMP synthesis above control levels. Importantly, however,
the cGMP levels of MTs in the presence of the anti-diuretic peptide and serotonin are
significantly greater than levels of MTs treated with serotonin alone. In addition, we recently
demonstrated cGMP stimulates absorption by the anterior midgut and that this absorption can be
blocked by the anti-diuretic peptide, RhoprCAPA-α2 (Ianowski et al., 2010). Thus, in the
anterior midgut, since both cAMP and cGMP are involved in the stimulation of fluid absorption,
cGMP is not involved in the inhibitory effect on absorption elicited by RhoprCAPA-α2
(Ianowski et al., 2010).
As mentioned earlier, extracellular calcium is an important component of the observed diuretic
effect of CAPA peptides in Dipteran MTs (Rosay et al., 1997). In R. prolixus, the involvement
of calcium in the anti-diuretic effect of the peptide, RhoprCAPA-α2, has not been previously
investigated. In preliminary experiments, I have assessed the ability of RhoprCAPA-α2 to
inhibit serotonin-stimulated fluid secretion by MTs in calcium-free saline and in the presence of
the calcium chelator, ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA).
The inhibitory effect of RhoprCAPA-α2 on fluid secretion of MTs stimulated with serotonin
appears to be independent of extracellular calcium.
Similarly, we have recently shown that calcium is likely not involved in the inhibitory effect of
RhoprCAPA-α2 on anterior midgut fluid absorption (Ianowski et al., 2010). Specifically, we
showed that in presence of the calcium chelators EGTA and membrane permeable BAPTA-AM,
RhoprCAPA-α2 is equally potent in evoking an inhibition of fluid absorption and ion transport.
In addition, 8-(N,N-diethylamino)octyl 3,4,5-trimethoxybenzoate hydrochloride (TMB-8), which
blocks calcium mobilization, also does not block inhibition of fluid absorption by RhoprCAPA-
α2 (Ianowski et al., 2010).
Thus, while calcium plays an integral role in facilitating the CAPA peptide-induced diuresis in
Dipteran MTs, it is evident that calcium likely does not play a role in the RhoprCAPA-α2
![Page 216: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/216.jpg)
202
inhibition of fluid secretion by MTs and fluid absorption by the anterior midgut in R. prolixus.
However, the possible involvement of intracellular calcium in secretion inhibition by MTs needs
to be further tested.
The role of other peptides encoded by the CAPA gene in R. prolixus
Fluid secretion by the MTs and fluid absorption by the anterior midgut is inhibited by the peptide
RhoprCAPA-α2. The physiological role of the other peptides encoded by the RhoprCAPA-α
gene, RhoprCAPA-α1 and RhoprCAPA-αPK1 are less understood. It can be hypothesized that
the first encoded peptide, RhoprCAPA-α1, is likely not capable of inhibiting fluid secretion by
MTs or fluid absorption by anterior midgut since it has lost the consensus carboxy terminal
sequence required for biological activity of these peptides (Nachman and Coast, 2007). This
prediction assumes that this peptide would utilize the same receptor as it does in other insects in
which the first two peptides encoded by the CAPA gene contain the consensus carboxy terminal
sequence. However, this modified peptide may have a yet-to-be determined distinct role, and
may also utilize a unique receptor satisfying the theory of ligand-receptor coevolution (Park et
al., 2002). The same rationale stated above could be applied to the last encoded peptide,
RhoprCAPA-αPK1, since this peptide also does not contain the CAPA peptide consensus
sequence. Previous reports have confirmed that the pyrokinin-related peptides encoded by the
CAPA gene utilize distinct receptors (Iversen et al., 2002; Olsen et al., 2007; Park et al., 2002)
and likely hold different physiological roles as they are inactive in stimulating secretion in D.
