Annual Report of IVRI 2011-12.
Transcript of Annual Report of IVRI 2011-12.
1
EDITORIAL BOARD
Dr. J.M. Kataria, Joint Director (Research) Chairman
Dr. D.N. Kamra, Head, Animal Nutrition Division Member
Dr. S.K. Agarwal, Head, AR Division Member
Dr. R.K. Agarwal, Head, B&M Division Member
Dr. P.S. Banerjee, Head, Parasitology Division Member
Dr. K.N. Bhilegaonkar, Principal Scientist, VPH Division Member
Dr. Rupasi Tewari, Senior Scientist & In-charge, ATIC Member
Dr. C. Madhan Mohan, Scientist (Sr. Scale), Vety. Biotechnology Member
Dr. M. Sankar, Scientist, TAH Division Member
Shri Kundan Singh, In-Charge, Communication Centre Member
Dr. H.P. Aithal, Senior Scientist, Surgery Division Member Secretary
Assistance:
Ashutosh Soni, T-7/8, Joint Directorate of Research
S.S. Bisht, T-5, Communication Centre
Published by : Prof. (Dr). M.C. Sharma, Director & Vice-Chancellor, Indian Veterinary Research Institute,
Izatnagar - 243 122 (U.P.), India, FAX: 0091-581 2303284, Gram: VETEX, website:
www.ivri.nic.in
Printed by : M/s Anoopam Press, Bareilly
2
Chapter Page No.
1. Executive Summary 1
2. Introduction 6
3. Research Achievements 15
4. Technologies Assessed and Transferred 99
5. Education and Training 102
6. Awards and Recognition 107
7. Linkage and Collaboration in India and Abroad including Funded Projects 110
8. List of Publications 118
9. List of Research Projects 136
10. Consultancy, Patents, Commercialization of Technologies 146
11. Meetings of Management Committee, Academic Council, RAC, IRC, etc. with significant decisions 149
12. Participation of Scientists in Conferences, Workshops, Symposia and Trainings in India and Abroad 154
13. Workshops, Seminars, Summer Institutes, Short Courses and Trainings convened at the Institute 158
14. Distinguished Visitors 160
15. IVRI Personnel 161
16. Any Other Relevant Information such as Infrastructure Development 170
17. Empowerment of Women and Mainstreaming the Gender issues 178
CONTENTS
1
A. ANIMAL HEALTH
* Live attenuated sheep pox vaccine was found
to be protective against challenge with virulent
virus even after 2 years of vaccination in
sheep.
* Thermo-stability studies of live attenuated orf
vaccine revealed it to be intrinsically stable
for 12 and 5 days when exposed at 37ºC and
42ºC, respectively.
* Developed aroA deletion mutant of P.
multocida.
* Four novel chicken miRNAs were identified
from the high throughput sequencing data of
MicroRNAs differentially expressed in chicken
lungs during H5N1 infection target immune
response genes.
* The siRNA cocktail was found to be a better
BVDV-inhibitor than the earlier reported
individual siRNAs.
* A small interfering RNA (siRNA) targeting
rabies virus (RABV) nucleoprotein (N) gene
delivered using replication-defective
adenoviruses and lentiviruses was found to be
effective in inhibiting RABV multiplication in
vitro in BHK-21 cells and in vivo in mice.
* Monoclonal antibodies were developed and
characterized against matrix and nucleoprotein
antigen of AIV.
* Molecular Beacon based real-time PCR assay
for detection of crimean-congo hemorrhagic
fever virus was developed.
* A micro plaque reduction neutralization test
was optimized for detection of West Nile fever
virus neutralizing antibodies in wild birds.
* A loop-mediated isothermal amplification
(LAMP) test for detection of IBR virus in bovine
semen was developed. The test could detect
as little as 0.2 TCID50 or 0.4 infective virus
particles per reaction.
* A highly sensitive multiplex real-time PCR
assay based on SYBR Green I dye was
developed for detection of IBR virus in bovine
semen. The assay could detect as low as
0.002 TCID50 of infective virus particle per
reaction.
* LAMP assay based on conserved region of 'N'
gene of PPR virus was standardized for rapid
and specific detection of PPR virus from
clinical samples.
* A TaqMan hydrolysis probe based real time
PCR assay targeting the ankyrin repeat protein
(C18L) gene sequences was developed for the
detection and quantitation of camelpox virus.
* A sandwich ELISA (s-ELISA) was developed
for detection of BTV antigen in blood, tissue
materials and culture fluid.
* Recombinant nucleoprotein based single serum
dilution ELISA kit for serological profiling of
Newcastle disease virus has been developed.
The kit has a shelf life of 6 months when stored
at 40C. The kit has been validated and is ready
for commercialization.
* Recombinant VP2 sub-viral particles as a
subunit vaccine candidate against Infectious
bursal disease virus (IBD) has been developed.
* Real Time RT-PCR was able to detect IBV
nucleic acids in tracheal and lung tissues from
24 h post infection.
* Standardized a loop mediated isothermal
amplification test for specific detection of
Salmonella enterica subsp. enterica serovar
Typhimurium. LAMP test was found to be
specific and successfully detected S.
Typhimurium in spiked meat samples.
* Multiplex PCR based on SCAR markers and
ITS-1 based nested PCR for species level
identification of Eimeria oocysts of poultry has
been standardized.
* Standardized PCRs for detection of extraneous
agents like BVDV-I, BVDV-II, PCV-1, PCV-2,
and parvovirus in vaccine and cell culture.
Three duplex PCRs, namely. pestivirus and
Mycoplasma; Mycoplasma and parvovirus, and
Mycoplasma and porcine circovirus-2 (PCV-
1)) were also standardized.
* A lateral flow strip based assay was developed
for detection of ciprofloxacin, the assay was
able to detect ciprofloxacin in spiked samples.
* Multi locus sequence typing of Indian isolates
of Pasteurella multocida (Type B) of buffalo
origin revealed that all isolates belonged to
Type ST-122.
* Cloning and sequencing of 5UTR, E2, NS5B
and 3UTR genes of CSFV isolates revealed
close homology between recent Indian isolates
of genotype 2.2 with Chinese and Taiwanese.
New diagnostics i.e. real-time RT-PCR and
fluorescent in situ hybridization were developed
for detection of (SFV).
* HPAIV-H5N1 was recorded in crows
(Jharkhand, Maharashtra, Odisha, Bihar, Uttar
Pradesh and Tripura) in addition to chicken and
ducks. A total of 86 H5N1 viruses from nine
States, six H9N2 from three States and one
each of H11N6 and H4N6 viruses were
isolated.
1. EXECUTIVE SUMMARY
2
* Acute BVDV-1 infection in lambs was found
to change CD4+ and CD8+ T-cell subset
counts, up-regulation of pro-inflammatory (IL-
1 and TNF-α) and regulatory (IL-10 and TGF-β) cytokines in lymphoid organs.
* Malignant catarrhal fever was diagnosed in a
wild bison from zoo at Bangaluru and cattle
from State Veterinary Hospital at Bengaluru.
* Crimean-Congo hemorrhagic fever virus was
detected in ticks collected from a cattle calf
from Vadnagar Taluq, Mehsana District of
Gujarat.
* The phylogenetic analysis of HA genes
indicated that the 2011-2012 H5N1 viruses
belonged to clade 2.3.2.1 and the 2008 viruses
belonged to clade 2.2.
* The PB1 gene of some of the clade 2.3.2
viruses isolated from chickens in Meghalaya
grouped with the unknown lineage of H9N2
viruses isolated from Tripura in 2008 and
Haryana in 2005 indicating reassortment
between the two subtypes of avian influenza
viruses.
* Phylogenetic analysis of 'S' segment sequence
of CCHFV revealed that the Indian isolate is
closest to Tajakistan virus (AY049083/TAJ/
HU8966) falling in Asia 2 group of the CCHFV.
* Genotyping of rotaviral isolates revealed that
G1 and G2 were most predominant G types
and P[6], P[4] and P[8] were most predominant
P types in human. In bovines, G6 was the
most prevalent G type and P[11] was the most
common P type.
* In vivo use of 2- nitropropanol (2-NPOH) in its
MIC dosage in chick exhibits its growth
inhibitory effect on shigatoxic E. coli and S.
Gallinarum.
* National (Indian) Reference Preparations of
Clostridium perfringens ε toxin and anti ε toxin,experimental preparations were produced and
standardized.
* Presence of Picobirnavirus was confirmed in
several diarrhoeal samples from calves from
cattle and buffaloes.
* The test extract Sd 2 has showed pronounced
hypoglycaemic, insulin releaseing and hypo
cholesterolaemic effect in clinical diabetic
dogs.
* Plant materials HNAP-11 in combination with
animal origin material HNAB-2 revealed potent
hepatoprotective property in clinical cases of
HBD in dogs as compared to conventional
standard hepatoprotectant (silymarin).
* Entada pursaetha extract (EPE) had effectively
reduced pro-inflammatory cytokines TNFα andIL1b production from RAW 264.7 cell line after
LPS stimulation and also reduced NO
production by these cells.
* The herbal formulations (EO-S1 and EO-S2)
showed marked efficacy against clinical
infection of Haemonchus contortus in sheep.
Formulation EO-F1 exhibited highly significant
efficacy against Fasciola gigantica in
experimentally infected sheep.
* Two herbal acaricides were developed, which
imparted up to 70% protection to cattle against
natural tick infestation in clinical trials in farms.
The active compounds of the acaricides were
identified as Rutin and Precocene I.
* Point mutation of cytocine ( C ) to adenine (A)
nucleotide substitution (CTC to ATC) at
position 190 in domain II S4-5 linker region of
Na channel gene was identified in acaricide
resistant field isolate of cattle tick,
Rhipicephalus (Boophilus) microplus.
* Resistance status of R.(B.) microplus to
synthetic pyrethroids (SP) was 66.6%. Level
II and Level III resistance was recorded in the
ticks collected from northern sub-temperate
trans-gangetic plains and from tropical middle-
gangetic plains, respectively.
* Beta-tubulin isotype-1 gene of Bunostomum
trigonocephalum and Mecistocirrus digitatus
cloned, sequenced and characterized. The
point mutation at 200th position, where phenyl
alanine converted into tyrosine was predicted
as main reason for benzimidazole resistance.
* Standardized allele specific PCR for
benzimidazole resistance diagnosis in
Bunostomum trigonocephalum and
Mecistocirrus digitatus. Further, allele specific
PCR for diagnosis of benzimidazole resistance
was applied in field samples and 13.1% of
Haemonchus contortus showed resistance.
* Interlocking nail systems for long bones-tibia
and femur/humerus were developed and
evaluated for internal fixation of fractures in
large ruminants.
* Standardized technique of intravenous infusion
of dexmedetomidine/ midazolam, pentazocine/
butorphanol, thiopental/propofol with isoflurane
for maintenance of general anaesthesia in
buffaloes.
* Venereal tumour in street dogs was
successfully shown to be regressed with use
of recombinant VP3 gene construct of chicken
infectious anaemia virus.
* Four unique horn cancer specific ligand
sequences were identified using Phage display
methods for developing horn cancer specific
peptide nano-delivery vehicle.
* Six brain cell homing peptides having more
than 80% homing ability were identified using
phage display technique.
3
* A total of 1,59,000 doses of RD 'F' strain
vaccine; 3,200 doses of R2B vaccine; 4,200
doses of fowl pox vaccine; 3,52,565 doses of
lapinized swine fever vaccine; 9,66,000 doses
of tissue culture sheep pox vaccine; 79,86,100
doses of PPR vaccine; 59,983 doses of
Brucella abortus strain-19 (live) vaccine; 1,000
doses of enterotoxaemia vaccine; 6,000 ml HS
adjuvant vaccine; 79,290 doses of tuberculin
PPD; 27,500 doses of Johnin PPD; 44,120
doses of mallein PPD; 98,000 ml of Brucella
agglutination test antigen; 67,240 ml of Brucella
abortus Bang ring antigen; 27,500 ml of rose
Bengal plate test antigen; 86 ml of Brucella
abortus positive serum; 4,560 ml of S. Pullorum
coloured antigen; 3,000 ml of S. Pullorum plain
antigen; 7 ml S. Pullorum positive serum and
2,000 ml of S. Abortus equi 'H' antigen were
produced, quality tested and supplied to
various organizations viz., Defense
Establishments, ICAR Institutes, Medical
Institutes, Diagnostic Laboratories, State
Governments and farmers.
* A total of 6.87 million monovalent doses of
FMD vaccine comprising of 1.44 million doses
of type O, 3.43 million doses of type A and 2.0
million doses of type Asia-1 were produced.
* PPR c-ELISA (43) and PPR s-ELISA (4) kits
were produced and supplied.
B. LIVESTOCK IMPROVEMENT
* In-house poly-herbal formulation and
supplementation of methionine was found to
ameliorate arsenic induced hematopoetic,
hepatotoxic and oxidative injuries in poultry
model and was also found to reduce arsenic
deposition in vital organs like liver and kidney.
* Aegle marmelos and Murraya koenigii leaves
and area specific mineral mixture demonstrated
potential effect on induction of estrus and
cyclicity in delayed pubertal heifers. Herbal
plants have beneficial effect on follicular
development & CL formation.
* Supplementation of Zn, Se and Vit E
significantly (P<0.05) reduced the Cd
concentration in the vital organs.
* Supplementation of Cu and Zn through
inorganic (sulphate) or organic (methionine)
sources showed significant (P<0.05)
improvement in cell mediated and humoral
immune response.
* Supplementation of 10% DMSC in the
concentrate mixture of crossbred calves and
lambs was effective for reducing the severity
of trickle infection of F. gigantica.
* Detoxified cake, after removal of karanjin,
pongamol and trypsin inhibitors, can safely
replace soyabean meal protein moiety up to
50% without any adverse effect on DM intake,
nutrient utilization, growth rate, FCR, metabolic
profile, immune response, carcass
characteristics and meat quality in kids.
* Inclusion of DMSC and guar meal @ 5% in
CCFB showed improvement in performance of
crossbred calves vis-a-vis reduced (L/kg DMI)
methane production (13.75 to 17.57%).
* Condensed tannins (CT) based TM rations
(1.5%) significantly improved the intake,
nutrient metabolism and growth performance
of growing lambs with reduction in GI parasites.
* Methanobrevibacter spp. was the most
abundant methanogen In buffaloes.
* An investigation on physical treatments, i.e.
chopping and sun drying revealed that although
both were effective in reducing hydrolysable
tannins, were not effective in reducing
condensed tannin contents, of F. roxburghii
leaves.
* For bio-prospecting sea buckthorn leaves, the
methanol, water and 50% methanol extracts
were analyzed for antioxidant activity using
DPPH, FRAP and ABTS assays, which
revealed high level of antioxidant activity.
* The micro mineral profile of most of the forage
grasses and of anestrous heifers at temperate
hills showed deficiency in Cu, Zn and I.
* Caprine mesenchymal stem cells after tagging
with tracking dye, were transplanted in
myocardial infarction in rabbit, it was observed
that these cells stayed in the rabbit heart and
helped in regeneration.
* Transgenic mesenchymal stem cells
expressing green fluorescence protein were
generated, which could be further propagated
through passaging.
* Higher expression of heat shock protein genes
in caprine PBMCs during thermal stress
suggest it's possible involvement to ameliorate
deleterious effect of thermal stress so as to
maintain cellular integrity and homeostasis in
goats.
C. ANIMAL GENETIC RESOURCES
* PCR SSCP and logistic regression analysis
of lactoferrin and DRB3.2 genes revealed
genotypes having highly significant correlation
with mastitis incidence in cattle.
* The CREB binding site at the 5' region of TLR4
gene was characterized by using Chromatin
Immunoprecipitation (ChIP) assay.
* Foetal myoblast cell line was established.
Three siRNA construct successfully down-
regulated MSTN among which siRNA-3
resulted in maximum knockdown. Three
shRNA were individually transduced using
lentiviral particles and stably transfected
myoblast cells successfully established.
4
* Based on 16 SSCP patterns of four polymorphic
regions of CatSper gene, three haplotypes were
identified and haplotye II and III showed
significance with three motility parameters viz.,
high mass motility, high initial progressive
motility and high post thaw motility in
crossbred cattles.
* Genotyping of FecG locus in five sheep breeds
i.e. Garole, Kuzi, Shahabadi, Balangir and
Bonpala showed presence of only one
genotype i.e. FecGHH, suggesting fixing of
FecG gene in these breeds.
* About 20% indigenous cattle population of
Ramganga Katri were found to suffer by
polydactyl genetic defects in surveyed 21
village of Bareilly district located on the bank
of Ramganga river.
* A new garbage processing indigenous
earthworm strain Perionyx ceylenesis
designated as "Jai Gopal" was developed
having high fecundity, heat tolerance and
inhabiting ability on animal and farm waste.
* Vermibiomanure sieving machine was
designed and fabricated.
D. LIVESTOCK PRODUCTS TECHNOLOGY
* Incorporation of 1% tamarind seed powder or
flaxseed flour was found effective for binding
of dietary fibre rich extended restructured
mutton chops as well as overall improvement
in sensory acceptability.
* Processing conditions and formulations were
standardized for preparation of shelf stable
products from meat of spent animals, namely
microwable meat chips, meat papad, ready to
reconstitute meat cubes and ready to cook
meat rings.
* Fortification of restructured buffalo meat steaks
with 0.5% mousambi peel powder imbibed
functional value and enhanced the shelf life
with reduction in the production cost of the
product.
E. EXTENSION ACTIVITIES
* Annual Kisan Mela Avam Pashu Vigyan
Pradarshini-2011 was organized during 18-20th
October, 2011 at Institute and approximately
13046 farmers, students NGO's personnel's,
government personnel's, industrialists visited
this Kisan Mela.
* All India Dog show was organized on 10th
January, 2012, wherein 108 dogs of 23 breeds
participated in dog show.
* A total of 105 exhibitions were put up at
different places in country viz., CSWRI
Avikanagar, GBPUA&T Pantnagar, NDRI
Karnal, Dehradun, CIRB Hisar, IARI, Pusa,
Gorakhpur, Allahabad and in Bareilly,
Moradabad and Badaun district of Uttar
Pradesh.
* Forty five animal health camps were organized,
wherein a total of 1,435 animals were treated.
* Fifty one kisan gosthies, 86 demonstrations
of technologies (viz., olinall, crystoscope and
area specific mineral mixture, fractured bone
fixator, UMMB, complete feed block, herbal
ointment, herbal anti-diarrhoea, herbal
acaricide, herbal medicament, vermiculture/
vermi-compost) were organized at different
place such as Anand district in Gujarat,
Dehradun and Haridwar districts of Uttrakhand,
Bareilly, Badaun, Moradabad, Gorakhpur and
Allahabad districts of Uttar Pradesh.
* A total of 14 training programmes were
organized on different subjects for 35 field
veterinarians, 18 pharmacists, and 202
progressive farmers.
* A total of 20,263 visitors' viz., livestock
owners/ farmers, students, and entrepreneurs,
distinguished visitors visited the Institute during
the year.
* A total of 463 questions related to various
aspect of livestock production, health and
management were replied through Kisan Call
Centre and further, a total of 489 calls were
attended at the Institute Help Line.
* Two issues of half yearly magazine entitled
"Pashu Chiktsa Vigyan" were published from
ATIC for dissemination of scientific information
to livestock owners, farmers and rural youth.
* Four interfaces meet with AI inseminators,
veterinary officers of Uttar Pradesh and
Uttarakhand States were conducted
* An interaction meet with the ATIC kisan club
members was organized, wherein a total of 41
ATIC Kisan Club members and the officials
from banking and insurance sectors
participated.
* Media Meet and showcasing of technologies
was organized at IVRI Izatnagar, wherein a total
of 50 media personnel of print and electronic
media and 50 progressive farmers of Bareilly
district participated.
* A total of 312 visits of ATIC mobile van in 95
different villages, were undertaken for
popularization of IVRI technologies.
* IVRI, ERS, Kolkata organized five (5) animal
health camps, two (2) training programmes for
tribal farmers and two (2) short term training
programmes for veterinary officers from various
states. Further, one farmers' interface meeting
was conducted at Domkal village of Sunderbans
area in collaboration with KVK, Sri Ramkrishna
Ashram, Nimpith, South 24 Parganas, West
Bengal.
5
* A total of 144 skill oriented trainings benefiting
2999 participants were organized on-campus,
off-campus, in-service and sponsored for
farmers, rural youths, rural women and
extension functionaries for disseminating the
latest and advance technical know how in their
area of work.
* Five hundred and seventy rural women have
been empowered technically in home science,
animal husbandry and crop science areas.
* A total of 58 demonstrations were conducted
under FLD on oilseed and pulses; 145
demonstrations were organized on Paddy SRI,
Napier grass, Berseem + Oat, nutritional kitchen
garden, wheat, chilly, fodder sorghum,
vegetables, bio control of fruit fly, floriculture
etc and 16 demonstrations units were
established on backyard poultry and 4 on
goatry in different villages.
* Seventeen animal health camps were
organized/ participated wherein 2110 animals
were treated, 38 Kisan goshties were organized
covering 18 different villages by KVK and
participated in 04 exhibitions/mela at national
level by putting institute stall to display the
technologies.
* KVK published 21 folders, 4 leaflets and one
CD on scientific paddy cultivation for farmers
and extension personnel's.
* One day kisan mela was organized in village
Pitamberpur wherein farmer goshti, technology
exhibition, animal health camp, animal
competitions were organized. About 265
farmers/ women were benefited.
* Three exposure visits to CIRG, Makhdoom,
GBPUA&T, Pantnagar and IVRI, Izatnagar were
organized for 60 rural women to make them
aware about the improved technologies of
livestock farming.
* Six OFT were conducted on mineral deficiency
in goats reared under semi intensive system,
problem of high mortality and low productivity
in backyard poultry, problem of bacterial blight
in Pusa basmati-1 variety of rice, low
productivity of late sown wheat crops, problem
of wilt disease in green chilies, problem of
nutritional insecurity among rural families.
* A total of 45 film shows were organized during
various training programs and about 1037
farmers, students, dignitaries', extension
personnel and visitors visited the KVK, KVK
farms etc.
* One women health camp was organized in
village Ganghora Ghangori, wherein more than
three hundred women/rural girls were checked
by the doctors of IVRI human hospital and free
medicines were distributed.
* Under distance education program, 29 radio
talks and 25 TV talks have been delivered
through AIR, Rampur and AIR, Bareilly and
Doordarshan Bareilly.
F. EDUCATION
* On the basis of All India Entrance
Examination, 240 students (136 MVSc and 104
PhD) were admitted to post-graduate
programmes during the academic year.
* A total of 6 veterinary officers from various
states were enrolled to national diploma
courses in one discipline.
* An International Training Course on 'Gene
based techniques for research in
biotechnology' sponsored by TCS Columbo
Plan, India Millennium Fund was conducted
from February 20 to March 11, 2012. Ten
participants from Asia Pacific region were
trained.
* Fifteen highly specialized short-term training
courses were conducted in different disciplines
to provide the recent advances and hands-on
training to students and in-service candidates.
G. PUBLICATIONS & PRESENTATIONS
* A total of 405 research papers were published
in Indian (213) and foreign (192) journals of
repute.
* The other major publications of the institute
include Books (24), Book Chapters (199),
Annual Reports (1), Popular/Technical Articles
(309), Bulletins (54), Research Abstracts (520),
GenBank submissions (169), Training Manual/
Compendia (30), Monographs (9), News Letter
(2), and extension bulletins (37).
* The scientific and mass media presentations
made during the year include Radio/TV Talks
(28), Press Releases/Newspaper
Presentations (120).
H. OTHER ACHIEVEMENTS
* The Institute generated Rs.8.95 crores from
sale of various livestock products, biologicals,
technologies, animal health diagnostic services
and other sources.
* Many ICAR National Awards and an
International recognition conferred on IVRI
including Rajrshi Tandon Rajbhasha Puraskar-
2010; Ganesh Shankar Vidyarthi Puraskar-
2010; Best KVK Award of Zone-IV for the year
2005-10; Best National Agribusiness Incubator
Award-2011; Best National Agribusiness
Incubatee Award-2011 and OIE certification for
notable contribution in achieving 'Zero
Rinderpest status' for India.
* The Institute has filed 12 new patents 3
copyright applications and 4 design registration
and 4 technologies were commercialized during
the year.
6
2. INTRODUCTION
BRIEF HISTORY
The Indian Veterinary Research Institute,
Izatnagar is one of the premier national institutions
in veterinary and animal sciences in the world.
Founded in 1889, the Institute is the oldest among
the institutions governed by Indian Council of
Agricultural Research. The major historical landmarks
in the genesis, growth and development of this
national Institute are detailed below:
1889 Foundation of Imperial Bacteriological
Laboratory (IBL) at Pune, Maharashtra
1890 Appointment of Dr. Alfred Lingard, a noted
medical scientist as the founder Director
1893 Shifting of the IBL to Mukteswar, Kumaon
Hills of Uttar Pradesh (now in Uttarakhand)
1897 Historical visit of renowned bacteriologists,
Dr. Robert Koch, Dr. R. Pfeiffer and Dr. G.
Gaffky
1899 Production of first batch of anti-rinderpest
serum
1913 Birth of Izatnagar campus
1925 Renaming as Imperial Institute of Veterinary
Research
1930 Renaming as Imperial Veterinary Serum
Institute
1936 Renaming as Imperial Veterinary Research
Institute (IVRI)
1940 Development of vaccine against Ranikhet
disease of poultry
1947 Shifting of headquarters of the Institute from
Mukteswar to Izatnagar and renaming as
Indian Veterinary Research Institute (IVRI)
under Govt. of India
1958 Establishment of a Postgraduate College of
Animal Sciences at Mukteswar, affiliated to
Agra University
1966 Transfer of administrative control to Indian
Council of Agricultural Research and
recognition as a National Institute
1967 Establishment of Regional Station at
Palampur (Himachal Pradesh)
1970 Establishment of a Regional Station at
Kolkata (formerly Calcutta)
1971 Establishment of IVRI Campus at Bangalore
1973 Development of irradiated lung worm vaccine
and establishment of Vaccine Production
Centre at Srinagar
1982 Establishment of Germplasm Centre at
Izatnagar
1983 Conferment of Deemed University status by
University Grants Commission to IVRI,
Izatnagar
1986 Establishment of National Biotechnology
Centre (NBC) at Izatnagar
1986 Establishment of a Centre for Animal Disease
Research and Diagnosis (CADRAD) at
Izatnagar
1998 Establishment of High Security Animal
Disease Laboratory at Bhopal
2000 Dedication of High Security Animal Disease
Laboratory to the Nation
2001 Development of competitive-ELISA
diagnostic kit for Rinderpest, approved by
OIE and validated by IAH, Pirbright, UK.
2001 P2 facility for FMD vaccine quality control
created at Animal Experimental Station,
Yelahanka, IVRI, Bangalore
2001 Conferment of Sardar Patel Outstanding
ICAR Institution Award
2002 Development of live modified PPR vaccine
2004 Establishment of Kisan Call Centre at
Izatnagar
2004 Inauguration of University-cum-
Administrative Block
2005 Award of ISO 9001: 2000 Certificate by
International Certificate Services Asia to
CADRAD
2007 Kisan Help Line at Mukteswar campus
2009 Recognition of HSADL as OIE approved
Referral Lab for HPAI diagnosis; the third
such lab in Asia and seventh in the world
2009 Establishment of SPF Animal Facility at
HSADL, Bhopal
2009 Establishment of Zonal Technology
Management - Business Planing and
Development Unit (North Zone)
2010 Conferment of Sardar Patel Outstanding
ICAR Institution Award for the year 2009
The Institute with its long heritage and glorious
scientific achievements has always enjoyed a certain
prestige and tradition of its own. The Institute at its
headquarters functions through more than 20
research divisions, 400 acres livestock and fodder
production farms, feed technology unit, a modern
computerised library, engineering section, medical
hospital, etc. Besides the main campus, three
regional stations at Kolkata, Palampur and Srinagar
and two full-fledged campuses at Mukteswar in
Uttarakhand and Bangalore in Karnataka are the other
functional units of the Institute dedicated to livestock
research and development. Further, the Institute is
the seat of two Centres of Advanced Studies in Animal
Nutrition, and Veterinary Physiology, many Network,
National Agricultural Innovation Projects and All India
Co-ordinated Research Projects.
7
MANDATE
1. To conduct research, provide postgraduate
education and transfer of the technology in all
areas of animal sciences with emphasis on
animal health and production.
2. To act as national referral centre for veterinary
type cultures, disease diagnosis, biologicals,
immunodiagnostics etc.
PAST ACHIEVEMENTS
The Institute, the largest of its kind in whole
of South-east Asia, is widely known for its impressive
contributions to all aspects of livestock and poultry
health, production technology and postgraduate
education. The Institute is a pioneer not only in
mission-oriented research, but also a foremost centre
for postgraduate training and education. For many in
the profession it is their Alma Mater.
The Institute takes a legitimate pride in its
contributions and distinguished services pro rata in
achieving the national goals. With the richest animal
resource in the world today, India is the largest milk
producer and ranks fourth in egg production and eighth
in broiler production in the world. These notable
achievements became a reality due to direct impact
on account of control of major diseases, particularly
rinderpest and CBPP in cattle, African horse sickness
in horses and Newcastle disease in poultry as a result
of potent vaccines developed by IVRI. Some of the
salient achievements are summarised below:
A. ANIMAL HEALTH
Early Interventions - Pre-independence Phase
* Development of anti-rinderpest serum (1899),
anti-anthrax serum for cattle (1902),
haemorrhagic septicaemia (HS) serum (1905)
* Development of black quarter vaccine (1906-
08)
* Treatment of surra (T. evansi infection) in
horses and camels (1908-11)
* Production of polyvalent HS vaccine (1908)
* Eradication of dourine in horses (1920-21)
* Development of goat tissue vaccine (GTV)
against rinderpest (1927)
* Development of R2B vaccine against Ranikhet
disease of poultry (1940)
Sustained R&D Activities - Post-independence
Phase
* Development and updating FMD vaccines
including crystal violet tongue epithelium
(1946-52), goat kidney cell culture (1964-65),
saponin and oil adjuvant (1968-70) and BHK-
21 monolayer and cell suspension (1971-78)
vaccines
* Development of anthrax spore vaccine (1951)
* Control and eradication of African horse
sickness through appropriate diagnostics,
vaccine and control strategies (1960 - 65)
* Development of an irradiated sheep lung worm
vaccine (1973)
* Standardization of fermenter technology for
large scale production of FMD vaccine in BHK-
21 (clone 13) cells in suspension (1976-79)
* Development of Theileria schizont vaccine for
bovine theileriosis (1979)
* Development of inactivated goat pox vaccine
(1986-87)
* Successful use of horn plates in the
management of long bone fractures in animals
(1986-90)
* Development of drugs/formulations from
indigenous medicinal plants for skin infections,
ecto-and endoparasites and wounds (1990-96)
* Molecular characterization and differentiation
of P. multocida strains, Salmonella serovars
of veterinary and zoonotic significance using
ribotyping, PCR and DNA fingerprinting
techniques (1992-2000)
* Development of ELISA technology for
diagnosis of salmonellosis, brucellosis,
listeriosis, theileriosis, babesiosis,
trypanosomosis, fasciolosis and
echinococcosis (1995-99) and inclusion body
hepatitis-hydropericardium syndrome (IBH-
HPS) in chicks (2000)
* Development and release of a COFAL test kit
for detection of ALC infection in poultry (1997)
* Olinall®, a formula for treatment of chronic skin
ailments commercialized (1997)
* Development of a panel of monoclonal
antibodies against rinderpest virus and a MAb
based competitive ELISA to distinguish
rinderpest and PPR viruses (1997-99)
* Development and release of a kit for diagnosis
of bluetongue (1998), FMD (1998), rinderpest
(2001)
* Demonstration of 'lead' as an inducer of
oxidative stress in bovines for the first time
(1998-99)
* Development of PCR assay and a non-isotopic
gene probe for detection of Trypanosoma
evansi (1998-2000)
* Development of IBD vaccine (1999) and a
thermostable IBD vaccine (2001) for Gumboro
disease of poultry (1999)
* Standardization of ELISA and PCR for the
diagnosis of Mycoides clusters of Mycoplasma
viz., Mycoides mycoides subsp. capri, M.
mycoides subsp. mycoides Type LC, M.
capricolum subsp. capricolumn, M.
capricolum, Subsp. capripneumoniae and
Mycoplasma sp. bovine group 7 (1999)
* Designing and fabrication of an external skeletal
fixation device for stable fixation of metatarsal
and radial fractures in large animals (1999)
8
* Development of CCPP vaccine for goats and
sheep (2000)
* Development of Rose Bengal coloured antigen
for serum agglutination test (1999-2000) and
kit for diagnosis of caprine pleuropneumonia
* Occurrence of chicken infectious anaemia
(CIA) in India by PCR assay and isolation of
virus (2000)
* Development of an inactivated oil emulsified
vaccine against IBH-HPS (2000)
* Targeted PCR assays for detection of
haemoprotozoan infections caused by Theileria
annulata and Babesia bigemina infected carrier
animals were standardized (2001)
* PCR based diagnostic technology developed
for the detection and differentiation of important
avian diseases viz., infectious bursal disease,
CIA, Newcastle disease, EDS-76 virus
syndrome, Avian Reovirus infection and duck
plague (2001)
* Development of an effective indigenous
treatment for endometritis in buffaloes (2002)
* Development of ELISA technology for
diagnosis of BVD and PPR (2003)
* Development of PCR based diagnostic
technology for fowl adeno virus-4 (2003)
* PCR based diagnostic assays standardized
for BPV, BVD virus, canine parvovirus,
Campylobacter (2003), Brucella and
Haemonchus contortus (2006)
* Development of area-specific mineral mixtures
to improve animal health and production (2003)
* Conferment of 100 per cent protection in
challenged calves by a low volume (2 ml)
saponified haemorrhagic septicaemia vaccine,
up to 12 months post immunization (2004)
* Conferment of 100 per cent protection in mares
challenged with a virulent S. Abortus equi strain
by defined deletion double mutant vaccine for
Salmonella Abortus equi (2004)
* Successful fixation of fractures in dogs with
osteopenic bones by modified technique of
interlocking nailing (2004)
* Commercialization of area specific mineral
mixture with industrial concerns (2005)
* Development of multiplex PCR for listeriosis
and nested PCR for BDV, BVDV (type 1 & 2)
and T. evansi (2006)
* Detection of H5N1 subtype of influenza virus
in poultry for the first time in the country. Four
H9N2 and one H9N1 viruses were isolated
(2006)
* Development of Real-time PCR based
diagnostic assays for important exotic
diseases namely, avian influenza virus and
pseudorabies (2006)
* A status of freedom from contagious bovine
pleuropneumonia infection in cattle and buffalo
was obtained from OIE (2007)
* Dot-ELISA was developed for serodignosis of
Fasciola gigantica infection (2007)
* Development of cell culture vaccine for
classical swine fever (2007).
