Hsp90 inhibitor PU-H71, a multimodal inhibitor of malignancy
Anti-Cancer Activity of PAK4/NAMPT Inhibitor and ...
Transcript of Anti-Cancer Activity of PAK4/NAMPT Inhibitor and ...
1
Anti-Cancer Activity of PAK4/NAMPT Inhibitor and Programmed Cell Death Protein-1
Antibody in Kidney Cancer
Josephine F. Trott*1, Omran Abu Aboud*1, Bridget McLaughlin2, Katie L. Anderson5,6,7,8‡, Jaime
F. Modiano5,6,7,8,9, Kyoungmi Kim3, Kuang-Yu Jen4, William Senapedis10, Hua Chang10, Yosef
Landesman10, Erkan Baloglu10, Roberto Pili11, and Robert H. Weiss1,2,12
1Division of Nephrology, Department of Internal Medicine, 2Comprehensive Cancer Center and 3Division
of Biostatistics, Department of Public Health Sciences and 4Department of Pathology and Laboratory
Medicine, University of California, Davis, CA, USA, 95616
5Animal Cancer Care and Research Program and 6Department of Veterinary Clinical Sciences, College of
Veterinary Medicine, University of Minnesota, St Paul, MN
7Masonic Cancer Center, 8Center for Immunology and 9Stem Cell Institute University of Minnesota,
Minneapolis, MN
10Research and Translational Development, Karyopharm Therapeutics, Inc, Newton, MA 02459
11Indiana University, School of Medicine, Simon Cancer Center, Indianapolis, IN
12Medical Service, VA Northern California Health Care System, Sacramento, CA, USA, 95655
*Equal contribution
‡Current address: North Carolina State University College of Veterinary Medicine. 1060 William Moore
Drive Raleigh, NC 27607
Please address editorial correspondence to:
Dr. Josephine F Trott Department of Animal Science 450 Bioletti Way University of California, Davis, CA. 95616 [email protected]
Kidney360 Publish Ahead of Print, published on March 27, 2020 as doi:10.34067/KID.0000282019
Copyright 2020 by American Society of Nephrology.
2
ABSTRACT
Background
Kidney cancer (or renal cell carcinoma, RCC) is the sixth most common malignancy in the US
and is increasing in incidence. Despite new therapies, including targeted and immunotherapies,
most RCCs are resistant to treatment. Thus, several laboratories have been evaluating new
approaches to therapy, both with single agents as well as combinations. While we have
previously shown efficacy of the dual PAK4/NAMPT inhibitor KPT-9274, and the immune
checkpoint inhibitors (CPI) have shown utility in the clinic, there has been no evaluation of this
combination either clinically or in an immunocompetent animal model of kidney cancer.
Methods
In this study we utilize the RENCA model of spontaneous murine kidney cancer. Male BALB/cJ
mice were injected subcutaneously with RENCA cells and after tumors were palpable, they were
treated with KPT-9274 and/or anti-programmed cell death 1 (PDCD1; PD1) antibody for 21
days. Tumors were measured and then removed at animal sacrifice for subsequent studies.
Results
We demonstrate a significant decrease in allograft growth with the combination treatment of
KPT-9274 and anti-PD1 antibody without significant weight loss by the animals. This is
associated with decreased (MOUSE) Naprt expression, indicating dependence of these tumors
on NAMPT in parallel to what we have observed in human RCC. Histology of the tumors
showed substantial necrosis regardless of treatment condition, and flow cytometry of antibody
stained tumor cells revealed that the enhanced therapeutic effect of KPT-9274 and anti-PD1
antibody was not driven by infiltration of T cells into tumors.
Conclusion
3
This study highlights the potential of the RENCA model for evaluating immunological responses
to KPT-9274 and CPI and suggests that therapy with this combination could improve efficacy in
RCC beyond what is achievable with CPI alone.
KEYWORDS
Renal carcinoma, Immunology and Pathology, Lymphocytes, Metabolism
ABBREVIATIONS
RENCA, renal cell adenocarcinoma; CPI, checkpoint inhibitor; PD1, programmed cell death 1;
PD-L1, CD274 molecule
4
INTRODUCTION
Recent advances in immunotherapy have revolutionized the field of cancer treatment.
Using antibodies against programmed cell death 1 (PDCD1; PD1) and/or programmed cell death
1 ligand 1 (CD274; PD-L1) to block the inhibition on immune recognition of tumor cells (i.e.
immune checkpoint) results in clearance of a wide range of tumor types by T cells (1). Specifically,
immune checkpoint inhibitors (CPI) have shown promise in multiple clinical trials of patients with
renal cell carcinoma (RCC) with objective response rates of 12-31% (2). Unfortunately, in RCC
patients, complete responses to a single PD1/PD-L1 antibody in the absence of an accompanying
conventional or targeted therapeutic are rare (2). For this reason, many clinical researchers are
investigating the treatment of RCC using combinations of CPI, with angiogenesis inhibitors (2) or
with targeted agents.
KPT-9274 is an orally bioavailable small-molecule that modulates the activities of both p21
(RAC1) activated kinase 4 (PAK4) and nicotinamide phosphoribosyltransferase (NAMPT;3). KPT-
9274 reduces the steady-state level of PAK4 in breast cancer cells (4) and kidney cancer cell lines
(3). KPT-9274 has also been shown to have potent antitumor activity in murine xenograft models,
including RCC (3-10), and in trials of companion dogs with lymphoma (11). KPT-9274 is currently
in a phase I study (NCT02702492) to assess the safety, tolerability and preliminary efficacy in
patients with advanced solid malignancies or non-Hodgkin’s lymphoma (NCT02702492; 12).
NAMPT catalyzes the rate-limiting step in the main salvage pathway used to produce
NAD+, an essential co-enzyme in energy-producing catabolic reactions (13). In vertebrates,
NAD+ can be synthesized de novo from tryptophan or salvaged from nicotinamide (through
NAMPT), nicotinic acid (through nicotinate phosphoribosyltransferase or NAPRT) or nicotinamide
riboside (through nicotinamide riboside kinase; 3, 13). Cancer cells preferentially generate NAD
through nicotinamide and NAMPT, most likely because de novo NAD+ synthesis occurs
predominately in the liver and NAPRT is often epigenetically downregulated in cancer cells
5
through hypermethylation of the NAPRT promoter (found in 5 – 65% of samples tested, depending
on tumor type). This correlates with low NAPRT expression in these lines and tumor samples (14).
We have previously shown that two human renal cell carcinoma (RCC) cell lines have very low
levels of NAPRT expression, and treatment with KPT-9274 reduces proliferation and induces
apoptosis in these cells (3). Additionally, a selective inhibitor of NAMPT (FK866/APO866) was
found to have anti-tumorigenic, anti-metastasis and anti-angiogenic activity in a syngeneic mouse
model of renal adenocarcinoma (RENCA) (15).
The signaling molecule PAK4 is involved in multiple pathways, including WNT/β-catenin
signaling (16) whose target genes include cyclin D1 and c-Myc (17), both of which have key roles
in cell proliferation (18). PAK4 regulates the activity of CDKN1A (p21) and thereby regulates
normal progression of the cell cycle (19). PAK4 has also been implicated in the oncogenic
transformation of cells (20, 21). In a recent publication, the epithelial-to-mesenchymal transition
(EMT) of gastric cancer cell lines was correlated to loss of NAPRT expression (22). The authors
suggested that NAPRT expression destabilizes β-catenin and acts as a tumor suppressor protein
prior to cells undergoing the EMT phenotypic change. However, when NAPRT is lost through the
dynamic process of epigenetic silencing (possibly through selective pressure on cancer cells), β-
catenin is stabilized, resulting in EMT expression in these cell lines. At the same time the EMT
cells become sensitive to NAMPT inhibition (22). PAK4 also affects β-catenin stability by inhibiting
degradation of β-catenin (16, 23).