melanogaster MTs (Kean et al., 2002). To address this issue in R. prolixus, serotonin-stimulated
fluid secretion needs to be measured in the presence of each of the RhoprCAPA-α gene encoded
neuropeptides. While the anti-diuretic peptide significantly decreases the serotonin-stimulated
secretion (Paluzzi et al., 2008), preliminary results show that the other RhoprCAPA-α gene
encoded peptides, RhoprCAPA-α1 and RhoprCAPA-αPK1, neither increase nor decrease the
serotonin-stimulated tubule secretion. Thus, these peptides do not appear to play a role in MTs
fluid secretion, but other potential tissue targets or physiological effects, such as a role in
modulating the ratios of secreted ions or reabsorption of ions and water by the lower MTs should
be investigated in the future. For the most part, this physiological result satisfies the observed
ligand-receptor interaction assay results obtained for the anti-diuretic hormone receptor
![Page 217: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/217.jpg)
203
described earlier. However, at higher doses tested, the peptide RhoprCAPA-αPK1 appeared to
activate the anti-diuretic hormone receptor in the heterologous expression assay. This result
warrants a revisiting of the physiological effects mentioned earlier. Preliminary results have
indicated that, even at higher doses (5-10µM), RhoprCAPA-αPK1 has no inhibitory effect on
serotonin-stimulated MTs fluid secretion. It is unclear how RhoprCAPA-αPK1 is able to
marginally activate the anti-diuretic hormone receptor at the higher doses tested in the receptor-
ligand interaction assay. However, one could postulate the heterologous assay system allowing
the expression of this receptor does not mirror the native cellular niche and post-translational
processing of the receptor. Another possibility could be that the signaling cascade in one tissue
type may differ from another type, or that differential ligand binding could lead to different
conformational changes by the receptor leading to different cellular pathways becoming
activated. These and other possibilities may be elucidated once the other RhoprCAPA-α peptide
receptor(s) are identified and characterized in R. prolixus. In addition, future experiments could
also test the physiological role of RhoprCAPA-αPK1 (as well as RhoprCAPA-α1) on the
absorption by the anterior midgut, since this has already been shown to be an important tissue
target under the regulation of the anti-diuretic peptide, RhoprCAPA-α2. Some preliminary
experiments testing the serotonin-mediated increase in transepithelial current across the anterior
midgut suggest that the RhoprCAPA-α1 has no effect on transport of ions across this epithelium.
However, it appears RhoprCAPA-αPK1 may weakly counteract the effect of serotonin, but
additional experiments are required for confirmation. Interestingly, preliminary results suggest
that serotonin-stimulated fluid absorption by the anterior midgut is not significantly different
when RhoprCAPA-αPK1 is applied in contrast to the clear inhibitory effect elicited by
RhoprCAPA-α2 (Ianowski et al., 2010; Orchard and Paluzzi, 2009).
CAPA peptides in R. prolixus may modulate the transport machinery responsible for fluid
secretion
Finally, electrophysiological experiments are required to determine the anti-diuretic hormone
effect on the characteristic triphasic response in transepithelial potential (TEP) following
stimulation by serotonin. The characteristic triphasic response is a result of the sequential
activation of an apical Cl- channel, an apical V-type H+ ATPase and a basolateral Na+:K+:2Cl-
![Page 218: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/218.jpg)
204
(NKCC) cotransporter (Ianowski and O'Donnell, 2001; O'Donnell and Maddrell, 1984). Data
collected thus far shows that there is a change in TEP such that the TEP is more positive in each
of the three phases in the presence of RhoprCAPA-α2, especially the third phase. This third
phase has been attributed to the effect of the basolateral NKCC which allows movement of Na+,
K+ and Cl- ions into the cells (Ianowski and O'Donnell, 2001; O'Donnell and Maddrell, 1984).
Thus, although no definitive conclusions can be drawn from this preliminary data, these results
suggest that the system involved in the transepithelial transport across the MTs may be a target
of the inhibitory pathway activated by RhoprCAPA-α2. It has been argued that the CAPA
peptide-induced signaling cascade in principal cells of D. melanogaster MTs activates an apical
vacuolar-type H+ ATPase which acidifies the tubule lumen and energizes a cation/proton
exchanger on the apical membrane (Dow et al., 1994a; Dow et al., 1994b; Dow and Davies,
2003; Wieczorek et al., 1991). Thus, it is obvious this family of peptides is capable of
modulating the transport machinery in other insects; albeit in R. prolixus, this involves different
intracellular signaling pathways and the exact targets of the transport machinery are yet to be
revealed.