* Development of recombinant antigen based
ELISA kit for serodiagnosis of IBD and NDV
(2007)
* Epoxy-pin external skeletal fixation technique
has been developed for a variety of compound
fractures of long bones in small animals (2007)
* A novel design of bilateral external fixator has
been developed for the management of long
bone fractures in large animals (2007)
* A Taqman based one-step Real-time RT-PCR
was developed for simultaneous detection and
genetic typing of ruminant pestiviruses,
namely, BVDV-1, BVDV-2 and BDV (2008)
* A diagnostic Real-time PCR based on DNA
polymerase gene has been developed and
validated using suspected clinical samples of
Capri poxviruses obtained from sheep and
goats (2008)
* A post-milking herbal teat dip for prevention of
bovine mastitis was developed (2008)
* A cart for rehabilitation of dogs suffering from
posterior paresis has been designed and
developed (2008)
* Porcine circovirus 2, the causative agent of
PMWS, an emerging disease of pig was first
identified in the Indian swine population (2009)
* Porcine parvovirus causing reproductive failure
in pigs was detected in Indian swine population
(2009)
* Real time PCR assays for specific diagnosis
of pox viruses (Orf, buffalo pox) and rotavirus
were developed (2010)
* A ELISA diagnostic kit for diagnosis of
Haemonchus contortus infection was
developed (2010)
* Phylogenetically new strain of H5N1 (clade
2.3.2) was identified from outbreak in ducks of
Tripura (2011)
* Allele specific PCR for benzimidazole
resistance diagnosis in Bunostomum
trigonocephalum and Mecistocirrus digitatus
(2011)
B. LIVESTOCK IMPROVEMENT/MANAGEMENT
* Introduction of Japanese quail (Coturnix
coturnix japonica) as an alternate to poultry
for the first time (1974) in India
* Development and release of a high yielding
broiler (B77) of poultry (1977)
* Development of urea-molasses liquid feed and
urea-molasses mineral liquid supplement for
efficient utilization of low grade straws by
ruminants (1980-85)
9
* Evolution of new strains of high yielding cattle
(3000-3500 kg of milk / 300 days of lactation)
(1986-97)
* Utilization of agro-industrial by-products like
mahua cake, neem seed cake, sal seed meal,
tomato pumace, etc. and unconventional feed
stuffs as livestock feed (1990-95)
* Development of a promising diet for growing
pigs and feeding standards for buffaloes,
rabbits and guinea fowls (1990-95)
* The feeding of lactics (lactic acid bacteria) to
pre-ruminant calves and yeast to adult
ruminants was found to improve animal
productivity (1995-2000)
* Designing and fabrication of a simple field
diagnostic tool 'Crystoscope' indigenously for
assessing the optimum insemination time and
categorization of bulls based on crystallization
patterns of cervical mucous and neat semen
(1999)
* A combined PCR-SSCP, PCR-RFLP,
microsatellite and heteroduplex analysis and
DNA sequencing were successfully used for
genotyping of animals (2001)
* Regression of thyroid gland activity with
decreased levels of thyroid hormones, T3 and
T4 was observed in goats infected with PPR
and liverfluke infection caused by F. gigantica
(2001)
* A pregnancy-specific marker protein of
placental origin in serum of pregnant goats was
characterized (2001)
* Technology development for utilization of
karanj cake, urea-ammoniated sugar cane
bagasse and kitchen waste as livestock feed
(2003)
* Genotyping of various genes namely, IGF BP-
3, IL-2, IL-10, NRAMP-1, DRB-3 and ITGB-2
genes that affect growth/ production
performance and/or disease resistance was
done in buffaloes and goats (2003)
* Eupatorium sesquiterpene (ODA, 9-oxo-10,11-
dehydroageropherone) identified as a potent
inhibitory agent in ruminant methane formation
(2003)
* Development of a lifting device for sick and
convalescent large animals (2003)
* Restoration of fertility in endometric cows by
autologous plasma and ketocytes (2004)
* Development of a tractor operated animal
carrier (2004)
* Development of cross-bred cattle strain
'Vrindavani' (2006)
* Feeding practices were devised for in vivo
reduction of methane production in buffaloes
(2010)
* Generated transgenic mesenchymal stem
cells expressing green fluorescence protein
(2011)
C. LIVESTOCK PRODUCTS TECHNOLOGY
* Development of technologies for value aided
recipes such as meat pickles (1982), buffalo
meat sausage (1982), meat patties (1986),
meat tikkas (1986), meat kofta (1987), rabbit
meat products (1992), chicken nuggets (1997),
milk sausages (1986), egg loaf (1997), meat
based snacks, chicken meat chips, curls
(2001), functional mutton nuggets (2007)
* Development of diet nuggets from broilers and
culled broiler hens (2002)
* Development of technologies for buffalo meat
based idli and meat samosa (2003)
* Development of technique for successful
incorporation of pork skin/rind in emulsion
based products (2003)
* Development of a novel device 'tandoor hook'
hanger for meat specialities (2003)
* Development of low salt, low fat, medium fibre
pork meat balls (2004)
* Development of meat products of nutritional
merit incorporating capsicum, carrot, radish,
red chilli, linseed and soya (2006)
D. HUMAN RESOURCE DEVELOPMENT
* Prior to conferment of Deemed University
status to IVRI in 1983, a total of 851 scholars
earned their postgraduate degrees from the
institute (M.V.Sc.-570, Ph.D.-273, D.Sc.-8)
including 103 scholars from 22 countries
* The Deemed University, IVRI awarded 105
M.Sc., 1808 M.V.Sc., 853 Ph.D. degrees to
P.G. scholars enrolled at this institute (1984-
2012)
* A total of 1559 field veterinary officers were
awarded National Diploma certificates by IVRI
before conferment of Deemed University status
* The Deemed University IVRI awarded 565
National Diploma certificates to field Veterinary
Officers (1984-2012)
10
11
STATEMENT SHOWING THE TOTAL NUMBER OF EMPLOYEES AT IVRI AND ITS CAMPUSES/
STATIONS AND NUMBER OF S.C. AND S.T. CATEGORY EMPLOYEES (AS ON 31.03.2012)
Class of No. of No. of No. of S.C. No. of S.T. No. of O.B.C. No. of
posts sanctioned employees category category category PHs in
posts in position employees employees employees position
Scientific
Scientists 202 175 16 01 11 02
Sr. Scientists 82 45 09 01 06 -
Principal Scientists 39 22 02 - - -
R.M.Ps 08 06 - - - -
Technical
Category-I 351 282 49 07 07 04
Category-II 82 60 15 10 11 -
Category-II (T-5) 15 12 (excluding 03 04 06 01
those promoted
by way of FYA)
Category - III 91 41 03 03 02 01
(T-6 to T-9)
Administrative
JD (Admn. & Registrar) 01 01 01 - - -
C.A.O 01 02 01 - 01 -
SF&AO 01 01 - - - -
S.A.O. 02 02 01 - 01 -
A.O. 05 03 - - - -
A.A.O 30 18 02 - - -
F&AO 02 02 01 - - -
AF&AO 04 02 - - - -
Asstt. Director (OL) 02 01 - - - -
Security Officer 02 01 - - - -
P.S. 11 10 - - 01 -
M.O. 06 04 01 - - -
Assistant 143 91 11 01 03 02
U D C 55 101 19 02 04 09
LDC 40 45 05 - 05 -
P.A. 15 09 - - 01 01
Steno Grade III 05 02 - - - -
Jr. A/cs Officer 01 01 01 - - -
Asst. Manager (Canteen)01 01 - - - -
Manager (Canteen) 01 01 - - - -
Cook 01 01 - - - -
Skilled Support Staff 1285 1003 330 24 52 23
12
REVENUE GENERATION DURING 2011-12
(Rupees in lakhs)
(A) Revenue Generation Izantnagar Mukteswar Bangalore Bhopal Total
1. Sale of dairy products 129.42 9.70 0.00 0.00 139.12
2. Sale of vaccines 198.13 5.10 134.03 0.00 337.26
3. Income from services rendered 0.00 0.00 0.00 0.00 0.0
4. Income from publications 3.15 0.00048 0.00 0.00 3.15048
5. Sale of animals 53.87 0.00 0.00 0.00 53.87
6. Other misc. receipts 239.11 30.58 33.52 58.45 361.66
Total 623.68 45.38 167.55 58.45 895.06
SUMMARY OF EXPENDITURE 2011-12
(Rupees in lakhs)
(B) Summary of Expenditure:
Non plan:
1. Estt. Charges including LSPC 7011.21 901.69 551.93 310.69 8775.52
2. T.A. 27.97 2.00 2.00 2.99 34.96
3. Assets acquired :
a) Equipment 38.88 3.52 2.19 0.86 45.45
b) Books & journals 0.00 0.00 0.00 0.00 0.0
c) Others 61.21 0.33 5.29 4.05 70.88
4. Feed & upkeep of animals 160.58 19.71 3.21 1.14 184.64
5. Chemicals & glassware 434.33 29.11 5.13 54.27 522.84
6. Scholarship/fellowship 301.57 18.45 2.29 0.00 322.31
7. Other misc. contingent expenditure 1089.71 122.10 80.21 325.98 1618
8. Works - repair & maintenance 192.05 36.62 26.99 18.10 273.76
Total 9317.51 1133.53 679.24 718.08 11848.36
Plan:
1. Estt. charges including LSPC
2. T.A. 21.98 3.94 4.00 4.00 33.92
3. H.R.D. 9.20 0.66 0.00 0.59 10.45
4. Assets acquired 0.00 0.00 0.00 0.00 0.00
5. Equipment 75.73 15.72 0.00 0.93 92.38
6. Books & journals 100.00 24.02 20.00 9.33 153.35
7. Livestock 1.80 0.92 0.00 0.00 2.72
8. Others 0.00 0.00 0.00 0.00 0.00
9. Feed & upkeep of animals 107.64 0.00 0.00 0.00 107.64
10. Chemicals & glassware 53.79 10.60 17.09 70.83 152.31
11. Scholarship/fellowship 0.00 0.00 0.00 0.00 0.00
12. Other misc. contingent expenditure 17.35 36.61 44.90 89.45 188.31
13. Major works 294.08 85.00 11.58 32.99 423.65
14. Repairs & maintenance 0.00 3.74 0.00 0.00 3.74
Total 681.57 181.21 97.57 208.12 1168.47
13
SCHEME-WISE EXPENDITURE DURING 2011-12
(Rupees in lakh)
S N.Summary of Expenditure Izantnagar Mukteswar Bangalore Bhopal Total
1 Non Plan 9317.51 1133.53 679.24 718.08 11848.36
2 Plan 676.57 181.21 97.57 208.12 1163.47
3 Schemes financed from Non Plan:
a ICAR Fellowship 274.75
b SUMMER INSTITUTES 2.97
(ICAR Summer/ Winter School)
4 Schemes financed from Plan Budget of Council:
a Niche Area Project 42.17 18.52
b Dr. Bhaskar Sharma (National Prof.) 46.89
c ZTMC/ITMU Project 9.57
d Environmental Pollutant 208.37
e Zoonotic Disease 167.50
f Ethno Veterinary Medicine 230.34
AICRPs:
g AICRP on Pigs 10.31
h AICRP on Feed Resources 10.54
All India Network Project:
i AINP on GIP 109.85
j AINP on HS 103.76
k AINP on BTD 94.91 7.65
l Enhancing Livelihood of Rural 4.68
Woment through Livestock
Production
Education Division Schemes:
m P.G.Education Programme 32.33
n Centre for Advance Studies (A N) 11.56
o Centre for Advance Studies (A. Phy) 9.38
p Advance Centre on P.G. Education -
5 KVK 62.12
6 Externally funded Projects:
NAIP 805.90 25.21 2.16
CDDL
'R' Deposit Schemes
Scheme Financed from other
Deptt. 336.93 26.48
DBT SFV
NPRE Project
AD-hoc project
7 A.P.Cess funded Schemes 1.79
}
14
3. RESEARCH ACHIEVEMENTS
Sl.No. Theme Page No.
1. Development and improvement of vaccines and vaccine delivery 15
2. Development and improvement of diagnosis 20
3. Production and standardization of veterinary biologicals 28
4. Molecular characterization of pathogens and host-pathogen interaction 30
5. Disease monitoring and surveillance 37
6. Exotic and emerging diseases 45
7. Development of alternate systems of therapy 49
8. Molecular mechanism of drugs and their monitoring in animal system 54
9. Environmental pollutants/xenobiotics and their impact on animal health and production 54
10 Clinical and surgical interventions 56
11. Clinical and diagnostic services 60
12. Genetic studies related to disease resistance, production and reproduction in livestock 63
13. Livestock production and management 68
14. Reproductive management and augmentation of fertility 73
15. Nutrition for health and welfare of livestock, pets and wildlife 77
16. Expending feed resources and improving nutrient extraction from biomass 81
17. Strategic supplementation of macro- and micro-nutrients for improving livestock production 83
18. Feeding practices for optimizing animal productivity and reducing environmental pollution 84
19. Impact of environmental stress on health and production in livestock 86
20. Database on livestock related statistics and development of statistical models 88
21. Economic evaluation of livestock diseases and marketing of livestock products 89
22. Extension interventions in livestock production systems 91
23. Value addition of livestock products 96
1 5
1. DEVELOPMENT AND IMPROVEMENT
OF VACCINES AND VACCINE
DELIVERY
(1) VIRAL VCCCINES
(a) Foot and mouth disease
(i) Evaluation of inactivated Foot-and-mouth
disease vaccine formulated with VacciMax, a
liposome based novel delivery system: Two
different formulations of high payload trivalent
VacciMax-FMD vaccine were evaluated in
comparison to the conventional oil adjuvanted
vaccine. Cattle immunized with these vaccines were
assessed for duration of immunity at monthly interval
up to 9 months post-vaccination and screened by
VNT for type specific FMDV antibodies. At 6 months,
animals were given booster vaccination. The VNT
data were analysed for duration of protective immune
response. Cattle vaccinated with two VacciMax-
FMDV preparation had shown titre of 64 up to 6
months similar to conventional vaccine. The mean
titre of >64 was observed in 70% of animals for type
O, 75% for type A and 87% for Type Asia1. The titre
(>64) was maintained till 7 months in conventional
vaccine while it started declining in VacciMax
formulations after 6 months. However, a booster dose
of VacciMax formulation on completion of 6 months
post-vaccination showed rise in VN titre of 64 and
above in 100% animals for all three serotypes.
(ii)Recombinant adenovirus vectored FMD
vaccine: Recombinant adenoviruses containing
capsid genes of three Indian Vaccine strains (O R2/
75, A 40/2000 and Asia-1 63/1972) and two field
strains (A 195/2007 and A 281/2003) were
constructed.
(iii) Baculovirus expressed FMD vaccine:
Baculovirus expressed P1-2A-3C of FMDV type O
was prepared in bulk for purification by sucrose
density gradient. The expressed proteins were tested
in sandwich ELISA format and found to be type
specific and showed reactivity to anti- FMDV antibody
raised in rabbit. The purified proteins were screened
in Transmission Electron Microscopy for empty
capsids.
Infectious genome length cDNA of FMDV type
O has been constructed. BHK-21 cells transfected
with plasmid containing full genomic cDNA of the
virus flanked by murine RNAPI promoter and
terminator sequences lead to recovery of infectious
FMDV particles as evidenced by cytopathic effects
(CPE) in the cultured cells (Fig.1). Recombinant virus
was characterized by virus neutralization test (VNT),
antigen ELISA, plaque assay.
B A
Fig. 1: CPE in BHK-21 cells infected with rescued virus
from infectious clone.
(A) Normal monolayer of BHK-21 cells transfected with
lipofectamine alone containing no cDNA construct. Cells
do not show any changes 72 hours post-transfection.
(B) BHK-21 cells transfected with 2 µg of pFMDV-O-IND-
R2/75 clone with lipofectamine after 24-48 h of
transfection show CPE characterized by cell aggregates
and cell degeneration that is characteristic of FMDV in-
fected BHK-21 culture.
(iv) Modulation of immune responses to FMDV :
A DNA vaccine was made by cloning VP1 of FMDV
serotype O either alone or fusing with HSP60 in pVAC
vector. The vaccine constuct, when studied for its in
vitro functionality in BHK21 cells and in vivo
immunogenicity in guinea pigs, showed that it
induced high level of IgG1, IgG2 and nitric oxides. A
protection of 50% in guinea pigs upon virulent FMDV
challenge was observed as compared to 30%
protection in VP1 alone.
A DNA vaccine construct carrying VP1 gene
of FMD virus serotype O fused to Omp A gene of
Salmonella Typhimurium (pVAC VP1- OmpA) was
constructed and evaluated for immunogenicity and
protection. This construct conferred 70% protection
against homologous virulent challenge, in immunized
guinea pigs.
Chitosan nanoparticles containing FMD whole
virus (146S) induced strong mucosal immunity (IgA)
when administered intranasally and withstood
intranasal FMD virus type O challenge in cattle.
(v) Bovine GM CSF: Molecular subcloning,
expression in Pichia pestoris and evaluation of
it's biological activity: Bovine GMCSF recombinant
peptide 16-20 kDa was expressed in Pichia pastoris
GS115 cells and purified. The biological activity of
purified recombinant bGMCSF was evaluated on
bovine bone marrow cells. It showed the highest
proliferation of bone marrow cells at 2-4 ng/ml of
culture in dose dependent manner.
3. RESEARCH ACHIEVEMENTS
1 6
(vi) Application of revere genetics: A novelapproach for studying the molecular basis of immune
response in Indian cattle breed: A chimeric virus with
structural protein genes of type 'O' and back bone of
Asia 1 was produced and studied as vaccine
candidate for eliciting specific immune response in
guinea pigs as well as in cattle. As per the survey a
few indigenous cattle breeds of Karnataka were
selected and vaccinated with the Chimeric 'O' vaccine
and the humoral and cell mediated immune responses
were studied. Of the four breeds selected, viz.,
Hallikar, Malnadugidda, Deoni and Amrutmahal,
Malnadugidda showed high antibody and gamma
interferon responses even after 6 months post
vaccination. A positive marker vaccine was
developed though the incorporation of 9 amino acids
of GFP in the structural protein gene of Asia 1.
(b) Enzootic bovine haematuria/Bovinepapillomatoses
A preliminary vaccine trial was conducted in
hill cows to evaluate the therapeutic potential of
binary ethylenimine (BEI) inactivated and saponized
bovine papillomavirus-2 (BPV-2) for enzootic bovine
haematuria (EBH). Although the vaccine failed to
show favourable clinical results in treatment of EBH
affected cows at 120 days post vaccination,
immunopathological responses were encouraging. A
significant difference was observed in humoral
(against Brucella abortus strain 19S) and cell-
mediated (in vivo phytohaemagglutination delayed
type hypersensitivity (PHA DTH) test and CD4+/
CD8+ T-cells ratio by FACS analysis) immune
responses following vaccination (Fig.2). The
vaccinated animals grossly failed to show regression
of bladder tumours but microscopically engorgement
and marked perivascular infiltration of mononuclear
cells was observed, which are indicative of the
induction of initial stages of tumor regression. Overall
results indicated that the therapeutic vaccine
developed can have potentials for treating EBH in
cows, for which further modifications in vaccine dose
and field trial is required.
Fig. 2: Analysis of CD4+/CD8+cells by FACS
Bar diagram showing CD4+/CD8+ by FACS in cows of
Control, EBH and EBHV groups.
(c) Pox vaccine
i. Long term immunitiy trial of sheep pox vaccine:The live attenuated sheep pox vaccine was found
protective after 1 year of vaccination in sheep. The
immunity of the vaccinated sheep after 2 years of
vaccination was assessed by challenge study using
virulent sheep pox virus. At 2 years post vaccination,
a total of 4 vaccinated and 2 control animals were
used for challenge with virulent strain (106.0 TCID50
/ml, SPPV Srinagar at passage level 6). All the
vaccinated animals were protected on challenge,
whereas, all unvaccinated controls developed
infections (Fig.3). The same has been reflected in
sero-monitoring of collected sera by using SNT. The
developed live attenuated sheeppox vaccine was
found potent even at 2 years of immunization of
sheep pox vaccine.
A B C
Fig. 3: No signs of infection in vaccinated animals (A)
and typical clinical lesion at the site of inoculation of
challenge virus in control animals (B and C) at 10 days
post challenge.
(ii) Intrinsic thermo-stability of live attenuated orfvaccine: The live attenuated orf vaccine wasevaluated for its safety, efficacy and potency by
laboratory trials and found to be satisfactory. The
intrinsic thermo-stability of developed orf vaccine was
evaluated at two different temperatures, 37ºC and
42ºC, without adding any stabilizer to the vaccine
during freeze-drying process. Sufficient number of
vaccines without any stabilizer was lyophilized and
initial titer of the vaccine was identified by end point
dilution method in cell culture and found to have 100
doses of vaccine virus. After exposure of the vaccine
at 37ºC and 42ºC for 10 days, the stability of vaccine
was checked in cell culture based end point dilution
method. It is found that the vaccine was stable for
12 and 5 days when exposed at 37ºC and 42ºC,
respectively.
(iii) Field trial of sheep pox, orf and combinedvaccine (goatpox and PPR): A total of 500 doseseach of sheep pox and Orf vaccines were tested in
sheep and goats as field trials in villages namely
Ayyampalayam, Sithankuttai and Uyilampalayam in
Erode district of the state Tamil Nadu during April-
May, 2011. Similarly, a total of 200 doses of
combined vaccine containing PPR and goat pox
vaccine strains were evaluated for safety in goats in
villages namely Sithankuttai and Uyilampalayam and
vaccines were found safe and not caused any
untoward reactions in vaccinated goats.
1 7
(d) Rabies
(i) Evaluation of anti-rabies effect of smallinterfering RNA (siRNA) delivered through viralvector: Two small interfering RNAs (siRNAs)targeting rabies virus (RABV) nucleoprotein (N) and
polymerase (L) genes were designed and evaluated
in vitro in BHK-21 cells and in vivo in mice. When
BHK-21 cells were treated with replication-defective
adenoviruses or lentiviruses expressing siRNAs and
challenged with RABV, there was significant reduction
in RABV gene transcripts analysed using quantitative
real-time PCR (Fig.4A and 5A). When mice were
treated intracerebrally with adenoviruses or
lentiviruses expressing siRNAs and challenged
peripherally with virulent RABV by the intramuscular
route in masseter muscle, there was significant
protection (62-65%) with adenoviruses and
lentiviruses expressing siRNAs against RABV-N
(Fig.4B and 5B). This supported the hypothesis that
RNAi, based on siRNA targeting RABV-N gene can
prevent RABV infection and holds the potential of
RNAi as an approach to prevent infection.
A
B
Fig.4: Effect of different adenoviruses expressing
siRNAs on inhibition of RABV multiplication in vitro in
BHK-21 cells (A) and in vivo in mice (B).
A. Reduction in RABV titers in BHK-21 cells treated with
different adenoviruses expressing siRNAs and then
infected with RABV-PV-11 strain.
B. Protection of mice treated intracerebrally with different
adenoviruses and challenged by intramuscular route in
masseter muscle with 20 LD50 of lethal RABV-CVS-11
strain.
A
B
Fig.5: Effect of different lentiviruses expressing siRNAs
on inhibition of RABV multiplication in vitro in BHK-21
cells (A) and in vivo in mice (B).
A. Reduction in RABV titers in BHK-21 cells expressing
siRNAs and then infected with RABV-PV-11 strain.
B. Protection of mice treated intracerebrally with different
lentiviruses and challenged by intramuscular route in
masseter muscle with 20 LD50 of lethal RABV-CVS-11
strain.
(e) Newcastle disease
Bulk propagation of ND virus (Indian isolate)
was made in the 10-day old embryonated chicken
eggs. After the end of 6th passage level, the virus
infected allantoic fluid showed the HA titre of 211.
The virus was inactivated with BPL, precipitated with
PEG, dialyzed and freeze dried.
(i) Preparation and characterization of PLG
nanoparticles: The nanoparticles made up ofpolylactide-co-glycolide (PLG) were prepared by
double emulsion solvent evaporation technique.
Characterization of nanoparticles by particle sizeanalyzer (zeta-sizer) revealed the mean diameter of
PLG nanoparticles as 201 nm with negative charge/
zeta potential of -6.0 mV. The scanning electron
microscopy (SEM) revealed a heterogenous
population of spherical shaped nanoparticles.
(ii) Preparation and characterization of chitosannanoparticles: Chitosan nanoparticles were prepared
1 8
by the method of ionotropic gelation of chitosan (CS)
with sodium tripolyphosphate (TPP) anions. Chitosan
nanoparticles exhibited mean size of 189 nm with a
positive charge of 47.3 mV as determined by Malvern
particle size analyzer.
(f) Infectious bursal disease:
The vvIBDV strain SD 1/10 was originally
isolated from a poultry farming Namakkal, Tamil Nadu
was utilized as the candidate viral isolate for cloning
and expression of VP2 gene. The full length VP2
gene was cloned and expressed in yeast
(Saccharomyces cerevisiae) expression system.
Expression of IBDV-VP2 (rVP2) in yeast resulted in
the formation of sub-viral particles (SVPs) with a
diameter of approximately 20 nm. The rVP2 SVPs
were further produced in bulk and purified. The
concentration of the recombinant VP2 protein was
found to be 14 mg/ml. The reactivity of the
recombinant protein was determined by Western blot
using polyclonal anti IBD sera. Electron microscopy
detected an approximately 20 nm particles that
contained only VP2 and the wild type yeast culture
under electron microscopy showed an approximately
40 nm sized particles. The recombinant VP2 SVPs
has been utilized to immunize the specific pathogen
free chickens following dose standardization and
safety test. It was found that 100 µg of rVP2 protein
was enough to induce cell mediated and humoral
immune response. There was no abnormal local or
systemic reaction observed in the immunized
chicken. This recombinant VP2 protein developed
as a vaccine candidate was safe for the birds.
(g) Chicken infectious anemia virus (CIA)
For the development of CIAV-DNA vaccine,
VP1 and VP2 genes of CIAV were cloned in
bicistronic pIRES eukaryotic expression vector.
Recombinant clones were characterized by colony
PCR, RE and sequencing. The in vitro expression
was studied, pIRES-VP1 -VP2 were expressed in
vero cells, which was demonstrated by employing
RT-PCR and immunoperoxidase test. Experimental
evaluation of the induction of immune response by
CIAV-DNA vaccine in 2 week old specific pathogen
free (SPF) chicks indicated protective humoral
immune response with ELISA antibody titres of 4784
to 4936 with primary DNA vaccination and 6183 to
6048 with booster DNA vaccination (booster
vaccination given at 2 weeks interval). IFN-γ and IL-4 titer values assessed also indicated an effective
cell-mediated immune response in booster DNA
vaccinated group. In another effort, for the
improvement in DNA vaccine, CIAV VP1 and VP2
genes cloned separately in pTARGET vector were
used as a DNA vaccine after incorporating novel
adjuvants (r-IL-2 and HMGB1). Recombinant chicken
high mobility group box protein one (HMGB1) was
amplified, sequenced and expressed in prokaryotic
system. Chicken interleukin-2 (IL-2) was cloned in
eukaryotic expression system. CIAV VP1 and VP2
genes cloned in pTARGET vector were bulk purifiedfor use as DNA vaccine.
(2) BACTERIAL VACCINES
(a) Haemorrhagic septicaemia
In an attempt to develop a live attenuatedvaccine strain for the protection against haemorrhagicsepticaemia, Pasteurella multocida P52 has beenused for targeted mutagenesis. The developed mutantwas highly attenuated. Mice inoculated with 1 X107
cells of P. multocida mutant strain, ∆aro-P52IVRI,by i/p route, survived. Rabbits immunized with liveP. multocida P52 aroA mutant strain showed highlevel of protection against virulent challenge. Cattlecalves were immunized with mutant strain of P.multocida P52. There was rise in rectal temperatureby about 2oC which subsided in 12 h.
(b) Combined vaccine against M. mycoidessubsp. capri and P. multocida serotype A: 1
A combined vaccine using M. mycoidessubsp. capri and P. multocida serotype A: 1 antigens,an seppic adjuvant was prepared. After sterility andsafety test the vaccine was inoculated in 40experimental goats @ 1 ml; subcutaneously at neckregion. The control group of goats were inoculatedwith seppic adjuvant alone. The individual animalswere periodically bled at fortnightly interval up to 4months; followed by monthly bleeding up to 10 monthperiod. Indirect ELISA and IHA were performed forthe pooled serum samples collected. The mean O.D.value in ELISA for M. mycoides subsp. capriantibodies in vaccinated goats was observed as 1.64on day 15th PI. It reached its peak of 1.85 at 3 and3.5 months PI. The mean O.D. value of 1.67 wasobserved at 10 month PI (Fig.6). The mean O.D. valuefor P. multocida A:1 antibodies in vaccinated goatswas observed as 1.13 on day 15th PI. It reached itspeak of 1.72 at 4 month PI. The mean O.D. value of1.43 was observed at 10 month PI (Fig.7).
Highest antibody titre (160) for M. mycoidessubsp. capri was found highest at 2.5 months, whichcame down at 40 by 5th month. At 10 m PI, the titrerecorded was 80. For P. multocida A:1; the titrereached up to 40 by 3.5 month PI. It reduced to 20
at 8th month PI and exhibited same up to 10 months
PI.
The potency testing of vaccine was conducted
by direct challenge test performed at 9 month PI, onvaccinated and control goats. The challenge culture
dose by intra-tracheal route was 1 ml 1012 cfu, for M.
mycoides subsp. capri and 8 ml of 5 x108 cfu for P.
multocida A:1 was performed. The challenged animals
were observed for a period of 7 days. The vaccinated
animals exhibited 62.5% protection for M. mycoidessubsp. capri challenge and 75% protection for P.
multocida A:1 challenge.
1 9
Fig.6: ELISA antibody titre for M. mycoides subsp capri
in goats vaccinated with combined vaccine
anatolicum
Fig.7. ELISA antibody titre for P. multocida A:1 in goats
vaccinated with combined vaccine
(c) Black leg
In an attempt to identify the potential vaccine
candidate antigens, Clostridium chauvoie was
characterized by PCR using the primers specific to
16-23s rRNA spacer gene that yielded a specific
product with size of 522 bp and flagellin gene which
yielded specific product of 535 bp (Fig.8).
Fig. 8: Characterization of Clostridium chauvoei by PCR.
A. 16-23s rRNA spacer gene specific 522 bp product. B.
Flagellin gene specific 535 bp product. M. 1 Kb DNA
ladder.
(3) PARASITIC VACCINES
(a) Anti tick vaccine
The efficacy of the BM-86 vaccine was
evaluated against Rhipicephalus (Boophilus)
microplus and Hyalomma anatolicum anatolicum.
Twenty cross bred calves of 3 month age were
randomly divided into four equal groups and animals
of groups 1 and 2 were immunized with 2 ml of rBm86
(100 µg) vaccine thrice at 30 days interval. Animals
of groups 3 and 4 were kept as negative control and
inoculated with PBS only. Each animal of group 1
and 3 was challenged with 7 day old 50 unfed adults
of H. a. anatolicum (1:1, male and female) and each
animal of groups 2 and 4 was challenged with 6-8
day old R. (B.) microplus larvae obtained from 50 mg
of eggs, on 17th day of last immunization. The efficacy
of rBm86 against tick infestation was determined as
percentage reduction in number of adults dropped
(DT%), engorged body weight (DR%), egg masses
(DO%) and immunogen efficacy (E%) (Fig.9). The
results indicated partial effectiveness of Bm86
antigen in imparting protection against homologous
and heterologous challenge infestations of Indian
ticks.
6.4
11.24
40.7
44.5
11.8 10.8
15
25.1
DT% DR% DO% E%
R. (B.) microplus H. a. anatolicum
Fig.9: Comparative efficacy of Bm86 based vaccine
a g a i n s t c h a l l e n g e i n f e s t a t i o n o f R. (B.) microplus and H.
a. anatolicum
(4) IMPROVEMENT OF VACCINES DELIVERY
AND ADJUVANT
(a) Modified LPS as an adjuvant
The study was designed to explore the
adjuvant potential of bacterial endotoxin after reducing
its toxic effect. LPS was extracted from Pasteurella
multocida strain 52, purified, characterized and
modified after treatment with alkaline phosphatase
to reduce its toxicity. The modified LPS were used
for in-vitro and in-vivo studies. It was found that
modified LPS were lower inducer of nitiric oxide
production from immune cells of mice as compared
to their native counterpart. Similarly enzyme treated
dephosphorylated LPS exhibited lower proliferative
response towards mouse splenocytes and ovine
PBMCs than native LPS. In repeated trial, it was
observed that modified LPS never exhibited toxic
2 0
effect at higher concentration on in vitro cell culture
system of mice and chicken origin, which is
considered as a most desired attribute of any adjuvant.
In vivo effect of modified LPS was studied as
an adjuvant for HELas soluble antigen. The group
received modified LPS with HEL elicited higher
antibody response against HEL as compared to
groups received HEL alone or in combination with
native LPS. Modified LPS did not influence IL-10
production which is antinflamatory cytokine that
protects the host from exaggerated effect of TNF,
where as TNFα secretion was found to be at lowerlevel in comparison to native LPS receiving groups.
In experimental protocol using variable dose of LPS,
none of the mice produced anti LPS antibody that is
more desirable. Histopathological changes in the liver
indicated normal architectural details in modified LPS
received group compared to native LPS received
group indicating reduced toxicity of modified LPS
which is in conformity with mice survivability test.
Collectively, the study indicates that the modification
process employed significantly attenuates the LPS
toxicity for its use as an adjuvant.
Foot and mouth disease
(b) Efficacy of different oil adjuvants for FMD
vaccine
Conventional inactivated whole virus vaccine
was prepared with different oil adjuvants viz.,
Montanide ISA 201, 206VG and Indigenous Oil
adjuvant. The three adjuvants were evaluated for
cytokine response, other correlates such as Th1/Th2
bias and protection against FMD challenge in cattle.
2. DEVELOPMENT AND IMPROVEMENT
OF DIAGNOSTICS
(1) VIRAL DISEASES
(a) Foot and mouth disease
Recombinant 3ABC antigen based indirect
ELISA (FMD-3ABC-iELISA) was developed for
detection of FMD non-structural protein antibodies in
sera. The assay which employs insect cell expressedantigen using baculovirus system is highly sensitive,
specific for FMD diagnosis with DIVA application.
The performance of the assay is comparable with
commercial kit (94.2% agreement). The test is highly
cost effective.
(b) Infectious bovine rhinotracheitis (IBR):
(i) LAMP PCR: Loop-mediated isothermalamplification (LAMP) test for the rapid detection of
IBR virus in bovine semen was developed. The testhad the sensitivity of 10 fg viral DNA or 0.2 TCID50/
0.4 infective virus particles per reaction. The whole
assay, including DNA isolation, isothermal
amplification and visualization of results can be
completed within 90 minutes and the results can be
visualized with naked eye by differentiating positive
and negative visual colour development.
(ii) Multiplex real time PCR: A highly sensitive SYBRGreen I dye based multiplex real-time PCR wasdeveloped for detection of IBR virus in bovine semen.
The assay employed two sets of primers, combined
in single tube multiplex format, targeting a highly
conserved region of the IBR virus and bovine growth
hormone gene (internal control) (Fig.10). The assay
had analytical sensitivity of 0.002 TCID50 of infectivevirus particle per reaction using extended bovine
semen spiked with IBR viral genome.
Fig.10: SYBR Green-based multiplex real-time PCR for
detection of IBR virus in bovine semen.
A. two peaks with positive sample (one IBR virus specific
and the other bGH specific internal control).
B. one peak with negative sample (bGH specific as
internal control).
(iii) Development of user friendly diagnostic kit:
Glycoprotein E (gE) was selected for development
of diagnostic ELISA. The B cell epitopic region of gE
was identified and amplified using PCR and cloned
in T/A cloning vector and recombinant plasmid
characterized. The gene fragment was subcloned into
a prokaryotic expression vector (pProEX HTc) and
transformed in E. coli DH5α strain for the expressionof recombinant protein.
Development and standardization of PCR for
the detection and differentiation of BHV 1 and BHV
5: PCR was standardized employing custom
synthesized primers to amplify gC gene of BHV 1
and BHV 5 in the clinical, morbid, semen and tissue
culture samples. In the positive cases 354 and 159
bp amplicons were visualized for BHV1 and BHV 5,
respectively, in agarose gel under UV translluminator.
(iv) Development of monoclonal antibodies
against IBR: For development of monoclonal
antibodies against Bovine Herpesvirus 1, fresh lot of
virus was produced in MDBK cell line, purified and
were used for mice immunization. For development
of ELISA, gB (partial), gC (complete) and gD (partial)
genes were sequenced and PCR standardized.
2 1
(c) Enzootic bovine haematuria/bovinepapillomatoses
Etiopathological characterization of upper
gastrointestinal tract (GIT) tumours of cattle andbuffaloes was undertaken. A total of 27 GIT wart-like
lesions in rumen, reticulum, mouth and oesophagus
of cattle and buffaloes revealed the presence of small
nodular growth to larger spherical or slender growths
with a thin base present on mucosa and ruminal pillar.
Ruminal warts of cattle and buffaloes revealed thepresence of BPV-5, -1 and -2, which is the first report
of presence of these BPVs in the ruminal warts from
India. Quantitative real time PCR revealed that DNA
samples of different GIT wart-like lesions contained
varying amount of BPV DNA copy numbers.
Immunohistochemistry revealed that the PCNA andKi67 immunopositivity was present in the basal and
spinosum layers of the fibropapilloma/papilloma
indicating these as the cellular proliferation sites. In
conclusion, that BPV-5, -1 and -2 are associated with
GIT wart-like lesions/growths in cattle and buffaloes
and the basal and spinosum layers of the ruminalfibropapilloma/papilloma were cellular proliferation
sites (Fig.11).
Fig.11: A-B. Buffalo ruminal lesion/wart: Varying shape
and size, small nodular or slender, elevated growth on
the mucosa of rumen.
C. Buffalo ruminal wart: Acanthosis, elongated rete pegs
and hyperplastic dermal fibrous tissue along with marked
MNCs infiltration. Fibropapilloma.
D. Buffalo reticulum wart: Hyperkeratosis, parakeratosis
and acanthosis with hyperplastic fibrous connective
tissue Fibropapilloma.
E. Buffalo ruminal wart: Ki67 immunopositivity in the
keratinocytes of staratum spinosum and basal layer.
Fibropapilloma, Ki67 IHC×AEC.
F. Buffalo ruminal wart: PCNA immunopositivity in the
keratinocytes of staratum spinosum and basal layer.
Fibropapilloma, PCNA IHC×AEC.