Recently, a correlation was reported between activation of the PAK4 and WNT/β-catenin
signaling pathway and T cell exclusion in melanoma patient samples (24, 25). The low immune
cell infiltration is also associated with resistance to PD-L1/CTLA-4 antibody therapy (24). This
correlation has been further validated in other cancer types including breast, colorectal, non-small
cell lung, and RCC (26), and these data suggested that combination therapies in which activated
β-catenin is inhibited simultaneously with targeting PD1, as we have investigated in this study,
6
may be particularly effective. Thus, PAK4/WNT/β-catenin, NAMPT, and the immune system seem
to converge making KPT-9274 and immune CPI combination a viable therapy for RCC patients.
In this study, we show that PD1 inhibition enhances the anti-tumor effect of the novel RCC
therapeutic KPT-9274, which specifically targets tumors because they have undergone metabolic
reprogramming of the NAD+ biosynthesis pathway. Thus, combination immunotherapies utilizing
dual PAK4/NAMPT inhibition as well as CPI antibodies are now primed to be studied in the
oncology clinic.
MATERIALS AND METHODS
Tissues and Cells
Mouse RENCA-luciferase (RENCA-luc) cells were derived from a spontaneous kidney
adenocarcinoma in BALB/cCr mice (27-29), and were authenticated by STR and species
analysis (IDEXX BioAnalytics, Colombia, MO). They were injected into mice at passage 4-6.
RCC cell lines (786-O, Caki-1 and ACHN) were purchased from and authenticated by ATCC
and passaged less than 20 times. All cells were confirmed mycoplasma-free, handled one-at-a-
time in the cell culture hood, each with their own media and trypsin bottle. Tissues from human
clear cell RCC (ccRCC) tumors and normal human kidney tissues (adjacent to a tumor) were
archived following IRB approval at the UC Davis Department of Pathology.
In vivo experiments
Animal experiments were performed in accordance with guidelines set forth by the
Institutional Animal Care and Use Committee at UC Davis. Six-week old male BALB/cJ mice
(Jackson Laboratories, Bar Harbor, ME) had ad libitum access to standard laboratory mouse
chow and water. RENCA-luc cells (2.5 x 105) were injected in 100 µl of OptiMEM with 33% BD
Matrigel Matrix (Corning, Tewksbury, MA) subcutaneously in the right flank of male mice when
they reached 8-weeks of age. Male mice were used because RCC is more severe and twice as
7
common in men than women (30). Treatments were started 10 days after injection. Four
separate batches of mice were injected with RENCA-luc cells and then treated. Treatments
were assigned randomly to mice within each batch. Anti-mouse PD1 or isotype control antibody
(250 µg/dose) was injected IP twice a week. KPT-9274 (200 mg/kg) or vehicle was administered
orally twice a day 5 days/week. Mice were weighed at the start of the treatment period and once
a week thereafter. Subcutaneous tumors were measured (length and width) in situ every 2-3
days using calipers and tumor volume was calculated using the formula ½*length*width2.
RENCA tumors were dissected from BALB/cJ mice after 21 days of treatments. The length,
width and depth of tumors were measured using a caliper, and tumor volume was calculated
using the formula 4/3*3.142*(length/2)*(width/2)*(depth/2). Tumors were dissected and a small
piece was frozen, a second small piece was fixed in 10% formalin for histology and
immunohistochemistry and the remainder was processed for flow cytometry. Spleens were also
harvested, either for flow cytometry or fixed in 10% formalin.
Immunohistochemistry
Formalin-fixed paraffin-embedded sections (5 μm) were cut from untreated BALB/cJ
mouse RENCA tumors. Immunohistochemistry was performed as previously described (31)
using the following antibodies, Ki67 (Cell Marque, 275R-18), PD-L1 (Cell Signaling Technology,
13684) and PD-L2 (Cell Signaling Technology, 82723).
Isolation of tumor-infiltrating cells and flow cytometry
Tumors and spleens were harvested, mashed against a size 60 mesh stainless steel
screen (Sigma-Aldrich) and passed through a 100-µm cell strainer (ThermoFisher Scientific).
Red blood cells were lysed using ammonium chloride potassium lysis buffer and cells
resuspended in PBS for staining with Aqua zombie (Biolegend Inc). Non-specific staining was
blocked using mouse gamma globulin (Jackson Immunoresearch Laboratories) and cells were
stained in staining buffer (PBS, 3.5% FBS, 1 mM EDTA) with a panel of antibodies purchased
8
from Biolegend Inc, except where indicated: anti-CD45-Alexa Fluor 700 (clone 30-F11), anti-
CD11b-APC/Fire 750 (clone M1/70), anti-CD4-PE (clone RM4-4), anti-CD19-FITC (clone 6D5),
anti-CD25-PE/Cy7 (clone PC61.5; eBiosciences), anti-CD3ε-Brilliant Violet 421 (clone 145-
2C11), anti-CD8a-Brilliant Violet 605 (clone 53-6.7). The stained cells were then fixed using
Foxp3/Transcription Factor Staining Buffer Set (eBioscience) and stained for intranuclear
staining with anti-FoxP3-APC (clone 3G3; ThermoFisher Scientific). Stained cells were analyzed
using a BD LSRII flow cytometer (BD Biosciences, San Jose, CA), and data processed using
Flowjo software (Treestar, Ashland, OR). The gating strategy for spleens and tumors is depicted
in Supp Fig. 1 and all populations of immune cells are expressed as a percentage of the total
number of single cell, live CD45+ lymphocytes.
RNA extraction, Reverse Transcription and Quantitative PCR (qPCR)
RNA extraction, reverse transcription and qPCR were performed as previously described
(32, 33). Primer sequences, annealing temperatures and efficiency of amplification for NAMPT,
NAPRT, Nampt and Naprt are in Table 1. The (HUMAN)NAMPT primers amplify 9 potential
transcripts including the full-length protein coding transcript. The (HUMAN)NAPRT primers
amplify 11 potential transcripts including the full-length protein coding transcript. The
(MOUSE)Nampt and Naprt primers amplify the single protein coding transcript in each case.
Immunoblotting
Immunoblotting was performed as previously described (34). Briefly, tumors and kidneys
were homogenized in T-PER buffer (ThermoFisher Scientific). PVDF membranes were blocked
in 5% milk and probed with appropriate primary and secondary antibodies. Signal was detected
with ECL using either a Fuji Imager, or x-ray film and ImageJ to quantify band intensity. Phospho-
β-catenin and PAK4 antibodies (Cell Signaling Technology, Danvers, MA) were probed at 1:1000.
Rabbit anti-NAMPT (Bethyl Laboratories Inc., Montgomery, TX) was probed at 1:2000. Rabbit
polyclonal anti-NAPRT (ThermoFisher Scientific PA5-70595) was probed at 1:500. Mouse anti-β-
9
actin (Sigma-Aldrich) was probed at 1:4000. Rabbit anti-β-actin (Cell Signaling Technology) was
probed at 1:2000.