Future directions
The identification of the native peptide involved in coordinating anti-diuresis in R. prolixus is an
important step in better understanding how this insect ensures that desiccation is avoided
following the rapid post-prandial diuresis and other potentially stressful events such as ecdysis.
In addition, the isolation and characterization of a receptor, which is involved in mediating the
anti-diuretic response, confirms the requirement for strict regulation of tissues in regulating the
bulk removal of excess water and salts following engorgement of a blood meal. Arising from
findings of this thesis is the potential for the anti-diuretic peptide, RhoprCAPA-α2, to modulate
the activity of other visceral tissues that are not involved in the rapid diuresis following feeding
(Coast et al., 2002; Coast, 2009). The physiological role of this peptide on the foregut, posterior
midgut and hindgut may be important at times when the blood meal is being digested and
nutrients are required for ongoing development or fulfillment of energy demands. In addition, a
myomodulatory role could help in mixing the luminal contents of the gut tissues as well as the
![Page 219: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/219.jpg)
205
haemolymph. Thus, experiments should be carried out to investigate this potential
myomodulatory role in R. prolixus, since such an effect has been demonstrated by structurally-
related peptides in other insects (Predel and Wegener, 2006). I have shown that the second
messenger pathway triggered by the anti-diuretic peptide differs substantially from that known
for homologous peptides in Diptera (Pollock et al., 2004) which have diuretic actions; however,
the identity of the endogenous intracellular targets remains unresolved. Thus, future studies
should focus specifically on elucidating these factors within R. prolixus as this may serve as an
important model for anti-diuresis in other insects. Extensive studies on the rapid post-gorging
diuresis in R. prolixus have revealed this insect to contain at least two diuretic hormones (Aston
and White, 1974; Lange et al., 1989; Maddrell et al., 1991; Orchard, 2009; Te Brugge and
Orchard, 2002; Te Brugge et al., 2002). The biogenic amine, serotonin, has been extensively
utilized in this thesis to test against the CAPA peptides, however, the peptidergic CRF-related
peptide, RhoprDH, which has now been identified (Te Brugge & Orchard, personal
communication), has not yet been tested against the CAPA peptides. However, with the
availability of the native diuretic peptide, this experiment can be performed and will undoubtedly
be useful in further supporting the role of RhoprCAPA-α2 in coordinating anti-diuresis in R.
prolixus.
I have also commenced investigation of the physiological relevance of other CAPA gene-
encoded peptides; however, no obvious effect has been noted in fluid secretion by MTs or fluid
absorption by the anterior midgut. The pyrokinin-related RhoprCAPA-αPK1 may have a
stimulatory role on visceral muscle tissues similar to other pyrokinins (Holman et al., 1986;
Predel et al., 1997; Predel and Nachman, 2001) although much less is known regarding the
physiological effect of the pyrokinin-related peptides encoded by CAPA genes in insects.
Nonetheless, puparial contraction in the flesh fly, Sarcophaga bullata has been shown to be
accelerated by members of the CAPA gene pyrokinin-related peptides (Zdarek et al., 2004). A
subsequent study, however, suggested that the likely true pupariation factor in a related species,
Neobellieria bullata, was a pyrokinin peptide that does not share substantial sequence homology
to the CAPA gene derived pyrokinin-related peptides (Nachman et al., 2006). Instead, it is likely
represented by a peptide derived from a hugin homologous gene (Verleyen et al., 2004). Thus,
![Page 220: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/220.jpg)
206
an important feat to be achieved is the spatial tissue-specific distribution of the endogenous
pyrokinin receptors in insects, some of which have already been identified (Cazzamali et al.,
2005; Olsen et al., 2007; Park et al., 2002; Rosenkilde et al., 2003; Watanabe et al., 2007).