Animal pox viruses
(i) Detection and quantification of camelpox virus
using TaqMan probe real time PCR assay:
A TaqMan hydrolysis probe based real time
PCR (rt-PCR) assay targeting the ankyrin repeat
protein (C18L) gene sequences was developed for
the detection and quantitation of camelpox virus
(CMLV) nucleic acid and compared with established
conventional and SYBR green rt-PCR assays. The
assay was specific with an efficiency of 99.4%. The
analytical sensitivity was 4×101 and 0.35 in terms of
copy number and picogram of virus genomic DNA,
respectively. The assay was linear (Fig.12) with an
acceptable intra (0.9-2.83% and 0.9-2.3%) and inter-
assay (0.46-2.3% and 0.9-3.3%) variations, when
standard plasmid DNA and genomic DNA from
purified CMLV, respectively were tested. The assay
was rapid, specific and sensitive as that of SYBR
green and 1000 times more sensitive than the
conventional PCR. It is suitable for the detection of
CMLV nucleic acid directly from clinical samples.
The virus titre in terms of copy number for clinical
samples screened by this QPCR technique ranges
from 2.21x106 to 3.82x107 copies µl of extracted viral
genomic DNA. This is an improved technique over
the conventional and SYBR green rt-PCR methods
for the detection and quantitation of CMLV from skin
scabs.
Fig.12: C18L gene based TaqMan real time PCR for
camelpox. Linear regression curve of the rt-PCR assay
based on 10-fold serial dilutions of standard plasmid
DNA over 109 dilution range. The square of correlation
coefficient (R2) and the slope value (b) is also shown.
(e) Peste des petits ruminants virus (PPR)
(i) LAMP assay: LAMP assay for rapid detection ofPPR virus from clinical samples was standardized.
The assay is based on conserved region of 'N'gene
of PPR viruses with their specific amplification.
Hydroxy naphthaol blue (HNB) dye was used for a
colorimetric assay of the LAMP reaction, which inpositive reaction, turned sky blue. The primer of LAMP
was specific for PPR and not cross reactive with
rinderpest.
(f) Bluetongue
A sandwich ELISA (s-ELISA) was developed
for detection of BTV antigen in blood, tissue materials
2 2
and culture fluid. The assay was applied to test 2000
samples from sheep, goat, cattle, buffaloes and cell
culture supernatant.
(g) Classical swine fever
A total of 21 suspected CSF outbreaks in the
State of Uttar Pradesh were investigated,
epidemiological data and appropriate samples (136
tissues and 139 serum) were collected. Outbreaks
were recorded in small holdings (30-40 animals). The
mortality rate varied from 25 to 75% and the case
fatality rate was highest in young weaners. Alternate
primers were used to generate the complete E2 gene
sequence and based on the obtained sequence data,
the established primers were modified to increase
the sensitivity of the RT-PCR assay. From CSFV
confirmed cases, 5UTR, Erns, E2, NS5B and 3UTR
genes were amplified from samples collected from
16 different outbreaks and 20 clones were
sequenced. The E2 protein of recent CSFV isolates
of India (genotype 2.2) were analyzed along with 6
Chinese isolates (genotype 2 viruses) to assess
amino acid substitutions. The B-cell epitopes
including those that induce neutralizing antibodies,
T-cell epitopes and potential glycosilation sites that
may affect the conformation of the protein revealed
significant amino acid substitutions, which may
compromise the efficacy of the lapinized vaccine
strain used in India.
A total of 50 samples, including two positive
and 2 negative controls were tested with conventional
RT-PCR based on Pan-Pestivirus primers (V324 and
V326) and CSFV primers (UP-1 and UP-2). The 46
samples tested consisted of specimens from lymph
nodes showing CSF suspected lesions. The 5UTR-
L1R1 assay resulted in 43 CSFV positive samples,
5 negative and 2 doubtful reactions, whereas the
NS5B rtRT-PCR assay resulted in 25 positive, 21
negative and 4 doubtful reactions. Comparison of the
results obtained by the two in house developed rtRT-
PCRs revealed that 17 samples found negative by
NS5B rt-RT-PCR assay were positive in the 5'UTR-
L1R1 assay. Among the two in house developed rt-
RT-PCR assays, the 5'UTR-L1R1 assay was found
more sensitive than the NS5B rt-RT-PCR assay. A
real-time PCR assay using a probe specific for the
lapinized vaccine strain used in India was also
designed.
As an alternative to FAT, Fluorescent In Situ
Hybridization (FISH) assay was developed by
designing two oligoprobes specific for CSFV E2 and
CSFV NS5B genes. A total of 16 samples were tested
with FISH and 12 were found positive with both
probes. The results of FISH assay corroborated with
those obtained by RT-PCR (Fig.13). Further
confirmation of positive signals owing to probe
hybridization with CSFV genome was done by
confocal microscopy (Fig.14).
Fig.13: 63/A/11, DNANS5B, Ileum, 400X: Mononuclear
cells showing fluorescent signals in the intercryptic area.
Alexa -568 and DAPI broad band filter overlay.
Fig. 14: Confocal microscopy: NKP-4/11, DNAE2, Lymph
node, 1000X (2OPZ): (A) Cells stained for Cytoskeleton
with FITC labelled anti β-actin mouse MAbs showing
green fluorescence. (B) FISH with Alexa-568 to
demonstrate virus in the cytoplasm of mononuclear cells,
red fluorescence. (C) 2D image FITC, Alexa-568 and
DIC image. (D) 2D image FITC, Alexa-568. (Courtesy;
AIRF, Confocal Microscopy Unit, JNU, New Delhi).
(h) Canine parvovirus infection
(i) Development and standardization of PCR:Amplification of part of VP 2 gene of both CPV 2a
and CPV 2b variants (3025 -3706 nucleotide position
of CPV genomic DNA) was carried out to yield a
product size of 681 bp using pCPV 2ab primers.
The PCR positive samples were further analysed
using pCPV 2b primers for specific amplification of
VP2 gene unique to CPV-2b variants only (4043 to
4470 nucleotide position of CPV genomic DNA) to
yield a product size of 427 bp and rest of the samples
were considered as CPV 2a and thereby
differentiating CPV 2a and CPV 2b variants (Fig.15).
Another set of primer pCPV RT was used to yield an
2 3
amplicon of 160 bp (3176-3295 nucleotide position
of CPV genomic DNA) of all the variants of CPV-2
(2a/2b/2c). This set of primer can also be used in
SYBR Green based Real Time PCR technology for
sensitive, specific and accurate diagnosis of CPV-
2 variants and its quantitation.
Fig. 15: PCR amplifying 427 bp amplicons of CPV-2b
(ii) Development and standardization of nested
PCR : Nested PCR was developed and standardized
employing the in house designed and custom
synthesized primers (pCPV 2 N) after the first round
of PCR (681 bp) to yield an amplicon of 442 bp. It
can be used to detect all the variants of CPV-2 and
to further substantiate the result of PCR. It was found
100 times more sensitive than conventional PCR.
(iii) Development and standardization of PCR for
amplification of whole genomic DNA: PCR was
also developed and standardized employing the in
house designed and custom synthesized primers
to amplify entire VP1/VP2 gene (2.2 kbp) coding for
the structural proteins of CPV-2. The eluted PCR
product was cloned into a TOPO TA vector. The 2.2
kbp products were further characterized by digesting
the inserts with Pst I, Bgl II, Bam HI, Sal I,
respectively, to obtain the desirable product sizes.
(iv) Molecular characterization of CPV-2 isolates:
PCR was developed and standardized to amplify
the C terminal of VP2 gene of CPV-2 to obtain a
DNA product of 765 bp. The product was cloned and
nucleotide sequences and deduced amino acid
sequences were analysed. The amino acid residue
at position 426 of the VP2 protein of all the isolates
were carefully analysed, which formed the basis of
classification of the CPV-2 into 3 antigenic types-
CPV-2a, CPV-2b or CPV-2c. Out of 7, 4 isolates were
designated as CPV-2b types and 3 isolates were
designated as CPV-2a types. Three isolates PALAM-
5, PALAM-8 and PALAM-10 were found to match
with isolates from USA, Brazil and New CPV-2a isolate
from USA, respectively. Feline Panleucopenia virus
(FPV/USA/M38246) formed a separate clade distinct
from the CPV isolates.
(i) Canine distemper: PCR was standardized
employing in house designed and custom
synthesized primers for specific and sensitive
amplification of N gene coding for the nucleocapsid
protein of canine distemper virus. In positive cases
an amplicon of 184 bp was revealed. The same primer
can also be used in SYBR green based real time
PCR with a high degree of sensitivity and specificity
and added advantage of quantification of copy
number.
(j) Canine adenovirus: Multiplex PCR for the
detection and differentiation of CAV 1 and CAV 2.
Multiplex PCR using custom synthesized primers
standardized to amplify the genomic DNA of CAV-1
and CAV-2 in order to diagnose and differentiate
pathogens causing ICH and ICTB in the clinical
samples and vaccines. A total of 19 clinical samples
and 7 commercially available vaccines were tested,
of which 3 and 9 samples were found positive for
CAV-1 and CAV-2, whereas 4 vaccines were found
positive only for CAV-2 (Fig.16).
Fig.16: Amplification of 1030 bp DNA product of E 3
gene of CAV 2 and 508 bp DNA product of CAV 1
(k) Avian reovirus
To develop a diagnostic kit for ARV infection,
sigma C gene was used. The gene was amplified by
PCR and cloned in pTZ57R T/A cloning vector.
(l) Newcastle disease
To develop a diagnostic kit to detect and
differentiate NDV vaccine strain from the virulent
strain, the work on development of monoclonal
antibodies (Mabs) against the virulent strain of NDV
was initiated. Hybrid clones were generated using
spleenocytes from mice immunized with either E.
coli expressed recombinant protein/whole NDV
virulent strain UP1/97/peptide.
2 4
(m) Egg drop syndrome 76
One immunogenic gene (1.3 kb) of EDS76 was
successfully expressed in prokaryotic expression
system and confirmed by SDS-PAGE and Western
blot analysis. The expressed protein has been purified
in bulk concentration estimated (140 µg/ml).
(n) Infectious bronchitis
The circulation of different genotypes of avian
IBV viz. Massachusetts (M41) and 4/91(793B) UK
type in the poultry flocks of India was found and all
the field isolates were found virulent for young chicks
in their pathogenicity study. Real Time PCR was used
for early detection and quantitation of IB virus in
infected materials. The technique was able to detect
IBV nucleic acids in tracheal and lung tissues from
24 hrs post infection up to 30 dpi. The presence of
IBV was detected in kidneys at 3 dpi and caecal
tonsils from 7 dpi.
(2) BACTERIAL PATHOGENS
(a) Haemarrhagic septicaemia
(i) Analysis of outer membrane protein profilesof P. multocida isolates: A comparative OMPs/IROMPs profile revealed the presence of protein
bands in the range of ~18 kDa to ~130 kDa (Fig.17).
OmpH and OmpA proteins were observed between
34 kDa and 42 kDa. Omp16 (16 kDa) was commonly
observed among all the isolates. Higher order
molecular weight proteins (~72-130 kDa) were
observed more prominently in IROMPs grown under
iron deplete conditions. Iron regulated proteins such
as transferring binding protein (TbpA ~103 kDa),
haemin binding protein (HemR ~102 kDa) and
haemoglobin binding protein (HgbA ~126 kDa) were
noticed prominently in most of the isolates. The
results also indicated the variable protein pattern
among animal and avian isolates, which reflected
variation in their pathogenesis of various disease
manifestations. Currently, further identification and
characterization of individual OMPs and genes
encoding them are underway.
Fig.17. A comparative outer membrane protein profile
of different avian isolates of P. multocida following growth
in iron deplete and replete in vitro conditions
(ii) Cloning, expression and purification of fimbrial
subunit and transferrin binding proteins: Based
on the bioinformatics analysis of available complete
genome sequence of P. multocida strain Pm70,
putative genes encoding of different outer membrane
proteins (OMPs) were identified. The specific primers
targeting the candidate genes (ptfA and tbpA) were
designed and respective fragments were amplified
by PCR (Fig.18 Panel A). Following confirmation of
gene insertion in pET32a vector, transformation was
done in to E. coli expression host (BL21-DE3 codon
cells).
Fig.18. ptfA gene amplification (panel A); expression of
recombinant fimbrial protein (panel B); Immunoblot of
purified recombinant fimbrial subunit protein (panel C).
The purified proteins were analysed qualitatively and
quantitatively; and confirmed by Westernblotting using
hyperimmune sera raised against P. multocida
serogroup B:2 (Fig.18. panel C).
(iii) A homology model of fimbrial subunit protein
of P. multocida serogroup B:2: A homology model
for fimbrial subunit protein of P. multocida serogroup
B:2 (strain p52), an Indian HS vaccine strain has
been predicted using SWISS-MODEL (Fig.19) and
its characteristics were analysed in comparison to
fimbrial proteins of other bacteria.
Fig.19: A homology model of fimbrial subunit protein
of P. multocida serogroup B:2 (strain p52).
The model and secondary structure predictions
revealed the presence of N-terminus long stretch of
hydrophobic α-helix region (α1) followed by four β-
strand regions (β1, β2, β3 and β4) at carboxyl
terminus. The three-dimensional model revealed N-
terminal α-helix wrapped by anti-parallel β-strands in
2 5
a characteristic topology of β1β2β3β4, indicating its
belonging to the type IVa subclass of fimbriae. The
disulfide bond between second pair of cysteine
residues (131 and143 aa) links the last strand β- sheet
to a peripheral C-terminal region to form a receptor
binding loop. The predicted homology model of
fimbriae from P. multocida serogroup B2 (strain p52)
support the conserved architecture of type IV pilins.
(b) Salmonellosis
A loop mediated isothermal amplification
(LAMP) test was standardized for specific detection
of Salmonella enterica subsp. enterica serovar
Typhimurium. A set of LAMP primers were designed.
The LAMP test was optimized by testing at different
time and temperature ranging from 20 to 70 min and
60 ºC to 70ºC. The LAMP performed at different DNA
concentrations (100 ng/µl to 1 fg/µl) revealed that
the test detected 1 pg/µl of target DNA. LAMP test
was found 10 times more sensitive than PCR. The
test was found to specific on testing with 8 different
isolates of non-Salmonella and 20 serovars of non-
Typhimurium Salmonella. Moreover, 35 isolates of
Salmonella Typhimurium collected from different
sources gave positive reaction indicating test to be
specific for the detection of Salmonella serovar.
(c) Johne's disease
For development of more sensitive and specific
ELISA basd test for detection of antibodies from
paratuberculosis infected animals, epitopic regions
from M. a. paratuberculosis (Map) coding sequences
were selected and expressed in E. coli as single as
well as multiantigenic polyproteins. Chekerboard
titration of proteins in indirect ELISA revealed that
40 ng of the recombinant polyproteins detectewd the
antibody consistently. Further the indirect ELISA was
standardized using recombinant single, polyproteins
as well as MAP culture filtrate (CF) as coating
antigens. The result indicated using sera from Map
infected cattles that multiantigenic proteins were
sensitive than the single protein.
Sera from 42 Johnin PPD positive cattle were
screened with ELISA, 18 were found positive for the
presence of Map specific antibodies using
recombinant polyproteins. However, only 8 were found
positive with the single protein. Sera samples from
175 goats were collected from slaughter houses and
32 samples were found positive for paratuberculosis
using polyproteins.
(d) Listeriosis
The study was carried out to develop and
evaluate internalin C (InlC)-based serological assay,
for diagnosis of Listeria monocytogenes (LM) infection
in goats. Nine peptides representing major antigenic
domains of InlC, a novel protein thought to be linked
to the virulence of LM, were identified, analyzed,
synthesized and employed in indirect ELISA in order
to evaluate their diagnostic potential by testing
against goat sera from experimental animals
inoculated with live and killed strain of LM as well as
the apparently healthy goats. The standardized ELISA
revealed titers of antibodies against InlC (AInlC) as
well as listeriolysin O (ALLO), even after adsorption
of sera with streptolysin O (SLO). In general, the
overall AInlC titres were found to be lower than ALLO
titres. A fair correlation was observed between the
titres of AInlC and ALLO in experimentally infected
as well as apparently healthy goats.
(e) Leptospirosis
The recombinant M15 cells of E coli containing
the N terminal conserved region of LigA and Lig B
gene in pQE expression vector were confirmed by
colony PCR and RE digestion of the pQE vector using
SacI and HindIII enzymes. On SDS-PAGE analysis,
LigB protein appeared as a thick band at the expected
size of 46 KDa.
The protein was purified (Fig.20) and rLigB
protein was tagged with sensitised latex beads. Latex
agglutination test was standardized for diagnosis of
leptospirosis.
Fig.20: SDS PAGE of LigB protein
Dot Blot and Western blot analysis using known
positive and negative bovine and canine sera samples
confirmed that rLigB protein is an immunodominant
protein against which antibodies are produced in host
during active infection and anti LigB antibodies are
present in sera of infected animals in sufficient
quantity.
2 6
(3) PARASITIC DISEASES
(a) Haemonchosis
Dot ELISA kit developed for diagnosis of H.
contortus infection was tested with experimental and
naturally infected sera. Out of 250 sera samples of
naturally infected sheep and goats, 175 sera samples
were found positive for H. contortus infection. The
kit was also validated by the collaborating centres
viz. Pantnagar, Chennai, Gangtok, Kolkata with high
sensitivity and specificity.
(b) Toxocariosis
Somatic soluble antigen of adult T. canis (Tc
SA) and excretory-secretory antigens of T. canis (Tc
ES) were separated and fractionated in reducing
condition using sodium dodecyl sulphate
electrophoresis. Tc SA antigen revealed 14
polypeptide bands of molecular moieties ranging from
44 to 300 kDa, while Tc ES antigen revealed 9
prominent bands ranging from 30 to 384 kDa.
The specific immuno-reactivity of the T. canis
somatic and excretory-secretory antigens with
naturally infected dog sera as well as hyperimmune
sera raised in rabbits was tested by Western blotting.
The immuno-dominant polypeptides of TcSA reactive
to T.canis infected dog serum were observed at
approximately 26 to 198 kDa regions, showing 12
prominent immuno-reactive bands of distinct sizes
at 23.8, 28.61, 32.60, 38.10, 43.04, 49.99, 73.22,
101.77, 144.74, 161.11, 177.84 and 196.31 kDa, while
those of TcES showed 5 bands of 43, 57,105,139,175
kDa.
The immuno-dominant polypeptides reactive
to anti-sera raised in rabbits against TcSA were
observed at approximately 11 to 250 kDa regions,
showing 8 prominent bands of distinct sizes at 34.83,
43.46, 52.47, 55.89, 61.80, 70, 74.60 and 107.06 kDa,
while those for TcES showed 10 bands of 21, 25, 30,
37, 45, 50, 57, 69. 77, 105 kDa.
(c) Oesophagostomum and Bunostomum
infection
Gene encoding a 31 kDa protein was identified
using primers (F-5'-ATGTCTCGTTTACTCAACGTG-
3',R-5'-TGAGGTGCTGAGAAGATAGTC -3') and
about 90% of the whole protein coding sequence of
the gene (720 bp) was successfully amplified from
cDNA of Oesophagostomum spp. parasite (O.
dentatum and O aspersum) of sheep and goat origin.
Analysis of sequences revealed that 8.33%,
7.77% and 6.94% variability was found between O.
dentatum/ O. columbianum, O. dentatum/O.
aspersum and O. columbianum/O. aspersum,
respectively. Transition and transversion ratio
between Oesophagostomum parasite of pig (O.
dentatum) and sheep and goat (O. coulmbianum and
O. aspersumi) was found to be 4.26. Phylogenetic
analysis revealed that oesophagostomum parasite
of sheep and goat was distinctly related with the
same parasite of pig origin.
(d) Toxoplasmosis
(i) Evaluation of serodiagnostic potential of
recombinant surface antigen 1 (SAG1) based
ELISA : A total number of 447 serum samples were
collected from sheep from Ranchi and Chatra districts
of Jharkhand for studies on seroprevalence of
toxoplasmosis using a laboratory standardized
recombinant SAG1 protein based ELISA. The sheep
sera samples collected from Chatra (n= 187) included
two breeds Muzaffarnagari (78 samples) and
Shahabadi (109 samples). A total of 148 samples
were collected from RVC farm, Ranchi maintaining
Chhotanagpuri breed and 112 samples from village
conditions from the same breed of sheep. The
performance of rSAG1 ELISA was compared with
that of native tachyzoite lysate antigen based ELISA.
Out of 447 samples 42.34% were positive by rSAG1
antigen based ELISA and 29.5% were positive with
native tachyzoites lysate antigen ELISA. A positive
correlation in the prevalence of toxoplasmosis was
established with the age of the sheep studied as
infection was higher in sheep aged more than 24
months.
Further, a total number of 411 goat sera
samples were collected from the Kumaon region. The
rSAG1 based ELISA could detect Toxoplasma
specific IgGs in 17.27% of sera samples.
(4) BIOSENSORS FOR PATHOGENS AND
DRUG RESIDUES
(a) Characterization and application of gold
nanoparticles for detection
Gold nanoparticles were synthesized from
aqueous auric chloride (HAuCl4) in presence of citrate
reducing agent under controlled conditions.
The synthesized gold NPs were characterized
for size by TEM, zeta potential and particle sizing by
Dynamic light scattering. Particles of size 17-20 nm
were observed on TEM and potential of particles were
found in the range of 35- 40 mv, which is suitable for
its stability and in-vivo applications.
(b) Lateral flow strip development for
ciprofloxacin
2 7
Ciprofloxacin-BSA protein conjugate and
ciprofloxacin-KLH conjugate were prepared to put a
test line of heptane's molecule for detection of
ciprofloxacin, a small molecule under inhibition assay
format. Conjugate of Ciprofloxacin with protein BSA
and KLH were done using EDC-NHS crosslinking
chemistries under optimum condition and optimized
for good yield of conjugates. Goat antimouse IgG
was used as control line of nitrocellulose membrane
strip. After formation of conjugate, it is preserved in
solution made of BSA, PEG, NAN3, NaCl and Tris-
HCl. The ciprofloxacin was detected on lateral flow
strip under competitive inhibition assay format.
Appearance of single line was confirmation of
presence of ciprofloxacin in sample. Detection limit
as low as 10 ng/ml was found.
(c) Characterization of magnetic nanoparticles
(MNPs) and its applications
The MNPs were conjugated to FITC through
strong covalent carboxydiimide chemistry taking into
account their in-vivo biomedical applications as
delivery vehicles and carrier of therapeutic agent.
(d) Development of surface plasmon resonance
biosensor surfaces for PPR monoclonal
antibodies
PPR 4G6 monoclonal antibody was covalently
coupled to 6-Ethylene glycol carboxy hexadecane
thiol self assembled monolayer through amine
coupling procedure over surface plasmon sensor
system. Chip showed a strong immobilization of 4G6
with 1000 RU, which is considered sufficient for
development of assay as shown in Fig.21.
Subsequently, this surface was checked for
sensitivity against 4H4 PPR monoclonal. This surface
is suitable to detect PPR antigen directly.
Fig.21: SPR sensorgram showing the amine coupling
procedure for immobilization of 4G6 PPR antibody over
6-Ethylene glycol carboxy hexadecane thiol surface.
(5) CANCER BIOMARKERS
(a) Matrix metalloproteases as biomarkers for
canine mammary tumour: Matrix metalloproteases
(MMP) were screened as biomarker, which is
essential for screening, diagnosis and prognosis of
dog mammary cancer. Stromelysin (MMP-11) was
chosen for cloning and expression to study its role
as antigen for immunotherapy of cancer. RNA was
collected from dog mammary tumour tissue and cDNA
was synthesized from it. MMP11 gene was amplified
using this cDNA as template and it was cloned in
eukaryotic expression vector PVAX-1. Transfection
of MDCK cell was done and expression of cloned
gene in MDCK cells was confirmed by Western blot
using human MMP-11 antibody.
(6) BOVINE MASTITIS
Attempts were made to develop molecular
diagnostics for pathogen detection and detection of
pro-inflammatory cytokines. For pathogen detection
three bacterial species at genus level
(Staphylococcus spp, Sreptococcus spp and E.coli)
were targeted. DNA isolation method directly from
milk and developed multiplex PCR to detect the
pathogen using internal control. For developing
diagnostic test based on host response to the
pathogen invasion. Specific biomarkers were targeted
and developed liquid phase blocking ELISA. The
method was further studied to make a pen-side test
using latex beads. To develop biochip based
detection of pathogen in mastitic milk, primers and
probes corresponding to genus-specific sequences
of S. aureus, Streptococcus spp., and E. coli and
virulence genes of the respective pathogens were
designed and used for immobilization on solid
surface. Four-tube multiplex PCR was carried out
using biotinylated reverse primers. The amplified
products were subjected for hybridization with the
dot-blotted probes on nylon membrane and detected
using avidin-alkaline phosphatase system. The
positive reactions correlated with the gel-based
detection of amplified products.
(7) MARKERS FOR SEX IDENTIFICATION OF
GYPS VULTURES
Chromohelicase DNA binding gene specific
test based on W-specific and ZW-common primer
combinations was assessed and was found to be an
accurate and reliable method for sexing Gyps indicus
and Gyps bengalensis vultures at VCBC, Pinjore,
greatly aiding future work and breeding programme
with these species (Working Manual on Conservation
Breeding of vultures, www.cza.nic.in).
2 8
3. PRODUCTION AND STANDARDIZA-
TION OF VETERINARY BIOLOGICALS
(1) PRODUCTION OF VACCINES,
DIAGNOSTICS AND KITS
The immunobiologicals produced and supplied
are given in Table 1.
Table 1: Immunobiologicals produced and
supplied by institute
Sl. Product Production
No. (Quantity)
A. VIRAL VACCINES
1. Cell culture sheep pox 9,66,000 doses
vaccine
2. RD vaccine (R2B strain) 3,200 doses
3. RD vaccine 'F' strain 1,59,000 doses
4. Fowl pox vaccine 4,200 doses
5. Lapinized swine fever vaccine 3,52,565 doses
6. PPR vaccine 79,86,100 doses
B. BACTERIAL VACCINES
7. HS oil adjuvant vaccine 6,000 ml
8. Enterotoxaemia vaccine 1,000 doses
9. Brucella abortus strain-19 59,983 doses
vaccine 59,983 doses
C. DIAGNOSTICS
10.Tuberculin PPD 79,290 doses
11. Mallein PPD 27,500 doses
12. Johnin PPD 44,120 doses
13. Brucella abortus plain (SAT) 98,000 ml
antigen
14. Brucella abortus Bang ring 6,7240 ml
antigen
15. Rose Bengal plate test antigen22,620 ml
16. Brucella abortus positive 86 ml
serum
17. Salmonella Pullorum plain 3,000 ml
antigen
18. Salmonella Pullorum coloured 4,560 ml
antigen
19. Salmonella Pullorum positive 7 ml
serum
20. Salmonella Abortus equi 'H' 2,000 ml
antigen
(b) Production and supply of FMD vaccine
A total of 6.87 million monovalent doses of
FMD vaccine comprising of 1.44 million doses of type
O, 3.43 million doses of type A and 2.0 million doses
of type Asia-1 were produced.
(c) Pox vaccines
A total of 500 doses each of orf and sheeppox
and 200 doses of goatpox with PPR combined
vaccines, respectively, have been field evaluated in
Tamil Nadu and Karnataka states and no adverse
reactions were reported. Further, a total of 800 doses
of goatpox vaccine have been supplied to field
conditions on cost basis.
(d) PPR vaccine and diagnostics
i) A total of 2.0 lakh doses of PPR vaccine were
produced.
ii) 43 PPR c-ELISA and 04 PPR s-ELISA kits were
produced and supplied.
(e) Bluetongue diagnostics
About 2.7 g recombinant VP7 protein was
prepared, from which 180 vials were made each
containing 15 µg of freeze-dried rVP7. Indirect ELISA
kit was supplied to two centres.
(2) QUALITY CONTROL AND QUALITY
ASSURANCE
(a) Foot and mouth disease vaccine
Four FMD vaccine (trivalent) referred samples
from DADF were evaluated for their quality testing
which included sterility, safety and estimation of
FMDV antibodies.
(b) Standardization and quality control of
veterinary immunodiagnostic antigens and
antisera
Standardization and quality control of the
immunodiagnostic antigens and antisera were done
for a total of 34 batches (Table 2), which included
mostly the B. P. Division - IVRI products and two
experimental batches of VBRI - Hyderabad products.
All the products passed were of satisfactory in quality.
Further, development of suitable SOPs for testing
veterinary immunodiagnostic antigens and antisera
in Indian Pharmacopoeia are under progress.
Table - 2: Details of immunodiagnostics tested during 2011-12
Sl. No. Name of antigens/antisera Production unit No. of batches tested
1. B. abortus RBPT antigen BP. Div. - IVRI 11
2. B. abortus RBPT antigen VBRI - Hyd. 1
3. B. abortus Plain antigen BP. Div. - IVRI 7
4. B. abortus ABR antigen -do- 7
5. B. abortus positive serum -do- 1
6. S. Pullorum plain antigen -do- 1
2 9
7. S. Pullorum coloured antigen -do- 2
8. S Pullorum coloured antigen VBRI - Hyd. 1
9. Mallein PPD -do- 1
10. Johnin PPD -do- 1
11. Bovine Tuberculin PPD -do- 1
Total = 34
(c) Standardization and quality control of veterinary vaccines
As a part of quality assurance programme, standardization and quality control of veterinary vaccines were
carried out for a total of 68 batches. These included 26 bacterial vaccines and 42 viral vaccines, from different
production units as detailed in Table 3.
Table 3: Bacterial and Viral vaccines tested during 2011-12
Sl. Name of vaccine Bacterial/ Production No. of
No. Viral unit batches
1 HS vaccine Bacterial BP Div., IVRI 1
2 Brucella abortus vaccine (Living) strain 19 Bacterial BP Div., IVRI 5
3 ET vaccine Bacterial BP Div., IVRI 1
4 HS BQ combined vaccine Bacterial Animal Husbandry 15
Dept, Bihar
5 HS vaccine (Alum ppt) Bacterial Punjab Vet. Vaccine 1
Inst., Ludhiana
6 Brucella abortus vaccine (Living) strain 19 Bacterial Drug Cont.Gen (India) 3
Indian Immunologicals
7 NDV live vaccine Viral Globion India Pvt. Ltd.,1
Lentogenic Lasota strain Hyderabad
8 NDV live vaccine Viral Ventri Biologcals, 2
(B-1 strain and Lasota strain) Pune
9 Sheep pox vaccine Viral Regional Vet. 1
Biological Unit, Jamdoli,
Jaipur
10 PPR cell culture vaccine Viral BP Division, IVRI 25
11 Rabies vaccine (experimental batches) Viral BP Division, IVRI 2
12 Rabies vaccine Viral Brilliant Bio Pharma 2
Ltd. Medak, (AP)
13 Lapinized swine fever vaccine Viral BP Division, IVRI 9
Total 68
(d) Veterinary type cultures
A total of 76 bacteria and 11 viral cultures were supplied on demand to various stakeholders.
Table 4: Cultures supplied during 2011-12
Sl. Culture No. of ampoules/vials/slant
No. supplied
1 Bacillus anthracis 4
2 Brucella abortus strain 19 2
3 Brucella abortus strain 99 2
4 Brucella abortus strain 544 2
5 Brucella melitensis 4
6 Brucella suis 1
7 Clostridium chouvoei-49 15
8 Clostridium septicum-51 11
9 Clostridium perfringenes type B 1
10 Clostridium perfringenes type C 1
11 Clostridium perfringenes type D 3
3 0
12 Pasteurella multocida p-52 25
13 Pasteurella multocida Fowl 3
cholera vaccine strain
14 Anti Brucella abortus serum 2
15 Rabies virus CVS 1
16 Fowl pox virulent 3
17 Fowl pox virus vaccine 2
18 Ranikhet disease vaccine strain F 3
19 Ranikhet disease vaccine strain R2B 2
(e) Standard reagents for use in standardizationof enterotoxaemia vaccines
Clostridium perfringens type D was revived and
cultured. ε protoxin produced was trypsinized and itstoxic activity was detected to be 1500 mld/ml in mice.
The crude culture filtrate toxin was validated as
epsilon toxin by neutralization test with WHO standard
epsilon antitoxin. It was found that 300 MLD of epsilon
toxin was neutralized by 2 IU of epsilon antitoxin.
Epsilon toxin was freeze dried so that each ampoule
contains 900 MLD of toxin. It was reconstituted in
desired volume of 3 ml to get 300 MLD/ml and then
checked for toxic activity and neutralizing activity.
The freeze dried toxin after reconstitution retained
the toxic activity (30 MLD: death within 30-45 min I/
V and 1.5-2 hrs I/P) and neutralization activity with
antitoxin. Keeping quality of the reconstituted toxin
at different temperature was also determined and it
was found that the keeping quality of reconstituted
toxin at -20°C and 4°C is less than one month. Toxoid
was prepared and was used for repeated immunization
of goat at 14 days interval to raise ε antitoxin. Theseveral collects of sera were pooled and anti epsilon
titer of the pooled serum was determined in terms of
IU/ml, in comparison with the WHO Standard (1 IU =
quantity of antitoxin capable of neutralizing 150 MLD
of toxin) and was found to be 52 IU/ml. Anti-epsilon
toxin was lyophilized in vials in 1 ml amount containing
52 IU antitoxin titer and stored at -20ºC. In house
validation of finished lots were done by reconstituting
the freeze dried preparation in desired volume of
normal saline and subjecting to mice neutralization
test in comparison to WHO standard. It was found
that 2 IU of WHO and test standards of antitoxin
results in 100% neutralization of toxin. For quality
control, one batch of Enterotoxaemia vaccine was
prepared in laboratory and was tested for potency
using both WHO and the laboratory developed
standard preparations. The ET vaccine batch was
found to be potent having anti epsilon titer > 2 IU/ml.
1. One batch of standard freeze dried preparation
of Cl. perfringens epsilon toxin. One ampoule
contains 900 MLD, which is sufficient to test one
batch of ET vaccine.
a. 300 MLD for standard antitoxin control
b. 300 MLD for test vaccinated serum and
c. 300 MLD as toxin control
2. One batch of standard freeze dried preparation
of Cl. perfringens epsilon antitoxin containing 52
IU, which is sufficient to test 26 batches of
Enterotoxaemia vaccine.
These standards are required for the quality
control of Enterotoxaemia vaccines and were not
available in India.
(f) Standardization of PCRs for detection of
extraneous agents
The PCR was standardized for nucleic acid
detection of extraneous agents like BVDV-I, BVDV-
II, PCV-1, PCV-2, and Parvovirus in viral vaccines.
Duplex PCR was standardized for detection of
Pestivirus and Mycoplasma in a single reaction.
Similarly duplex PCR was also standardized for
detection of Mycoplasma and Porcine circovirus-1
(PCV-1) and Mycoplasma and Parvovirus genome.
All the PCRs can be used for screening of animal
derived products used for production of live viral
vaccine.
4. MOLECULAR CHARACTERIZATION
OF PATHOGENS AND HOST-
PATHOGEN INTERACTION
(1) VIRAL PATHOGENS
(a) Animal pox viruses
i) Genetic characterization of Indian orf virusisolates based on A32L gene: The comparative
sequence analysis of Indian field isolates of ORFV
(n=13) based on full length A32L gene sequences
was carried out along with those of parapoxviruses
available in the GenBank database. Multiple
sequence analysis has revealed high nt and aa
identity among Indian isolates of ORFV from sheep
and goat belonging to different regions. They shared
97.7-99.9% and 97.8-99.6% sequence identity among
themselves at the nt and aa level, respectively.
Sequence analysis of the nt and deduced aa of the
Indian ORFV isolates shared relationship with other
ORFV isolates from different regions (93.8-99.6% and
95.5-96.6%), and shared the highest homology with
ORFV-SA00 and ORFV-Nan from USA and Taiwan
(98.4-99.6% and 98.2-99.6%). However, ORFV-Pal
isolate showed identity with other Indian ORFV of
97.7-99.3% and 98.2-98.9% at nt and aa level,
3 1
respectively. The results of phylogenetic analysis
based nucleotide sequences revealed two major
clusters, which included all 13 Indian orf isolates along
with two foreign isolates (ORFV-SA00 and ORFV-
Nan) forming a Cluster-1, and rest of foreign isolates
were grouped into a Cluster-2. The study indicated
that Indian orf viruses obtained from small ruminants
were phylogenetically closely related to other orf
viruses reported globally, however, carboxyl terminal
heterogeneity could be potentially used for strain
differentiation.
ii) Comparative multiple sequence alignment
analysis of animal pox viral ATPase motifs: Multiple
alignments of ATPase sequences from different
animal poxviruses including Indian animal poxviruses
available in the GenBank database were done using
MegAlign (DNASTAR). Poxviral ATPase motifs
alignment (Fig. 22) indicated the presence of highly
conserved four conventional functional motifs (motifs
I-IV) and which included Walker A, Walker B and two
motifs (III and IV) belonging to A32L specific regions,
respectively (Fig. 22). Another AYDG motif-V was
also found to be conserved among all the pox viruses
(Fig. 22). By sequence comparison, certain amino
acid substitutions in various motifs without affecting
the critical functional residues were observed. These
variations were similar in most of respective members
of genus. Furthermore, it was observed that all the
poxvirus ATPases bore a highly conserved arginine
(R) at the beginning of motif-III, equivalent to
identically positioned arginine fingers in HerA/FtsK
ATPases and sensor-1 residue (Q) at the C-terminus
of motif-III.