Oxidized (NAD+) and Reduced ß-nicotinamide Adenine Dinucleotide (NADH) Assay
Total NAD+NADH was quantified in tumor extracts using the NAD/NADH Glo Assay kit
(Promega) following the manufacturer’s instructions. Briefly 10-30 mg of tumor tissue was
homogenized in 1-5 ml of a 50:50 mixture of PBS pH 7.4 and bicarbonate base buffer with
dodecyltrimethylammonium bromide (DTAB; Sigma-Aldrich) (1% DTAB, 100 mM sodium
carbonate, 20 mM sodium bicarbonate, 10 mM nicotinamide (Sigma-Aldrich), 0.05% Triton® X-
100). Four dilutions of the tumor homogenates were assayed against a standard curve of NAD+
(Sigma-Aldrich), prepared in a 50:50 mixture of PBS:bicarbonate base buffer with DTAB (0 - 400
nM). NAD+NADH values were normalized to protein concentrations that were measured using
the DC protein assay (Bio-Rad).
MTT Assay
Cells (1.4x103) were plated in 96-well plates and the next day KPT-9274 was added to
fresh media in a range of concentrations (0-10 µM). Three days later cells were stained with
Thiazolyl Blue Tetrazolium Bromide (MTT) as previously described (35).
Bisulfite Genomic DNA modification, Methylation Specific PCR and Quantitative Methylation
Specific PCR
Genomic DNA (gDNA) was extracted from ccRCC tumors, RENCA tumors (untreated
mice), normal kidneys (human and BALB/cJ mice) and the RCC cell lines Caki-1, 786-O and
ACHN. Each human gDNA sample (1 µg) was methylated using CpG Methyltransferase
(M.SssI) following the manufacturer’s instruction (New England Biolabs, Ipswich, MA). For each
human sample an equal mass of both 100% methylated gDNA and untreated gDNA (range of
376-826 ng) were bisulfite-converted along with mouse gDNA (500 ng) using the Zymo EZ DNA
Methylation kit (Zymo Research), and eluted in 20 μl. MethPrimer (36) predicted CpG islands in
10
the first exon of both (HUMAN)NAPRT and (MOUSE)Naprt and primers were designed for both
methylated and unmethylated (MOUSE)Naprt and for methylated (HUMAN)NAPRT (Table 2).
The (MOUSE)Naprt primers were located in exon 1, 26-27 bp upstream and 78-79 bp
downstream of the translation start site. The (HUMAN)NAPRT primers were located in exon 1,
56-123 bp downstream of the translation start site. The methylation specific PCR (MSP)
reactions were performed on mouse gDNA using EpiMark Hot Start Taq Polymerase (New
England Biolabs) on 2 μl of bisulfite-modified DNA with 200 nM of primers specific for
methylated (M) or unmethylated (U) (MOUSE)Naprt. PCR reactions were heated to 95oC for
30s, then 40 cycles of 95oC 15 s, annealing for 30s (U) or 60s (M) and 68oC for 30 s, followed
by a final extension of 68oC for 5 min. The Quantitative MSP (qMSP) reactions were performed
on 100% methylated and untreated human gDNA using Power SYBR Green Master Mix
(ThermoFisher) on 1 μl of bisulfite-converted gDNA with 400 nM of primers specific for
methylated (HUMAN)NAPRT or 250 nM of (HUMAN)ACTB primers. PCR reactions were heated
to 95oC for 10 min, then 40 cycles of 95oC 15 s, annealing/extension for 1 min. The %
methylation of each human gDNA sample was calculated using the 2-ΔΔCT method.
(HUMAN)NAPRT methylation (Ct) was corrected for (HUMAN)ACTB (Ct) and then the fraction
of methylation in untreated gDNA (if >0) was calculated relative to the 100% methylated gDNA
for each sample.
Statistics
Statistical analyses of data were performed with SAS software, version 9.3 (SAS
Institute, Cary, NC). Data were transformed to achieve normality and homogeneity of variance
prior to statistical analysis. Outliers in the flow cytometry data sets were assessed using Prism8
(GraphPad Software). Tumor growth and size data were analyzed using mixed-effects models
with repeated measures followed by a post-hoc Tukey test while controlling for multiple testing.
Treatment, day and batch were considered fixed effects, while cage was considered a random
11
effect. Similarly, data for in situ and ex vivo tumor sizes on individual days and flow cytometry
data were analyzed using a mixed-effects model followed by a post-hoc Tukey test.
Immunoblotting and NAD+NADH assay data was analyzed for main effects of PD1 antibody
(present/absent) and KPT-9274 treatment (present/absent) and its interaction using a two-way
factorial ANOVA (PROC GLM) and a post-hoc Tukey test. Two-tailed p-values less than 0.05
were considered statistically significant as appropriate.
RESULTS
NAMPT and NAPRT expression in human and murine kidney cancers
We have previously demonstrated growth attenuation of human ccRCC cell line murine
xenografts in response to KPT-9274 administration (3), however we did not assess NAMPT and
NAPRT expression. Herein, we evaluated these genes in archived human ccRCC tumors and
normal kidneys using qPCR. No significant differences were observed in either NAMPT (Fig.
1A) or NAPRT mRNA (Fig. 1B) expression between normal kidneys and ccRCC tumors of
grades 1-4. However, six out of nineteen (31%) ccRCC tumors ranging from grades 1 to 4 had
at least 25% lower NAPRT mRNA expression than the lowest expressing normal kidney sample
(Fig. 1B). These low expressing NAPRT tumors were found across all four grades of ccRCC.
We next examined the methylation status of the NAPRT promoter in normal kidney samples,
ccRCC tissue and cell lines. We used qMSP to measure the relative percent of methylation and
found that the NAPRT promoter was unmethylated in normal human kidneys. However NAPRT
was hypermethylated in all ccRCC tumors and cell lines with low expression of NAPRT mRNA
but only minimally methylated in ccRCC tumors with high expression of NAPRT (Fig. 1C).
We chose the RENCA mouse model of RCC (32) to test the effects of KPT-9274 in
combination with an immunotherapeutic since these cells represent a syngeneic tumor in an
immunocompetent mouse, whereas “standard” immunodeficient xenografted nude mice would
12
be ineffective for evaluating an immunotherapeutic. The RENCA tumors were found to be highly
proliferative in the mouse as evidenced by Ki67 staining, associated with a relatively high level
of PD-L1 expression with PD-L2 expression confined to stromal cells (Fig. 2). We next
examined the expression of both MOUSE Nampt and Naprt in RENCA tumors and normal
mouse kidneys and found that RENCA tumors expressed Nampt at a similar level to that in the
normal kidney, both at the protein and mRNA levels (Fig. 3A). However, RENCA tumors have
downregulated expression of NAPRT compared with normal kidney tissue (Fig. 3A) while Naprt
mRNA expression is >6-fold lower in RENCA tumors vs kidneys (Fig. 3B). These protein
expression data are consistent with what we previously observed in human RCC cell lines (3).
We next examined whether the observed downregulation of (MOUSE)NAPRT was due to
methylation of the promoter, as we have already demonstrated was present in the human
ccRCC tumors. A CpG island was found in exon 1 of the Naprt gene, in a similar location to the
NAPRT gene. The gDNA from RENCA cells was subjected to methylation-specific PCR analysis
and found to contain methylated Naprt promoter sequences (data not shown). When we
analyzed gDNA from three mouse kidneys using MSP we found they contained unmethylated
Naprt gDNA while three RENCA tumors were found to contain both unmethylated and
methylated Naprt gDNA (Fig. 3C). Thus, as with human ccRCC, in RENCA tumors the
downregulation of Naprt at the level of transcription is also associated with methylation of the
promoter.