Obviously, this would also be of great importance in R. prolixus as this may provide some
evidence pertaining to the physiological roles of the CAPA gene-derived pyrokinins in this
insect. Outside the scope of this thesis, I have commenced in silico screening of the preliminary
genome assembly of R. prolixus in attempts to isolate the endogenous pyrokinin receptors, and
this will be a focus of my post-doctoral research.
In addition to the anti-diuretic hormone encoded by the CAPA genes, it is of great interest to
explore the possibility of other peptides acting to regulate and maintain anti-diuresis in R.
prolixus. Such examples of non-CAPA-related peptides regulating anti-diuresis have been
established in other insects such as the ADF peptides in T. molitor (Eigenheer et al., 2003;
Eigenheer et al., 2002), and I have found in silico evidence suggesting the presence of
structurally-related peptides in R. prolixus, which I will pursue during my post-doctoral research.
One final and possibly least understood phenomenon regarding anti-diuresis in R. prolixus is its
initiation. I have demonstrated that the two genes encoding the anti-diuretic peptide in R.
prolixus are constitutively expressed, but do not undergo any major changes in transcript
abundance associated with feeding and the rapid diuresis that follows. However, my early
experiments using time-course immunohistochemical analysis revealed that the contents of the
neurosecretory cells and their associated neurohemal release sites within the MTGM are
significantly depleted at a time which coincides with the cessation of the rapid post-prandial
diuresis. Thus, this suggests that these cells receive a signal which ultimately leads to their
contents’ release into the haemolymph. Abdominal distension leading to activation of stretch
receptors are believed to be involved in activating the diuretic response in R. prolixus (Maddrell,
1964); however, such a mechanism has been argued not to be involved in triggering anti-diuresis
due to the change in properties of the cuticle associated with plasticization (Quinlan et al., 1997).
The activation of the CAPA peptide-containing cells likely involves a central neurochemical that
![Page 221: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/221.jpg)
207
has perhaps already been identified in other insects (and possibly even R. prolixus), but has not
yet been associated with this function in R. prolixus. Thus, since the overwhelming majority of
these signaling molecules utilize receptors belonging to the seven transmembrane (GPCR) super
family, the localization of these receptors may provide clues that help identify the signaling
cascade synchronizing anti-diuresis in R. prolixus. The completion and annotation of the R.
prolixus genome should yield excellent opportunities to test candidate factors for their potential
involvement in activating anti-diuresis in this medically-important insect.
![Page 222: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/222.jpg)
208
References
Aston, R. J. and White, A. F. (1974). Isolation and purification of the diuretic hormone from
Rhodnius prolixus. J. Insect Physiol. 20, 1673-1682.
Bader, R., Wegener, C. and Pankratz, M. J. (2007a). Comparative neuroanatomy and
genomics of hugin and pheromone biosynthesis activating neuropeptide (PBAN). Fly (Austin) 1,
228-231.
Bader, R., Colomb, J., Pankratz, B., Schröck, A., Stocker, R. F. and Pankratz, M. J.
(2007b). Genetic dissection of neural circuit anatomy underlying feeding behavior in
Drosophila: Distinct classes of hugin-expressing neurons. J. Comp. Neurol. 502, 848-856.
Cazzamali, G., Torp, M., Hauser, F., Williamson, M. and Grimmelikhuijzen, C. J. P.
(2005). The Drosophila gene CG9918 codes for a pyrokinin-1 receptor. Biochem. Biophys. Res.
Commun. 335, 14-19.
Chapman, T., Bangham, J., Vinti, G., Seifried, B., Lung, O., Wolfner, M. F., Smith, H. K.
and Partridge, L. (2003). The sex peptide of Drosophila melanogaster: Female post-mating
responses analyzed by using RNA interference. Proceedings of the National Academy of
Sciences of the United States of America 100, 9923-9928.
Chen, P. S., Stumm-Zollinger, E., Aigaki, T., Balmer, J., Bienz, M. and Böhlen, P. (1988). A
male accessory gland peptide that regulates reproductive behavior of female D. melanogaster.
Cell 54, 291-298.
Coast, G. (2009). Neuroendocrine control of ionic homeostasis in blood-sucking insects. J. Exp.