Fig. 22: Multiple sequence alignment of animal
poxviruses ATPase proteins functional motifs.
On the basis of conserved ATPase functional
motifs among poxviruses, it is presumed that all the
poxvirus ATPases form a similar structure of the core
ATPase domain as described, involving a common
mechanism of viral DNA packaging and probably had
evolved from a common ancestor. The best
conserved ATPase domain followed by A32L specific
motif among poxviruses could potentially be used
as signature region of the family for diagnostic
purpose.
iii) A homology model of Indian orf viral A32L gene
encoded ATPase domain/motifs: A consensus A32L
gene region of Indian ORFV was analysed using
various protein prediction programs such as ExPASy,
JpredV3, Phyre and PSIPRED for secondary structure
as well as characterization. An automated homology
model of A32L was done using SWISS-MODEL and
the functional motifs of ATPase were identified. The
consensus ATPase protein sequence of Indian ORFV
with distinct functional motifs as well as predicted
homology model using SWISS-MODEL is depicted in
Fig. 23. The secondary structure predictions revealed
the presence of four β-strands (β1, β2 with substrandβ2.1, β3 and β4) and three α-helices (α1, α2 and α3)in A32L encoded ATPase especially in the N-terminus
(aa16-aa141). The first conserved block in A32L
ATPase include the Walker A (motif-I), which
encompasses the first β-strand, the P-loop and thefollowing helix (α1). The Walker B (motif-II) definedthe second conserved block with third β-strand (β3).The third conserved motif-III, a part of A32L specific
region includes a run of bulky hydrophobic amino acids,
forming a beta-strand (β4) followed by a highlyconserved polar amino acid (Q) at the C-terminus and
the distinct helix (α3) with a highly conserved argininethat precedes this strand (Fig. 23). Another motif-V is
mapped between second strand (β2) and its shortsubstrand (β2.1). In the three-dimensional (3D)homology structure of A32L, β-strand 4 (β4), ispositioned in between the Walker A and Walker B
strands (Fig. 23). The predicted structure indicate the
expected strand (β1)-helix (α1, α2)-strand (β3)structure, which makes a P-loop and Mg2+ binding
pocket. The conserved core of the HerA/FtsK
superfamily is a seven-stranded β-sheet with a7615423 topology. The current homology model also
confirmed the presence of requisite DNA binding motifs
in A32L gene encoded ATPases of orf viruses.
Fig. 23: A homology model of Indian orf viral ATPase
protein with functional motifs.
3 2
b) Rotavirus
i) Sequence analysis of NSP4 gene: A total of 15NSP4 genes of bovine RVA from different regions of
India were sequenced and showed most common
genotype E2, except two isolates, P9 and P-BC, from
Pantnagar (UKD), which showed E1 genotype, which
is more common in humans. Phylogenetic tree
constructed within isolates of present study,
distributed all the isolates in a single E2 cluster, while
P-BC and P9 isolates of E1 genotypes formed a
separate E1 cluster (Fig. 24). With bovine isolates,
these two isolates showed a low identity both at
nucleotide level (<80%) as well as amino acid level
(<86%), while the human isolates showed a very high
identity both at nucleotide level (>99% with the isolate
R1949 from France) as well as at amino acid level
(>99% with the isolate R1949 from France).
Fig. 24: Phylogram indicating the genetic relationship
of the NSP4 gene of different isolates from different
regions of the country. Significant Bootstrap values (1000
replicates) above 70 are indicated at each branch nodes.
The length of the horizontal bar indicates the number of
nucleotide substations per site.
ii) Sequence analysis of VP7 gene: Phylogeneticanalysis of VP7 gene sequences from the 15 bovine
RVA isolates (Fig. 25) showed that G3 isolates formed
a single cluster, while G6 isolates formed another
single cluster. Three isolates with G1, G8 and G9
genotypes formed individual clusters. Phylograms
constructed for the 15 isolates of this study with other
Indian and world isolates depicted that G1 (BR-91)
and G9 (WB-H2) isolates were clustering with human
G1 and G9 isolates, respectively, while all other
isolates with common bovine type G types clustered
within the respective clusters i.e. G3 with bovine G3,
G6 with bovine G6 and G8 with bovine G8,
respectively. The G1 and G9 bovine RVA isolates (BR-
91 and WB-H2) showed an identity of 95% at nucleotide
and amino acid level with corresponding human G1
and G9 isolates, respectively. These showed lower
identity of <85% both at nucleotide level and amino
acid level with the bovine isolates. One isolate, BE-
3 with G6 genotype formed a different sub-cluster
within the G6 cluster, in the phylogenetic tree
constructed for these isolates. This BE-3 also formed
a totally different sub-cluster within the G6 cluster in
the phylogenetic tree constructed with the world
isolates. Analysis of this isolate (BE-3) at amino acid
level with other two G6 isolates of this study, BR-
111 and WB-H6, revealed amino acid variations at
17 positions.
Fig. 25: Phylogram indicating the genetic relationship
of the VP7 gene of different isolates from different regions
of the country. Significant Bootstrap values (1000
replicates) above 70 are indicated at each branch nodes.
The length of the horizontal bar indicates the number of
nucleotide substations per site.
The results confirmed a changing pattern of
circulation of bovine RVA in India. The sequence
analysis of bovine RVA isolates indicates possible
inter-species re-assortment events. These findings
suggest that interspecies transmission and
reassortment events between RVs can occur in
nature.
(iii) G and P typing of human and animal isolates:Molecular characterization of the 86 human rotavirus
isolates showed only 47 and 55 isolates typable by
VP7 (G) and VP4 (P) gene based typing, respectively.
G1 and G2 (18 each) were the most prominent G
type in children from North India, followed by G9 (5),
G4 (4) and G12 (2). P typing revealed P[6] to be the
most prominent type (37), with P[4] (12) and P[8] (6)
also being detected.
VP7 gene based typing of the bovine rotavirus
isolates revealed G6 (64.7%) to be the most prevalent
followed by G3 (17.6%), G8 (11.8%) and G10 (5.89%).
Among the P genotypes, P[11] was the most
common, accounting for 92.3% of the 13 typable
bovine rotavirus isolates, with rest of the isolates
being P[3] (7.7%). G6P[11] was the most prevalent
3 3
genotype combination encountered, with G8P[11],
G10P[11], G3P[11] and G3P[3] being the others.
Molecular characterization of the goat kid isolates
revealed G8 and P[14] genotype. Nearly 17 human
and bovine rotavirus sequences for VP7, VP4, NSP1,
NSP2, NSP3, NSP4 and NSP5 genes have been
submitted to the NCBI gene bank.
d) Bluetongue virus:
i) Sequence analysis of segment-2 (VP2 gene):The ORF (VP2 gene) length in all the isolates was
found to be 2874 bp and 5'-GTTAAA and ACTTAC-3'
sequences were seen in the 5' and 3' termini
respectively beyond the ORF region. BLAST analysis
of full length segment-2 of each isolate showed 96%
identity at nucleotide level with other BTV 23 segment-
2 sequences available in GenBank. This indicates
that all BTV isolates studied in this work belong to
BTV 23 serotype and earlier designated BTV 18
namely, Parbhani and Srinagar isolates are now
confirmed as BTV 23.
e) Classical swine fever virus (CSFV)
Characterization of CSFV adapted to
heterologous cell lines viz. Madin-Darby Canine
Kidney (MDCK) and Rabbit Kidney (RK-13) was
carried out. Investigations included, serial passaging
of virus in respective cell lines, type of cytopathic
effect (CPE) produced, titre of the virus, antigenic
reactivity against monoclonal antibody (MAb), cloning,
sequencing and analysis of sequence data. Findings
indicated that the virus adapted in MDCK cell lines
exhibited cytopathic effect but not in RK-13). The
virus identity was confirmed in both the cell lines by
amplification of 5'UTR, E2 and NS5B genes in PCR
and positive signal of immunoperoxidase test (IPT)
using MAb against E2 gene. In case of MDCK
passaged virus, 5'UTR and E2 were detected in all
the passages with no or minor change; whereas,
NS5B gene could be detected up to passage 12 only
with 30% divergence between passages (Fig.26).
Fig. 26: Gene-wise characterization of RK-13 and MDCK
adapted CSFV.
a & d: CSFV 5' UTR (151 bp) based amplification in all
representative passages.
b & e: CSFV E2 (173 bp) based amplification in all
representative passages.
c & f : CSFV NS5B (449 bp) based amplification in all
representative passages.
M: 100 bp DNA ladder plus Marker MBI, Fermentas)
NTC: Non template control.
Phylogenetic analysis based on 5UTR, E2 and
NS5B genes of recent CSFV isolates revealed that
genotype 2.2 viruses are circulating in Madhya
Pradesh, Uttar Pradesh, West Bengal, Haryana,
Assam, Meghalaya, Mizoram and Kerala. Two Indian
isolates from the northeast detected during 2002 and
2006, belonged to genotype 2.1. The CSF 40-02 was
the first Indian isolate of genotype 2.2 detected in a
northeastern state during 2002. Subsequently, from
2006 onwards, genotype 2.2 viruses were detected
in other states in the north, central and southern India.
The new emerging genotype 2 has been detected in
wild hogs of Assam and West Bengal also and they
were closely related to viruses circulating in China
(GXW02) and Taiwan (0406/CH/01/TWN). Map
showing distribution of genotype 2 viruses in different
states of the country are depicted in Fig. 27.
Fig. 27: Map depicting distribution CSFV genotype 2
viruses in India.
Molecular characterization of classical swine
fever challenge virus by partial sequencing of E2, 5
NTR and NS5B genes and its comparison with other
reference strains revealed that the challenge virus
belongs to group 1.1. Phylogenetic studies also
revealed that the challenge virus is very similar to
one of the world reference virulent strain, i.e., Brescia
strain, which is also used as challenge virus for
potency resting of swine fever vaccines.
f) Canine parvovirus
Primer sets were designed to amplify the part
of the VP2 gene of CPV to yield a product of N
terminal part of the VP2 gene to yield a product of
990 bp and C terminal part of the VP2 gene of CPV
3 4
to yield a product of 765 bp. The C terminal part of
the VP2 gene of CPV-2 of 7 isolates were amplified
(765 bp), sequenced and the nucleotide and amino
acid sequences were analysed. Four isolates
(PALAM-1, PALAM-5, PALAM-8 and PALAM-10)
having Aspartate at the 426 position were
designated as CPV-2b types, which were again
confirmed by BLAST analysis and also on
phylogenetic analysis. Three isolates (PALAM-2,
PALAM-4 and PALAM-7), which had Asparagine at
426 position were designated as CPV-2a types, which
were confirmed in a similar manner. Three isolates
PALAM-5, PALAM-8 and PALAM-10 were found to
match with isolates from USA, Brazil and New CPV-
2a isolate from USA, respectively.
(2) BACTERIAL PATHOGENS
(a) Pasteurella multocida
Multi-locus sequence typing (MLST) was
carried out for 17 isolates of capsular type B of buffalo
origin belonging to different parts of the country. The
genomic DNA of all the isolates was isolated. PCR
amplification of 7 house keeping genes selected for
the MLST analysis (adk (adenylate kinase), est
(esterase), pmi (mannose-6-phosphate Isomerase,
mdh (malate dehydrogenase), gdh (glutamate
dehydrogenase), pgi (phospho glucose isomerase)
and Zwf (glucose-6-phosphate dehydrogenase) was
carried out, which yielded amplicons of expected size.
The PCR products were purified from gels and
subjected to nucleotide sequencing in both directions.
The nucleotide sequences were aligned and
compared by using Laser Gene software. The allelic
profiles obtained for the isolates at the seven loci
were 23, 37, 21, 17, 4, 2, 17 for adk, est, pmi, zwf,
mdh, gdh and pgi genes, respectively, based on the
data in RIRDC MLST data base for P. multocida.
These isolates were grouped into a single sequence
type (ST122) indicating that the isolates prevalent in
the buffalo population were closely related and had
the same allelic profile for all the 7 house keeping
genes
(b) Campylobacter spp.
Genotyping of 61 thermophilic Campylobacter
spp. isolates from diverse origin was carried out by
PCR-based RFLP and RAPD techniques in order to
deduce their molecular heterogeneity. The typeability
for RFLP in the present study was 100%. The overall
discriminatory power and typeability of the PCR-RFLP
method was satisfactory.
RAPD technique was applied with the view to
compare typeability and discriminatory efficacy of
two universal primers, OPA-11 and HLWL85, and the
overall comparison of this method with fla-typing.
The molecular heterogeneity studies and
comparison of the two genotyping methods revealed
that both the techniques are suitable for the diversity
studies. The D value index of > 0.9 is desirable for
typing schemes and the results are to be interpreted
with confidence. Among the two methods, RAPD was
found more discriminatory on comparing the D values.
However, disadvantages such as minor differences
in band patterns and weak band patterns in RAPD
make its discriminatory capacity somewhat poor,
which may lead to subjective interpretation of results.
Further, it was observed that the RAPD technique
sometimes required a second PCR assay as it gave
negative results in the first trial or yielded weak bands.
Taking into consideration the latter facts, fla-typing
seems to be a better suited method for genotyping
Campylobacter isolates as evident by its ability to
type all the isolates under study and also to give
acceptable level of discriminatory index. The isolates
studied reveal the existence of wide DNA diversity.
(c) Brucella spp.
In order to work out the molecular epidemiology
of the Brucella, PCR targeting the OMP 31 gene of
Brucella was run using DNA from the field isolates of
B. melitensis (n=19) with the primers designed. The
PCR product from each isolate was sequenced. The
sequences of the OMP 31 were aligned using the
software. The sequences of OMP 31 gene of each
field isolate were compared with each other and with
those available in the NCBI database to find out any
similarity or differences. It was found that the
sequences of the different field isolates of the B.
melitensis from India did not differ from each other.
When the same were compared with those available
in the database, again no difference was observed.
This showed the highly conserved nature of the gene
of the Brucella.
(d) Shiga toxin producing E. coli
A total of 17 human and 41 cattle STEC
isolates were screened for the presence of cardinal
genes i.e., stx1, stx2 and both stx1 and stx2 . Among
the 17 human isolates stx1 gene was detected in 9
isolates, stx2 in 5 isolates and both stx1 & stx2 in 3
isolates. Among the 41 cattle isolates, stx1 gene
was found in 12 isolates, stx2 in 16 isolates and both
stx1 and stx2 were in 13 isolates.
Five genes namely Ler, orf1----(L0053, L0052,
L0051, L0050), EscRSTU---(escR, escS, escT,
escU), orf2----(L0054, L0044, L0043) and cesD
belonged to LEE pathogenicity island were screened,
where Ler, EscRSTU and orf-2 were not found in
human isolates; however, orf-1 and cesD were
detected in 1 and 8 isolates, respectively. Among
the cattle isolates (n=41), ler, orf-1, EscRSTU, orf-2
and cesD were present in 19.5%, 9.8%, 12.2%, 9.8%
and 48.8% isolates, respectively.
(e) Staphylococcus aureus
An attempt was made to investigate the
molecular interactions between two ECM proteins,
vitronectin and fibronectin, and S. aureus. Heparin
binding site in vitronectin was altered by site directed
3 5
mutagenesis to understand its role. Mutation caused
no alteration in the multimerization of the protein thus
indicating that the primary heparin-binding site hasno role in this process.
(3) PARASITIC PATHOGENS
(a) Haemonchus contortus
(i) Complement C3 binding protein ofHaemonchus contortus and its significance inhost-parasite interactions: C3 binding protein in H.contortus was characterized as glyceraldehyde 3
phosphate dehydrogenase (GAPDH) by mass
spectrometry and by generating the recombinant formof H. contortus. The rGAPDH bound to C3
complement and inhibited sensitized sheep
erythrocyte lysis by complement. Furthermore, the
presence of rGAPDH inhibited C3b and membrane
attack complex formation. Identification of GAPDH
as complement C3 binding protein is a novelobservation.
(ii) Drug resistance: Beta-tubulin isotype-1 gene ofBunostomum trigonocephalum and Mecistocirrus
digitatus cloned, sequenced and characterized. The
point mutations were predicted for benzimidazole
resistance diagnosis. The deduced amino acidsequence showed point mutation (phenyle alanine to
tyrosine) at 200th position on beta-tubulin protein may
be responsible for benzimidazole resistance. Based
on the mutation at 200th position (599th position at
nucleotide level), standardised allele specific PCR
(AS-PCR) for benzimidazole resistance diagnosis in
Bunostomum trigonocephalum and Mecistocirrusdigitatus. For anthelmintic resistance study in field
level, AS-PCR was applied and 13.1% of
Haemonchus contortus were showing resistance
against benzimidazole group of drugs.
(b) Taenia solium cysticerci
Total RNA was extracted from cysticerci of
Taenia solium collected from muscles of pigs(measly pork, Fig. 28) using trizol reagent following
standard protocol and cDNA was synthesized using
oligo (dT)18 primer. The 201 bp coding sequence of
Ag1V1 protein of T. solium cysticerci was PCR
amplified using specific primers and cloned in INSTA
cloning vector. The presence of insert in therecombinant clone was confirmed by restriction
digestion with Nco I and Hind III as well as by colony
PCR.
A B
Fig. 28: A. Mesly pork; B. Scolex of Cysticercus cellulosae
(c) Cryptosporidium spp.
A 834 bp nested PCR product (Fig. 29) of 18S
rRNA gene of Cryptosporidium spp. (from faecal
samples of cattle, buffalo and kid) were subjected
to PCR-RFLP using three restriction enzymes (SspI,
VspI and MboII). The specific RFLP patterns (Fig.30)
confirmed the presence of Cryptosporidium parvum
in all the cattle and buffalo isolates. However, RFLP
pattern of the kid isolate was different from C. parvum.
For further confirmation of species, the 834 bp nested
product of one isolate each from Pantnagar and Bihar
and two isolates of Izatnagar (one cattle and one
buffalo) was cloned in pTZ57R/T cloning vector and
custom sequenced. The sequence homology with
known sequences available in GeneBank further
confirmed these species as C. parvum.
For further subtyping of C. parvum, one sample
each from IVRI cattle, IVRI buffalo, Pantnagar cattle
and Bihar buffalo was subjected to nested PCR based
amplification of Gp60 gene. These nested PCR
products of 340 bp (Fig. 31) of GP60 gene were directly
sequenced. The sequences obtained were aligned
with already published sequences of C. parvum sub-
genotypes IIa, IIb, IIc, IId and IIe. The alignment
studies showed maximum homology of all the four
isolates with published sequence of IId sub-genotype.
Further analysis of sequences revealed that all the
sub-types had 15 copies of the TCA repeat and 1
copy of the TCG repeat and one ACATCA sequence
was present immediately after the trinucleotide
repeats (TCA or TCG). Thus, all the 4 subtypes of C.
parvum were further classified as IIdA15G1R1, which
is known to be zoonotic.
Fig. 29: 834bp Nested Fig. 30: PCR-RFLP pattern of
amplicons of 18S rRNA 834bp nested amplicons
of Cryptosporidium spp. of 18S rRNA gene of C.
Lane A,B,C: cattle isolates parvum, Lane A,C: Vspl
Lane D,E,F: buffalo isolates (628bp & 115bp); Lane D,
Lane M:100bp DNA ladder E: Sspl (450bp, 267bp &
108bp); Lane B,F: Mboll
(771bp & 76bp) Lane M:
100bp DNA ladder
3 6
Fig. 31: Nested PCR amplification of GP-60 gene of C.
parvum
Lane A: IVRI Cattle isolate
Lane B: IVRI Buffalo isolate
Lane C: Pantnagar Cattle isolate
Lane D: Bihar Buffalo isolate
Lane M: 100bp DNA ladder
(d) Ticks
The larvae of laboratory maintained acaricide
susceptible reference IVRI-I strain of Rhipicephalus
(Boophilus) microplus and those emanated from
deltamethrin-resistant adult female ticks collected
from ten locations spread over three agroclimatic
regions of India were used to amplify three point
mutation sites (kdr like mutation in domain IIS6,
T2134A in domain IIIS6 and C190A in domain IIS4-
5) of sodium channel gene known to be associated
with resistance to pyrethroids. The double stranded
sequence analysis of at least two clones from each
of the deltamethrin-resistant isolates failed to detect
any nucleotide substitution, which is linked to
resistance (mutation) in either domain IIS6 or domain
IIIS6 region when compared with the sequence from
susceptible IVRI-I strain.
The double stranded sequence analysis from
susceptible strain and field isolates of ticks led to
the identification of a cytocine (C) to adenine (A)
nucleotide substitution (CTC to ATC) at position 190
in domain II S4-5 linker region in three field isolates
having highest resistant factors (7.6 to 34.9) and
elevated esterase levels. In silico translation of this
nucleotide substitution causes a leucine to isoleucine
(L64I) change within domain II S4-5 of the sodium
channel gene. The occurrence of mutation in the tick
isolates having high resistance factor suggested that
target site insensitivity is a mechanism of resistance
to deltamethrin in the Indian isolates of R.(B.)
microplus. These results concluded that the mutation
site is similar in Indian and Australian tick isolates
while it is different in isolates of ticks from Mexico
and Brazil.
(4) HOST-PATHOGEN INTERACTION/
ONCOLYSIS
(a) Elucidation of molecular mechanism involved
in Newcastle disease virus induced oncolysis
Infection of HeLa cells with 0.1 moi of HeLa
adapted Newcastle disease virus induced apoptosis,
which was evident from the translocation of
phosphatidyl serine translocation from inner leaflet
to outer leaflet. The percent Annexin V positive cells
at 48 h p.i in mock-, parental NDV- and HeLa adapted
NDV at passage-5 infected and staurosporin treated
cells were 19.14%, 39.64%, 69.86% and 51.42%,
respectively. Analysis of propidium iodide stain cells
in flow cytometer indicated significant increase in
hypodiploid cell count (sub-G1 peak). Around 64.79%
cells were PI positive in NDV infected HeLa cells as
against 66.78% staurosporin treated control cells
Our results indicated that NDV infection of
HeLa cells causes disruption of mitochondrial
membrane potential at 24 h p.i. which increased till
48 h p.i. suggesting that mitochondria plays role in
NDV induced apoptosis of HeLa cells. Further study
revealed that TRAIL acts as one of the effector
molecules which was up-regulated in NDV-infected
HeLa cells confirming involvement of death receptor
mediated pathway.
(b) Identification of oncolytic viral genes anddevelopment of tumour targeted nano-delivery vehicle for cancer therapy in bovines
The NS1 gene of CPV-2 and VP3 of chickeninfectious anaemia virus (CAV) amplified and clonedin eukaryotic expression vector pcDNA3.1(+) in order
to develop viral gene therapeutics were found toinduce apoptosis in HeLa cells (Fig. 32). Detailed
study of molecular mechanism of cell death confirmedthat NS1 induces apoptosis only through endoplasmicreticulum stress mediated pathway and there was
no involvement of p53, bax and bcl2, whereas VP3induced cell killing is only through mitochondria and
cleavage of poly (ADP-ribose) polymerase (PARP).
In order to develop horn cancer specific nano-
delivery system, four unique horn cancer specificligand sequences were identified using phage displaymethods. These horn cancer specific ligands were
chemically synthesized by solid phase peptidechemistry and labeled by FITC labeled at their N-
terminal ends to detect their preferentially homing tohorn cancer cells.
In-vivo tumour models for evaluating theoncolytic potential of the gene constructs were
developed in male Wistar rats using 1% DMBA (7,12 -Dimethylbenz (a) anthracene) (2.5 mg DMBA in0.25 ml of acetone to each rat) tissues. Similarly
mammary tumour models were developed) in female
3 7
Sprague Dawley rats using N-methyl-N-Nitroso Urea(Sigma Aldrich, USA) for evaluation and validation
of oncolytic gene therapeutics. Tumours werecharacterized by histopathology, AgNOR and PCNA
count.
Fig. 32: Detection of nuclear fragmentation by Hoescht
staining in transfected HeLa cells
5. DISEASE MONITORING AND
SURVEILLANCE
(1) VIRAL DISEASES
(a) Rotavirus infection:
A total of 885 diarrhoeal (784) and non-
diarrhoeal (101) faecal samples of human beings and
animals (calves, goats kids and lambs) from five
states of north India viz, Punjab, Rajasthan, Himachal
Pradesh, Uttar Pradesh and Jammu & Kashmir were
screened for rotavirus. SDS-PAGE, ELISA and RT-
PCR were able to detect viral load in 28.29%, 41.46%
and 41.95% of the 205 human samples with an overall
prevalence of 48.29%. The highest prevalence (70%)
was observed during the months of November to
February and in children aged 3-6 months (74.28%).
In case of bovine calves a prevalence of
15.41% was observed, with 4.29%, 10.15% and
15.41% positivity shown by SDS-PAGE, ELISA and
RT-PCR, respectively. Of the 202 goat kid and 212
lamb samples screened, a prevalence of 9 (4.46%)
and 7 (3.3%), respectively was observed by RT-PCR.
Real time PCR was also standardized for the
VP7 gene and found more sensitive than conventional
RT-PCR.
(b) Japanese encephalitis
Of the 309 pig sera samples from various
regions of Uttar Pradesh screened for presence of
antibodies to JE virus by indirect IgM ELISA, 159
(51.45 %) were found to be positive.
A total of 140 pig blood samples were collected
from various regions of Uttar Pradesh, out of which
22 (15.71%) samples were found positive by RT-
PCR.
(2) PRION DISEASES
(a) Bovine spongiform encephalopathy
A total of 42 brain samples from adult cattle
and buffaloes of different age groups belonging to
clinical suspect/downers/fallen cases/slaughter
house were collected/ received from the postmortem
room of the institute. Brain sections were stained
with haematoxylin and eosin as well as with special
stain. The brain sections were examined and none
showed spongiform lesions of BSE. A total of 3179.2
surveillance points were gathered. The other
microscopic lesions identified as: congestion/
hemorrhages, gliosis and neurons degeneration. The
clinical suspect cases were also tested for Rabies
by dFAT and 3/7 found positive for rabies. Veterinary
Officers (120) from Rajasthan, Punjab, Himachal
Pradesh, Uttar Pradesh, Bihar, Maharashtra, Goa and
SSB were trained on BSE surveillance, collection
and preservation of brain for various tests for
confirmation of BSE.
(3) BACTERIAL DISEASES
(a) Pasteurellosis
Twenty eight of 33 cultures and samples
received from different parts of the country for isolation
and confirmation of Pasteurella multocida, were
identified as Pasteurella multocida on the basis of
morphological, cultural and biochemical tests. The
isolates were from different animal species viz., cattle,
buffalo, sheep, goat, rabbit, duck, chicken and emu.
The capsular typing of all isolates was done by
multiplex PCR using capsular types A, B, D and F
specific primers. Among 28 isolates, 16 were found
to be serotype A, 8 isolates serotype B, while 4
isolates belong to type F.
(b) Leptospirosis
A total of 590 sera samples of different animal
species and human beings were examined for
leptospirosis by latex agglitunation test and MAT, of
which 436 were found positive for the presence of
Leptospira antibodies. The results of both tests were
comparable. Of the 432 cattle sera from Mathura,
West Bengal and Odisha, 298 were found positive.
Serovars identified were Icterohaemorrhagiae,
followed by Grippotyphosa, Hebdomadis, Hardjobovis
and Australis. This high seroprevalence (65%)
recorded may be attributed to the endemicity in this
region. Screening of 18 caprine sera revealed 11 to
be positive. Fourteen of 15 canine sera samples
suspected for leptospirosis tested positive when
screened using both MAT and rLigB based LAT.
Icterohaemorrhagiae and Grippotyphosa were the
serovars prevalent in canines in Bareilly region.
As many as 34 human sera of 35 tested were
positive for leptospirosis. Icterohaemorrhagiae was
the predominant serovar, followed by Javanica and
Grippotyphosa.
3 8
Majority (69) of the 80 sera samples of wild
animals (tiger, lion, jaguar, leopard, cheethal, black
buck, panther etc.) referred from different zoos were
tested positive for leptospiral antibodies. Serovars
identified were Icterohaemorrhagiae, Pomona and
Grippotyphosa. Buffalo carcasses without removing
offals fed to wild animals were suspected to be
responsible for infection.
(c) Vero-toxic E. coli infection
The study was aimed for the detection of
virulence genes, viz VT1 and VT2 in Escherichia coli
isolates, from samples received from postmortem/
diseased domestic and wild animals. A total of 106
samples yielded 30 E. coli isolates, which were
maintained in Dorset egg medium (modified) at 40C.
E. coli specific polymerase chain reaction (PCR) was
carried out. E. coli specific PCR of isolates resulted
in a single amplification product of 231bp. However,
E. coli VT1 gene and VT2 gene specific PCR of the
isolates revealed the absence of 130 bp VT1 and
346 bp VT2 genes.
(d) Arcobacteriosis
A total of 174 samples (poultry faeces - 55,
chicken meat - 70, pig faeces - 49) screened for
Arcobacter spp. by genus specific PCR by targeting
16S rRNA. Out of which 28 (16.09%) samples were
found positive for Arcobacter spp. All genus specific
positive samples were subjected to multiplex-PCR
for species confirmation. Out of which 8 (14.54%)
poultry faecal samples were found positive for
Arcobacter butzleri (401 bp), 13 (18.57%) chicken
meat samples found positive for Arcobacter butzleri,
out of 13 samples one found positive for both A.
butzleri and A. cryaerophilus (257 bp), 7 (14.28%)
pig faecal samples found positive for Arcobacter spp.
out of which 5 samples were positive for A. butzleri
and 2 samples found positive for A. skirrowii (641
bp).
(e) Campylobacteriosis
A total of 123 samples were screened for the
presence of thermophilic Campylobacter spp.
comprising of human stools (35), pig faeces (50),
vegetables (24) and dog faecal samples (14). Out of
these, 9 samples were found positive giving an overall
prevalence of 7.3%, with highest isolation rate from
vegetables (12.5%), followed by dog faeces (7%),
pig faeces (6%) and human stools (5.7%).
(f) Q fever
A total of 202 samples (bovine milk-172,
poultry eggs-12, cattle blood-05 and human blood-
13) were collected and screened for detection of the
pathogen by standardized Trans-PCR and/or Real
Time-PCR. Among them only 20 bovine milk samples
were found positive for Coxiella burnetii DNA. 12 out
of 20 PCR-positive milk samples were further
processed for isolation studies, by egg inoculation
method, however, none of the samples did yield live
Coxiella burnetii.
(g) Streptococcus suis infection
A total of 81 clinical/morbid materials from pigs
suspected to have Streptococcus suis infection were
collected from Nekpur slaughter house (40),
Premnagar slaughter house (5), swine production
farm, IVRI (14) and postmortem room, Division of
Pathology, IVRI (16) and outside Bareilly (6). Out of
81 samples collected, 67 lungs, brain and tonsils
showed gross lesions. Ten nasal swabs from
apparently healthy animals, 2 joint fluids and 2
abscesses were also collected. All the samples were
subjected to microbiological investigation for the
presence of S. suis. Out of which, 30 isolates were
suspected to be S. suis based on the haemolysis
pattern of bacterial colonies on blood agar. On Gram's
staining, they were arranged in pairs or in short chains.
All these isolates were subjected to various
biochemical tests. Out of 30 suspected isolates, 6
isolates showed no growth in 6.5% NaCl, positive
bile esculin test, negative MRVP test and positive
starch hydrolysis test. On various sugar fermentation
tests, 3 isolates showed positive result for raffinose,
lactose, salicin, inulin and negative for sorbitol and
mannitol.
4. MYCOTIC INFECTIONS
A total of 236 samples suspected for the
presence of fungal element from different animal
species and human beings were aseptically collected
and screened. Out of 111 samples from dogs, 11
were found positive for Malassezia spp., 12 for
Candida spp., 9 for Alternaria spp., 5 for Trichophyton
spp., 3 for Mucor spp., 3 for Aspergillus flavus, 2 for
Aspergillus niger, and 1 each for Cladosporium spp.
and Penicillium spp. Out of 28 samples from
buffaloes, 8 were positive for Alternaria spp, 2 each
for Candida spp., Cladosporium spp., Aspergillus
flavus and dermatophytes, 1 each for Cephalosporium
spp. and Mucor spp. Among 29 samples from goats,
4 were found positive for Alternaria spp,, three for
Penicillium spp., 2 for Cladosporium spp., and 1 each
for Candida spp., Cladosporium spp., Curvularia spp.
and for Cephalosporium spp. Out of 13 samples of
cattle, 3 were positive for Candida spp., 1 for
Fusarium spp., and 1 for Microsporum gypseum.
Twenty nine samples from calves were also collected,
5 were positive for dermatophytes and 3 for each
Alternaria spp. and Aspergillus flavus. Among 11
samples from sheep, 5 were positive for Alternaria
spp., 2 for Cladosporium spp. and 1 for Trichophyton
spp. Out of 7 samples from horses, 3 were positive
one each for Aspergillus flavus, Aspergillus spp. and
Alternaria spp. Three of 8 samples from human beings
were positive for Candida spp. and 1 each for
Fusarium spp., Alternaria spp. and Aspergillus niger.
3 9
In addition, 2 impression slides of female Bengal tiger
were found negative for any of the fungal agents.
5. PARASITIC DISEASES
(a) Canine toxocarosis
A total of 558 faecal samples of dogs (278
stray dogs and 280 pet dogs) in and around Bareilly
were screened for T. canis infection. An overall
prevalence of 24.3% (31.29% stray and 17.5% pet)
was recorded in dogs. Among the 86 stray pups
screened, 54 (62.79%) were found positive for T.
canis eggs in their faeces. On the contrary, only 7.8%
adult stray dogs were positive (7/89). Infection rates
in male and female stray pups were 61.22% and
64.86%, respectively; whereas in adult stray dogs,
5.88% males and 10.52% females were infected.
Among the 103 pet pups screened, 43 (41.74%) were
found positive for T. canis eggs, whereas out of 177
adult pet dogs screened, only 6 (3.38%) were found
positive. In the young pet dog population, 43.86%
males and 39.13% females were positive. In dogs
where the age and sex could not be determined
25.24% (26/103) were positive.
Out of the 327 soil samples collected in and
around Bareilly, 42 (12.84%) were found to contain
the eggs of Toxocara species. Out of 94 samples
examined from public parks, 16 (17.02%) samples
were positive for Toxocara species eggs. A
prevalence of 13.33% was recorded in door mat dusts,
11.71% in the samples of road sides/ sidewalks and
8.33% in samples from playgrounds.
(b) Animal cryptosporidiosis
Faecal samples of 502 domestic animals
(cattle, buffalo, sheep and goat), collected from 8
different states, were examined microscopically for
the presence of Cryptosporidium spp. oocysts. State
wise prevalence is presented in Table 5. Age wise
prevalence revealed higher infection rate (33.72%)
in calves below 1 month of age. The infection was
higher in diarrhoeic (25.56%) than in non-diarrhoeic
(3.33%) calves. Highest prevalence was noticed in
monsoon (23.3%), followed by premonsoon (9.91%)
and post-monsoon seasons (6.85%)
Table 5: Prevalence of Cryptosporidium spp. in
domestic animals and man
State No. of No. %
Samples Positive Prevalence
Uttar Pradesh 203 49 24.13
Uttarakhand 76 18 23.68
Haryana 25 0 0
Bihar 32 4 12.50
West Bengal 53 6 11.32
Gujarat 12 2 16.60
Karnataka 96 4 5.20
Kerala 05 0 0
Total 502 83 16.53
(c) Poultry coccidiosis
Poultry droppings were collected from 35
broiler (27-U.P. and 8-Uttarakhand) and 14 layer farms
(9-U.P. and 5-Uttarakhand). Besides these, 9
samples (6-U.P. and 3-Uttarakhand) were also
collected from backyard poultry. 88.6% broiler farms,
71.4% layer farms and 77.8% backyard poultry were
positive for Eimeria spp. oocysts.
The oocysts were harvested from the poultry
droppings of individual farms separately and genomic
DNA were extracted using genomic DNA isolation
kit. Multiplex PCR based on SCAR markers and ITS-
1 based nested PCR for species level identification
of Eimeria oocysts of poultry were standardized.