We measured the effect of KPT-9274 on RENCA-luc cell growth in vitro and found that
the viability of RENCA-luc cells was attenuated by KPT-9274 in a concentration-dependent
manner (Supp Fig. 2). This is evidence that the loss of the NAPRT pathway through epigenetic
changes not only sensitizes human RCC to NAMPT inhibition but may be directly recapitulated
in this syngeneic mouse model of RCC. Based on our in vitro data as well as in vivo data on
subcapsular growth of RENCA in the syngeneic mouse previously described (15), we expected
13
that the subcutaneous RENCA tumor model would respond well to NAMPT inhibition with KPT-
9274 (3).
RENCA tumor growth is attenuated by KPT-9274
For the in vivo model, cultured RENCA-luc cells were injected subcutaneously in
BALB/cJ mice. After palpable tumors appeared (in 10 days), the mice were then treated for 21
days with either KPT-9274 or anti-PD1 antibody or a combination of both agents (see Materials
and Methods). The tumors were measured with calipers every two to three days (Supp Fig. 3;
Fig. 4A). An analysis of the tumor growth data using repeated measures over time
demonstrated that there were significant effects of day and treatment on tumor sizes
(p<0.0001), but no interaction between day and treatment (p=0.98). The combined treatment
with KPT-9274 and anti-PD1 gave significantly smaller tumors than KPT-9274 alone (p=0.001),
anti-PD1 alone (p<0.0001) or control treatments (p<0.0001). When tumor sizes were analyzed
at each day of measurement, there was an effect of KPT-9274 on tumor growth (p<0.03) on
days 14, 17, 19 and 21 and there was also an interaction between anti-PD1 and KPT-9274 to
reduce tumor growth on days 19 and 21 (p<0.05; Fig. 4A). No significant changes in weight
were observed due to treatment, suggesting a lack of general toxicity of the treatments (Fig.
4B).
The RENCA tumors were removed and measured at necropsy 21 days after starting
treatment. In this analysis, we found that there was an effect of KPT-9274 on tumor size
(p=0.0014) and evidence of a possible interaction between anti-PD1 and KPT-9274 (p=0.088).
The combination treatment (KPT-9274 and anti-PD1) was more effective at decreasing tumor
growth than either anti-PD1 alone (p=0.0012) or KPT-9274 alone (p=0.0164; Fig. 4C).
RENCA tumors were highly necrotic
Formalin-fixed, paraffin-embedded tissue sections stained with hematoxylin and eosin
were evaluated by a pathologist (K.-Y.J). All tumor samples showed pronounced areas of
14
geographic necrosis admixed with areas of viable tumor, which did not correlate with specific
treatments (Supp Fig. 4).
Effects of treatments on tumor infiltrating T cell populations
RENCA tumors were dispersed to single cells and stained to detect live CD45+
lymphocytes that were further gated on CD11b, CD19, CD3, CD4, CD8, CD25 and FoxP3
(Supp Figs 1A and B). Data are expressed as a % of live CD45+ lymphocytes. The gating is
described in Supp Fig. 1. The infiltration of CD3lo&CD3high cells into tumors was heterogenous
in all treatment groups (Fig. 5A). They had a bimodal distribution (either <20% CD3+ or >40%
CD3+) which was most accentuated in the tumors from KPT-9274 treated mice. The infiltration
of CD8+ cells was low in most tumors and heterogeneous with a bimodal distribution (either
<1% CD8+ or >2% CD8+). This bimodal distribution was accentuated by the addition of KPT-
9274 and anti-PD1, resulting in significantly more CD8+ cells in the combination treatment
group compared to KPT-9274 alone (Figs 5A and B). The infiltration of Treg cells was also very
low (<2% of all CD45+ tumor infiltrating lymphocytes), although they too had a bimodal
distribution in different tumors (<0.35% and >0.5%) which was accentuated somewhat in the
combination treatment group (Fig. 5A).
Tumor expression of Pak4 and phospho (P)-β-catenin was reduced by KPT-9274
KPT-9274 treatment of RCC cells is known to reduce PAK4 protein levels and interfere
with the WNT/β-catenin signaling pathways (3). Proteins from the RENCA tumors were
immunoblotted to examine levels of PAK4 and phospho (P)-β-catenin (Fig. 6 and Supp Fig. 5).
We measured PAK4 and (P)-β-catenin in the tumors from 24 mice in the four treatment groups
(n=6 per group; Supp Fig. 5). As expected, there was a effect of KPT-9274 causing a reduction
in Pak4 expression levels (p=0.04; Fig. 6A) as well as inhibiting the phosphorylation of β-catenin
(p=0.02; Fig. 6B).
Tumor levels of NAD+NADH were reduced by KPT-9274 and increased by PD1 antibody
15
In addition to reducing levels of PAK4, KPT-9274 also inhibits the enzymatic activity of
NAMPT and represses NAD biosynthesis. To confirm NAMPT inhibition in vivo, we examined
the NAD+NADH levels in RENCA tumors from mice. When we examined NAD+NADH levels in
response to each treatment individually, the NAD+NADH levels in RENCA tumors were lower in
mice treated with KPT-9274 compared to anti-PD1 (p=0.01; Fig. 7). We also found, as in other
models, that total NAD+NADH was decreased by a main effect of KPT-9274 treatment (p=0.02;
Fig. 7). Interestingly, the NAD+NADH levels in RENCA tumors were increased by a main effect
of the anti-PD1 antibody (p=0.02; Fig. 7).
DISCUSSION
In this study, we found a significant interaction between the dual PAK4 and NAMPT
inhibitor, KPT-9274, and an antibody against PD1 that slowed the growth of RENCA tumors in a
syngeneic mouse model of renal cancer. This is in line with a recent report describing mouse
models of melanoma and colon adenocarcinoma, where KPT-9274 improves the response to anti-
PD1 therapy to reduce tumor growth (24). This was accompanied by a KPT-9274-driven decrease
in PAK4 expression and β-catenin activation. Interestingly, while KPT-9274 reduced total
NAD+NADH as expected, there was not an overall decrease in total NAD+NADH in the
combination treatment (KPT-9274+anti-PD1), possibly due to the inhibitory effect of KPT-9274 on
energy metabolism being off-set by a stimulatory effect of anti-PD1. To our knowledge, this is the
first evidence that PD1 antibody therapy may be linked to increases in NAD+. Therefore, two
mechanisms may be occurring independently in these tumors: first, the inhibition of
(MOUSE)NAMPT activity by KPT-9274 which decreases NAD+NADH in the tumor cells (because
the RENCA cells are lacking NAPRT) and, second, the PD1 antibody may have re-engaged T cell
activation and possibly increased NAD+NADH levels even in the presence of KPT-9274, because
16
T cells have normal levels of NAPRT. Increased NAD+ may actually enhance the anti-tumor T
cell response (37), another salutary effect of this combination therapy.
Data from breast, colorectal, non-small cell lung, and RCC tumors (26), has suggested that
combination therapies in which activated β-catenin is inhibited simultaneously with targeting PD1
can be particularly efficacious. In the RENCA model we found the effects of PD1 blockade was
unpredictable with only ~25% of tumors responding (Fig. 4C). The effect of anti-PD1 on T cell
infiltrates was minimal but the combination of anti-PD1 and KPT-9274 increased CD8+ infiltration
in ~50% of animals (Fig. 5A). However, the tumors that responded to the anti-PD1+KPT-9274
treatment were not the tumors with increased T cell infiltration (data not shown). Similarly, the
tumor size response to treatment (Fig. 4A; Supp Fig. 3) did not display the same bimodal
distribution observed in the infiltrated T cells (Fig. 5). Thus the effectiveness of the combination
treatment is possibly associated with direct anti-tumor effects of KPT-9274 perhaps stimulating
more robust T cell activity which may be enhanced by anti-PD1. Further experiments would
greatly assist in exploring these possibilities.