Biol. 212, 378.
Coast, G. M., Orchard, I., Phillips, J. E. and Schooley, D. A. (2002). Insect diuretic and anti-
diuretic hormones. In Advances in Insect Physiology, pp. 279-409: Academic Press.
![Page 223: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/223.jpg)
209
Donini, A., O'Donnell, M. J. and Orchard, I. (2008). Differential actions of diuretic factors on
the Malpighian tubules of Rhodnius prolixus. J. Exp. Biol. 211, 42-48.
Dow, J. A., Maddrell, S. H., Grtz, A., Skaer, N. J., Brogan, S. and Kaiser, K. (1994a). The
Malpighian tubules of Drosophila melanogaster: A novel phenotype for studies of fluid secretion
and its control. J. Exp. Biol. 197, 421.
Dow, J. A., Maddrell, S. H., Davies, S. A., Skaer, N. J. and Kaiser, K. (1994b). A novel role
for the nitric oxide-cGMP signaling pathway: The control of epithelial function in Drosophila.
Am. J. Physiol. Regul. Integr. Comp. Physiol. 266, R1716-1719.
Dow, J. A. T. and Davies, S. A. (2003). Integrative physiology and functional genomics of
epithelial function in a genetic model organism. Physiol. Rev. 83, 687-729.
Eckert, M., Predel, R. and Gundel, M. (1999). Periviscerokinin-like immunoreactivity in the
nervous system of the American cockroach. Cell Tissue Res. 295, 159.
Eigenheer, R. A., Wiehart, U. M., Nicolson, S. W., Schoofs, L., Schegg, K. M., Hull, J. J.
and Schooley, D. A. (2003). Isolation, identification and localization of a second beetle anti-
diuretic peptide. Peptides 24, 27-34.
Eigenheer, R., Nicolson, S., Schegg, K., Hull, J. J. and Schooley, D. (2002). Identification of a
potent anti-diuretic factor acting on beetle Malpighian tubules. Proceedings of the National
Academy of Sciences 99, 84-89.
Farmer, J., Maddrell, S. H. P. and Spring, J. H. (1981). Absorption of fluid by the midgut of
Rhodnius. J. Exp. Biol. 94, 301-316.
Gerber, B., Stocker, R. F., Tanimura, T. and Thum, A. S. (2009). Smelling, tasting, learning:
Drosophila as a study case. Results Probl. Cell Differ. 47, 139-185.
Gordon, M. D. and Scott, K. (2009). Motor control in a Drosophila taste circuit. Neuron 61,
373-384.
![Page 224: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/224.jpg)
210
Haley, C. and O'Donnell, M. J. (1997). K+ reabsorption by the lower Malpighian tubule of
Rhodnius prolixus: Inhibition by Ba2+ and blockers of H+/K+-ATPases. J. Exp. Biol. 200, 139-
147.
Holman, G. M., Cook, B. J. and Nachman, R. J. (1986). Primary structure and synthesis of a
blocked myotropic neuropeptide isolated from the cockroach, Leucophaea maderae.
Comparative biochemistry and physiology.C, Comparative pharmacology and toxicology 85,
219.
Ianowski, J. P. and O'Donnell, M. J. (2001). Transepithelial potential in Malpighian tubules of
Rhodnius prolixus: Lumen-negative voltages and the triphasic response to serotonin. J. Insect
Physiol. 47, 411-421.
Ianowski, J. P., Paluzzi, J., Te Brugge, V. A. and Orchard, I. (2010). The anti-diuretic
neurohormone RhoprCAPA-2 downregulates fluid transport across the anterior midgut in the
blood-feeding insect Rhodnius prolixus. Am. J. Physiol. Regul. Integr. Comp. Physiol. 298,
R548-557.
Iversen, A., Cazzamali, G., Williamson, M., Hauser, F. and Grimmelikhuijzen, C. J. P.
(2002). Molecular cloning and functional expression of a Drosophila receptor for the
neuropeptides capa-1 and -2. Biochem. Biophys. Res. Commun. 299, 628.