Based on the results, E. tenella, E. acervulina, E.
maxima, E. necatrix and E. mitis were the
predominant species in poultry farms of U.P., while
E. acervulina, E. maxima, E. tenella, E. praecox and
E. mitis were predominant species in Uttarakhand.
(d) Gastrointestinal parasites
District wise map of gastrointestinal parasites
in Rohilkhand region was developed. In different
zones, Haemonchus, Oesophagostomum and
Trichostrongylus spp. were recorded. Haemonchus
infection was predominant throughout the year
whereas Oesophagostomum and Trichostrongylus
infection found prevalent during rainy and winter
seasons, respectively. Bioclimatograph for
Haemonchus infection has been prepared for
Rohilkhand region. Favourable months for pasture
infection to livestock recorded during August to
November based on pasture larval burden (L3 /kg
DH)
A total of 1433 and 43 faecal samples of goats
and calves, respectively were screened by
qualitatively and quantitatively faecal analysis method
to study the endoparasites prevalence in different
seasons over the year. The results indicated that
the endoparasite particularly strongyles infection was
present throughout the year and the mean egg per
gram (EPG) between 900-4200. The highest EPG
was observed from April to November. However, the
infection was also noticed in winter months (December
to February) though the intensity of infection was less.
The faecal samples were cultured for L3 larvae and
the predominant strongyle parasites found in this area
were: Haemonchus contortus (throughout year),
Teladorsagia circumcincta (November to March),
Oesophagostomum columbianum (throughout the
year with medium level of infection), Bunostomum
trigonocephalum (sporadic) and Trichostrongylus spp
(All seasons except severe winter) (Fig. 33). In sub-
population structure study on H. contortus revealed
knobbed (60%) form was predominant in Mukteswar
region though linguiform (20%) and smooth form
(15%) also observed.
4 0
Total of 53 gastrointestinal tracts of goats were
screened for GI parasites and it also revealed
strongyle as observed in faecal culture analysis.
Along with strongyles, adult and immature
amphistomes were also observed from GI tracts;
however, the rate of infection was very low. For
molecular identification of different strongyles
composition in field population, beta-tubulin PCR-
RFLP, PCR for ITS-1 and 2 on Haemonchus
contortus, Trichostrongylus colubriformis were
standardised and also ITS-2 of Paramphistomum
epiclitum were cloned, sequenced (JF834888) and
characterised.
Fig. 33: Various parasites isolated from Mukteswar
(e) Canine parasitic diseases
Faecal samples were collected from 413 dogs
with digestive system ailments, brought for treatment
in the Referral Veterinary Polyclinic. Blood samples
of these animals were tested for haematological and
haematobiochemical parameters. A total of 10.89%
dogs were found positive for gastrointestinal parasites
which included 6.055% cases of Ancylostoma
caninum and 4.84% had mixed infection of
Ancylostoma caninum and Toxocara canis. The
positivity percentage of males and females affected
were 14.4 and 6.21, repectively.
(f) Fishborne parasites
A total of 123 economically important
freshwater fish of 10 different species such as Catla
catla (n=10), Oreochromis niloticus (n=24), Puntius
gonionotus (n=19), Labeo rohita (n=12), L. bata
(n=14), Notopterus chitala (n=7), Cirrhinus mrigala
(n=9), Arius tenuispinus (n=17), Cyprinus carpio
(n=11) and Nematolosa nasus (n=9) were
metacercarial stage of digenean trematodes. Out of
161 samples (tissue muscles and head), prevalence
of metacercarial stage of digenean trematodes was
found in 18.35% samples. On species-wise
comparison, encysted metacercariae of digenean
trematodes were highest in O. niloticus (35.48 %)
followed by in P. gonionotus (30.43 %), A. tenuispinus
(29.41%), L. bata (16.66%), C. carpio (15.38%) and
N. nasus (11.1%), whereas rest of the fish species
examined did not harbour the trematodes.
6. OTHER DISEASES
(a) Calf diarrhoea
A total 72 faecal samples were collected from
diarrhoeic calves from C&B farm, IVRI. Out of which,
61 samples were found to be positive for E. coli on
cultural examination. The E. coli bacteria were further
confirmed by PCR and were subjected to antibacterial
sensitivity test against common antibiotics. Among
the other pathogens, 11, 8, 13 samples were found
to be positive for rota virus, corona virus and
Cryptosporidium spp., respectively. Few samples
were of mixed infections.
(b) Abortion in dairy animals
Twenty three (20 IVRI, 3 Bareilly local) cases
of abortions were investigated, post-mortem was
carried out and gross lesions were recorded. The
morbid samples were collected for histopathological
and microbiological diagnosis of the abortions. The
vaginal swab and blood serum samples were also
collected from the aborted dam. Among these 23
cases, 19 cases were of cattle and 4 of buffaloes.
Sixteen abortions occurred in the 3rd trimester (7-9
months) while 7 in 2nd trimester (4-6 months). In some
cases foetus carcasses revealed vascular
congestion in lungs, liver, kidneys, brain and serosal
haemorrhages over the stomach. The stomach
contents were reddish brown in colour in few cases,
while gruel like in others. Four aborted cattle serum
samples were found positive for Brucella antibodies.
E. coli was isolated from stomach contents of 2 cattle
aborted foetuses as well as vaginal swabs. Two
aborted cattle had shown the history of repeat
breeding and inseminated twice.
7. INVESTIGATIONS BY CADRAD
A total of 1276 samples including 407 serum
and other clinical (646), morbid (131) samples were
collected/received for bacteriological analyses from
the states of UP (836 ), UA (201), JK (84), Punjab
(25), West Bangal (5), Odisha (16) and Rajasthan (9)
of these 407 were serum, 646 clinical and 131 morbid
samples. These samples belonged to different animal
species viz. cattle, buffalo, caprine, canine, ovine
and swine. After bacteriological processing of
samples isolates of 92 different bacterial spp. were
4 1
isolated. The isolates were characterized by colony
characteristics, morphology, biochemical reactions
and sugar fermentation tests. From the serum
samples, 374 were tested for brucella antibodies and
14 were found positive. A total of 70 animals were
screened for TB and JD belong to UP and UA. The
observation of skin reaction as made after 72 h, no
animal showed positive reaction for tuberculin and
Johnin testing. Apart from this 26 serum samples
were tested for mucoplasma and two were found
positive from Jammu and Kashmir. Seven sera
samples were tested for Leptospiral antibodies. Total
836 biological samples (sputum, milk, dung and urine)
from 246 animals from different military farms across
the country were examined for presence of acid fast
bacterium. Only three were found positive in ZN
smear microscopy.
A total of 1105 clinical and morbid samples
including 813 serum samples, 139 semen samples,
90 tissue blood samples/swabs and 63 faecal
samples from different states were analyzed for IBR,
PPR, FMD, classical swine fever, canine parvovirus,
swine pox, sheep pox, JE and ICH. 105/280 serum
samples from U.P., U.K., Odisha, Punjab, Nagaland,
and 32/76 semen samples from, UK and U.P. were
found positive for IBR. 3/26 tissue, 8/13 serum
samples from Punjab, Haryana and U.P. were found
positive for classical swine fever, 3/6 serum samples
and 28/62 faecal samples found positive for CPV
(U.P. and Odisha), 1/1 tissue as tested positive for
CPV (UP). 116/174 samples (serum, stool, nasal
swab, ocular swab, rectal swab, tissue) were tested
positive for PPR (UK, Bihar, J&K and U.P). 30/31
samples (semen, serum and tissue) were tested
positive for FMD (U.P., U.K. and J & K), 9/43 samples
(serum, tissue) were tested for sheep pox from H.P.,
1/1 sample was tested for ICH (U.P.) and 1/1 tissue
sample tested positive for CAV-2.
A total of 594 biological specimens, including
369 morbid tissues, 204 clinical (blood/serum) and
21 carcasses of 9 species including wildlife received
from UP, UA, Rajasthan, Haryana, MP, Jharkhand,
Chhattisgarh, HP, Tripura, Kerala, Bihar, Odisha and
West Bengal were processed for pathomorphological,
hematobiochemical, special staining, immuno-
histochemistry (FAT) and PCR methods. The results
revealed rabies (UP), pasteurellosis (UP), Fasciolosis
(UP), suppurative bronchopneumonia (UP), fatty liver,
toxemia, FMD (UP and UK) in buffaloes;
granulomatous pneumonia (TB) (UP), gangrenous
myositis (BQ) (Odisha), Theileria sp. infection
(Chhattisgarh), FMD (UP, UK), anemia (UP,
Chhattisgarh) in cattle; PPR (UP), sheep pox (HP),
intestinal schistosomosis (Raj.), plant toxicity (UK)
in sheep; verminous pneumonia (UK), nephrosis,
hemocidrosis (UK), anemia (UP) in goats;
hemangiosarcoma, anemia, nephrosis (UP),
septicemia (UK) in horses; rabies (UP, UK), anemia,
urinary calculi (UP), suppurative bronchopneumonia,
metastatic calcification in vessels, chronic interstitial
nephritis, hepatoses, CPV, (MP), leptospirosis (Bihar)
in dog; swine fever (Haryana), pasteurellosis (UA),
aflatoxicosis, necrotic hepatitis, splenitis (UP),
granulomatous hepatitis (Schistosomosis) (WB) in
pig; chronic hepatitis, debility and heptoses (Lion),
pulmonary congestion (Tiger), toxicity (Peacock),
chronic necrotic hepatitis and enteritis (Spectacled
languor), bronchitis, fatty liver, necrotic hepatitis
(Civet cat), congestion and lung edema (Shock) in
Bison, leptospira in Panther (Raj.), ICH (Sloth bear)
(Bihar), verminous pneumonia (Leopard) (UK), bird-
flu (Crow in Jamshedpur) in wild life; hepatic
coccidiosis in the rabbit (Chhattisgarh).
For toxicological analysis,150 samples
including feeds, fodder and biological materials were
analysed for the presence of various toxicological
agents. Out of 44 samples of compounded livestock
feed (cattle & buffalo-17, poultry-12, pig-06, horse-
03, rabbit-06 and feed ingredients-06) analyzed for
aflatoxin-B1, a major feed contaminant, 16 feed
samples (C&B-06, Pig- 04, Poultry- 04, Rabbit- 02)
were found positive. The concentration of AFB1
ranged from 0. 1 to 2.0 ppm, which is higher than the
permissible levels in cattle/poultry feed. Out of 06
feed ingredients analyzed for presence of aflatoxin-
B1, one sample (Maize) was found positive. These
samples were also analyzed for other mycotoxins.
Four feed samples were found to contain Ochratoxin-
A and two feed samples were positive for T-2 toxin.
A total of 07 fodder samples, suspected for cause of
mortality in animals, were analyzed for the presence
of various toxicants and one sample was found to
contain hydrocyanic acid. Toxicological analysis of
various morbid samples i.e. liver (35), kidney (20),
rumen contents (10), intestinal contents (13) stomach
contents (07) and gizzard contents (08) from various
species was carried out for toxicants like alkaloids,
heavy metals, nitrate/nitrite, pesticides, phosphine
etc. One sample of poultry liver was found to contain
aflatoxin B1 (0.2 ppm). A total of 18 samples (liver-
06, kidney -03, rumen content -02 and gizzard content-
07) were found to contain an organochlorine group of
insecticide (probably BHC/ Lindane). These samples
were associated with mortality in deer and peacocks.
A blood smears/blood samples of different
animals were examined and 25 were found positive
for blood protozoan infection, names babesiosis and
trypanosomosis in horses and theileriosis in cattle;
out of 285 faecal samples from different animals, 98
were positive for different gastro-intestinal parasites;
11 skin scrapings of different animals were examined
and all were found negative for mange mites; two
specimens received were identified as Tabanus and
Haematopinus spp.; 410 preputial washings from
4 2
cattle and buffalo bulls received were cultured and
were found negative for Trichomonas foetus infection.
A total of 397 sera samples of 5 species of
animals (bovine, caprine, swine, canine and equine)
collected and/or received from 12 sources (Tekanpur,
Jharkhand, Gurgaon, Odhisa, Mukteshwar,
Chatishgarh, Rishikesh, Meerut, Bareilly, Mathura,
and Kerala) were tested for brucellosis. Altogether
40 samples (10.08%) of bovine were found positive.
Screening of bovine herd for Tuberculosis and
Paratuberculosis was also carried out. A total of 506
cattle which belonged to Military Dairy Farm, Bareilly
and IVRI, Mukteswar were screened for tuberculosis,
out of which 67 animals of military dairy farm, Bareilly
were found positive to tuberculin test while none of
the animals of IVRI, Mukteswar were found positive.
Ninety nine animals of IVRI, Mukteshwar were also
screened for paratuberculosis but none of them were
found positive.
Outbreak investigations
i. At Sardhana, Meerut (18.4.11) 13 animals
(buffalo-07, cattle-06) were confirmed for rabies
in these animals.
ii. At Chinbauli, Uttarkashi (UK) (18.4.2011) 60 out
of 300 goats died due to PPR were investigated.
iii. General health checkup of horses of Dr. B.R.
Ambedkar, PTC Moradabad was carried out (6-
5-2011).
iv. Disease investigation in GADVASU dairy farm
carried out on 28.5.11. Total 35 buffalo calves
reported dead within 5-6 d time after showing the
symptoms of respiratory distress and swelling
around the neck. The mortality was attributed to
Pasteurellosis.
v. General health check up of cattle at Chak Gajaria,
Lucknow was carried out on 29-8-2011.
vi. General health check up of horses of Dr. B.R.
Ambedkar, PTC Moradabad was carried out on
7.9.11. Total 12 animals were found to be affected
with different affections of bone, hoof ailments
and dermatitis.
vii. Testing of breeding bulls at ULDP Shyampur,
Rishikesh was carried out on 12-9-2011.
viii. Disease investigation in animals of village
Mohammadpur Devmal, block Mandavar District
Bijnor was carried out on 25.9.11. The animal
population was 2000 (Cattle-500, buffalo-1500).
Total 21 animals (He buffalo-2, she buffalo-10,
cow-05, bullock-03, horse-01) were reported to
be dead in about 1 month time after showing the
nervous symptoms. The disease was diagnosed
as rabies.
i. Disease investigation in pigs at French Farm,
Gurgaon, Haryana was carried out on 21-22
October, 2011. Total 207 out of 375 pigs reported
dead in last 2 months. The disease was
diagnosed as swine fever.
ii. Disease investigation in pigs at Govt. Livestock
and Agricultural Farm, Sitapur, U.P carried out
on 4.11.11. Thirtyfive young pigs (3 to 6 month
age) out of total 170 pigs (26 male, 9 female)
were reported died in 1 month time with the
symptoms of high fever, respiratory distress,
staggering. The disease was diagnosed as
aflatoxicosis.
iii. The flood affected areas of district Jagatsinghpur,
Jajpur, Puri and Khurda of Odisha were visited
during 14-19 November, 2011 to assess the
animal losses as a result of flood.
iv. Mortality in crows at Jamshedpur was
investigated on 18-19 November, 2011. More
than 1000 crows reported died. The samples sent
to HSADL from Project Directorate on Cattle,
Meerut were found positive for H5N1.
v. Serum and semen samples were for IBR and
Blue tongue testing. (20 and 21 December 2011).
vi. Disease investigation in horses at Allahabad was
carried out on 29-12-2011 and was found to be
Glanders.
vii. Outbreak in poultry birds at Tripura was
investigated on 30-12-2011 and the mortality was
found to be because of R.D.
viii. Disease investigation in village Shiv Nagar,
Champatpur, Block Majhwagan, Bareilly was
carried out on 21-01-2012. 13 blood, serum and
fecal samples were analyzed, some of the animals
showed decreased hoemogram values indicating
anaemia.
ix. Disease outbreak in goats at Purnia, Bihar was
attended on 24-01-2012. 95 goats out of 351 died
due to PPR.
x. Disease investigation in Durgapur and Maghra
Karik Nagal Village, Block Kanalganj/
Mohammadabad,Distt. Farukhabad was carried
out on 14.03.2012. Blood, serum and faecal
samples were collected for investigation. The
disease was diagnosed as FMD.
xi. Disease investigation in Nagla Madhi Village,
Block Sheetalpur, Etah was carried out on
16.03.2012. Blood, serum, oral swab and morbid
samples were collected for Foot and Mouth
disease. The disease was diagnosed as FMD.
xii. Disease investigation in Kursena Village,
Jaswantnagar, Distt Etawa was carried out on
21.03.2012. Blood, serum and faecal samples
were collected for bacterial infection,
gastrointestinal parasitism and foot and mouth
disease. The disease was diagnosed as FMD.
8. MORTALITY PATTERN AND CAUSES OFDEATH AMONG LIVESTOCK, POULTRY ANDWILDLIFE
Bovines: A total of 60 bovine carcasses (25 belowsix months and 35 above six months of age) were
necropsied. Among the calf carcasses, 13 were
4 3
males and 12 females. Gastro-enteritis was the major
pathological condition (3/25) causing mortality among
calves. Pneumonia, hepatitis, septicemia, arthritis,
premature births were the other important causes of
death. Out of 35 cattle carcasses (above six months
of age), 17 were cattle received from LPM (C&B)
and remaining were from other divisions/ sections of
Institute. Tuberculosis (02), endometritis (02),
mastitis, gastroenteritis, anemia, singly and in
combination were recorded.
Buffalo: A total of 17 buffalo (8 calves + 9 adults)carcasses were received for disease diagnosis.
Among young animals, 6 were males and 2 females,
while in adults 7 were females and 2 males. Major
causes of deaths in young animals were- enteritis
(3, 17.65%), septicemia (2, 11.76 %), pneumonia (1,
5.88 %), suppurative arthritis (1, 5.88 %), pneumonia
(1, 5.88%) and pneumo-enteritis (1, 5.88%). The major
causes of mortality in adult buffaloes were pneumonia
(2, 11.76 %), chronic pericarditis (1, 5.88 %),
septicemia (1, 5.88 %), trauma (1, 5.88 %),
haemorrhagic gastro-enteritis (1, 5.88 %), rumen
impaction (1, 5.88 %), hepatitis (1, 5.88%) and no
abnormal detected (1, 5.88 %).
Goats: One hundred seventy five goat carcasses(99-male and 76-female) were received from various
Divisions/ Sections of the Institute for necropsy 10
animals were of less than 1 month of age, 56 were 1-
6 month and 45 were of 7-12 month and 64 were
above 1 year. Major causes of mortality among
included haemonchosis (16.00%) followed by
pneumonia (15.42%), debility (12.00%), enteritis
(11.4%), gastroenteritis (6.85%), cold shock (2.85%),
metritis (1.71%), tympany/ruminal impaction (1.71%),
traumatic injury (1.14%), coccidiosis (0.571%),
hepatic rupture (0.571%), exp. pasteurellosis
(0.571%), expt. mycoplasmosis (0.571%) and
experimental listeriosis (0.571%). Forty nine (28%)
cases couldnot be diagnosed due to advanced stages
of putrefaction/autolysis.
Sheep: Forty one sheep carcasses (19-male and22-female) were received from various Divisions/
Sections of the Institute for necropsy 3 animals were
in less than 1 month old, 1 in 1 - 6 month and 5 were
in 7-12 month and 31 were above 1 year. Major
causes of mortality were pneumonia (19.5%) followed
by enteritis (14.63%), gastroenteritis (12.19%),
haemonchosis (12.19%), septicemia (7.31%), exp.
Trypanosomiasis (4.87%) and debility (4.87%). Ten
cases (24.39%) couldnot be diagnosed due to
advanced stages of putrefaction/autolysis.
Swine: In total, 74 pigs from the Swine ProductionFarm of the institute were received for necropsy
examination. The proportional mortality rate (PMR)
was highest (37.8%) in piglets below one week of
age and the causes of mortality were trauma,
pneumonia and enteritis. In piglets below one month
of age, the PMR was 16.2% and the causes of
mortality were pneumonia and enteritis. In piglets
aged 1-3 months, the PMR was 36.5% and the causes
of mortality were enteritis and pneumonia, which was
found together in many cases. Some of the
pneumonic cases revealed fibrinous pleuritis and
histopathologically most lesions were characterized
as interstitial pneumonia with varying degrees of
secondary bacterial infections. In a proportion of the
enteritis cases, fibrinonecrotic lesions were seen in
the large intestines. Polyserositis, peritonitis and
ascites were the other causes of death in this age
group. In growers (4-9 months old) the PMR was 8.1%
and the major causes of mortality were pneumo-
enteritis and CSF. The single mortality in an adult
pig was due to septicaemia. A total of 21 suspected
CSF outbreaks in Uttar Pradesh were investigated.
Generally, CSF outbreaks were recorded in small
holdings (30-40 animals), where vaccination had not
been done. The mortality rate varied between 25 to
75% and the case fatality rate was highest in young
weaners.
Canines: A total of nine necropsy of dogs wereconducted and important conditions diagnosed were
rabies (03), parasitic enteritis due to Diplidium
canninum (02), parasitic nodules in oesophagial wall
(Spirocerca lupi- 01) and pneumonia (02).
Equines: Two equine carcasses were necropsied.Parasitic gastritis and debility was diagnosed in one
case. The other animal died due to severe traumatic
injuries as result of severe colic due to enterolith.
Wildlife: A total of 109 carcasses of different speciesof wild animals (tiger-1, leopard-2, spotted deer-1,
black buck-5, neelgai-2, ghariyal-3, turtle-76, pangolin-
1, monkey-2 and langur- 1) were necropsied. The
important diseases/ conditions diagnosed included
trauma and shock ( due to in fighting and automobile
accidents) in majority of carnivores and cervids,
dystokia due fetal mis-presentation and gangrenous
pneumonia in chital and hepatitis in black buck. In
turtles disarticulation of cervical vertebrae leading to
severing of spinal cord and instantaneous death were
main findings. Formalin fixed tissues from 69 different
species of wild animals were processed and examined
microscopically. Important pathological conditions
diagnosed were interstitial nephritis with severe
tubular nephrosis in white tiger, interstitial pneumonitis
in serow and bonet monkeys, cholangiocellular
adenocarcinoma replacing most of liver parenchyma
with intrahepatic cholestasis in sloth bear, necrotic
hepatitis in deer and acute fibrino-purulent
bronchopneumonia in deer.
During the year, histopathological (304 tissues
from 69 animals), 102 microbiological (304 tissues
from 69 animals), toxicological (43) and
parasitological (8) and haemato-biochemical (5)
examinations were conducted on tissues/samples
4 4
collected/received from different places and the
reports were sent to the stake holders. In addition,
post-mortem examinations were conducted on 109
animals comprising 2 leopards, 9 blackbuck, 4
spotted deer, 2 nilgai, 3 gharials, 2 crocodile, 80
turtles, 6 peacock, 2 Sarus crane, 2, monkey, 2
vulture, one each of pangolin, tiger, langur, sambhar
and owl. Systemic aspergillosis was found to be the
cause of mortality in one vulture (Gyps himalayensis).
Leptospirosis in both carnivorous as well as
herbivorous species such as tiger, lion, leopard,
panther, spotted deer, buffalo was diagnosed. Even
human staff in one of the zoo was also found positive
for leptospira.
Poultry and other captive birds: A total of 5927
birds comprising 5295 chickens, 240 Guinea fowls
and 392 turkeys received from CARI poultry farms
were necropsied. The significant disease conditions
diagnosed upon necropsy were Marek's Disease,
lymphoid leucosis, ranikhet disease, air sacculitis,
colibacillosis, coccidiosis, fatty liver kidney
syndrome, ascaridiasis, visceral gout, enteritis, heat
stroke and egg peritonitis. Among Guinea fowls, RD,
egg-peritonitis, E. coli infection, parasitic enteritis and
deficiency disorders were the main causes of deaths.
In turkeys, significant diseases encountered were E.
coli infection, hepatitis, egg peritonitis and debility.
A total of 108 ailing or dead birds of different species,
age groups and breeds/strains were received from
various Govt. and Private Poultry Farms (42) of 5
states viz. UP, Uttrakhand, Rajasthan, J&K state
and Jharkhand. The main disease conditions
diagnosed on the basis of laboratory tests including
histopathology, serology and isolation of causal
agents in these farms were mixed infection of E. coli,
mycoplasma and IBD, MD, coccidiosis, ascites, egg
peritonitis and fatty liver. Diagnosis was also given
on formalin fixed tissue specimens referred by various
State Poultry Farms, Disease Diagnostic Laboratories
and National Zoological Parks. Histopathological
diagnosis on referred specimens revealed acute toxic
hepatosis in peacock, visceral gout in steppe eagle,
pox in pigeon and collangiocellular carcinoma in green
pheasant. Etiological investigations included 38
samples either freshly collected or preserved in 50%
glycerine saline for virus isolation, 17 for fungal
isolation and 18 for coccidia. Various etiological
agents isolated/ demonstrated were RDV, IBDV, IBV,
E. coli, Coccidia and Aspergillus fungi. Serological
investigations on 105 sera samples, 21 bursa of
Fabricius and 28 feather follicles revealed presence
of antibodies to IBV, IBDV and RDV. IBD antigens
in bursa of Fabricius and MD antigens in feather
follicles were also detected by immunodiffusion test.
Disease investigation was also carried out on dead/
morbid materials of various wild birds/zoo birds,
captive and migratory birds viz. peacocks, pigeons,
ducks, owl, pheasants, Himalayan Griffon vulture,
Steppe eagle, and Siberian crane.
9. MAINTENANCE OF REGISTRY OFPATHOLOGY AND ONCOLOGY
A total of 977 specimens of important
pathological conditions were maintained in the registry
museum. System wise catalogued specimens
included gastrointestinal-238, reproductive-184,
respiratory-159, urinary system-89, cardiovascular-
89, lymphatic-72, haemic-25, muscles and bones-
23, nervous-13, and miscellaneous-90. Two new rare
specimens were incorporated which included
'disseminated intravascular coagulation' in cattle
where all the internal organs- like liver, kidneys and
lymph nodes showed marked haemorrhages. Cut
surface of liver showed multiple circumscribed lesions
of haemorrhages throughout the parenchyma.
Another case was 'diprosopus condition' in a newborn
piglet which had 2 faces with a single head on a single
trunk. It is one of the rarest craniofacial malformations
and a rare form of conjoined twinning.
10. INVESTIGATION ON DISEASES, SERO-PREVALENCE AND ANIMAL HUSBANDRYPRACTICES IN NWHR
Investigations were conducted on various
materials received from different sources such as
private farms and Government Institutions. The
animals (8) received for post mortem examination
included goats (5), rabbit (1), Himalayan civet cat (1)
and leopard (1). The important observations at
necropsy were cachexia, gastroenteritis, renal oedema
and infarction in goats; chronic hepatopathy in
Himalayan civet cat, and pulmonary haemorrhages
and intestinal nematode infestation in leopard.
Histopathological processing and examination of
tissues was carried out in 129 cases including those
of rabbit, poultry (chicken, quail), mare, buffalo,
sheep, goats and wildlife (lion, hog deer, monkey,
Himalayan civet cat, leopard). The major microscopic
findings included sheep pox disease, verminous
pneumonia in sheep and goats; glomerulo-nephritis
and haemorrhagic gastritis in goats; renal amyloidosis
and severe diffuse interstitial nephritis and hepatitis
in mare; fibrino-purulent pneumonia and pericarditis
in lion; and multifocal glomerulo-nephritis and hepatitis
in Himalayan civet cat. A total of 60 blood samples
from goats, 1 cow, 3 leopards and 2 lions were
subjected to haematological tests such as, estimation
of haemoglobin, packed cell volume, total erythrocyte
count, total leucocyte count and differential leucocyte
count. Physical, chemical and microscopic
examination of urine was done for 6 cows suspected
to be suffering from Enzootic bovine haematuria and
urine samples of goats (60) maintained on sole oak
leaves feed. Faecal examination was done in 60
samples including those from cow (56), buffalo (2),
bullock (1) and dog (1). The major parasitic eggs
4 5
observed included Paramphistomum and Strongylus
spp. mixed infection (4), Fasciola hepatica and
Strongylus spp. mixed infection (2), Paramphistomum
and Moniezia spp. mixed infection (2), Moniezia and
Strongylus spp. mixed infection (2), Toxocara
vitulorum and Paramphistomum spp. mixed infection
(2), Fasciola hepatica and Paramphistomum spp.
mixed infection (1), Trichuris and Paramphistomum
spp. mixed infection (1), Fasciola hepatica (2)
(Buffalo-1), Strongylus spp. (4), Paramphistomum
spp. (11), Toxocara vitulorum (3), Trichuris spp. (1),
Ancylostomum caninum (1) (dog) and negative (27).
Culture sensitivity test was done in 16 samples from
human beings and one bullock. Field visits were
organized in 8 villages of district Kangra and Mandi,
Himachal Pradesh, to study the animal husbandry
and health practices and technical know-how was
provided on the queries raised by the farmers.
6. EXOTIC AND EMERGING DISEASES
(1) AVIAN INFLUENZA
(a) Vaccine development
(i) Development and evaluation of neuraminidaseDIVA marker vaccines against highly pathogenicH5N1 avian influenza viruses in chickens:Antigenic and genetic analysis of Indian isolates of
highly pathogenic avian influenza H5N1 viruses from
Indian outbreaks from 2006 to 2010 for selection ofhaemagglutinin gene donor vaccine candidate
revealed no major antigenic differences among these
viruses in the four antigenic sites of HA1 sequence,
except for few differences in the antigenic site B.
Based on the 3-D and 2-D antigenic cartography (Figs.
34 and 35) constructed on cross-HI data, H5N1 strain
A/chicken/West Bengal/80995/2008 was selected asthe best fit HA gene donor for reverse genetics based
DIVA marker vaccine. For development of reverse
genetics based non-pathogenic H5 vaccine strain,
the basic amino acid cleavage site RRRKKR*GLF in
the HA gene of H5N1 strain A/chicken/West Bengal/
80995/2008 was modified to IETR*GLF by sitedirected mutagenesis so that the recombinant virus
made through incorporation of mutated HA gene in
the reverse genetics backbone of type A influenza is
non-pathogenic and hence can be used as a vaccine
candidate.
Fig. 34: Antigenic map (3-D) of selected H5N1 influenza
viruses isolated at HSADL from 2006 to 2010. As shown
in the map, strain 80995 is located in the centre of all the
three axes of the map, hence, would be at a minimum
distance from all other viruses representing a best fit as
an HA gene donor virus.
Fig. 35: Antigenic map (2-D) of selected H5N1 influenza
viruses isolated at HSADL from 2006 to 2010. The relative
positions of strains (coloured with full virus name) and
antisera (grey coloured with only number format) were
adjusted such that the distances between strains and
antisera in the map represent the corresponding HI
measurements with the least error. The periphery of each
strain denotes the total error; thus, size and shape
represent a confidence area in the placement of the strain.
The vertical and horizontal axes both represent antigenic
distance. The spacing between grid lines is 1 unit of
antigenic distance - corresponding to a twofold dilution
of antiserum in the HI assay. As evident from the map,
the antisera against H5N1 strains - 142119, 100879,
155505, 80995 and 81760 are at a position in the map,
where most of the viruses are covered within two units of
antigenic distance (2 grid radius).
(ii) MicroRNAs differentially expressed in chickenlungs during H5N1 infection target immuneresponse genes and genes in the influenza Apathway: Four novel chicken miRNAs were identifiedfrom the high throughput sequencing data. 3135 target
genes were identified for the 36 upregulated and 5655
target genes were identified for the 90 down regulated
miRNAs databases namely miRDB and TargetScan.
389 genes involved in chicken immunology and 21
genes involved in the influenza A pathway were
predicted to be targets of the upregulated miRNAs,
while 677 genes involved in chicken immunology and
51 involved in the influenza A were predicted to be
targets of the downregulated miRNAs. Target sites
of several of the differentially expressed miRNAs
were identified in the segment 2 and segment 8 of
H5N1.
(b) Diagnostic development
(i) Development of an immunochromatographictest for the diagnosis of avian influenza virusinfection in chicken: The recombinant M1 and NPhas been expressed by induction of recombinant
E.coli BL21(DE3)pLyS with 1mM IPTG. The
recombinant proteins were bulk purified under native
conditions. Two sets of mice were inoculated with
AIV rM1 and rNP separately. The spleenocytes from
immunized birds were fused with myeloma cells and
4 6
selected 10 hybrids of M1 ab and seven hybrids of
NP ab were subcloned and MAbs were characterised.
The MAbs produced by rM1 hybridoma subcloneswere tested for their reactivity in dot blot and western
blot. They produced intense reaction with rM1 and
M1 of AIV H5N1. They did not react with allantoic
fluid from control SPF, NDV, bacterial cell Lysate or
with other HIS tagged recombinant proteins (NP of
AIV and Nipah Virus). However, they also did notreact with AIV H9N2 and SIV H1N1. Ten high reactive
clones have been cryopreserved. The MAbs produced
by rNP hybridoma subclones were tested for their
reactivity in dot blot and western blot. They produced
intense reaction with rNP but produced a mild reaction
with AIV H5N1.
(c) Characterization of viruses
The HA gene of 10 H5N1 viruses isolated fromWest Bengal (2), Jharkhand (1), Bihar (1), Meghalaya
(1) and Tripura (5) were sequenced. Further, the PB1
gene of 15 H5N1 viruses (Meghalaya-2, West Bengal-
2, Maharashtra-2, Jharkhand-2 and Tripura-7) were
also carried out. The phylogenetic analysis of HA
and NA genes indicated that the 2011-2012 H5N1viruses belonged to clade 2.3.2.1 and the 2008
viruses belonged to clade 2.2 H5N1 viruses (Figs.36
and 5). The PB1 gene of some of the clade 2.3.2
viruses isolated from chickens in Meghalaya grouped
with the unknown lineage of H9N2 viruses isolated
from Tripura in 2008 and Haryana in 2005 indicatingreassortment between the two subtypes of avian
influenza viruses (Fig.37). The antigenic relationship
of 16 clade 2.3.2 viruses isolated from various states
with that of clade 2.3.2 viruses isolated from Tripura
in 2011 and clade 2.2 virus isolated in 2008 was
studied. Antigenic analysis revealed 32 to 256-foldreduction in the HI titres between clade 2.3.2.1 H5N1
viruses and clade 2.2 viruses indicating that these
nine clade 2.3.2 isolates were antigenically similar
to Tripura clade 2.3.2 viruses and different from clade
2.2 viruses.
Fig. 35: Phylogenetic relationships of the
haemagglutinin genes of representative H5N1 influenza
A viruses. The tree was rooted to A/Goose/Guangdong/
1/96. Numbers near the node indicate bootstrap values
of ?90%. Clade/subclade are shown to the right. Scale
bar indicates nucleotide substitutions per site. The
isolates in red are sequenced during this year.
Fig. 37: Phylogenetic relationships of the PB1 genes of
representative H5N1 influenza A viruses. The tree was
rooted to A/Goose/Guangdong/1/96. Numbers near the
node indicates bootstrap values of ?90%. The isolates
in red are sequenced during this year.
(i) Pathogenic characterization of the viruses
isolated by IVPI test: The IVP index of 10 H5N1
viruses isolated from Tripura (2 from ducks and 5
from chickens), Jharkhand (2- crows) and West
Bengal (1-chicken isolated in 2008) ranged from
2.525/3.00 to 2.96/3.00 indicating that these isolates
are highly pathogenic to chickens. The IVP index of
one H9N2 virus isolated from a chicken in West Bengal
was found to be 0.325/3.00 indicating low
pathogenicity to chickens.
(d) Disease monitoring and surveillance
(i) Surveillance of Indian poultry and imported
samples: A total of 79,371 samples (45,806 tissue
and 33,565 serum) were received from various parts
of the country for avian influenza virus surveillance
during the year. Out of 44,910 tissue samples tested,
86 samples from nine States (5 from Assam, 6 from
West Bengal, 7 from Bihar, 12 from Jharkhand, 10
from Maharashtra, 5 from Meghalaya, 34 from Odisha,
4 7
Pig sera samples (507) were tested for antibodies
against H1N1 by HI test, 118 samples found positive.
Of the 507 pig sera samples tested for antibodies
against H5 and H9 by HI test, all were found negative.
(3) BOVINE VIRAL DIARRHOEA/BORDER
DISEASE:
(a) Disease monitoring and surveillance:
Diagnostic samples from cattle, buffaloes,
sheep, goats and imported biologicals (bull semen,
FBS, ABS, other biologicals) submitted by various
Govt. and private agencies and collected from field
were tested following the OIE prescribed methods.
A total number of 1096 samples were tested during
the period. Testing of 151 samples submitted through
AQCS showed the presence of BVDV neutralizing
antibodies in four imported FBS, and four adult bovine
serum samples. Of the 166 samples from cattle,
buffaloes and bisons belonging to various states
tested, eight cattle sera were found positive for BVDV
antibodies. Of the 779 samples (390 blood leukocytes
and 389 serum) from sheep, BDV was isolated from
a sheep (both leukocytes and serum) from a farmer's
flock migrating in Madhya Pradesh. Repeat testing
indicated that the lamb was persistently infected with
BDV. A high percentage of sheep (38.5% of 389
tested) were found to possess BDV neutralizing
antibodies.