NAMPT transfers a phosphoribosyl residue from 5-phosphoribosyl-1-pyrophosphate to
nicotinamide which produces nicotinamide mononucleotide. Nicotinomide mononucleotide
adenylyl transferase converts nicotinamide mononucleotide into NAD+ (38). An alternative NAD
biosynthesis pathway employs the three step Preiss-Handler pathway that starts with NAPRT
acting on nicotinic acid to generate nicotinic acid mononucleotide, which is then converted to
nicotinic acid adenine dinucleotide and subsequently to NAD+ (39, 40). This pathway can also
salvage NAD+ from nicotinamide by using a gut bacterial nicotinamidase to convert nicotinamide
to nicotinic acid (13). A subset of non-small cell lung carcinoma, small-cell lung carcinoma, breast
cancer, pancreatic cancer, glioma and fibrosarcoma cell lines have epigenetic downregulation of
the NAPRT promoter, which correlates with low NAPRT expression in these lines (14, 41), as we
found in a sub-set of human ccRCC patients (Fig. 1) and RENCA cells (Fig. 3). In these patients,
17
NAMPT inhibitors may be particularly efficacious at inhibiting tumor growth because one salvage
pathway for NAD biosynthesis is severely reduced. The supplementation of nicotinic acid to
patients can mitigate the potential toxic side effects of NAMPT inhibition in non-target tissues that
still express NAPRT while the tumor cells that have reduced NAPRT expression will still be
affected by the NAMPT inhibitor despite nicotinic acid supplementation (14). Low expression of
NAPRT (over 7.62 FPKM) in renal cancer is an unfavorable prognostic marker
(https://www.proteinatlas.org/ENSG00000147813-NAPRT/pathology/tissue/renal+cancer). This
has not been found in other malignancies and has not been reported elsewhere, and the data
suggest a personalized medicine approach in which those RCC patients identified to have low
expression of NAPRT mRNA associated with methylation of the NAPRT promoter (see Fig. 1)
would likely be particularly appropriate candidates for KPT-9274 therapy with nicotinic acid
supplementation.
A high level of variation in tumor growth rates was observed in the control mice despite
these being clonal tumors in syngeneic hosts. In all treatment groups there were mice whose
tumors grew very little over the 21-day treatment period (Supp Fig. 3) while in the anti-PD1 and
control groups only, some mice grew very large tumors. The innate immune system is capable of
both promoting tumor growth as well as inhibiting tumor growth (42). If the combination treatment
KPT-9274 + anti-PD1 is inhibiting tumor growth via recruitment of more tumor inhibitory than tumor
promoting elements of the immune system, this suggests there are stochastic events that control
the immune response to tumors that we may not be able to measure or easily control. However,
we can conclude that the combination treatment did not cooperate to recruit more T cells to the
tumors in our experiments.
In summary, we have extended our previous work on a dual PAK4/NAMPT inhibitor in
kidney cancer to show that therapy with this drug in combination with the anti-PD1 is more
effective at inhibiting growth of the tumors when compared to the single therapies. These data
18
indicate that this combination should be evaluated in patients who are unresponsive to immune
CPI alone; our work thus may broaden the populations that shows a robust response with these
novel antibody treatments.
ACKNOWLEDGEMENTS
We thank Lauren Hirao for assistance with planning the flow cytometry experiments.
AUTHOR CONTRIBUTIONS
Josephine Trott: Conceptualization; Formal analysis; Funding acquisition; Investigation;
Methodology; Writing – original draft; Writing - review and editing
Omran Abu Aboud: Conceptualization; Formal analysis; Investigation; Methodology; Writing -
original draft; Writing - review and editing
Bridget McLaughlin: Formal analysis; Investigation; Methodology; Writing - original draft; Writing
- review and editing
Katie Anderson: Conceptualization; Methodology; Writing - review and editing
Jaime Modiano: Conceptualization; Methodology; Writing – original draft; Writing - review and
editing
Kyoungmi Kim: Formal analysis; Writing - review and editing
Kuang-Yu Jen: Formal analysis; Writing – review and editing
William Senapedis: Conceptualization; Funding acquisition; Writing - review and editing
Hua Chang: Investigation; Writing - review and editing
Yosef Landesman: Funding acquisition; Writing - review and editing
Erkan Baloglu: Resources
19
Roberto Pili: Resources
Robert Weiss: Conceptualization; Funding acquisition; Resources; Supervision; Writing - original
draft; Writing - review and editing
DISCLOSURES
This work was in part supported by grants from Dialysis Clinics Incorporated (DCI), but DCI had
no influence on the experiments, data collection, or manuscript writing. Y Landesman, W
Senapedis, E Baloglu and H Chang were employees of Karyopharm Therapeutics while the
work was being carried out; and report a patent to WO 2017031213 issued. H Chang conducted
immunohistochemistry experiments. Y Landesman and W Senapedis provided advice. Y
Landesman, W Senapedis, E Baloglu and H Chang did not influence the experiments or
conclusions of the paper. Karyopharm provided KPT-9274 and an unrestricted gift for purchase
of some reagents. W Senapedis has stock and options in Karyopharm Therapeutics Inc.
FUNDING
This work was supported by NIH grants 1R03CA181837-01 and 1R01DK082690-01A1, the
Medical Service of the US Department of Veterans’ Affairs (all to R.H. Weiss), Dialysis Clinics
Inc. (DCI) (to R.H. Weiss and J.F. Trott) and K.L.A was supported by the Ruth L. Kirschstein
National Research Service Award from NCI (F30 CA195973). J.F.M was supported by the
Perlman Chair in Animal Oncology. This project was also supported by the University of
California Davis Flow Cytometry Shared Resource Laboratory with funding from the NCI P30
CA093373 (Cancer Center), and NIH NCRR C06-RR12088. A non-restricted gift for research
purposes was provided by Karyopharm Therapeutics, Inc.
20
REFERENCES
1. Gong J, Chehrazi-Raffle A, Reddi S, Salgia R: Development of PD-1 and PD-L1 inhibitors as
a form of cancer immunotherapy: a comprehensive review of registration trials and future
considerations. J Immunother Cancer, 6: 8, 2018.
2. Ross K, Jones RJ: Immune checkpoint inhibitors in renal cell carcinoma. Clin Sci (Lond), 131:
2627-2642, 2017.
3. Abu Aboud O, Chen CH, Senapedis W, Baloglu E, Argueta C, Weiss RH: Dual and Specific
Inhibition of NAMPT and PAK4 By KPT-9274 Decreases Kidney Cancer Growth. Mol
Cancer Ther, 15: 2119-2129, 2016.
4. Rane C, Senapedis W, Baloglu E, Landesman Y, Crochiere M, Das-Gupta S, Minden A: A
novel orally bioavailable compound KPT-9274 inhibits PAK4, and blocks triple negative
breast cancer tumor growth. Sci Rep, 7: 42555, 2017.
5. Mitchell SR, Larkin K, Grieselhuber NR, Lai TH, Cannon M, Orwick S, Sharma P, Asemelash
Y, Zhang P, Goettl VM, Beaver L, Mims A, Puduvalli VK, Blachly JS, Lehman A,
Harrington B, Henderson S, Breitbach JT, Williams KE, Dong S, Baloglu E, Senapedis W,
Kirschner K, Sampath D, Lapalombella R, Byrd JC: Selective targeting of NAMPT by
KPT-9274 in acute myeloid leukemia. Blood Adv, 3: 242-255, 2019.