Kean, L., Cazenave, W., Costes, L., Broderick, K. E., Graham, S., Pollock, V. P., Davies, S.
A., Veenstra, J. A. and Dow, J. A. T. (2002). Two nitridergic peptides are encoded by the gene
capability in Drosophila melanogaster. Am J Physiol Regul Integr Comp Physiol 282, R1297-
1307.
Lange, A. B., Orchard, I. and Barrett, F. M. (1989). Changes in hemolymph serotonin levels
associated with feeding in the bloodsucking bug, Rhodnius prolixus. J. Insect Physiol. 35, 393-
&.
Loi, P. K. and Tublitz, N. J. (2004). Sequence and expression of the CAPA/CAP2b gene in the
tobacco hawkmoth, Manduca sexta. J. Exp. Biol. 207, 3681-3691.
![Page 225: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/225.jpg)
211
Maddrell, S. H. and Overton, J. A. (1985). Maintenance of function in single epithelial cells
spatially isolated from similar cells. J. Embryol. Exp. Morphol. 90, 409.
Maddrell, S. H. (1963). Excretion in blood-sucking bug, Rhodnius prolixus Stal .1. Control of
diuresis. J. Exp. Biol. 40, 247-256.
Maddrell, S. H. (1964). Excretion in blood-sucking bug Rhodnius prolixus Stal .3. Control of
release of diuretic hormone. J. Exp. Biol. 41, 459-472.
Maddrell, S. H. (1969). Secretion by Malpighian tubules of Rhodnius . Movements of ions and
water. J. Exp. Biol. 51, 71-&.
Maddrell, S. H. P. and Phillips, J. E. (1975). Secretion of hypo-osmotic fluid by the lower
Malpighian tubules of Rhodnius prolixus. J. Exp. Biol. 62, 671-683.
Maddrell, S., Herman, W., Mooney, R. and Overton, J. (1991). 5-Hydroxytryptamine: A
second diuretic hormone in Rhodnius prolixus. J Exp Biol 156, 557-566.
Melcher, C. and Pankratz, M. J. (2005). Candidate gustatory interneurons modulating feeding
behavior in the Drosophila Brain. PLoS Biol 3, e305.
Meng, X., Wahlström, G., Immonen, T., Kolmer, M., Tirronen, M., Predel, R., Kalkkinen,
N., Heino, T. I., Sariola, H. and Roos, C. (2002). The Drosophila hugin gene codes for
myostimulatory and ecdysis-modifying neuropeptides. Mech. Dev. 117, 5-13.
Morita, H. and Shiraishi, A. (1985).Comprehensive Insect Physiology, Biochemistry, and
Pharmacology (ed. G. A. Kerkut and L. I. Gilbert), pp. 133-165. Oxford ; New York: Pergamon
Press.
Nachman, R. J., Strey, A., Zubrzak, P. and Zdarek, J. (2006). A comparison of the
pupariation acceleration activity of pyrokinin-like peptides native to the flesh fly: Which peptide
represents the primary pupariation factor? Peptides 27, 527-533.
Nachman, R. and Coast, G. (2007). Structure-activity relationships for in vitro diuretic activity
of CAP2b in the housefly. Peptides 28, 57-61.
![Page 226: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/226.jpg)
212
O'Donnell, M.,J., Aldis, G.,K. and Maddrell, S. H.,P. (1982). Measurements of osmotic
permeability in the Malpighian tubules of an insect, Rhodnius prolixus Stal. Proc. R. Soc. Lond.
B 216, 267-277.
O'Donnell, M. J. and Maddrell, S. H. P. (1984). Secretion by the Malpighian tubules of
Rhodnius prolixus Stal - electrical events. J. Exp. Biol. 110, 275-290.
Offermanns, S. and Simon, M. I. (1995). Gα15 and Gα16 couple a wide variety of receptors to
phospholipase C. Journal of Biological Chemistry 270, 15175-15180.
Olsen, S. S., Cazzamali, G., Williamson, M., Grimmelikhuijzen, C. J. P. and Hauser, F.