(b) Effect of si-RNAs on BVDV-1 replication in
MDBK cells
The effect of small interfering (si) RNAs
(synthetic and cocktail) on BVDV replication in
cultured bovine cells showed that the siRNA cocktail
and three synthetic siRNAs produced moderate anti-
BVDV effect in-vitro as shown by 25-40% reduction
in BVDV antigen production, 7.9-19.9-fold reduction
in viral titre and 21-48 fold reduction in BVDV RNA
copy number. The siRNA cocktail was found to be a
better BVDV inhibitor than the earlier reported
individual siRNAs targeting 5'UTR and the structural
envelope region of BVDV can be effective targets
for designing siRNAs.
(c) Alterations in immunocompetent cells and
cytokines in the pathogenesis of acute
Bovine Viral Diarrhoea Virus infection in
sheep
Experimental acute BVDV-1 infection was
induced in 4-month-old lambs through intranasal
inoculation of Indian BVDV-1 isolate, Ind-17555.
Results demonstrated that the Indian BVDV-1
isolated can cause mild to moderate disease in sheep
characterized by mild increase in rectal temperature,
occasional diarrhoea, leukopenia, thrombocytopenia,
enlargement of enteric lymph nodes, lymphoid
depletion, petechiation in spleen, duodenal
congestion, and haemorrhage and bronchopneumonia
One from Uttar Pradesh and 6 from Tripura) have
tested positive for H5N1 virus by isolation. One of
the samples received from West Bengal was positive
by virus isolation but negative by RT-PCR and Real
time RT-PCR tests. Six H9N2 viruses were isolated
from three States viz. Odisha (4), Gujarat (1) and
Maharashtra (1). 18 suspected samples from Bhutan
were received for testing against AIV. Of these, 8
samples were positive for H5N1 virus by Real time
RT-PCR, RT-PCR and virus isolation. A total of 5,792
imported pork and poultry samples were also tested
for isolation and found negative. A total of 30,389
serum samples had been tested and none of the
samples were positive for H5 antibodies. A total of
853 serum samples from day old chicks of imported
grand parent stock have been tested and all the
samples were negative by AGID test.
(ii) Surveillance of avian influenza in migratorybirds: A total of 152 serum and 4490 swabs/tissues/
dead bird samples received from various parts of the
country were tested for avian influenza. Ten samples
from ducks (Jharkhand - 9 and Odisha - 1) were found
positive for H5N1 AIV by Real Time PCR, ELISA
and virus isolation. One each of H11N6 and H4N6
subtypes of avian influenza virus were also isolated
from duck samples collected from Jharkhand State.
(iii) Investigation of H5N1 avian influenza
outbreaks in crows: Reports of unusually highmortality in the crow populations from Jharkhand,
Odisha, Bihar, Maharashtra and Uttar Pradesh were
investigated in detail and the samples from crow
carcasses were tested for the presence of H5N1
influenza virus. A total of 38 crow samples were found
positive for H5N1 virus from all the above states
indicating a serious threat to not only the crow
population in the country, but also to the human and
other livestock population in view of the proximity of
crows to these populations.
(iv) Persistence of H5N1 avian influenza virus:
Persistence of H5N1 avian influenza virus in different
lake and water samples was studied at two different
temperatures. Considerable variation was observed
in the survivability of virus in different water samples
at various temperatures. The survivability of the virus
ranged from 2-5 days in the lake water and up to 10
days in pond water at 24º C. At 10º C, the virus
survived for 7-11 days in lake water and up to 18
days in pond water.
(2) SWINE INFLUENZA
(a) Surveillance of swine influenza (H1N1)
among pig population of India
The serological evidence of swine influenza
was recorded around 23% in pigs and there was no
evidence of any antibody against H5 or H9 Avian
influenza viruses. Pig nasal swabs (495) tested from
different states of India were found negative for H1N1.
4 8
due to secondary infections (Figs.38 and 39).
Immunopathogenesis of acute BVDV-1 infection in
lambs included changes in CD4+ and CD8+ T-cell
subset counts, up-regulation of pro-inflammatory (IL-
1 and TNF-α) and regulatory (IL-10 and TGF-β)cytokines in lymphoid organs.
Fig. 38: Demonstration of BVDV-1 antigen by indirect
immunofluorescent test in a) Brunner's gland of
duodenum and b) tonsil.
Fig. 39: Follicular lymphoid depletion in mesenteric lymph
node of BVDV-1 infected sheep.
(4) MALIGNANT CATARRHAL FEVER
(a) Diagnostic preparedness
Wild bison from Zoo at Bengaluru and a cattle
sample from the state veterinary hospital at Bengaluru
tested positive for ovine herpes virus-2 by OIE
approved primers for diagnosis by PCR and Nested
PCR (Fig.40). The results were confirmed by
sequencing and submitted to Genebank (Accession
No.: JQ801454).
Fig. 40: PCR amplification of tegument region with
primers set Bax-556 and Bax- 755 for outer PCR
Lane 1 Negative control; Lane 2 Positive control;Lane
3 Tissue sample cattle; Lane 5 Tissue sample cattle-2;
Lane 9 Blood sample bison; Lane 11 Tissue sample
sheep; Lane 1, 4, 6, 7, 8, 10 Negative field sample
(5) CRIMEAN-CONGO HEMORRHAGIC FEVER
(a) Diagnostic development
Developed novel molecular beacon probe
based diagnostic test for detection of CCHFV.
(b) Detection and molecular characterization
Detected Crimean-Congo haemorrhagic fever
virus in cattle in India. Phylogenetic analysis of 'S'
segment sequence of CCHFV revealed that the Indian
isolate is closest to Tajakistan virus (AY049083/TAJ/
HU8966) falling in Asia-2 group of the CCHFV (Figs.
41 and 42).
Fig.41: Full length amplification of CCHFV 'S' segment.
Lane 1. PCR product (1.67 Kb), Lane M. 1 Kb ladder
Fig. 42: Phylogenetic tree of CCHFV 'S' segment
constructed using Maximum Likelihood method.
Maximum Likelihood trees with 500 bootstrap replicates
were inferred using MEGA5. Phylogenetic analysis
reveals that Indian isolate falls in Asia-2 group of CCHF
virus.
4 9
(6) WEST NILE FEVER
(a) Diagnostic preparedness and surveillance in
migratory birds
A micro plaque reduction neutralization test
was optimized for detection of West Nile virus
neutralizing antibodies in wild birds. A total of 488
sera samples from different species of wild resident
and migratory birds were tested and 13 samples were
found positive for WNV antibodies by plaque reduction
neutralization test providing serological evidence of
WNV infection. Testing of 177 cloacal swabs, 20 oral
swabs belonging to seven states of India revealed
absence of WNV genomic RNA by real time RT-PCR.
Testing of 29 dead birds sampled from areas showing
high crow mortality during 2011-12 were tested
negative for WNV infection by real-time RT-PCR and
virus isolation.
(7) RABBIT HAEMORRHAGIC DISEASE
(a) Diagnostic preparedness
A total of 183 serum samples were received
from the Animal Quarantine and Certification Services
(Chennai) for the diagnosis of RHD in imported rabbits
and all were found negative by ELISA test.
(8) NIPAH VIRUS
(a) Surveillance in India
There was no evidence of Nipah virus infection
in sampled fruit-bat colonies from West Bengal and
no antibodies against NiV in pigs surveyed from W.
Bengal, Uttar Pradesh, Madhya Pradesh, Tripura and
Assam. Pig sera (240) samples tested for antibodies
against Nipah virus by ELISA and Western Blot and
all samples were negative. Bat urine samples (68)
and pig nasal swabs (113) were processed and tested
by RT-PCR for Nipah virus, all were negative. Bat
urine/faecal samples (78) and swine nasal swabs (15)
were tested for Nipah with Taqman real-time RT-PCR
and all found negative.
(9) PICOBIRNA VIRUS
Picobirna virus, a dsRNA bi-segmented virus
was detected in diarrhoeal cases of cow and buffalo
calves. The genome segment 2 encoding RNA
dependent RNA polymerase has been amplified and
sequenced which also confirms the picobirnavirus
existence in bovines. The virus isolates have been
found to be of genogroup I.
7. DEVELOPMENT OF ALTERNATE
SYSTEM OF THERAPY
(1) HERBAL THERAPY
(a) Development of herbo-mineral formulation for
amelioration of lead toxicity
Experiment I: Ameliorative potential against lead in
circulation was best observed after 60 days in group
given extract of black garlic + zinc sulphate (3.07
ppm). Findings also indicating the immediate effects
of zinc on lead level in blood. The administration of
lead caused a marked increase in the relative liver
weight (10-40%) in all the treated groups, when
compared with negative control (3.56 g/100g b. wt).
However, relative increase in liver weight (g/100g b.
wt) amongst treated groups was least in group given
extract of black garlic + zinc sulphate (4.76). Results
indicated that supplementing zinc salt increased CMI
response
Experiment II: Results of the experiment indicated
ameliorative effect of calcium salt against lead
toxicity, however better results were obtained in
c o m b i n a t i o n w i t h M E D - P K - 5 ( Spirulina powder).
(b) Pharmacodynamic investigations of Entada
pursaetha and its therapeutic potential
Entada pursaetha stem extract referred here
in 'EPE' was investigated for its potential in modulating
the effect on inflammatory processes. Anti-
inflammatory effect of EPE with cellular model of
LPS stimulated RAW 264.7 cells was elucidated.
Some of the key proinflammatory cytokines and
mediators including TNF-α, IL-1β were studied by EIAkit. EPE significantly inhibited the production of TNF-
α, IL-1β and NO in LPS- stimulated RAW 264.7 cellsthan that of single LPS -stimulated cells. Based on
these results EPE in the doses of 20, 30, 50 µg/ml
was found to have anti-inflammatory effect and low
cell toxicity in MTT assay suggesting itse potential
therapeutic application in regulation of inflammatory
responses. EPE was studied for its antioxidant
activity in vitro by iron (III) and Iron (II) reducing activity
and Ascorbate Iron catalyzed phospholipid
peroxidation. EPE showed iron (III) to iron (II) reducing
activity, which increased with increase in
concentration. EPE also showed inhibition of
phospholipid peroxidation, with increase in
concentration of EPE. EPE (30 µg/ml) showed nitric
oxide free radical scavenging activity.
In conclusion, EPE was found to have anti-
inflammatory effect in in vitro system of inflammation
as evident by reduction of TNF-α, IL-1β and NO levelsin culture medium. Extract also possessed
antioxidant activity in in vitro test.
(c) Efficacy studies of some promising essential
oil preparations in experimental and clinical
haemonchosis and fasciolosis
In clinical cases of haemonchosis in sheep,
the formulations (EO-S1 and EO-S2) caused marked
reduction in EPG of Haemonchus contortus.
However, EO-S1 appeared more potent in reducing
EPG as compared to EO-S2. The essential oil
5 0
formulations (EO-S1 and EO-S2) were administered
orally to overnight off-feed sheep at a dose rate of 40
mg/kg t.i.d. at one hour interval with prior
administration of 10 ml Tyrode's solution. The effect
persisted for a period of 14 days. In some sheep,
EPG was reduced to zero while in other sheep there
was 80-90% reduction. In clinical cases of
haemonchosis in goat, both the formulations (EO-
G1 and EO-G2) produced marked reduction in EPG
of H. contortus in 60% of goats.
In experimentally infected sheep with Fasciola
gigantica both the formulations (EO-F1 and EO-F2)
produced diametrically different results. EO-F1
reduced the F. gigantica EPG to zero on 7th day
post-treatment and the effect persisted for one month.
However, EO-F2 did not reduce the EPG.
In conclusion, the essential oil formulations
(EO-S1 and EO-S2) showed marked efficacy against
H. contortus in sheep. Formulations EO-G1 and EO-
G2 produced marked but inconsistent effect against
H. contortus in goats. Formulation EO-F1 exhibited
highly significant efficacy against F. gigantica in
experimentally infected sheep.
(d) Assessment of cardioprotective effect of
herbal preparations
Standardization of the cardiomyopathy or
cardiac injury model in rat was done. Rats were
divided into two groups i.e. control and isoprenaline-
treated rats. Isoprenaline was used to create the
myocardial injury and infarction in the rat heart.
Different parameters were analyzed in control and
isoprenaline-treated rats as blood pressure, heart rate,
body weight, serum lactate dehydrogenase (LDH),
creatine kinase-myocardial band (CK-MB), triglyceride
and tissue lipid peroxidation, superoxide dismutase
(SOD). Blood pressure was recorded by invasive
method of carotid artery cannulation using reusable
transducer (AD Instruments, Australia). Isoprenaline
significantly decreased the blood pressure of the rat
in comparison to control. Lipid peroxidation was
increased while the SOD was decreased in
isoprenaline-treated rats. Isoprenaline increased
significantly (p<0.05) LDH, CK-MB, triglycerides level
in the serum. Heart weight of isoprenaline-treated rats
was increased significantly as compared to control
animals while body weight of the isoprenaline-treated
rats was decreased in comparison to control.
In conclusion, isoprenaline produced
myocardial injury and myocardial infarction in rat.
(e) Evaluation of therapeutic potential of
polymeric nanoparticle encapsulated
curcumin for management of subclinicalmastitis
A Method was standardized for preparation of
polymeric nanaoparticle-encapsulated curcumin.
Curcumin-loaded nanoparticles were formulated by
solid-in-oil-in-water emulsion technique with PLGA
(carrier) and PVA (stabilizer). The yield of the
nanoparticle-encapsulated curcumin was found to be
88%. The corresponding encapsulation efficiency of
curcumin in the nanoparticle was found to be 86%.
The curcumin-loaded PLGA nanoparticle prepared
was completely dispersed in aqueous media with no
clumps.
(f) Herbal acaricides
Following intensive screening, two herbal
acaricides have been identified and tested against
resistant ticks and found highly efficacious. Acarides
were also found efficacious against dog tick (R.
sanguineus) and buffalo lice. With 7-8%
concentration, 76-88% mortality and 47.2-59.6%
inhibition of oviposition (IO) in dog ticks was recorded.
In case of lice, 62.5-80% mortality was observed with
7-8% extract.
(i) Herbal acaricide I: The HPTLC finger printing
profile revealed the presence of "Rutin" as one of the
components in the extract (Fig. 43). The LC85 value
of the extract was determined as 8.05% through dose-
response bioassay against IVRI-I line of ticks. The
extract was found effective against resistant tick
lines (IVRI-IV) showing 20-100% mortality with 33.8%
IO while 40-100% ticks of IVRI-V line (multi-acaricide
resistant tick) were dead with 40.2% IO of the
survived ticks.
Fig. 43: HPTLC profile and identification of compound
in NBA-13/B/2 extract
In the challenged infestation, the efficacy of
the extract (E %) was obtained as there was 70.4 with
61.4% reduction in tick number (DT %). However, the
extract efficacy slightly decreased on 15 and 30 days
post treatment. There was no significant difference in
the DO % of ticks, however, DR % was decreased
from 10.6 to 5.4%. The overall efficacy was constant
up to 15 days post application (Fig.44).
5 1
Fig. 44: In vivo efficacy against R. (B.) microplus
Clinical trial using the formulation was
conducted on 60 cross-bred cattle stationed at
commercial dairy farm. Animals were treated with
optimum concentration of the extract and the efficacy
was monitored at 15 days intervals. The tick load
before each application was compared with the mean
pre-treatment tick load. The overall average
protection from tick infestation was obtained up to
86.9% during six applications. During the
experimentation period, the application of any
chemical acaricides was suspended.
(ii) Herbal acaricide II: Precocene-I was identifiedas one of the active components in the extract (Fig.
45). The LC90 value of the extract was determined
as 5.91% by dose-response bioassay against
acaricide susceptible IVRI-I line of R. (B.) microplus.
The anti-tick activity of the extract against resistant
IVRI-IV & V line of R. (B.) microplus was recorded in
the range of 60-80%. The extract was also found
effective (60-100% mortality) against dog tick,
Rhipicephalus sanguineus.
Fig. 45: HPTLC profile of acaricide II showing active
compound
The hexane and chloroform guided fractions
of the extract showed 60-100% and 60-80% efficacy
at 3% and 6% concentration, respectively, against
IVRI-II line of Hyalomma anatolicum. While in case
of lice, hexane and chloroform fractions exhibited 90-
100 and 60-90% mortality, respectively, when treated
with 6% concentration.
The efficacy (E%) of the extract in a pen trial
was found 67.0% and it persisted after 15 days of
extract application. However, direct effect of extract
(DT%) on the tick infestation was recorded as 45.3%
which reduced to 39.0% after 15 days. The extract
adversely affected the oviposition of ticks with 43.2%
reduction (Fig. 46). Repeat application of extract on
cattle was recommended in 15 days interval as
aqueous solution.
Fig. 46: In vivo data of acaricide II
The clinical field trial with the extract was
conducted at commercial dairy farm, where 75-80%
tick control was achieved when the extract wasapplied at 15 days interval by swabbing.
(iii) Resistance status of R. (B.) microplus tosynthetic pyrethroids (SP): The average resistancefactor (RF) of 6.1 (level II) was recorded in the ticks
collected from northern sub-temperate trans-gangetic
plains while high average RF values of 26.65 (level
III) was recorded in the ticks collected from tropicalmiddle-gangetic plains.
The overall prevalence of SP- resistant R. (B.)
microplus among the sampled farms was 66.6%. Out
of these 18 areas resistance to deltamethrin at level
I was detected in 08 areas (resistance factor=2.0-
4.9), at level II in 09 areas (RF = 5.2-11.8), at level
III in 01 area (RF=34.9) and at level IV in 01 area(RF=95.7). The resistance to cypermethrin was
detected in 16 areas and level of resistance was
detected at level I in 10 areas (RF=2.06-4.64) and at
level II in 06 areas (RF=5.13-9.88). At 05 places
amitraz resistance was found at level II (RF=9.3-23.3)
while the highest resistance factor of 27.3 (level III)was found in R. (B.) microplus at Sikar district of
Rajasthan. At 03 places amitraz resistance was
recorded at level I.
(g) Arsenic in food chain: cause effect andmitigation
Administration of an in-house poly-herbal
formulation and methionine was found to amelioratearsenic induced hematopoetic, hepatotoxic and
oxidative injuries in poultry model and was found to
reduce arsenic deposition in vital organs like liver
and kidney. Hematological parameters reflected a
5 2
marked impact of arsenic over the hematopoeticsystem as evident by significant (P<0.01) decline inhemoglobin level, TEC and TLC of the birds.Significant (P<0.05) rise of plasma ALT (alanine aminotransferase) and AST (aspartate amino transferase)profiles indicated severe hepatic insults followingarsenic exposure. However, administration ofmethionine and poly-herbal formulation exertedhepatoprotective effect as evidenced by normalserum enzyme level. Again, both the poly-herbalformulation and methionine prevented the elevationof erythrocytic lipid peroxidation and depletion of SOD(superoxide dismutase), catalase and GSH (reducedglutathione) in birds displaying their potentiality tosupport antioxidant defense system. Interestingly,the formulation and methionine also significantly(P<0.01) reduced the deposition of arsenic in vitalorgans like kidney and liver (Fig. 47 and 48). Itindicated that methionine as well as the herbalformulation increased the excretion of arsenic andprevented their long-term damage to host cell.
The dramatic ameliorative potentiality of theherbal formulation may be extended to the benefit ofother livestock and human being under chronicarsenic exposure. However, a long-term clinical trial
is also required for the same.
Fig. 47: Bar diagram displaying arsenic deposition inkidney tissue of the poultry birds. The data were
expressed as mean ± standard error. Different letters
shows statistical difference between the groups.
Fig. 48: Bar diagram displaying arsenic deposition in
liver tissue of the poultry birds. The data were expressed
as Mean ± SE. Different letters shows statistical difference
between the groups.
(h) Bio-prospecting of sea buckthorn(Hippophae) species for biomolecules withtherapeutic potential
Bioprospecting of sea buckthorn leaves for
antioxidant activity was carried out. Initially the sea
buckthorn leaves were extracted using different
solvents and solvent combinations such as methanol,
water and 50% methanol. The extracts were tested
for antioxidant activity using DPPH assay along with
standards. Though all the extracts showed very high
level of the activity, 50% methanol extract had slight
edge over the others. These extracts were also
analyzed with other antioxidant assays such as FRAP
and ABTS assays which showed antioxidant activity
in proportion to that of DPPH assay. These extracts
were analyzed in HPLC and number of
phytochemicals detected was more in 50% methanol
extract in comparison to the other extracts.
In order to further purify and identify the
compound responsible for antioxidant activity in the
methanol extract, bioactivity guided fractionation was
carried out. The extract was subjected to slilca gel
column chromatography and the fractions were
analyzed in thin layer chromatography (TLC) for
identification of the compounds and antioxidant
activity (in situ DPPH assay). The percentage
inhibition in DPPH assay varied from 4 to 96% in
different fractions and the fraction with more number
of bands in TLC had relatively higher antioxidant
activity.
(i) Clinical evaluation of herbal and homeopathicagents for augmentation of wound healingin domestic ruminants
Two square 2x2cm full-thickness skin excision
wounds, one on either side of dorsal midline and
2.5cm from the dorsal midline were made in rabbits
and medicaments were applied and the following
observations were made for subjective evaluation of
healing in wounds:
In the first step, wound healing potential of
Tridax procumbens extract was evaluated on
excisional wounds in rabbits. The wounds were
assigned randomly to 2 treatment groups. Tridax
procumbens extract applied topically over the wound
surface (treatment) and sterile normal saline dressing
(Control). Treatment was initiated immediately after
creation of wounds. Wounds treated with injection of
topical application of Tridax procumbens extract
showed better healing than control wounds and early
and faster epithelialization, wound contraction, and
shorter duration of complete healing in excisional
wounds. Histopasthological results confirmed
increased cellular proliferation (fibroplasia), early
control of inflammatory reaction, increasing the
formation of granulation tissue, neovascularization,
synthesis of collagen and better epithelialization and
early histological maturation than in control. It was
5 3
concluded that Tridax procumbens extract induced
faster healing as compared to control.
In second step, herbal group consisted of 5
treatments; topical application of Calendula officinalis(CO), Adansonia digitata (AD), oral administration of
graphites (G) and combination of Calendula officinalis
and graphites (CG). The findings of present study
indicated that application of CO, AD,G and CG
treatments augmented healing of excisional wounds,
but CG treatment resulted in early and faster woundcontraction, granulation tissue appearance and
shorter duration of complete healing in excisional
wounds than CO, AD, G and NS. Histopathological
and histochemical studies revealed that both CG and
CO augmented wound healing activity significantly
by increasing cellular proliferation (fibroplasia), earlycontrol of inflammatory reaction, increasing the
formation of granulation tissue, neovascularization,
synthesis of collagen and better epithelialization and
early histological maturation than control treatments.
(2) HOMEOPATHIC THERAPY
(a) Evaluation of certain homeopathic medicinesfor their immunomodulatory and/orantioxidant potential
Evaluation of homeopathic drugs for their
antioxidant and immunomodulatory potential through
a three tier system involving in vitro tests, in vivo
tests in laboratory animals and in vivo tests in clinical
cases indicated Azadirachta indica to be possessing
antioxidant potential and selenium to be possessing
immunomodulatory potential.
(b) Evaluation of potential of homeopathic systemfor clinical management of mastitis, fever,diarrhoea, skin ailment and injury
Homeopathic drugs (including phytolacca,
calc. flour., silicia, belladona, bryonia, podophyllum,
arnica, Calendulla officinalis etc.) were tried for their
efficacy against clinical conditions like mastitis/fever/diarrhoea/skin ailment/injury/milk enhancement and
retention of placenta. Homeopathic medicines/
combinations used were all tested to be safe.
Effective formulations could be prepared against the
indicated clinical conditions
(3) STEM CELL BASED THERAPY
Bone marrow derived mesenchymal stem cells
(BM-MSCs) from bubaline and caprine bone marrowwere isolated by ficoll density gradient method and
cultured in DMEM supplemented with fetal bovine
serum (FBS) using the standardized laboratory
protocol and characterized according to morphology,
growth dynamics, cell surface antigen profile, and
differentiation repertoire in vitro (Fig. 49).
MSCs showed high proliferation ratios,
expressed doubling time of 30-35 h and were found
positive for alkaline phosphatase. Buffalo and goat
BM-MSCs have the capacity to form plastic adherent
clusters of fibroblast-like cells when cultured in vitro.
Colony forming unit assay confirmed their clonogenic
property. These cells when subjected to RT-PCR were
found to be expressing surface markers viz., CD-73,CD-90 and CD-105 and their respective proteins were
localized through immunostaining. However, these
MSCs were found to be negative for haematopoietic
marker CD-34. Furthermore these cells expressed
pluripotency markers like Oct-4, Nanog and Sox2
when subjected to FACS analysis followed byimmunostaining (Fig. 50). In conclusion, bone marrow
derived MSCs could be successfully generated from
buffalo and goat, characterized through different
surface markers, showed high pluripotency potential.
Osteogenic differentiation was induced in vitro, after
21 days, the differentiated osteogenic cell populationshowed mineral deposits which were assessed by
Von Kossa and Alizarin Red staining (Fig. 51). These
cells are being expanded ex-vivo at P-10 level for
further therapeutic work. To the best of our knowledge
this is the first global report of buffalo BM-MSCs
which suggests that MSCs can be derived andexpanded from buffalo bone marrow and can be used
after characterization as a novel agent for
regenerative therapy.
Fig. 49: Buffalo mesenchymal stem cells (BM-MSCs);
alkaline phosphatase positive MSCs; and
normal chromosomal profile of buffalo BM-MSCs
Fig. 50: Localization of Oct 4 (A: Texas Red with nuclear
stain DAPI) and Sox 2 (B: Alexa Fluor 568 with nuclear
stain DAPI) mRNA transcripts by fluorescent in situ
hybridization using RNA specific DNA oligos. (Original
magnifications 400X)
Fig. 51: Osteogenic differentiation of buffalo BM-MSCsdetected by alizarin red Staining (A) and von Kossa
5 4
Staining (B). Buffalo BM-MSCs were incubated in
differentiation media for 21 days and were further
assessed for mineral deposition. (Original magnifications
40X) (C) Adipogenic differentiation of buffalo BM-MSCs
indicating red colored lipid droplets by oil red O staining
(Original magnifications 20X) (D) Chondrogenic
differentiation of buffalo BM-MSCs showing purple
colored metachromatic matrix (Original magnifications
10X).
Caprine Mesenchymal stem cells (MSC) have
been isolated, cultured and characterized. It has been
observed that caprine MSC grew better in 20% FBS
than 10% or 15% in DMEM with low glucose. However,
CR11 media could also be used for better proliferation
of these cells. These MSCs have been differentiated
into cardiomyocytes, which have also been
characterised. Caprine MSCs after tagging with PKH-
26, were transplanted in myocardial infarction in rabbit
and it was observed that these cells stayed in the
rabbit heart and helped in regeneration also, which
has been tested by tracking the cells. A transgenic
MSC expressing green fluorescence protein was also
generated which could be further propagated up to
4th passage.
(a) Caprine iPS colonies
Induced pluripotent stem cells (iPS) like cell
colony have been derived from buffalo fetal fibroblast
transected with lentivirus vector which is carrying four
pluripotent genes. The iPS colonies expressed
pluripotent markers and showed pluripotent gene
expression.
(b) Caprine neural stem cells
Neural stem cells have been isolated and
characterized from caprine fetal brain for the first time
in India. The neural stem cells expressed Pax6,
Nestin and SOX2 and Mushashi1 (Fig. 52). Neurons
have been developed from caprine mesenchymal
stem cells and they have been characterized.
Fig. 52: Molecular characterization of neural stem cell
markers. Lane M: Marker; Lane 1: Pax6; Lane 2: Sox2;
Lane 3: Nestin; Lane 4: GAPDH
(4) BACTERIOCIDAL EFFECT OF 2-
NITROPROPANOL AGAINST SELECTIVE
FOOD-BORNE BACTERIAL PATHOGENS
In-vivo effect of 2-nitropropanol (2-NPOH) in
chick model was studied using 4 days old chick.
Before using 2-NPOH, total count of intestinal
bacterial flora was assessed as 23x106 per gram of
faeces. After use of 2-NPOH (MIC dosage) total
bacterial count in such fresh chicks reduced to
14.6x106 per gram of faeces. Young grown culture of
Shiga toxic E. coli (STEC) and Salmonella gallinarum
was fed to fresh group of chicks and total bacterial
flora count was recorded as 33x107 and 29x107 per
gram of faeces. 2-NPOH (MIC dosage) was used in
this group of chick and total bacterial count was noted
as 11.2 x106 and 9.4x106 per gram of faeces. Above
all, the findings suggested that 2-NPOH in its MIC
dosage in chick facilitates its growth inhibitory effect
on Shigatoxic E. coli and S. Gallinarum.
8. MOLECULAR MECHANISM OF DRUGS
AND THEIR MONITORING IN ANIMAL
SYSTEM
(1) PHARMACOKINETIC STUDIES OfGATIFLOAXCIN IN SHEEP
The pharmacokinetics of gatifloxacin was
studied in non-lactating sheep. Gatifloxacin was
administered as a single intramuscular dose of 5 mg/
kg b.wt. Following intramuscular administration of
gatifloxacin (5 mg/kg), the drug was absorbed rapidly
and appreciable concentration of the drug was
detectable in plasma at 5 min i.e. 0.36 0.04 µg/ml
which continued to increase gradually to attained
Cmax of 1.24 0.24 µg/ml at 1.0 h (tmax). Thereafter,
the plasma levels declined gradually till 12 h (0.09
0.02). The concentration of gatifloxacin was
undetected at 24 h. Mean absorption and elimination
half-lives were found to be 0.27±0.06 and 2.88 ±0.26
h, respectively. The high value of AUC observed
i.e. 6.75±1.24 µg.h.ml-1 reflects the vast area of body
covered by drug concentration. Similarly high value
of Vd(area) 3.08±0.46 L/kg also indicate extensive
distribution of the drug into various body fluids and
tissues. The total body clearance (ClB) was found to
be 0.74±0. 14 ml/kg/h and MRT was 4.51±0.74 h.
Bioavailability of gatifloxacin after intramuscular
administration was found to be 61.6%. On the basis
of pharmacokinetic parameters obtained, it is
suggested that gatifloxacin may be used at a dosage
of 7.5 mg.kg-1 intravenously and 10 mg.kg-1
intramuscularly every 12 h for treatment of infections
in sheep.
9. ENVIRONMENTAL POLLUTANTS/
XENOBIOTICS AND THEIR IMPACT
ON ANIMAL HEALTH AND
PRODUCTION
(1) MONITORING IN CATTLE AND BUFFALOCARCASSES SURVEYED IN 2009-10 ANDINVESTIGATING OTHER CAUSES OF
MORTALITY IN VULTURES IN INDIA
The survey of 2009-10 included buffaloes (537),
cattle (1303), goats (37), sheep (9), dogs (5), horses
(4) and three non-descript samples out of 1898 liver
5 5
samples. Extract was prepared from each tissue and
stored as two aliquots at -20°C, one set for ELISA
and the other set for LCMS. Out of total 1898 extracts
analysed by indirect competitive ELISA, 156 were
found positive for the presence of diclofenac residue,
indicating 8.22% prevalence. However, these figures
included 310 samples collected from Rajasthan in
2008. Thus, in 2009-10 (by eliminating these 310
samples), 87 out of 1588 extracts were found positive
for diclofenac residue suggesting 5.47% prevalence.
State-wise prevalence was as follows: Andhra
Pradesh (0.61%), Haryana (9.09%), Jammu &
Kashmir (4.59%), Madhya Pradesh (5.22%,
Maharashtra (0.97%), Panjab (8.58%), Uttar Pradesh
(0.56%), West Bengal (2.97%), Rajasthan (19.25%),
and overall: 15.62% in 2010 and 22.25% in 2008. It
is apparent that the prevalence of diclofenac in
Rajathan is very high though in other states it is
declining.
Extracts were also prepared from 66 tissues
(liver and kidney) from 33 vulture carcasses as above
and stored at -20°C for residue monitoring. Out of 33
vultures, 12 were found positive for diclofenac
residue. The concentration of diclofenac residue in
positive samples ranged from 12 to 920 ppb. These
results suggest that in spite of ban on veterinary use
of diclofenac, it is very much in use still and warrants
strict measures to stop the illegal use of diclofenac.
Other conditions responsible for vulture
mortality as diagnosed by post mortem and
histopathology included systemic aspergillosis,
visceral gout, amyloidosis, hepatic cirrhosis and
multiple granulomas in lungs.
(2) EVALUATION OF TOXIC INFLUENCE OF
ARSENIC ON THE PHARMACODYNAMICSOF NONSTEROIDAL ANTI-INFLAMMATORY
DRUGS
The influence of arsenic exposure was
evaluated on the pharmacodynamic effects of a
selective cyclooxygenase-2 (COX-2) inhibitor.
Meloxicam was selected as the selective COX-2
inhibitor and used @ 3 mg/kg b. wt orally based on
the results of a pilot study. Adult male rats were
preexposed to arsenic (1 and 4 ppm of elemental
arsenic concentrations) as sodium arsenite daily
through drinking water for 28 days. Next day, the
pharmacodynamic effects of orally-administered
meloxicam were evaluated in arsenic-preexposed
rats. Inflammatory pain, inflammation and pyretic
responses were assessed through formalin-induced
nociception, carrageenan-induced inflammation and
lipopolysaccharide (LPS)-induced pyrexia,
respectively. Meloxicam decreased the number of
flinches in the late phase, but not in the early phase
of formalin-induced nociception. On the contrary,
arsenic increased the number of flinches in both the
phases. Arsenic-mediated increase in nociception in
the early phase remained unaffected in the rats given
meloxicam. However, both the concentrations of
arsenic attenuated the analgesic effect of meloxicam
in the late phase to the control level. Meloxicam
decreased the carrageenan-induced oedema volume,
while arsenic increased the oedema volume in a
concentration-dependent manner. At 4 ppm
concentration, arsenic inhibited the anti-inflammatory
effect of meloxicam, but not at 1 ppm level.
Meloxicam decreased the LPS-induced pyrexia.
Arsenic preexposure per se did not increase pyrexia,
but enhanced LPS-stimulated pyrexia. Preexposure
to arsenic attenuated the antipyretic effect of
meloxicam. Further, meloxicam strongly inhibited the
activity of COX-2, but caused only insignificant
reduction in COX-1 activity. Effects of arsenic on
COX activities were tissue- as well as COX isozyme-
specific. Arsenic only at the higher concentration
increased the COX-1 activity in rat paw muscle, but
had no effect on the COX-1 activity in rat
hypothalamus. Arsenic caused dose-dependent
increase in the activities of COX-2 in both the muscle
and brain tissues. Meloxicam decreased the levels
of PGE2, TNF-α and IL-1β levels, while arseniccaused dose-dependent increase in the production
of these mediators in rat paw muscle. In
hypothalamus, the LPS-induced increases in these
mediators were further dose-dependently enhanced
by arsenic. However, arsenic preexposure in both
the concentrations caused comparable reduction in
the inhibitory effects of meloxicam on these
inflammatory mediators and brought their activities/
productions to the control levels. These observations
substantiate the COX-2 selectivity of meloxicam as
well as demonstrate the higher susceptibility of COX-
2 to arsenic-mediated induction. Lesser susceptibility
of COX-1 to arsenic is further substantiated by the
insensitivity of COX-1 to arsenic in hypothalamus.
The results suggest functional antagonism of the
effects of meloxicam by arsenic. This may relate to
arsenic-mediated local release of the cytokines, TNF-
α and IL-1β, which cause induction of COX andconsequent release of PGE2, the principal mediator
of pain and inflammation. In conclusion, subacute
exposure to environmentally relevant concentrations
of arsenic through drinking water could exacerbate
pain, inflammation and pyrexia. Thereby, arsenic
could aggravate the pathogenesis of painful
inflammatory conditions and reduce the therapeutic
efficacy of meloxicam in chronically arsenic-exposed
subjects in the arsenic-endemic areas.