6. Li N, Lopez MA, Linares M, Kumar S, Oliva S, Martinez-Lopez J, Xu L, Xu Y, Perini T,
Senapedis W, Baloglu E, Shammas MA, Hunter Z, Anderson KC, Treon SP, Munshi NC,
Fulciniti M: Dual PAK4-NAMPT Inhibition Impacts Growth and Survival, and Increases
Sensitivity to DNA-Damaging Agents in Waldenstrom Macroglobulinemia. Clin Cancer
Res, 25: 369-377, 2019.
7. Aboukameel A, Muqbil I, Senapedis W, Baloglu E, Landesman Y, Shacham S, Kauffman M,
Philip PA, Mohammad RM, Azmi AS: Novel p21-Activated Kinase 4 (PAK4) Allosteric
21
Modulators Overcome Drug Resistance and Stemness in Pancreatic Ductal
Adenocarcinoma. Mol Cancer Ther, 16: 76-87, 2017.
8. Fulciniti M, Martinez-Lopez J, Senapedis W, Oliva S, Lakshmi Bandi R, Amodio N, Xu Y,
Szalat R, Gulla A, Samur MK, Roccaro A, Linares M, Cea M, Baloglu E, Argueta C,
Landesman Y, Shacham S, Liu S, Schenone M, Wu SL, Karger B, Prabhala R, Anderson
KC, Munshi NC: Functional role and therapeutic targeting of p21-activated kinase 4 in
multiple myeloma. Blood, 129: 2233-2245, 2017.
9. Jiang YY, Lin DC, Mayakonda A, Hazawa M, Ding LW, Chien WW, Xu L, Chen Y, Xiao JF,
Senapedis W, Baloglu E, Kanojia D, Shang L, Xu X, Yang H, Tyner JW, Wang MR,
Koeffler HP: Targeting super-enhancer-associated oncogenes in oesophageal squamous
cell carcinoma. Gut, 66: 1358-1368, 2017.
10. Takao S, Chien W, Madan V, Lin DC, Ding LW, Sun QY, Mayakonda A, Sudo M, Xu L,
Chen Y, Jiang YY, Gery S, Lill M, Park E, Senapedis W, Baloglu E, Muschen M, Koeffler
HP: Targeting the vulnerability to NAD(+) depletion in B-cell acute lymphoblastic
leukemia. Leukemia, 32: 616-625, 2018.
11. London C, Brown M, Warry E, Schuh E, Senapedis WT, Argueta C, Kashyap T, Chang H,
Ellis J, Shacham S, Baloglu E: Abstract LB-308: KPT-9274 inhibits cellular NAD and
synergizes with doxorubicin to treat dogs with lymphoma. Cancer Res, 77: LB-308, 2017.
12. Naing A, Leong S, Pishvaian MJ, Razak ARA, Mahipal A, Berlin J, Cho D, Baloglu E, Ellis J,
Meade J, Kauffman M, Shacham S, Senapedis W: 374PDA first in human phase 1 study
of KPT-9274, a first in class dual inhibitor of PAK4 and NAMPT, in patients with
advanced solid malignancies or NHL. Ann Oncol, 28, 2017.
13. Bogan KL, Brenner C: Nicotinic acid, nicotinamide, and nicotinamide riboside: a molecular
evaluation of NAD+ precursor vitamins in human nutrition. Annu Rev Nutr, 28: 115-130,
2008.
22
14. Shames DS, Elkins K, Walter K, Holcomb T, Du P, Mohl D, Xiao Y, Pham T, Haverty PM,
Liederer B, Liang X, Yauch RL, O'Brien T, Bourgon R, Koeppen H, Belmont LD: Loss of
NAPRT1 expression by tumor-specific promoter methylation provides a novel predictive
biomarker for NAMPT inhibitors. Clin Cancer Res, 19: 6912-6923, 2013.
15. Drevs J, Loser R, Rattel B, Esser N: Antiangiogenic potency of FK866/K22.175, a new
inhibitor of intracellular NAD biosynthesis, in murine renal cell carcinoma. Anticancer
Res, 23: 4853-4858, 2003.
16. Li Y, Shao Y, Tong Y, Shen T, Zhang J, Li Y, Gu H, Li F: Nucleo-cytoplasmic shuttling of
PAK4 modulates beta-catenin intracellular translocation and signaling. Biochim Biophys
Acta, 1823: 465-475, 2012.
17. Clevers H: Wnt/beta-catenin signaling in development and disease. Cell, 127: 469-480,
2006.
18. Liao DJ, Thakur A, Wu J, Biliran H, Sarkar FH: Perspectives on c-Myc, Cyclin D1, and their
interaction in cancer formation, progression, and response to chemotherapy. Crit Rev
Oncog, 13: 93-158, 2007.
19. Nekrasova T, Minden A: PAK4 is required for regulation of the cell-cycle regulatory protein
p21, and for control of cell-cycle progression. J Cell Biochem, 112: 1795-1806, 2011.
20. Callow MG, Clairvoyant F, Zhu S, Schryver B, Whyte DB, Bischoff JR, Jallal B, Smeal T:
Requirement for PAK4 in the anchorage-independent growth of human cancer cell lines.
J Biol Chem, 277: 550-558, 2002.
21. Kimmelman AC, Hezel AF, Aguirre AJ, Zheng H, Paik JH, Ying H, Chu GC, Zhang JX, Sahin
E, Yeo G, Ponugoti A, Nabioullin R, Deroo S, Yang S, Wang X, McGrath JP,
Protopopova M, Ivanova E, Zhang J, Feng B, Tsao MS, Redston M, Protopopov A, Xiao
Y, Futreal PA, Hahn WC, Klimstra DS, Chin L, DePinho RA: Genomic alterations link Rho
23
family of GTPases to the highly invasive phenotype of pancreas cancer. Proc Natl Acad
Sci U S A, 105: 19372-19377, 2008.
22. Lee J, Kim H, Lee JE, Shin SJ, Oh S, Kwon G, Kim H, Choi YY, White MA, Paik S, Cheong
JH, Kim HS: Selective Cytotoxicity of the NAMPT Inhibitor FK866 Toward Gastric Cancer
Cells With Markers of the Epithelial-Mesenchymal Transition, Due to Loss of NAPRT.
Gastroenterology, 155: 799-814 e713, 2018.
23. Dart AE, Wells CM: P21-activated kinase 4--not just one of the PAK. Eur J Cell Biol, 92:
129-138, 2013.
24. Abril-Rodriguez G, Torrejon DY, Liu W, Zaretsky JM, Nowicki TS, Tsoi J, Puig-Saus C,
Baselga-Carretero I, Medina E, Quist MJ, Garcia AJ, Senapedis W, Baloglu E, Kalbasi A,
Cheung-Lau G, Berent-Maoz B, Comin-Anduix B, Hu-Lieskovan S, Wang C-Y, Grasso
CS, Ribas A: PAK4 inhibition improves PD-1 blockade immunotherapy. Nature Cancer,
1: 46-58, 2020.
25. Spranger S, Bao R, Gajewski TF: Melanoma-intrinsic beta-catenin signalling prevents anti-
tumour immunity. Nature, 523: 231-235, 2015.
26. Luke JJ, Bao R, Sweis RF, Spranger S, Gajewski TF: WNT/beta-catenin Pathway Activation
Correlates with Immune Exclusion across Human Cancers. Clin Cancer Res, 25: 3074-
3083, 2019.