(2007). Identification of one capa and two pyrokinin receptors from the malaria mosquito
Anopheles gambiae. Biochemical and biophysical research communications 362, 245-251.
Orchard, I. (2009). Peptides and serotonin control feeding-related events in Rhodnius prolixus.
Front. Biosci. (Elite Ed) 1, 250-262.
Orchard, I. and Paluzzi, J. P. (2009). Diuretic and anti-diuretic hormones in the blood-gorging
bug Rhodnius prolixus. Ann. N. Y. Acad. Sci. 1163, 501-503.
Paluzzi, J. P. and Orchard, I. (2006). Distribution, activity and evidence for the release of an
anti-diuretic peptide in the kissing bug Rhodnius prolixus. J. Exp. Biol. 209, 907-915.
Paluzzi, J. P. and Orchard, I. (2010). A second gene encodes the anti-diuretic hormone in the
insect, Rhodnius prolixus. Mol. Cell. Endocrinol. 317, 53.
Paluzzi, J. P., Russell, W. K., Nachman, R. J. and Orchard, I. (2008). Isolation, cloning, and
expression mapping of a gene encoding an anti-diuretic hormone and other CAPA-related
peptides in the disease vector, Rhodnius prolixus. Endocrinology 149, 4638-4646.
Park, Y., Kim, Y. and Adams, M. E. (2002). Identification of G protein-coupled receptors for
Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-
receptor coevolution. Proc. Natl. Acad. Sci. U. S. A. 99, 11423-11428.
![Page 227: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/227.jpg)
213
Pollock, V. P., McGettigan, J., Cabrero, P., Maudlin, I. M., Dow, J. A. T. and Davies, S. A.
(2004). Conservation of capa peptide-induced nitric oxide signaling in Diptera. J. Exp. Biol. 207,
4135-4145.
Predel, R., Eckert, M. and Holman, G. M. (1999). The unique neuropeptide pattern in
abdominal perisympathetic organs of insects. Ann. N. Y. Acad. Sci. 897, 282.
Predel, R., Linde, D., Rapus, J., Vettermann, S. and Penzlin, H. (1995). Periviscerokinin
(Pea-PVK): a novel myotropic neuropeptide from the perisympathetic organs of the American
cockroach. Peptides 16, 61.
Predel, R., Rapus, J., Eckert, M., Holman, G. M., Nachman, R. J., Wang, Y. and Penzlin,
H. (1998). Isolation of periviscerokinin-2 from the abdominal perisympathetic organs of the
American cockroach, Periplaneta americana. Peptides 19, 801-809.
Predel, R., Russell, W. K., Neupert, S., Russell, D. H., Esquivel, J. F. and Nachman, R. J.
(2006). Identification of the rirst neuropeptides from the CNS of Hemiptera: CAPA peptides of
the southern green stinkbug Nezara viridula (L.). Peptides 27, 2670-2677.
Predel, R., Russell, W. K., Russell, D. H., Lopez, J., Esquivel, J. and Nachman, R. J. (2008).
Comparative peptidomics of four related Hemipteran species: pyrokinins, myosuppressin,
corazonin, adipokinetic hormone, sNPF, and periviscerokinins. Peptides 29, 162-167.
Predel, R., Kellner, R., Kaufmann, R., Penzlin, H. and Gäde, G. (1997). Isolation and
structural elucidation of two pyrokinins from the retrocerebral complex of the American
cockroach. Peptides 18, 473-478.
Predel, R. and Nachman, R. J. (2001). Efficacy of native FXPRLamides (pyrokinins) and
synthetic analogs on visceral muscles of the American cockroach. J. Insect Physiol. 47, 187-193.
Predel, R., Nachman, R. J. and Gade, G. (2001). Myostimulatory neuropeptides in
cockroaches: Structures, distribution, pharmacological activities, and mimetic analogs. J. Insect
Physiol. 47, 311-324.
![Page 228: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/228.jpg)
214
Predel, R. and Wegener, C. (2006). Biology of the CAPA peptides in insects. Cell Mol Life Sci
63, 2477-2490.