(3) T-2 MYCOTOXICOSIS IN ANIMALS:
PATHOLOGY, PATHOGENESIS, DIAGNOSIS
AND AMELIORATIVE MEASURES
Six batches of maize and wheat were cultured
and the T-2 toxin was estimated by TLC and
5 6
spectrophotometry. The levels of T-2 toxin obtained
were in the range of 10.52-32.34 ppm and were later
confirmed by AFAQAL, Namakkal. A total of 74
livestock feed samples were analysed by
aforementioned methods Fourteen samples were
found positive (range 0.035-1.344 ppm) for aflatoxin
while in 5 samples, T-2 toxin could be detected (range
0.25 to 0.642 mg/kg ppm). T-2 induced reproductive
toxicity and teratogenicity in was studied in rats. The
reproductive toxicity was induced in Wistar rats by
feeding T-2 toxin @ 0.25, 0.50 and 0.75 ppm in feed
continuously for 10 weeks. Important findings
observed retardation in growth and reduced
reproductive indices including pregnancy percent,
litter size, foetal body weight and crown-rump lengths
in dose dependent manner. The major gross
malformations were subcutenous hematoma,
macerated foetus, visceral anomalies including
internal hydrocephaly, microphthalmia, rounding of
heart and enlarged renal pelvis. Major skeletal
defects were developmental defects in skull bones,
sternebrae, vertebrae and ribs. The toxicated rats
developed anaemia and thrombocytopenia,
hypoproteinemia, hypoalbuminemia and
hyopglobinemia, increased values of serum ALT,
AST and creatinine in dose and duration dependent
manner in males and females of F0, F1 and F2. The
relative liver, kidneys and brain weights were
significantly higher while spleen, thymus, testes and
ovary weights were significantly reduced in T-2
intoxicated animals of all F0, F1 and F2 generations.
The type, extent and severity of the lesions were
dose dependent. Significant histomorphological
changes were noticed in kidneys, liver and testes,
ovary and uterus.
10.CLINICAL AND SURGICAL
INTERVENTIONS
(1) MANAGEMENT OF CHRONIC PANCREATIC
DISORDERS WITH SPECIAL REFERENCE
TO DIABETES MELLITUS IN DOGS
A total of 251 dogs were screened for diabetes
using blood sugar and clinical parameters and 27
(10.88%) (19 females and 8 males of different breeds)
were found to be diabetic. These dogs were divided
randomly into 3 groups of 9 animals each. One group
of animals received SD 2 @ 50 mg/kg orally daily,
another group received metformin @ 5 mg/kg b. wt.
and remaining group received SD 2 extract @ 50
mg/kg along with metformin 5 mg/kg orally. The
efficacy was assessed on the basis of clinical
response, blood glucose and insulin levels.
Observations were made up to 28 days. The test
extract SD 2 showed pronounced hypoglycaemic,
insulin releasing and hypocholesterolaemic effect in
clinical diabetic dogs.
(2) DEVELOPMENT OF BIODYNAMICTHERAPEUTIC REGIME AGAINST BOVINE
SUB-CLINICAL MASTITIS
A total of 298 lactating cows were screened
for the status of intramammary infection and milk
samples were collected from different villages of
Bareilly District. The preliminary screening for SCM
was done on the basis of CMT + to CMT +++ reaction
of the milk samples. CMT ranged between 0.21 and
2.68 point scores in milk samples either collected
from normal healthy cattle or animals positive for
SCM. The SCC ranged between 2.38 and 11.72 x 10
5 cells / ml of milk collected from normal healthy
cattle and animals positive for SCM. Out of 298 cows
screened, SCM was positive in 28% samples.
Pathogen isolated and identified on
biochemical tests- CNS 56%, S. aureus coagulase
positive 7% (CPS), Colibacilli 13%, Streptococcus
sp 5% and no growth 19%.
Out of 298 milk samples, 57 samples revealed
no growth on culture media on 3 repeated cultures.
Out of 57 samples, 12 samples amplified for Coa
gene by PCR at 809 BP. The overall prevalence of
mastitis was 19.16% and the Staphylococcus aureus
mastitis was 8.64% on quarter basis.
Twenty lactating cows spontaneously infected
with SCM were treated with udder tablets + udder
paste once a day for 15 days and compared with
standard treatment given with above treatment along
with Enrofloxacin @ 1.5 mg /kg b.wt for 3 days by
i.m. route. In cases of SCM, significant reduction of
SCC and TBC to an extent of 35.8% and 29 % (SCC,
9.2 to 6.3 x 105 cells/ml of milk, TBC 12 to 8.5x 103
cells/ml of milk) was recorded 15 days PT,
respectively. Similarly the LDH concentration in serum
reduced significantly on day 18.
Alpha-tocopherol concentration in serum of
lactating bovines ranged between 1.83 and 3.24 µg/
ml serum. The serum copper and zinc concentration
in mastitic cows was lower than normal.
Isolation and biochemical characterization of
polysaccharide fraction from Tinospora cordifolia -
the stem of T. cordifolia extracted with acetone, TCA,
methanol and water revealed the presence of highly
mitogenic polysaccharide fraction, one of the main
components of udder tablet. The phagocytic index
increased in post treated mice with significant
decrease in TBC and COX values.
(3) DEVELOPMENT OF DIAGNOSTIC MARKERS
AND CATALYTIC THERAPY FOR
MANAGEMENT OF HEPATOBILIARY
DYSFUNCTIONS
Common chemically known nutraceuticals
were selected on the basis of their in vitro assessment
by ferric reducing antioxidant power activity assay
5 7
and ascorbate - Iron (III) - catalyzed phospholipids
peroxidation assay. During in vivo study, hepatotoxic
rats receiving selenium as an antioxidant revealed
best followed by vitamin C treated group and zinc
treated group when compared for therapy with single
antioxidant only. During combination (vitamins and
minerals) therapy, best antioxidant potential was
revealed in rats which received Zn + Se + vitamin C,
followed by Zn + Se and Zn + vitamin C. In multiple
combination (vitamins, minerals and standard
hepatoprotectant) therapy which received best
antioxidant potential was revealed in rats Zn + Se +
vitamin C + Silymarin followed by Zn + Se + vitamin
C, Zn + Se and Zn + vitamin C. Study revealed that
use of minerals, vitamins and standard
hepatoprotectant in combination provides synergistic
activity as a potent antioxidant as well as
hepatoprotectant in sub-acute to chronic hepatopathy
of rat.
In vitro assessment for antioxidant potential
of nutraceuticals revealed most potent antioxidant
properties in HNAP-11 among the 11 selected bio-
organics of plants origin, and HNAB-2 among 3 bio-
organics of animal origin. Study conducted to evaluate
hepatoprotective potential of certain nutraceuticals
in sub acute hepatotoxicity in rat model revealed
promising hepatoprotective activity by HNAP-11 and
HNAB-2 individually and also as a combination
therapy. Safety trial of the effective nutraceuticals
did not depict any side effects. Validation of
hepatoprotective potential was done in 12 dogs
confirmed for HBD. Neutraceuticals namely HNAP-
11 @ 100 mg/kg b.wt + HNAB-2 @ 100 mg/kg b.wt
as a combination therapy showed potent
hepatoprotective property in clinical cases of HBD in
dogs.
(4) STUDIES ON HALOTHANE AND
ISOFLURANE INHALATION ANAESTHESIA
IN LARGE RUMINANTS
Six male buffaloes used in groups T and P
were divided in eight subgroups T1, T2, T3, T4, P1,
P2, P3 and P4. In T1 and P1 dexmedetomidine (2.5
µg/kg) and pentazocine (0.05 mg/kg), in T2 and P2
midazolam (0.05 mg/kg) and pentazocine (0.05 mg/
kg), in T3 and P3 dexmedetomidine (2.5 µg/kg) and
butorphanol (0.05 mg/kg) and in T4 and P4 midazolam
(0.05 mg/kg) and butorphanol (0.05 mg/kg) were
administered i.v. In groups T and P, induction was
done by i.v. 5% thiopental and 1% propofol,
respectively. Maintenance was done by isoflurane in
100% oxygen using a large animal anaesthetic
machine. The treatments were compared by
clinicophysiological, haematobiochemical and
haemodynamic parameters.
Dexmedetomidine and pentazocine/
butorphanol were better preanaesthetics as compared
to midazolam and pentazocine/butorphanol for
thiopental/propofol and isoflurane anaesthesia. The
dose sparing effect of these drugs on thiopental and
isoflurane anaesthesia was more as compared to
propofol. All the combinations produced adequate
surgical anaesthesia. However, dexmedetomidine,
butorphanol/pentazocine, thiopental and isoflurane
were found better. Cardiopulmonary functions were
well preserved with all the drugs and none of the
combinations produced any deleterious effects on
vital organ functions and were found safe in buffaloes.
A few better combinations were used in clinical cases
in cattle (14) and buffaloes (12) for the management
of different surgical conditions.
(5) ISOLATION, CULTURE, CHARACTERIZA-
TION AND EVALUATION OF BONE
MARROW DERIVED MESENCHYMAL STEM
CELLS FOR THE HEALING OF SKIN AND
CARTILAGE DEFECTS
The study was conducted to evaluate the
efficacy of bone marrow derived mesenchymal stem
cells (BM-MSCs) for the repair of full thickness skin
wounds in rabbits and compared with control treated
with hydrogel applied topically. Twelve rabbits of 6-8
months of age and 1.5 -2.0 kg of b.wt were divided in
two groups, i.e. treatment and control groups. Two
full thickness skin excision wound, one wound each
on either side of the dorsum were created under
xylazine-ketamine general anaesthesia in all the
animals. BM-MSCs were injected s.c. at four sites
around the wound margins once on day 0 in treatment
group. In control group PBS was injected at four sites
in the similar manner. Subsequently, the wounds in
both groups were cleaned daily with PBS, and pluronic
F-127 hydrogel was applied topically to keep the
wounds moist.
The wounds treated with stem cells showed
rapid contraction between 7th and 14th day, while in
control group rapid contraction was seen between
14th and 21st day. There was a rapid contraction of
the wound in treatment group and the mean wound
size reduced to 10-20% of initial size by day 14, <
1% by day 21 and complete healing was noticed by
day 23. In control group mean wound area was 45-
55% of initial size by day 14, 10-15% by day 21 and
complete contraction was not seen on day 28. Stem
cell treated animals showed complete healing by day
23, while the scab still remained at the wound site on
day 28 in control group, indicating incomplete healing.
There was apparently full covering of wound area with
hair in all the treated animals while control group has
shown sparse hair growth in and around the wound
site. The results of the study indicated that bone
marrow derived stem cells when injected into the
wound margins can enhance the healing of the full
thickness skin wounds in rabbits.
5 8
(6) MESENCHYMAL STEM CELLSCONSTRUCT ON OSTEOGENESIS FORREPAIRING LARGE BONE DEFECTS INANIMAL MODEL
Protocol for isolation, proliferation and culture
of bone marrow derived MSCs from New Zealand
White rabbits was standardized. In vitro osteogenic
differentiation of BM-rMSC was performed in
monolayer culture for 3 weeks. Rabbit MSCs of 4th
passage were induced towards osteogenesis after
reaching 60-70% confluence. For osteogenic
differentiation, cells were cultured in an osteogenic
induction medium, consisting of 10-8 M
dexamethazone, 1M ß-glyserophosphate and 50µg/
ml L-ascorbic acid. Osteogenic induced cell cultures
changed morphology from adherent monolayer of
swirling spindle shaped cells, which was still apparent
in the control cultures, to layered cell clusters
surrounded by a matrix-like substance positive upon
Alizarin Red S. Statistically significant higher
quantities of calcium deposition and alkaline
phosphatase activity at the 90% level were
demonstrated in these osteogenic induced culture
wells. In positive cases, the nucleus of MSCs took
bluish-purple colour.
Flow cytometric analysis for characterization
of rMSC by expressing positive (CD-105, CD-29, CD
44) and negative (CD-34 and CD-45) CD markers was
initiated. The HA/TCP bio-ceramic tissue engineering
construct seeded with rMSCs was developed. In vivo
osteogenesis and osteoinduction by this construct
at 15 mm critical sized radius bone defect in rabbit
model was observed.
(7) DEVELOPMENT OF BIOENGINEEREDCOLLAGEN MATRICES FORRECONSTRUCTIVE SURGERY
The acellular collagen matrices (decellularized
pericardium and diaphragm) were used for 3-D in vitro
growth of mouse embryo fibroblasts (MEF) and were
tested in experimental cases of artificially created
wounds in rats as per standard protocols. All the
wounds implanted with grafts and control wounds
showed wound contraction, scab formation, change
in the wound size and colour. There was gradual
decrease in the wound area as the days of implantation
increased. Maximum reduction in wound area was
observed in bioengineered graft implanted animals.
Bioengineered diaphragm matrix (BDM) and
bioengineered pericardium matrix (BPM) showed a
complete healing of the wound by day 18 and 21,
respectively. On the basis of the results, the acellular
pericardium and diaphragm seeded with mouse
embryo fibroblasts were found to be novel
biomaterials, which have amphipathic character in
full thickness skin repair and enhanced wound
healing. The acellular diaphragm seeded with mouse
embryo fibroblasts have an edge over seeded acellular
pericardium in full thickness skin wound repair. The
acellular pericardium and acellular diaphragm alone
have wound healing potency, however, seeding with
MEF increases the wound healing potency.
(8) DEVELOPMENT OF BIOENGINEERED
COMPOSITE SCAFFOLDS FOR BONEREPAIR USING FETAL CELLS
Femur bone samples of animals aged 1-1.5 yr
from the bovine slaughter house were collected. It
was then cut into small pieces of 20 mm width and
20 mm height by using osteotome. The samples were
made from the cortical as well as cancellous bones.
The decellularization was attempted using three
standard protocols of bone decellularization: (i)
immersing in 250 ml of solution containing a mixture
of 25% acetone and 75% ethanol (vol %) combination,
(ii) immersing in solution containing 1% sodium do-
decyl sulfate, and (iii) subjecting the explants to 5
freeze-thaw cycles. The explants were tested for the
presence of cells by histopathology and scanning
electron microscopy. For the isolation of fetal cells,
two pregnant (full term 30-31 days) New Zealand White
rabbits of 6-8 m of age and 2-3 kg of b. wt were
utilized by performing caesarean section under
xylazine-ketamine anaesthesia. The bone samples
were aseptically taken out; the bone was sectioned
into small pieces and were digested at 37°C for 15
min with 0.25% trypsin and shaken well and laid in a
plastic culture flask with suitable medium. It was then
inverted and incubated in a humidified atmosphere
with 5% CO2 at 37°C. The medium was changed twice
a week till nearly confluent cell layers around the
bone tissue (80% covering of the total culture flask
area) were formed. The normal culture medium
contained DMEM supplemented with 10% v/v FBS,
penicillin and streptomycin. The protocol has been
successfully developed for decellularization of bone
explants by all the methods tried.
(9) STUDIES ON CARDIAC STRUCTURAL ANDFUNCTIONAL ASSESSMENT IN DOGS WITHSPECIAL REFERENCE TO CARDIACIMAGING
Echocardiographic reference values in 48
clinically healthy, adult Spitz (24) and Labrador
retriever (24) dogs of both sexes were compared to
find out the effect of body weight and sex on these
parameters. In Spitz, body weight was found to
significantly affect the values of some of the left
ventricular and mitral valve parameters, which
included left ventricular diameter at diastole (LVDd),
left ventricular diameter at systole (LVDs),
interventricular septal thickness at diastole (IVSd),
intervenricular septal thickness at diastole (IVSs),
left ventricular posterior wall thickness at diastole
(LVPWd), left ventricular posterior wall thickness at
systole (LVPWs), end diastolic volume (EDV), end
systolic volume (ESV), stroke volume (SV),
5 9
maximum amplitude of anterior mitral valve leaflet
(DE amplitude) and E point to septal separation
(EPSS), and had an increasing trend with increase
in body weight. Insignificant effect of gender was
seen on some of the echo parameters but significant
effect was seen on DE amplitude, where males had
significantly higher values. In Labrador retriever, body
weight was found to significantly affect the values
of some of the left ventricular and mitral valve
parameters including LVDd, LVDs, IVSd, IVSs,
LVPWd, LVPWs, EDV, ESV, SV, DE amplitude and
EPSS, and had an increasing trend with increase in
body weight. Insignificant effect of gender was seen
on all the echo parameters.
Fifteen clinical cases of different cardiac
ailments (dilation cardiomyopathy, hypertrophic
cardiomyopathy, mitral regurgitation, pericardial
effusion etc.) in dogs were diagnosed as well as their
therapeutic efficacy was evaluated. Vertebral Heart
Score (VHS) was calculated in 12 adult healthy
mongrel dogs consisting of six males and six females
with an average age of 2.5 yr, and average b. wt of
14.5 kg. VHS in mongrel dogs was 9.7±0.67
vertebrae, VHS in females was 9.8±0.12 and in
males 9.6±0.09. No significant difference (P>0.05)
of VHS was found between males and females.
(10) A NEW THERAPEUTIC APPROACH TO
CANINE MAMMARY TUMOURS
A total of 89 tumour cases (CMT-66%, CTVT-
12% and others 22%) were recorded in canines. The
incidence was highest in the age group of 7-9 yr and
highest in Spitz followed by German shepherd and
mongrel breeds. Histopathologically benign and
malignant tumours were 16% and 84%, respectively.
Different treatments namely mono-
chemotherapy (5-Flurouracil), Anti-angiogenic/
estrogenic therapy (Tamoxifen), cryosurgery,
combination chemotherapy (5-Flurouracil with COX-
2 inhibitor-Etoricoxib), chemotherapy with
immunotherapy (5-Flurouracil with Etoricoxib +
Levamisole), adjuvant chemotherapy (surgery + 5-
Flurouracil + Levamisole) and surgical therapy were
given as per the merit of the case and owner's
consent.
Percentage of apoptotic cells increased at
succeeding weeks of chemotherapy as compared to
pre-treatment values. 5-Flurouracil along with
Etoricoxib + Levamisole was found to be a promising
combination for the treatment of CMT. Anti-
angiogenic drug also showed good response. Large
size mammary tumours responded well to surgery
along with chemotherapy. Higher expression of p-
53, Cox-2 and MMP-7 genes was detected in
mammary tumour tissues than normal mammary
tissues.
(11) DEVELOPMENT AND EVALUATION OFINTERLOCKING NAILS AND LOCKINGPLATES FOR INTERNAL FIXATION OFFRACTURES IN LARGE ANIMALS
An interlocking nail (ILN) system for femur and
humerus of large ruminants was developed. The
optimum dimensions of ILNs for animals weighing
about 50-200 kg were found to be of 18-20 mm in
diameter and 18-24 cm in length. The ILN was then
used successfully for fixation of femur fractures in 3
buffalo calves (in 2 cases by retrograde and in one
case by normograde technique). The angular tibial
ILN was used in 6 cases for tibial fractures in large
ruminants (2 calves, 2 adult buffaloes and 2 cows).
The contoured locking plates for radius and
tibia were designed and developed. The dimensions
of the designer locking plate for tibia include 18-24
cm in length, 5-6 mm in thickness, 15-30 mm in width
with 16-20 locking holes in two rows; screws are of
30-60 mm long and 5.5 mm diameter. The dimensions
of locking plate for radius were 16-22 cm in length, 5-
6 mm in thickness, 25-30 mm in width with 16-20
locking holes in two rows; screws were of 30-60 mm
long and 5-6.5 mm diameter.
(12) DEVELOPMENT OF PHYSICAL THERAPYAND REHABILITATION PROTOCOLS IN
VETERINARY PATIENTS
Clinical studies were conducted in 40 dogs
suffering from hind quarter weakness. The animals
were divided into 5 equal groups, I to V and subjected
to conventional drug therapy, CDT (n=8) alone; and
in combination with therapeutic ultrasound, US (n=8);
electroacupuncture, EA (n=8); static magnetic field,
SMF (n=8); and interferential, IF (n=8) current,
respectively. All treatments were continued for 14
days. CDT was given using methyl prednisolone
acetate, meloxicam, gabapentine, mecobalamine,
vitamins B1, B6, B12 and D-Panthenol. US therapy
was applied at a frequency of 1 MHz and an intensity
of 0.5 Watt/cm2 for 5 min daily in a pulsed mode. The
electro stimulation of acupoints, Bai Hui, BL-30, GB-
34, ST-36, BL-67 and GV-1) using 55-100 mA
intensity, 50 Hz frequency and 9 Volts DD wave
current was given daily for 10 min. For SMF, 4 bipolar
magnets bars, each of 850-950 G strength and
embedded in a bandaged pad, were placed daily for
2 hr on lumbar region in a way that each magnet of a
pair lay on either side of the vertebral column with
the opposite poles facing each other. Interferential
therapy at 4 KHz frequency, using 2 pole electrodes
over the lumbar region was given daily for 10 min. All
the animals regained their normal postural reactions,
except hopping reaction in hind limbs, by day 14 of
the therapy. Hopping reaction was achieved in 25
dogs (2 in group I, 4 in group II, 6 each in groups III
and IV and 7 dogs in group V) by day 14 and in rest
of them by day 28. US therapy was also given to 4
6 0
horses, presented with the symptoms of peripheral
myopathy, at 1 MHz and 1 Watt/cm2 daily for10 min
along with drug therapy. Progressive improvement
was noticed in horses after 3-5 sessions of the
therapy.
11.CLINICAL AND DIAGNOSTIC
SERVICES
(1) CLINICAL DIAGNOSIS, TREATMENT ANDPROPHYLAXIS OF LIVESTOCK DISEASES
Total number of cases presented to Referral
Veterinary Polyclinic of IVRI was 4252. Treatment
was provided to the cattle, buffaloes, horses, sheep,
goats, dogs, cats, and poultry for various diseases
like bloat, ruminal impaction, acidosis, helminthiosis,
theileriosis, anaplasmosis, ketosis, alkaline
indigestion, colibacillosis, babesiosis,
trypanosomiasis, traumatic reticuloperitonitis,
mastitis, colic and tetanus, PPR, mycoplasmosis,
scabies, CD, parvoviral infection, leptospirosis,
babesiosis, ehrlichiosis, pyoderma, congestive heart
failure, renal failure, deworming, vaccination, etc.
Total of 146 cases have been subjected to
ultrasonography, and in 120 cases ECG was done.
(2) CLINICAL AND PREVENTIVE HEALTHCARE OF LIVESTOCK OF IVRI
A total of 4863 morbid cases were treated.
Wound and diarrhoea were the most common
conditions. Activities performed included vaccination
against FMD (1948 animals), PPR (86 animals), HS
(254 animals), enterotoxemia (709 animals) and
sheeppox (160). Deworming was carried out in 1853
animals and ectoparasiticidal dipping/spray in 758
cases. Neonatal care was provided to 102 animals.
Study indicated that skin diseases, diarrhoea,
weakness were associated with a disturbance of
oxidant-antioxidant system and antioxidant
preparation was found to be useful.
Immunomodulatory adjunct therapy was also
beneficial in making the animals recoup in many
clinical states.
A total 1178 cases from livestock farms were
treated for different conditions. Common conditions
included wounds-355, enteritis-286, ringworm/mange-
86, mastitis-83, debility/weakness-76, joint ill/arthritis-
55 and rest of the cases were of pneumonia, tympani,
eye infection, milk fever, spraying, dislocation, hernia,
lameness etc. Besides, the vaccination against FMD
(1372), haemorrhagic septicemia (607), brucellosis
(99) was regularly done in the livestock farm. The
deworming and coccidiostat (832 animals) and
application of ectoparasiticide (1466) were also
accomplished. Supplementation of multivitamins was
given to 405 weak animals.
A total 915 cases reported ailing at LPR pig
during the period; which comprised of wound-680,
lameness-49, enteritis-96, skin lesions/dermatitis/pox
like lesions-12, pyrexia-6, weakness/dullness-68
cases, umbilical hernia one, farrowing difficulty
(dystocia)-1 and hypoglycaemia-2. Besides,
prophylactic measures were also provided, which
included iron and Vit. B-Complex injection at 4th and
14th as well as at 5th and 15th day of age, respectively,
in piglets; annual vaccination against FMD and
classical swine fever in all the stock (except
pregnant). During the year, 160 animals were
vaccinated against FMD and 125 animals were
vaccinated against classical swine fever. The routine
deworming (193 animals) and disinfection were also
done.
(3) TREATMENT OF SURGICAL CASES,PREPARATION OF ANIMAL MODELS,COLLECTION OF BIOPSIES ANDRADIOLOGICAL DIAGNOSIS
During 2011-2012, 2896 surgical cases,
referred by field veterinarians and different sheds of
the Divisions of the institute, were successfully
treated. The maximum number of cases were of
different types of wounds (623), urolithiasis/urinary
obstruction (384), fractures (315), lameness (250),
posterior paresis (220), ocular affections (176),
tumours (162), otitis (76), multiple trauma (75),
castration (69), cesarean sections (50), aural
haematoma (45), congenital conditions (36), rickets/
NBD (36), ovariohysterectomy (34), udder/teat
affections (33), hernias (28), foreign body obstruction
(22), docking (11), rectal/vaginal prolapse (05), and
miscellaneous surgical conditions (246).
Animal models (46) prepared during the period
included castration in pigs (20), cardiac ischemia
model in rabbits (10), uterine flushing for collection
of embryos in goats (08), testicular biopsy in sheep
(06) and vasectomy in buffalo bulls (02).
A total of 766 radiographs were taken for
diagnosis in clinical cases and for the evaluation of
research results in experimental animals (clinical-621,
research and teaching-138). Contrast radiography was
performed in a few cases. Radiographs were also
taken for wildlife cases (03).
A total of 658 ultrasonographic scanning in
experimental and clinical cases in different species
of animals were done for evaluation/diagnosis of
cardiac, reproductive tract disorders of ovaries and
uterus, GIT and urinary tract disorders.
(4) DIAGNOSIS AND TREATMENT OFREPRODUCTIVE PROBLEMS INLIVESTOCK AND FIELD AI WORK ATINSTITUTE POLYCLINIC
A total of 462 cases of bovines (221), canines
(190), caprine (42), equine (08) and ovine (01) were
treated for various reproductive problems as shown
in Table 6. A total of 699 field AI and 83 pregnancy
diagnosis were performed in cattle and buffaloes.
6 1
Table 6: Reproductive problems treated at Institute Polyclinic
Disorders % (No.) Disorders % (No.)
P. D. 22.94 (106) Repeat breeding 6.06 (28)
Metritis/Pyometra 8.8 (41) Dystocia 10.60 (49)
In heat 5.84 (27) Anestrus 3.46 (16)
Uterine Prolapse 3.24 (15) Uterine torsion 3.24 (15)
Abortion 2.3 (11) Ret. of placenta 3.03 (14)
Post mating 1.2 (06) Infantile genetalia 0.4 (02)
Misc. 6.2 (29) Gyne. Exam. 11.68 (54)
Ref. to Surgery 8.8(41) Ref for Medicine 1.2 (06)
Macerated foetus 0.2 (01) Mucometra 0.2 (01)
Total cases treated: 462
were found infected with Theleria annulata and 2 with
Trypanosoma evansi. In equines, Trypanosoma
evansi infection was recorded in 7 of the 65 cases.
Out of the 11 canine skin scrapping samples, 7 were
found positive for Demodex canis and 2 for Sarcoptic
mange. Amongst the faecal parasites, 2 bovine
samples were positive for Fasciola sp. eggs and 1
for mixed infection of Toxocara vitulorum and
strongyle eggs. The canine samples were found
positive for Ancylostoma sp. and Toxocara sp. eggs.
(7) COMPARATIVE EVALUATION OF IMAGINGTECHNIQUES, ELECTROCARDIOGRAPHICCHANGES AND BLOOD BIOCHEMICALFINDINGS TO EVOLVE DIAGNOSTICMARKERS FOR CARDIOPULMONARY ANDUROGENITAL DISORDERS IN CANINES
Out of 372 cases suspected for cardio-
pulmonary disorders, 81 cases showed abnormal
changes in electrocardiography. The cases which
showed abnormality in clinical examination and in
ECG were subjected to further examination like
echocardiography, radiography and cardiac biomarker
estimation to confirm cardio-pulmonary disorder. 16
cases were diagnosed as cardiomyopathy, 41 cases
showed other complications. The biochemical
parameters estimated (41 cases) were creatine
kinase (ck-MB), LDH, sodium, potassium,
magnesium, ALT, AST, BUN and creatinine. The
cardiac biomarkers NT-proBNP, Troponin-I, and
Troponin-T were also estimated. Three cases showed
severe cardiomegaly by Vertebral Heart Score
method in thoracic radiograph. The diagnosed cases
of cardio-pulmonary disorders were treated
accordingly and most of the cases showed
improvement in condition.
(8) EVALUATION OF CYTOLOGICALTECHNIQUES FOR RAPID DIAGNOSIS OF
PET ANIMAL DISEASES
A total of 45 clinical cases of dogs were used
to evaluate cytological techniques in rapid diagnosis.
The samples examined included 38 cases of
(5) PRODUCTION AND SUPPLY OF FROZENSEMEN OF CATTLE AND BUFFALO BULLSAT GERM PLASM CENTER
A total of 41820 frozen semen straws from
Vrindavani (11735 straws), Tharparkar (1235 straws)
and buffalo (28850 straws) bulls were produced.
Frozen semen of 3110 straws from Vrindavani,
Tharparkar and buffalo bulls were supplied to the AI
unit of Cattle and Buffalo farm, Key Village unit of
Animal Reproduction division, Physiology division,
Extension division, IVRI campus of Mukteswar, AGB
division and AR division. A total of 673 ml of liquid
semen from Tharparkar and also 673 ml of liquid
semen from Vrindavani were supplied to LPM section.
592 straws of six Vrindavani, 1657 of three Tharparkar
and 4429 semen straws of nine buffaloes are stored
at Germ Plasm Centre. A total of 13923 straws of
Vrindavani, 1025 straws of Tharparkar and 26109
straws of buffalo semen were sold to outside
agencies.
(6) DIAGNOSTIC SERVICES IN POLYCLINIC
A total of 1221 samples, collected from 716
clinical cases (520 canine, 123, bovine, 65 equine, 1
feline and 7 caprine) were examined. The whole blood
was subjected to haematological tests such as,
estimation of haemoglobin (609), total erythrocyte
count (578), total leucocyte count (611) and differential
leucocyte count (622). The peripheral blood smears
(579) were examined for presence of haemoprotozoan
parasites. Faecal examination was conducted in 359
cases for the presence of eggs/larvae of various
parasites, 43/359 were positive. The skin scrapings
were examined for the presence of mites in 11
animals. Urine samples of 05 animals were subjected
to routine examination.
Among the haemoprotozoan parasites,
Babesia canis, B. gibsoni, Theileria annulata,
Erhlichia canis, Trypanosoma evansi and Anaplasma
sp. were recorded in different animal species. In dogs,
Ehrlichia canis was recorded in 6, Babesia gibsoni in
6, and Babesia canis in 9 cases. In bovine, 4 cows
6 2
neoplasms, 5 urine samples and 2 growths. The
neoplasms of mammary gland (13), skin (5),
connective tissue (3) and genital organs (1) were
studied using cytological and histological techniques.
Cytological techniques used included fine needle
aspiration cytology (FNAC), impression smear and
tissue triturate. A total of 76.2% of the tumours were
diagnosed by FNAC and 85.7% by impression smear
and tissue triturate methods each. Histologically
different tumours diagnosed included squamous cell
carcinoma, malignant trichoepithelioma, anal gland
adenocarcinoma, tubulopapillary adenocarcinoma (1),
solid carcinoma (4), inflammatory adenocarcinoma
(1), complex adenocarcinoma (2) and
carcinosarcoma (1) of mammary gland and fibroma,
fibrosarcoma, mast cell tumour, histiocytoma and
osteosarcoma. FNAC smear stained with Giemsa
stain was found useful for rapid diagnosis of most of
the tumours.
(9) DIAGNOSTIC SERVICES PROVIDED BYVARIOUS LABS OF IVRI
Salmonella
A total of 96 cultures received from different
institutions were subjected to standard method of
serotyping (Kauffman- White scheme). Of these 78
cultures were found positive for Salmonella belonging
to 12 different serotypes. Serotypes identified were
S. Typhimurium, S. S. Enteritidis, S. Virchow, S.
Weltevreden S. Elisabethville, S. London, S. Logos,
S. Essen, S. Drogana, S. Gallinarum, S. Eppendorf
and rough.
Mycoplasma
A total of 187 morbid materials (lung, pre-
scapular LN, liver, nasal swabs and cell line) procured
from goats, ovine, poultry and horses etc were
processed for the isolation of Mycoplasma. Twenty
eight isolates were confirmed to be of either
Mycoplasma spp. (22) or Acholeplasma spp. (6). Out
of 28 caprine serum samples procured, 5 samples
exhibited antibodies for M. mycoides subsp. capri
antigen
Clostridium
A total of 10 samples suspected for clostridial
infections were received. Out of these, 1 sample each
was positive for Clostridium septicum, and
Clostridium perfringens type D and remaining eight
samples were negative for Clostridium spp.
Parasite examination
The results of diagnosis for parasite material/
samples from wild life, domestic ruminants, pet
animals and man, which were received from various
places, are tabulated in Table-7.
Table 7: Biological materials received for diagnosis of parasitic diseases
S.No. Animal Material/Sample Results
1. Turtle Parasite samples (n=3) Ascarids
2. Pangolin Parasites Tapeworm segments, hookworm
3. Guldar Parasites Toxocara cati
4. Dog 1) Blood samples/ 1) Babesia gibsoni-a, d(5), f, h(2)
slides (n=53) Ehrlichia canis-d
2) Skin scraping 2) nil
3) Parasites 3) Dipylidium caninum, Spirocerca lupi
5. Tiger 1) Parasites 1) Toxocara cati, Physaloptera sp.
2) Blood smear 2) nil
6. Lion Blood smear nil
7. Spotted deer/ Faecal samples ( 3+2) F. gigantica and amphistome eggs, amphistome
Cheetal eggs
8. Black buck 1) Faecal samples (3+4) 1) F. gigantica & Strongyle eggs,
Amphistome eggs
2) Parasites 2) Amphistomes
9. Hog deer Faecal samples (1+2) Amphistome eggs, nil
10. Leopard Parasites Hypoderma lineatum
11. Equine 1) Faecal sample 1) Strongyle eggs
2) Blood sample 2) nil
12. Bovine- local Parasite Gigantocotyle sp. amphistome
13. Cattle- cross bred Blood sample Theileria annulata
14. Buffalo Faecal samples (8+5+2) nil, nil, Cryptosporidium sp.
6 3
15. Calf Faecal samples nil, nil, Eimeria oocyst, nil,
(15+20+1+10+2+1) Cryptosporidium, Eimerian oocyst
16 Vrindavani calves Faecal samples nil, nil, nil,
(10+7+5+4) Cryptosporidium sp.
17. Tharparkar calf Faecal samples (2) nil
18. Calf/Heifer Faecal samples (10) Strongyle, Trichuris sp., Eimeria sp.
19. Goat Faecal samples (5+10) Strongyle (all), Trichuris sp.(1)
20. Human 1)Worm specimen - ve for Dracunculus medinensis
2) Blood sample 2) nil
21. Water Worm specimens Hairworms (Gordiacea)
22. Child Worms Chrysomyia spp.
23. Leopard Parasites Toxocara cati, Physaloptera sp
Apart from general health care, specific
ailments in different livestock species (159 cases at
ECH, 248 cases at goat farm, 72 cases at LAPS, 3
cases at equine section, 13 farm bullocks and 47
cases in exp. animals of Virology Division were
treated, accordingly. Besides above, specific
treatments and health care services were also
provided to animals (204) in near by villages during
field visits for attending animal health camps.
12.GENETIC STUDIES RELATED TO
DISEASE RESISTANCE, PRODUCTION
AND REPRODUCTION IN LIVESTOCK
1. GENES RELATED TO DISEASE RESISTANCE
(a) Association of SSCP pattern in Lactoferrinand DRB3.2 with mastitis
Investigation was undertaken to identify singlenucleotide polymorphisms (SNPs) in lactoferrin andDRB3.2 gene and to find its association with mastitissusceptibility/ tolerance. The cows which had neverbeen affected by clinical mastitis during theirproductive life and tested negative for Californiamastitis test and somatic cell count (SCC) weredesignated as mastitis tolerant, whereas the cowsaffected with clinical mastitis at least once duringtheir productive life were taken as mastitissusceptible. A total of 100 crossbred cows (71-mastitis tolerant and 29-clinical mastitis) weregenotyped by SSCP in the exon 4 and introl 6 regionof lactoferin genes and exon 2 of DRB3 gene. A 293bp fragment encompassing partial intron 3 to partialintron 4 and 301 bp fragment from intron 6 of lactoferingene and 284 bp fragment of DRB3.2 gene wereamplified by using sequence specific primers.