27. Murphy GP, Hrushesky WJ: A murine renal cell carcinoma. J Natl Cancer Inst, 50: 1013-
1025, 1973.
28. Salup RR, Herberman RB, Wiltrout RH: Role of natural killer activity in development of
spontaneous metastases in murine renal cancer. J Urol, 134: 1236-1241, 1985.
29. Tracz A, Mastri M, Lee CR, Pili R, Ebos JM: Modeling Spontaneous Metastatic Renal Cell
Carcinoma (mCC) in Mice following Nephrectomy. Journal of Visual Experiments, 86:
e51485, 2014.
24
30. Escudier B, Porta C, Schmidinger M, Rioux-Leclercq N, Bex A, Khoo V, Grunwald V,
Gillessen S, Horwich A, ESMO Guidelines Committee: Renal cell carcinoma: ESMO
Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol, 30: 706-
720, 2019.
31. Wang AY, Weiner H, Green M, Chang H, Fulton N, Larson RA, Odenike O, Artz AS, Bishop
MR, Godley LA, Thirman MJ, Kosuri S, Churpek JE, Curran E, Pettit K, Stock W, Liu H: A
phase I study of selinexor in combination with high-dose cytarabine and mitoxantrone for
remission induction in patients with acute myeloid leukemia. J Hematol Oncol, 11: 4,
2018.
32. Trott JF, Kim J, Abu Aboud O, Wettersten H, Stewart B, Berryhill G, Uzal F, Hovey RC,
Chen CH, Anderson K, Graef A, Sarver AL, Modiano JF, Weiss RH: Inhibiting tryptophan
metabolism enhances interferon therapy in kidney cancer. Oncotarget, 7: 66540-66557,
2016.
33. Trott JF, Hwang VJ, Ishimaru T, Chmiel KJ, Zhou JX, Shim K, Stewart BJ, Mahjoub MR, Jen
KY, Barupal DK, Li X, Weiss RH: Arginine reprogramming in ADPKD results in arginine-
dependent cystogenesis. Am J Physiol Renal Physiol, 315: F1855-F1868, 2018.
34. Inoue H, Hwang SH, Wecksler AT, Hammock BD, Weiss RH: Sorafenib attenuates p21 in
kidney cancer cells and augments cell death in combination with DNA-damaging
chemotherapy. Cancer Biol Ther, 12: 827-836, 2011.
35. Hwang VJ, Zhou X, Chen X, Trott J, Abu Aboud O, Shim K, Dionne LK, Chmiel KJ,
Senapedis W, Baloglu E, Mahjoub MR, Li X, Weiss RH: Anticystogenic activity of a small
molecule PAK4 inhibitor may be a novel treatment for autosomal dominant polycystic
kidney disease. Kidney Int, 92: 922-933, 2017.
36. Li LC, Dahiya R: MethPrimer: designing primers for methylation PCRs. Bioinformatics, 18:
1427-1431, 2002.
25
37. Chatterjee S, Daenthanasanmak A, Chakraborty P, Wyatt MW, Dhar P, Selvam SP, Fu J,
Zhang J, Nguyen H, Kang I, Toth K, Al-Homrani M, Husain M, Beeson G, Ball L, Helke K,
Husain S, Garrett-Mayer E, Hardiman G, Mehrotra M, Nishimura MI, Beeson CC, Bupp
MG, Wu J, Ogretmen B, Paulos CM, Rathmell J, Yu XZ, Mehrotra S: CD38-NAD(+)Axis
Regulates Immunotherapeutic Anti-Tumor T Cell Response. Cell Metab, 27: 85-100
e108, 2018.
38. Jayaram HN, Kusumanchi P, Yalowitz JA: NMNAT expression and its relation to NAD
metabolism. Curr Med Chem, 18: 1962-1972, 2011.
39. Preiss J, Handler P: Biosynthesis of diphosphopyridine nucleotide. II. Enzymatic aspects. J
Biol Chem, 233: 493-500, 1958.
40. Preiss J, Handler P: Biosynthesis of diphosphopyridine nucleotide. I. Identification of
intermediates. J Biol Chem, 233: 488-492, 1958.
41. Tateishi K, Wakimoto H, Iafrate AJ, Tanaka S, Loebel F, Lelic N, Wiederschain D, Bedel O,
Deng G, Zhang B, He T, Shi X, Gerszten RE, Zhang Y, Yeh JJ, Curry WT, Zhao D,
Sundaram S, Nigim F, Koerner MVA, Ho Q, Fisher DE, Roider EM, Kemeny LV, Samuels
Y, Flaherty KT, Batchelor TT, Chi AS, Cahill DP: Extreme Vulnerability of IDH1 Mutant
Cancers to NAD+ Depletion. Cancer Cell, 28: 773-784, 2015.
42. Hagerling C, Casbon AJ, Werb Z: Balancing the innate immune system in tumor
development. Trends Cell Biol, 25: 214-220, 2015.
26
Table 1. PCR primers used for quantitative PCR.
Accession Number Gene Forward and Reverse Primers (5’-3’) Tm2
(oC) E3 (%)
(HUMAN) NAMPT4
GCAGAAGCCGAGTTCAACATC TGCTTGTGTTGGGTGGATATTG 64 98
NM_145201.5 (HUMAN) NAPRT1
TCCCTGGGTGGCGTCTATAA ATGAGTGGAGACCCGTCAGA 64 96
(MOUSE) Nampt5
TCGGTTCTGGTGGCGCTTTGCTAC AAGTTCCCCGCTGGTGTCCTATGT 66 81
NM_172607.3 (MOUSE) Naprt1
AGAAGGGCAGTGAGGTGAATG TCCAGTAGCAAAGACCCATCG 60 86
Rpl13a6 GACCTCCTCCTTTCCCAGGCG GCCTCGGCCATCCAATACCAGAA 66 92
Eef26 TCTGAGAATCCGTCGCCATCCG TCAGAGAGCTCGTAGAAGAGGGA 66 80
RNA18S5&Rn18S7
ACGGCTACCACATCCAAGGA CCAATTACAGGGCCTCGAAA 60 70
PPIA8 ACCGCCGAGGAAAACCGTGTA TGCTGTCTTTGGGACCTTGTCTGC 64 82
RPS138 TCGGCTTTACCCTATCGACGCAG ACGTACTTGTGCAACACCATGTGA 64 83
1PCR products confirmed by sequencing
2Annealing temperature
3Efficiency of amplification
4Schuster, S., Penke, M., Gorski, T., Petzold-Quinque, S., Damm, G., Gebhardt, R., Kiess, W.,
and Garten, A. (2014) Resveratrol differentially regulates NAMPT and SIRT1 in
Hepatocarcinoma cells and primary human hepatocytes. PLoS One 9, e91045.
5Wang, L. F., Wang, X. N., Huang, C. C., Hu, L., Xiao, Y. F., Guan, X. H., Qian, Y. S., Deng, K.
Y., and Xin, H. B. (2017) Inhibition of NAMPT aggravates high fat diet-induced hepatic
steatosis in mice through regulating Sirt1/AMPKalpha/SREBP1 signaling pathway. Lipids
Health Dis. 16, 82.
6Trott, J. F., Hwang, V. J., Ishimaru, T., Chmiel, K., Zhou, X., Shim, K., Stewart, B., Mahjoub, M.
R., Jen, K. Y., Barupal, D., et al. (2018) Arginine reprogramming in ADPKD results in
arginine-dependent cystogenesis. Am. J. Physiol. Renal Physiol. 315, F1855-F1868.