Quinlan, M., Tublitz, N. and O'Donnell, M. (1997). Anti-diuresis in the blood-feeding insect
Rhodnius prolixus Stal: The peptide CAP2b and cyclic GMP inhibit Malpighian tubule fluid
secretion. J Exp Biol 200, 2363-2367.
Quinlan, M. C. and O'Donnell, M. J. (1998). Anti-diuresis in the blood-feeding insect
Rhodnius prolixus Stal: Antagonistic actions of cAMP and cGMP and the role of organic acid
transport. Journal of Insect Physiology 44, 561-568.
Rosay, P., Davies, S. A., Yu, Y., Sozen, M. A., Kaiser, K. and Dow, J. A. (1997). Cell-type
specific calcium signaling in a Drosophila epithelium. J. Cell. Sci. 110 ( Pt 15), 1683-1692.
Rosenkilde, C., Cazzamali, G., Williamson, M., Hauser, F., Søndergaard, L., DeLotto, R.
and Grimmelikhuijzen, C. J. P. (2003). Molecular cloning, functional expression, and gene
silencing of two Drosophila receptors for the Drosophila neuropeptide pyrokinin-2. Biochem.
Biophys. Res. Commun. 309, 485-494.
Te Brugge, V. A. and Orchard, I. (2002). Evidence for CRF-like and kinin-like peptides as
neurohormones in the blood-feeding bug, Rhodnius prolixus. Peptides 23, 1967-1979.
Te Brugge, V., Ianowski, J. P. and Orchard, I. (2009). Biological activity of diuretic factors
on the anterior midgut of the blood-feeding bug, Rhodnius prolixus. Gen. Comp. Endocrinol.
162, 105-112.
Te Brugge, V. A., Schooley, D. A. and Orchard, I. (2002). The biological activity of diuretic
factors in Rhodnius prolixus. Peptides 23, 671-681.
Verleyen, P., Clynen, E., Huybrechts, J., Van Lommel, A., Vanden Bosch, L., De Loof, A.,
Zdarek, J. and Schoofs, L. (2004). Fraenkel's pupariation factor identified at last. Dev. Biol.
273, 38-47.
![Page 229: Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii peptides in R. prolixus.Gene structure and phylogenetic analyses demonstrate that this](https://reader034.fdocuments.us/reader034/viewer/2022043018/5f3a34851010aa3bc8786102/html5/thumbnails/229.jpg)
215
Watanabe, K., Hull, J. J., Niimi, T., Imai, K., Matsumoto, S., Yaginuma, T. and Kataoka,
H. (2007). FXPRL-amide peptides induce ecdysteroidogenesis through a G-protein coupled
receptor expressed in the prothoracic gland of Bombyx mori. Mol. Cell. Endocrinol. 273, 51-58.
Wegener, C., Linde, D. and Eckert, M. (2001). Periviscerokinins in cockroaches: Release,
localization, and taxon-specific action on the hyperneural muscle. Gen. Comp. Endocrinol. 121,
1-12.
Wieczorek, H., Putzenlechner, M., Zeiske, W. and Klein, U. (1991). A vacuolar-type proton
pump energizes K+/H+ antiport in an animal plasma membrane. Journal of Biological
Chemistry 266, 15340-15347.
Wiehart, U. I. M., Nicolson, S. W., Eigenheer, R. A. and Schooley, D. A. (2002). Antagonistic
control of fluid secretion by the Malpighian tubules of Tenebrio molitor: Effects of diuretic and
anti-diuretic peptides and their second messengers. J Exp Biol 205, 493-501.
Zdarek, J., Verleyen, P., Mares, M., Doleckov, L. and Nachman, R. (2004). Comparison of
the effects of pyrokinins and related peptides identified from arthropods on pupariation
behaviour in flesh fly (Sarcophaga bullata) Larvae (Diptera: Sarcophagidae). J. Insect Physiol.
50, 233.
Žitnaň, D., Zitnanova, I., Spalovska, I., Takac, P., Park, Y. and Adams, M. E. (2003).
Conservation of ecdysis-triggering hormone signaling in insects. J. Exp. Biol. 206, 1275-1289.