27
7Rowson-Hodel, A. R., Manjarin, R., Trott, J. F., Cardiff, R. D., Borowsky, A. D., and Hovey, R.
C. (2015) Neoplastic transformation of porcine mammary epithelial cells in vitro and
tumor formation in vivo. BMC Cancer 15, 562.
8Dupasquier, S., Delmarcelle, A. S., Marbaix, E., Cosyns, J. P., Courtoy, P. J., and Pierreux, C.
E. (2014) Validation of housekeeping gene and impact on normalized gene expression in
clear cell renal cell carcinoma: critical reassessment of YBX3/ZONAB/CSDA expression.
BMC Mol. Biol. 15, 9
28
Table 2. Methylation specific primers for (HUMAN)NAPRT and (MOUSE)Naprt used on bisulfite
converted gDNA.
Accession Number Gene M or U1 Forward and Reverse Primers (5’-3’) Tm2
(oC)
NM_145201.5 (HUMAN) NAPRT3 M ACCTCTACCAAACCACCATAACG
GAATTCGGCGGCGTTTC 65
(HUMAN) ACTB4 M GGGTGGTGATGGAGGAGGTT
TAACCACCACCCAACACACAAT 66
NM_172607.3 (MOUSE) Naprt5 U AGTTGGGAGTTTGTGTATTTTGTGG
CACCATAATAACCTAATAAAAATCAAT 59
NM_172607.3 (MOUSE) Naprt5 M TAGTCGGGAGTTTGTGTATTTCGC
ACGCCATAATAACCTAATAAAAATCGAT 64
1M=methylated sequence, U=unmethylated sequence
2Annealing temperature
3Primers amplify a region 56-123bp downstream of the translation start site in exon 1
4Liloglou, T. and Nikolaidis, G. (2013) Quantitative Methylation Specific PCR (qMSP). Bio-
protocol 3: e871.
5Primers amplify a region 26-27 bp upstream to 78-79 bp of the translation start site in exon 1
30
Figure 1. (HUMAN)NAPRT is downregulated at the level of transcription, which in some RCC
tumors is associated with high levels of promoter methylation.
RNA was extracted from normal kidneys and RCC tumors of grades 1-4.
A) Extracted RNA was reverse-transcribed and subjected to qPCR for (HUMAN)NAMPT
mRNA (corrected for PPIA, RPS13 and RNA18S5 mRNA levels). Data are means ± SD (n=3-9).
B) Extracted RNA was reverse transcribed and subjected to qPCR for (HUMAN)NAPRT
mRNA as in A). The red line is located below the lowest NAPRT mRNA value for normal
kidneys. Data are means ± SD (n=3-9).
C) The relative % of methylation of the (HUMAN)NAPRT promoter. Bisulfite-converted
untreated gDNA and bisulfite-converted 100% methylated gDNA from human kidneys (NHK;
n=3), RCC tumors (n=8) and RCC cell lines (ACHN, Caki-1, 786-O) was analyzed by qMSP
using primers specific for methylated (M) NAPRT sequences 56-123 bp downstream of the
NAPRT translation start site, and normalized against ACTB. Samples were divided into low
(blue bars) and high NAPRT expression (red bars) based on the data in B) and from Abu Aboud
et al. (3).
31
Figure 2
Figure 2. RENCA tumors express both PD-L1 and PD-L2 and are highly proliferative. Subcutanous RENCA tumors from
untreated Balb/cJ mice were fixed, paraffin-embedded, sectioned and stained with hematoxylin and eosin or subjected to
immunohistochemistry for Ki67, PD-L1 and PD-L2 using DAB as the chromagen and a hematoxylin counterstain.
32
Figure 3
Figure 3. (MOUSE)NAPRT is downregulated at the level of transcription in RENCA tumors
where the Naprt promoter is methylated.
Protein and RNA were extracted from kidneys and subcutanous RENCA tumors from
untreated Balb/cJ mice.
A) Proteins were immunoblotted for NAMPT, NAPRT and β-actin. Immunoblots are
representative of at least two repeats.
B) RNA was extracted, reverse transcribed and subjected to qPCR for Nampt or Naprt
33
mRNA (corrected for Eef2, Rpl13a and Rn18S mRNA levels). a,b,cindicate a significant difference
(p<0.05). Data are means ± SEM (n=3 kidneys; n=4 tumors).
C) Bisulfite-converted gDNA from Balb/cJ mouse kidneys or RENCA tumors was
amplified by PCR using primers specific for either unmethylated (U) or methylated (M)
sequences to amplify sequences between 26-27 bp upstream and 78-79 bp downstream of the
Naprt translation start site. Data are representative of two independent PCR reactions. Neg =
mouse gDNA.
35
Figure 4. The combination of KPT-9274 and anti-PD1 had a significant inhibitory effect on tumor
growth.
A) Subcutaneous measurements of RENCA tumor growth in 10 week old male Balb/cJ
mice over the 21 days of treatment. RENCA-luc cells (250,000) were injected subcutaneously in
30% matrigel and treatments started 10 days after injection. Data are mean ± SEM (n=8-
10/treatment). a,bindicate significant differences within one day’s measurements (p<0.05).
*p<0.05, **p<0.005 for main effect of KPT-9274. PD1 = anti-mouse PD1 antibody. Control =
isotype control.
B) The anti-tumor treatments did not affect mouse health as determined by body weights.
Male Balb/cJ mice bearing RENCA tumors were 10 weeks old when treatments were started.
Mice were weighed at the start of the treatment period and once a week thereafter. Data are
means ± SEM (n=9-10/treatment). *p<0.05 compared to control at that time point.
C) Volume of RENCA tumors measured ex vivo at sacrifice following 21 days of
treatment with either KPT-9274, anti-PD1 antibody (PD1) or a combination of both. a,bindicate a
significant difference (p<0.05). Data are mean ± SD (n=8-10/treatment).
37
Figure 5. Bimodal tumor cell T cell infiltration response in mice treated with combination of KPT-
9274 and anti-PD1.
A) CD3+, CD4+, CD8+ and T-reg T cell infiltration into syngeneic RENCA tumors. Data
are individual tumor data points with mean ± SD. Statistically determined outliers for CD8+ cells
in the KPT-9274 treated mice (3.8%, 8.1%) and in the anti-PD1 treated mice (31.2%) were
omitted to enable clarity of presentation.
B) Representative 2D contour plots (with outliers) for CD4+ and CD8+ T cells in one
tumor from each treatment group.
39
Figure 6. KPT-9274 decreased phosphorylation of β-catenin and total PAK4 expression.
Protein was extracted from RENCA tumors in mice treated with PD1 antibody (Anti-PD1),
KPT-9274 or a combination of both, and was immunoblotted for phospho (P)-β-catenin, Pak4
and β-actin. ImageJ quantification of P-β-catenin and PAK4 expression, each corrected for β-
actin, are underneath a representative immunoblot from one tumor/mouse. a,bIndicate a
significant difference (p<0.05). Data are means ± SEM (n=6).
40
Figure 7
Figure 7. KPT-9274 reduces and anti-PD1 increases NAD+NADH concentrations in tumors.
RENCA tumors from Balb/cJ mice were harvested 12-18 h after the last dose of either
KPT-9274 or vehicle and subjected to assays of total NAD+NADH as described in Materials and
Methods. Mice treated with KPT-9274 had lower total NAD+NADH in RENCA tumors than mice
treated with anti-PD1. Data are means ± SD (n=7). a,bindicate a significant difference (p<0.05).