PCR SSCP revealed two genotypes each ofexon 4 (Fig.53A) and intron 6 (Fig.53B) of lactoferringene namely EE, EF and AA, AB, respectively. Thegenotypes EF and AA as well as alleles E and Awere predominant genotypes. The genotype EF andAA had significant effect on mastitis incidence incomparison to EE and AB. Sequencing of therepresentative genotypes and its subsequentsequence homology comparison revealed one SNPin allele E and two SNPs in allele F, which changed
(10) CLINICAL AND DIAGNOSTIC SERVICES AT
IVRI MUKTESWAR
A total of 105 thorough necropsy examinations
of different livestock and experimental animals (39-
goats, 7- cattle and 31- rabbits of TAH division and
25-exp.goats and 4- exp. sheep of Virology Division)
were conducted during the period. The major causes
of mortality recorded in cattle were pneumonia and
stillbirth. In small ruminants (sheep and goat)
pneumonia, some time associated with diarrhoea and
dehydration were the cause for mortality. However,
in case of rabbits, coccidiosis, pneumonia, diarrhoea
and were the major causes of mortality. In cattle of
local area, haematuria and bovine pappiloma were
major problems.
Based on results of EPG in representative
animals, strategic deworming was performed at farms.
Further, the tick infestation in case of cattle and lice
infestation in case of goats were controlled
strategically using different acaricidal drugs. For the
control of GI parasites, deworming was performed in
a total of 386 animals (331 cases in goats, 46 cases
in cattle and 9 cases in bullock using different groups
of anthelmintics with different mode of action
(fenbendazole, doramectin and closantel) to minimize
the development of anthelmintics resistance. Ticks
infestation in cattle was controlled (total- 218) by using
flumethrin, Butox (bayticol pour on) and doramectin
(injectable preparation). Lice control in goats (total-
180 cases) and mange control in rabbits was
performed using doramectin injection. Feed
supplement viz. Livol, HB, Monobolus, Ostocalcium
and Agrimin was given to 39 cattle, 213 goats, 356
poultry and 214 laboratory animals. For prevention
of foot and mouth disease in livestock, a total of 219
cattle, 12 bullocks and 124 goats were vaccinated
using FMD vaccine obtained from IVRI, Bangaluru
unit and also 143 goats were vaccinated with PPR.
To assess the antibody titer in these animals, pre
and post vaccination serum samples were collected
and sent to PD, FMD, Mukteswar for further testing.
6 4
amino acid isoleucine to valine in exon 4. In intron 6,there was one SNP in allele A and three SNPs inallele B. Similarly PCR-SSCP of DRB3.2 gene alsorevealed two genotypes namely AA and AB(Fig.53C). Genotype AB was predominantly presentin mastitis tolerant animals with a frequency of 0.72.Analysis of variance for SCC revealed that bothDRB3.2 genotypes had significant effect on SCC.Logistic regression showed that genotype AA washighly significant for mastitis incidence in comparisonto genotype AB. Cloning and sequencing resultsrevealed two SNPs in allele A and four SNPs in allele
B.
Fig. 53: PCR-SSCP pattern for A: 293 bp exon 4 of
lactoferin gene, B: 301 bo of intron 6 of lactoferin gene,
C: 284 bp fragment of DRB3.2 gene on 10 % PAGE in
crossbred cattle.
(b) miRNAs expressed in bubaline mammary
tissue
Small RNAs were extracted from freshly
collected bubaline mammary tissues and enriched
by running small RNA on 15% denaturing (7M urea)
PAGE and its subsequent elution and concentration
by glycogen and precipitation. The enriched small
RNA fractions were ligated with a 3' and a 5' linker in
two separate reactions by using miRCat™ Small RNA
Cloning Kit (IDT). The 5' and 3' ligated RNAs contain
both RNA and DNA regions. These were converted
to DNA by using M-MLV Reverse Transcriptase
(Invitrogen) with the RT/REV primer. Synthesized
cDNA was used as template to amplify the miRNA
by using the primers designed on the known
sequences of linkers. These amplified PCR products
were checked on 15% PAGE. Amplification of
distinct 62 bp band indicated the effective extraction
of miRNAs from bubaline mammary tissues (Fig54).
Fig. 54: PCR amplification of cDNA. Lane L1 and L2:
PCR product of about 62bp. Lane M: 10 bp DNA marker.
(c) Recombinant adenovirus delivering bovine
lactoferrin gene produced and evaluated
Open reading frame (ORF) of bovine lactoferrin
gene was isolated from cow milk. It was then ligated
into a shuttle vector p Shuttle CMV. Recombinant
shuttle vector p Shuttle CMV-bLf was characterized
for the presence of the insert. Bovine lactoferrin gene
was then shuttled to adenoviral transfer vector p
AdEasy-1 to produce adenoviral backbone
recombinant for bovine lactoferrin. This was then
transfected into adenoviral packaging cell line, HEK-
293 to produce recombinant adenovirus expressing
bovine lactoferrin. Produced virus particles lysed the
cells forming characteristic CPE (Fig.55). The primary
virus was amplified by further infecting HEK-293 cells.
Amplified virus was purified, concentrated and
titrated. The titer of the virus was 107 pfu/ml. Purified
adenovirus recombinant for bovine lactoferrin was
characterized for its bovine lactoferrin gene delivery
in vitro in cell culture by using reverse transcriptase
PCR. It delivered bovine lactoferrin gene (Fig.56).
Fig. 55: Characteristic CPE in transfected cells.
Fig. 56: Expression of bovine lactoferrin gene by cells
transduced with adenovirus recombinant for bovine
lactoferrin. M: 100 bp ladder plus; T: transduced cells; C:
control non-transduced cells.
(d) DNA-protein interactions at the 5' end of
bovine TLR4 gene studied by Chromatin
Immunoprecipitation (ChIP) assay
ChIP assay was designed and optimized to
characterize putative binding site at 5' region of
6 5
bovine TLR4 gene in cross-bred cattle. The 5' region
of bovine TLR4 (EU386357.1) was analyzed for
putative CREB binding region by using software
PROMO. PCR primers flanking this region were
designed by using Oligo Analyzer program. Bovine
peripheral blood mononuclear cells (PBMCs) were
isolated and cultured following standard protocols.
Cells were treated with LPS to mimic the process of
inflammation/infection. Cells were fixed with
formaldehyde cross-linking. Chromatin fragmentation
was carried out with different parameters viz. 5S (5
cycles of sonication: each cycle included a pulse of
amplitude 5 for 1 min followed by a resting phase of
1 min in ice) and 10S (10 cycles of sonication: each
cycle included a pulse of amplitude 5 for 1 min
followed by a resting phase of 1 min in ice). Obtained
chromatin fragmentation was characterized. CREB
bound DNA from chromatin fragments was
precipitated with 1-4 µg anti-CREB antibody and
protein A agarose beads. The precipitated immune
complexes were washed and eluted. The DNA-protein
cross-links were then reversed to isolate DNA
involved in DNA-protein interactions. The DNA
containing putative CREB binding site at the 5' region
of TLR4 gene was amplified. An amplicon of 167 bp
was obtained.
(e) Genetics of host resistance against
Mycobacterium avium partuberculosis
Protocol for isolation and maintenance of
peripheral blood momonuclear cells (PBMC) derived
macrophages in goat and buffalo has been optimized.
PBMC derived macrophage cells from goat were
induced with E.coli lipopolysaccharide (LPS) and
expression profile of some of the important candidate
genes (viz., IFN-G, IL-10, NRAMP1 and TNFα ) wereassayed using real time PCR. Expression of IFN-G
remained unchanged. While expression of IL2 and
IL-10 was up-regulated (P<0.01) by 1.5 to 2 folds
due to induction with LPS. However, expression of
NRAMP1 was down-regulated (P<0.01) (Fig.57).
Fig. 57: Differential expression of candidate genes in
macrophages while induced/challenged with E. coli
derived LPS. In contrast to down-regulation (P<0.01) of
NRAMP1, expression of IL10 and TNF-alpha up-
regulated (P<0.01).
2. GENES RELATED WITH PRODUCTION
(a) Polymorphism in IGFBPs and Leptin genes
and it association with body weight in rabbits
Birth weights and subsequent body weights
of individual kits of New Zealand White rabbits were
analyzed to estimate the impact of direct additive
genetic, maternal additive genetic and permanent
environmental litter effect on growth traits i.e. birth
weight (BW), 15th day b. wt (15dW), 30th day b. wt
(30dW), and 90th day b. wt (90dW) and 180th day b.
wt (180dW). Effect of litter size was significant on all
the growth traits except 90dW. Kits born in winter
season had significantly higher BW, 30dW and 90dW
than the kits born in summer season. The heritability
estimate for BW ranged from 0.266 (Sire Model) to
0.540 (Animal Model 2). The permanent effect of litter
(c2) was highest (0.288 to 0.310) just before weaning
at 30dW and decreased after weaning. The effect of
indirectly inherited maternal genetic effect (m2) was
present at early juvenile stage of growth (15dW, 30dW
and 90dW) and was nil for 180dW. Selection for better
growth would be more reliable at 180dW because at
this age both c2 and m2 become lower than in previous
stages of growth. Using Animal Model 1,
repeatabilities of doe effects on BW, 15dW, 30dW,
90dW and 180dW were 0.35, 0.44, 0.40, 0.35 and
0.01, respectively. Animal Model 1 was better than
Animal Model 2 in partitioning of variances when the
maternal genetic variance (σ2m) was very low or zero.
For explaining the variation in growth of rabbits,
Leptin and IGFBP4 were taken as candidate genes.
Two amplicons of leptin gene of 204 (exon 1) and
265 (exon 2) base pair were amplified using genomic
from 120 New Zeeland White rabbits as template.
The primers for amplifying these two fragments were
F: 5- GGT GGT TCC TTC TGC CTT CA- 3 & B: 5-
AGC CTC TGT ACC GTG TGT GAG-3 and F: 5-AAT
AGC CAA CGA CCT GGA GAA CCT-3 & B: 5-GAT
TCT TTC CTC AGC GTG GTC CTT-3, respectively.
Both of these fragments revealed monomorphic
single-strand conformation polymorphism (SSCP)
profile, suggesting no polymorphism. In contradiction
with reports in other species it was found that in
rabbits the amplified fragments of leptin has no role
in influencing body weight growth. Exon 2 (258bp)
and exon 3 (135bp) of IGFBP-4 also showed no
polymorphism as evident from monomorphic SSCP
pattern in 15% PAGE.
(b) In-vitro knockdown of myostatin gene
Primary culture for foetal and adult myoblast
was developed from caprine muscle tissue. Myoblast
cell lines were confirmed using specific cell marker
of myogenic cells (i.e., Desmin Antibody) as well as
amplification of the myogenic markers using
quantative Real Time PCR (RT-qPCR). Best in vitro
model for studying MSTN knockdown was assessed.
6 6
The best in vitro model should have enough
endogenous expression of MSTN so that any down-
regulation due to knocking down could be measured.
Accordingly, endogenous expression of MSTN and
other associated myogenic genes were studied in
fibroblast, foetal and adult myoblast, and myotubules.
The caprine foetal myoblast cell lines showed highest
level of MSTN expression indicating its suitability as
the best possible model.
Three siRNAs were designed on the basis of
caprine MSTN sequences. Transfection protocol
using siPORT NeoFX (Ambion, USA) was optimized.
The above three siRNAs were individually transfected
into caprine foetal myoblast cells using siPORT
NeoFX (Ambion, USA) as transfecting agent. Each
individual transfection was performed in triplicates.
After 48 hr of transfection, total RNA was isolated
from the transiently transfected cells. cDNA was
synthesized and checked for the efficient knockdown
using RTqPCR. Knockdown of MSTN gene has been
observed for each of the three siRNAs (Fig. 58). There
was no significant difference in the expression of
OAS-1 gene among the three siRNAs with respect
to control. All three siRNAs did not induce OAS-1 in
transfected caprine foetal myoblast cells. To
downregulate MSTN gene, three shRNA individually
cloned into pLKO.1-puro-CMV-tGFP vector were used
for stable transfection using Lentiviral particles as
carrier. After optimizing the multiplicity of infection
(MOI), Foetal myoblast cells were transduced
individually with each lentiviral construct. The stably
transduced myoblast cells having significant MSTN
down regulation were established.
Fig. 58: Knock down effect of different siRNAs (1, 2 & 3)
transfection on Myostatin (MSTN) and associated genes
(Myogenin: MYOG; Myogenic factor 5: Myf 5 and
Myogenic differentiation 1: MyoD) in primary caprine
foetal myoblast cells
(c) SSCP in ATP1A1 gene
The ATP1A1 gene is one of the important
candidate genes for heat tolerance. A 301bp fragment
of ATP1A1 gene consisting of exon 17 was
successfully amplified using a set of forward (5'- ACA
AAC AAA AGG GTC ACA ACA T -3') and reverse
(5'- CTT ACC CTA GAT CCT GGC TCA T -3') primers
using genomic DNA as template from 100 crossbred
cattle and 75 Tharparkar cattle, and DNA was
isolated. The PCR-SSCP of 301 bp of exon 17 of
this gene revealed polymorphism (Fig.59).
Fig. 59: Polymorphic SSCP pattern for 301 bp fragment
of ATP1A1 gene in crossbred cattle.
(d) RNA interference (RNAi) in regulation of fattyacid synthesis
With the aim to produce designer pig with lower
fat in meat, two genes belonging to fatty acid
synthase systems were targeted by RNA interference.
Established mesenchymal stem cells (MSC) for
generating induced pluripotent stem (iPS) cells and
validated expression of ELOVL6 and SCD1 genes in
pig tissue samples and in MSC (Fig. 60).
Fig. 60: Culture and characterization of pig
mesenchymal stem cells
3. GENES RELATED WITH REPRODUCTION
(a) SNPs associated with CatSper1 geneinfluencing sperm motility
The study was undertaken to identify SNPs in
CatSper1 gene, which is known to control sperm
motility. Randomly selected 111 Vrindavani
(crossbred) cattle were included. PCR-SSCP
technique was used to detect polymorphism in five
fragments i.e. fragment I (299 bp), fragment II (376
bp), fragment III (237 bp), fragment IV (385 bp) and
fragment V (282 bp) of CatSper1 gene. The fragment
I was found monomorphic in all the animals. The
fragment II revealed polymorphism exhibiting four
genotypes i.e. AA, BB, CC and AB. The fragment III
(237 bp) was also polymorphic, which revealed five
genotypes i.e. DD, EE, FF, GG and HH. The
polymorphism was also observed in the fragment IV
(385 bp), which revealed four genotypes II, JJ, KK
6 7
and LL. The fragment V revealed three genotypes
viz. MM, MN and NN. Only exonic SNPs (that were
responsible for alteration in amino acid) were included
for haplotype determination. Thus a total of three
haplotype viz haplotype I, haplotype II and haplotype
III were obtained. The least square analysis of
variance revealed a significant (P<0.01) effect of
haplotype on all the three motility parameters, viz.
mass motility (MM), initial progressive motility (IPM)
and post thaw motility (PTM) .
(b) Microarray analysis for identifying genesinfluencing sperm motility
Seminal parameters viz., volume,
concentration, mass motility, initial progressive
motility, post thaw motility, live count and HOST in
freezable and non freezable semen samples from
crossbred bulls were evaluated. Microarray analysis
using RNA from spermatozoa in freezable and non-
freezable semen was done. A total of 160 up-regulated
genes and 145 down-regulated genes were identified.
Among these, up-regulation of CTRB1
(chymotrypsinogen B1) gene and down-regulation of
CYB5R4 (cytochrome b5 reductase 4) gene was
validated using real time qPCR.
(c) FecB gene in sheep
FecB gene was genotyped in 1410 animals
belonging to 16 Indian sheep breeds by using forced
PCR-RFLP, viz. Muzaffarnagari (100), Jalauni (100),
Deccani (100), Madgyal (40), Madras Red (88), Garole
(100), Kuzi (100), Patanwadi (100), Nellore (104),
Mandya (36), Vembur (76), Kilakarsal (104), Ramnad
White (112), Balangir (100), Shahabadi (100) and
Bonpala (50). The results of genotyping of FecB locus
revealed that there was presence of FecB mutation
in Garole, Kuzi and Shahabadi sheep of breeds.
Genotyping of Garole results showed 67% were
FecBBB, 20% were FecBB+ and 13% were FecB++.
Similarly in Kuzi, 65% were FecBBB, 30% were
FecBB+ and 5% were FecB ++, whereas in Shahabadi
76% were FecB B+ and 24% were FecB ++.
Genotyping of Muzaffarnagari, Jalauni, Madgyal,
Deccani, Madras Red, Patanwadi, Nellore, Mandya,
Vembur, Kilakarsal, Ramanand White, Bonpala and
Balangir were FecB ++ carrier with a genotypic
frequency of 1. The least square mean for litter size
based on 100 observations of Garole, Kuzi and
Shahabadi were 1.585 ± 0.055, 1.780 ± 0.062 and
1.141 ± 0.02, respectively; whereas least square
means for litter size of 13 non-prolific sheep breeds
were 1.00 ± 0.00. The sequencing of representative
samples of FecB gene from each breed showed point
mutation i.e. G to A at 110th position in FecBBB/
FecBB+ carrier and absence of point mutation in
FecB++ non-carriers. The point mutation G to A
translated glutamine to arginine amino acid at position
249 of the mature protein in FecB carriers. The study
showed that Kuzi is equally prolific and higher body
weight than Garole.
(d) Fec G gene
A total of 450 animals of five sheep breeds,
viz. Garole, Kuzi, Shahabadi, Balangir and Bonpala
were evaluated for FecG gene using forced PCR-RFLP. The results of genotyping of FecG locus in
these breeds showed only one genotype, i.e. FecGHH
(Fig. 61). Sequencing of representative samples of
FecG gene in each breed showed point mutation C
to T at 105th position in FecG carrier. The point
mutation C to T translated the amino acid from serineto phenyl alanine at position 77 of mature peptide.
There was no infertility observed in these five breeds.
This may be due to FecG action nullified by epistatic
action of FecB gene or breed variation. The result
also suggested that FecG gene is fixed in all these
five sheep breeds. Based on the results, it issuggested that FecB gene is the reliable genetic
marker for evaluation of prolificacy in sheep. Forced
PCR-RFLP method is useful method to evaluate the
allelic variants of FecB and FecG genes. Kuzi the
best alternative source for FecB gene than Garole to
increase prolificacy and body weight in non-prolific
breeds of India.
Fig. 61: Genotypic pattern of 139 bp amplicon of FecG
gene/ DdeI PCR RFLP. M: 100 bp ladder; Lane 1-14: HH
genotype.
(e) SNPs in the candidate genes influencingprolificacy in Black Bengal goat
Complete coding region of several candidate genes
namely Growth Differentiation Factor 9 (GDF9), Bone
Morphogenetic Protein 15 (BMP15), BMP Receptor
1 B (BMPR1B), IGF-1, IGF-2 and Follistatin in five
different breeds of goat were amplified, cloned and
characterized. More than 25 novel sequences of these
candidate genes were obtained in different breeds.
Novel SNPs in the exonic regions of BMP15, GDF9,
BMPR1B, IGF-I, IGF-II, Follistatin and IGFBP3
genes were identified using SSCP and targeted re-
sequencing of polymorphic SSCP patterns (Fig. 62).
Fig. 62: Native PAGE showing the SSCP in Exon 2 of
BMP15gene
6 8
13.LIVESTOCK PRODUCTION AND
MANAGEMENT
(1) MULTIPLICATION AND EVALUATION OF
VRINDAVANI CATTLE
The opening balance of Vrindavani cattle as
on 01.04.2011 was 500 heads (95 males and 405
females). Additions in the herd were due to birth of
82 female and 93 male calves (175 heads). The
closing balance of the Vrindavani cattle herd as on
31.03.2012 was 358 heads (46 males and 312
females).
The overall mortality per cent was 5.78%. The
overall female mortality was 5.95%, whereas for
males it was 5.32%. The overall culling per cent was
27.56 with respective values for male and female
culling % as 25.00 and 28.54, respectively.
The overall conception rate in Vrindavani cattle
herd was 52.33%. The figures in heifer and adult
groups were 60.97 and 49.08%, respectively. The
overall calving abnormalities were 30.29%, which
included 8.00% abortions, 6.29% unseen abortions,
1.71% dystokia, 6.29% retained placenta, 5.14%
premature births, 1.14% prolapse, 1.14% still births.
The least squares' means (LSM) for age at first
calving, service period, dry period and calving interval
were 989.44±17.95 days, 102.83±5.87 days,
97.50±22.39 days and 445.21±24.08 days,
respectively.
Vrindavani cattle produced 536846.0 kg milk
during the current year. On an average, 78.80% of
the total adult Vrindavani females were in the milk
during the current year. Means for overall wet and
herd averages were 10.53 and 8.31 kg, respectively.
The Fat, SNF and Total Solids were 4.30%, 8.76%
and 13.06%, respectively. The LSM's for total
lactation milk yield, total lactation length, milk yield
per day of total lactation length, 305 days' milk yield,
milk yield per day of 305 days lactation period, peak
yield, days to attain peak yield and weight at calving
were 3499.48±38.11 kg, 316.33±3.81 days,
10.74±0.14 kg/d, 3492.63±73.59 kg, 11.46±0.24 kg/
d, 18.41±0.26 kg, 71.42±7.91 days and 405.96±4.23
kg, respectively.
The least squares' means (LSM) for overall
live body weights at birth, 3, 6, 12, 18 and 24 months
of age were 22.25±0.33, 45.23±0.95, 90.92±1.59,
150.15±3.22, 246.23±3.53 and 300.08±4.06 kg,
respectively.
(2) THARPARKAR CATTLE
The opening balance of Tharparkar cattle as
on 01.04.2011 was 154 heads (30 males and 124
females). The M:F ratio of new calvings was
1.00:0.95. The closing balance of the Tharparkar
cattle herd as on 31.03.2012 was 98 cattle heads
(15 males and 83 females).
The overall mortality per cent in Tharparkar
herd was 4.62%. The overall conception rate in
Tharparkar herd was 64.78%. The figures in heifer
and adult groups were 63.63 and 65.30%,
respectively. The overall calving abnormalities were
34.15%, which included 7.32% abortions, 2.44%
unseen abortions, 7.32% retained placenta, 2.44%
premature births, 9.76% prolapses and 4.88% still
births. The least squares' means (LSM) for age at
first calving, service period, dry period and calving
interval were 1056.67±90.22, 230.34±20.63,
292.05±118.36 and 472.46±28.95 days, respectively.
Tharparkar cattle produced 21679 kg milk
during the current year. Means for overall wet and
herd averages were 3.39 and 1.48 kg, respectively.
On the basis of analysis of 384 milk samples, the
overall Fat, SNF and Total Solids were 4.34, 8.77
and 13.12%, respectively.
The least squares' means (LSM) for overall
live body weights at birth, 3, 6, 12, 18 and 24 months
of age were 21.27±0.48, 56.18±2.33, 108.52±3.27,
171.34±7.77, 230.79±2.56 and 260.06±3.98 kg,
respectively.
(3) MURRAH BUFFALO
The opening balance of Murrah buffaloes as
on 01.04.2011 was 223 heads (62 males and 161
females). Additions in the herd were due to birth of
23 female and 31 male calves (54 heads). The closing
balance of the buffalo herd as on 31.03.2012 was
150 buffalo heads (118 females and 32 males).
The overall mortality was 6.07%. The overall
female and male group mortality were 3.38% and
15.87%, respectively. A total of deaths were recorded
in buffalo herd during the current year (10 males and
5 females).
The overall conception rate was 50.00%. The
figures in heifer and adult groups were 43.24% and
53.84%, respectively. The overall calving
abnormalities were 18.64%, which included 1.69%
abortions, 1.69% unseen abortions, 1.69% dystokia,
5.08% retention of placenta, 1.69% prolapse and
6.77% premature births and still births. The least
squares' means (LSM) for age at first calving, service
period, dry period and calving interval were
45.61±3.22 months, 152.91±20.66 days,
207.38±22.22 days and 460.89±17.90 days,
respectively.
The least squares' means (LSM) for overall
live body weights at birth, 3, 6, 12, 18 and 24 months
of age were 32.75±0.63, 63.40±1.95, 123.73±3.41,
226.53±7.84, 308.13±7.21 and 377.90±6.53 kg,
respectively. The weight at first calving during the
current year was 498.44±16.72 kg.
Means for overall wet and herd averages were
5.82 and 3.39 kg, respectively. On an average,
57.44% of the total adult females were in the milk
6 9
during this period. The LSM's for total lactation milk
yield, average lactation length, average 305 days'
yield and peak yield were 2208.41±70.08 kg,
308.75±07.72 days, 2276.82±82.85 kg and
11.54±0.37 kg, respectively. The Fat, SNF and Total
Solids were 8.08, 9.67 and 17.76 %, respectively.
(4) DEVELOPMENT OF APPROPRIATE MILKPRODUCTION MODELS FOR SELECTIONOF VRINDAVANI CATTLE AND MURRAHBUFFALOES
Ten-year data (1.4.1999 to 31.3.2009) on
Vrindavani cattle and Murrah buffaloes on milk
production along with initial reproduction traits were
used.
In Vrindavani, prediction of ATLMY(average
total lactations milk yield), based on overall records
up to eight parities indicated that out of five initially
expressed traits, FLL (first lactation length) followed
by FCI (first calving interval) and FDP (first dry period)
could follow the significant criterion obtained through
stepwise procedure of regression analysis. Up to 4th
parity, FLL was the main predictor variable followed
by AFC, FCI and FSP and beyond this, FDP followed
by FCI were the main predictors for estimation of
parities-wise TLMY based on these traits. Curve
estimation suggests that for AVTLMY, quadratic
function had significant association, whereas for
individual parities, TLMY logarithmic function was the
best fit. In Murrah, FLL was the only initial trait and
the reason of non-inclusion of other traits may be
introduction of new animals. S-curve was the best
fit. Estimation of TLMY in first parity showed the
inclusion of FLL in the model with best fitness of S-
curve.
(a) Lifetime milk yield estimation with principalcomponents as predictors
Lifetime milk yield production estimate was
made based on data records (1999-2009) on parity
wise part milk yields (100, 170 and 240 days yields)
and respective total milk yields, for evolvement of
models for lifetime milk yield (total up to 4th parity-
PTLMY4, and 5th parity-PTLMY5) using principal
component regression analysis for both the species.
Principal component analysis could retain three
components, which explained 93.08% and 94.09%
variation of the original variables in Vrindavani cattle
and Murrah buffaloes, respectively.
(b) Lifetime milk production estimation withrespect to early expressed traits
In Vrindavani, stepwise regression analysis for
PTLMY4 with respect to early growth, reproduction
and part lactation milk yields (BWT, AFC, FLL, FCI,
FSP, FDP, my100_1, my170_1, my240_1, tlmy1,
my100_2, my170_2, my240_2, tlmy2), could retain
part total milk yield at 240 days of second lactation
(my240_2) together with first lactation milk yield
(TLMY1) and part total milk yield at 170 days of
second lactation (my170_2) as predictors and jointly
explained 40.32% variation in estimated value.
However, for prediction of PTLMY5 part total
milk yield at 240 days of second lactation (my240_2)
together with first lactation length (FLL) as predictors
jointly explained 26.71% variation in estimated value.
In Murrah buffaloes, stepwise regression
analysis for PTLMY4 with respect to my100_1,
my170_1, my240_1 and tlmy1, could retain part milk
yield of 240 days (my240_1) and part milk yield of
100 days (my100_1) of first lactation as predictors
(when significance level was fixed at 5%) and
explained 65.19% variation in estimated value (R2)
of PTLMY4.
(5) DEVELOPMENT OF DATABASE PACKAGE
FOR PROCESSING OF VRINDAVANI
CATTLE DATA
To monitor performance of our dairy farm and
to make decisions based on real-time data on various
growth, production and reproduction aspects of
Vrindavani cattle since 1969, a database package is
being developed in MS Access. The relationships
amongst files having information on daily milk yield,
gestation, animal pedigree, growth and milk yield have
been established for preparation of database.
(6) DEVELOPMENT OF PACKAGE OF
PRACTICES FOR WEANING OF MURRAH
BUFFALO CALVES
The overall least squares' means for monthly
milk consumption by Murrah buffalo calves under
suckling system during month 1 (MC1) to month 7
(MC7) were 92.72±27.99, 126.63±3.90, 121.54±2.62,
128.72±2.21, 132.69±1.00, 128.69±4.41 and
111.22±27.240 kg/month. The overall least squares'
means for total milk consumption (TC), duration of
milk consumption (DC) and per day milk consumption
(PDMC) were 547.83±39.80 kg, 131.91±6.68 day and
4.07±0.45 kg/day, respectively. Highly significant
effect (P=0.01) of rearing system was evident on total
milk consumption and duration of milk consumption,
however, its effect on PDMC was non-significant.
The total milk consumption in calves of suckling
system was higher than weaned system due to the
fact that under weaning system the milk at
predetermined recommended levels was fed for 71 d
only whereas under suckling system it was continued
up to 203.75±3.05 d. The per day milk consumption
was slightly higher in suckling calves (4.23±0.21 kg/
d) as compared to their weaned counterparts
(3.93±0.19 kg/d).
For fertility response of both groups, the
concentrations of progesterone and estrogen were
measured in blood serum of weaning as well as
suckling groups up to 42 days post partum collected
7 0
at weekly interval. The mean serum progesterone
and estrogen differed significantly (P<0.05) between
weaning and suckling groups of animals. Animals in
weaning group have shown higher estrogen and
progesterone levels at 28 and 38 days, respectively,
indicating of early resumption of cyclicity in weaned
buffaloes.
(7) LEVEL OF INBREEDING IN VRINDAVANIHERD AND ITS IMPACT ON GROWTH,PRODUCTION AND REPRODUCTIONPERFORMANCE
Collected and computerized pedigree records
of 8609 Vrindavani cows/bulls. Information consisted
of animal number, animal breed, sire number, sire
breed, dam number, dam breed, date of birth and
sex. Performance recording and further
computerization is under progress. Pedigree file will
be used to determine the level of inbreeding in
Vrindavani herd across the years.
(8) DESIGN AND DEVELOPMENT OFCLEANING AND COLLECTIONEQUIPMENTS FOR LIVESTOCK FARM
The prototype for the new equipment was
designed and fabrication of the frame has been
completed. The fabrication of transportation unit and
collection unit is underway.
(9) CHARACTERIZATION AND DOCUMENTA-TION OF ROHILKHANDI GOAT
Total milk yield of 90 days averaged 58.77
litres with average ADMY 0.65 litre/day. The fat, SNF,
protein and lactose were 5.28%, 7.89%, 2.87% and
4.44%, respectively. The fat in T1, T2 and T3 group
were 5.89%, 5.88% and 4.15%, respectively. The
fat per cent was similar in T1 and T2 groups and was
higher than T3 which differed significantly (P<0.05).
The SNF in T1, T2 and T3 groups was 7.75%, 8.02%
and 7.95%, respectively. The protein and lactose were
lower (2.77% and 4.30%, respectively) in T1 in
comparison to other two groups. Overall milk
production in rainy season (0.726l/d) was significantly
(P<0.01) higher than winter season (0.657l/d).
Udder morphology for the local goat was
measured. The udder volume (UV) in primiparous and
multiparous goats was 516.54 ± 74.52 ml and 940.76
± 46.47 ml, respectively. These mean values were
statistically significant (P<0.05). The values of udder
length (UL), udder depth (UD), udder circumference
(UC), udder row width (URW) and udder column width
(UCW) for primiparous goats were 10.41±0.60,
11.58±0.63cm, 28.34±1.12cm, 8.74±0.45 and
7.66±0.52 cm, respectively. Corresponding values
of UL, UD, UC, URW and UCW for multiparous goats
were 12.14±0.38cm, 14.74±0.39cm, 35.20±0.69cm,
10.83±0.28cm and 9.30±0.32 cm, respectively. The
value of various teat parameters viz. teat length (TL),
teat diameter (TD), teat circumference (TC), teat
height from ground (THG) and distance between teats
(DBT) for primiparous goats were 9.07±0.57cm,
3.02±0.27cm, 10.09±0.88cm, 20.83±1.02cm and
8.22±0.88cm, respectively. Corresponding values for
multiparous goats were 9.58±0.35, 4.28±0.17,
13.52±0.55, 18.42±0.64 and 10.04±0.56,
respectively. The UL, UD, UC, URW and UCW were
significantly (P<0.05) higher than primiparous goats.
Average daily milk yield is positive and significantly
(P<0.01) correlated with udder volume, udder length,
udder depth, udder circumference, udder row width,
teat diameter and teat circumference, except for teat
height from ground. The same trend was also observed
for the total milk yield with the udder morphological
and teat characteristics.
(10) SWINE PRODUCTION FARM
(a) Establishment of pure Landrace nucleus herd
Pure Landrace nucleus herd, established in
the year 2006-07, is being maintained. Eleven females
farrowed in the year 2011-12. Herd strength at the
beginning of the year (as on 01.04.2011) was 109
(52 males and 57 females), whereas at the end of
the year (on 31.03.2012), it was 65 (27 males and 38
females). Piglets attained live weight of 8.59±0.16
kg at weaning (42 days of age) and average daily
gain during pre-weaning period was 172.19±3.66 g/
d. Overall mortality was 13.89%.
All the females were bred with 98% conception
rate with 1.09 services per conception. A herd of 65
Landrace pigs (27 males and 38 females) was
maintained (as on 31.03.2012) after selecting from a
total stock of 642. Birth weight and body weight at
weaning were 1.34±0.02kg and 9.39±0.16 kg,
respectively. Overall growth rate up to 24 weeks of
age was 378.64 g/d. Mean litter size at birth was
9.82±0.50 and at weaning it was 8.14±0.51. Overall
mortality rate in Landrace pigs was 3.89%.
A low-cost wooden dummy was designed for
training of boars for semen collection. A span of 22
days was required to train the boars for mounting the
dummy after first exposure to the dummy. First
ejaculation was obtained after 28 days from start of
the training. Semen collection was done by gloved
hand method. A total of 48 collections were studied
for semen biology in two Landrace boars. Average
ejaculate volume was 254.44±19.45 ml (gel fraction:
41.11±4.47 ml and sperm-rich fraction: 213.33±15.36
ml). The mean sperm concentration was
279.44±62.08 millions/ml. Artificial insemination was
done following standard technique in available
oestrous sows.
(b) Crossbred swine
During the year, inter se mating was carried
out to study the performance of the crossbred pigs.
A total of 146 crossbred pigs (52 males and 94
7 1
females) were present on 01.04.2011, whereas the
balance at the end of the year (as on 31.03.2012)
was 82 (37 males and 45 females). A total of 215
piglets (101 males and 114 females) were born,
whereas 279 pigs (116 males and 163 females) were
disposed off. Overall mortality rate was 11.27%.
Number of services per conception was
1.10+0.01. The litter size was 10.23±0.64 and litter
weight was 11.68±0.62 kg at birth; whereas, at
weaning litter size was 8.89±0.67 and litter weight
was 79.00±4.81 kg. Average daily gain of pre-weaning
piglets was 189.15±8.52 g/d and that of post weaning
(up to 32 weeks of age) pigs was 420.76±18.62 g/d.
Studies on the feed conversion efficiency in
crossbred boarlings (5-20 weeks of age) revealed that
overall feed consumption was 2.50±0.05 kg for one
kg of body weight gain. In order to bring down the
Landrace inheritance to 75%, 12 indigenous animals
were maintained.
(11) LABORATORY ANIMAL SECTION
Four laboratory animal species are being
maintained at LAR section i.e. rabbits (New Zeeland
and Angora breeds), rat (Wister strain), mice (Albino
strain) and guinea pig (Dunkin Hartley strain). Also,
for scaling up the rabbit production to fulfill the demand
of swine fever vaccine, demand a separate extension
of rabbitary unit was established. The opening
balance, on 1st April, 2011 for rabbit, guinea pig, rat,
and mice were 319, 246, 1061 and 896, respectively;
whereas closing balance on 31st March, 2012 were
301, 323, 706 and 751, respectively. During the year,
440 rabbits, 466 guinea pigs, 2932 rats and 3143
mice were supplied for production of biologicals and
for research work.
(12) EXPERIMENTAL CATTLE HERD,MUKTESWAR
The experimental dairy farm maintained initial
(opening balance on 01.04.2011) strength of 126, out
of which 35 cows were in milk, 18 dry cows, 25 heifers
above 18 months of age, 23 heifers between 6 and
18 months, 8 female calves, 13 male calves, 2
breeding bulls, one teaser bull and one pony. The
respective closing balance (as on 31.03.12) was a
total of 127 herd strength of which, 33 cows were in
milk, 16 dry cows, 25 heifers above 18 months of
age, 18 heifers between 6-18 month age, 11 female
calves, 24 male calves, 1 breeding bull and 2 teaser
bulls. During the period a total of 31 calving were
achieved, out of which maximum calving occurred in
the month of July (22.58%) followed by September
(16.13%) and January (12.90%). Total 6 heifers calved
during the period and the age at first calving (AFC)
averaged 1811.67±66.58 days. Average dry period
and inter-calving period in the herd were 137.0±18.21
and 442.24±22.43 days, respectively. One
primiparous cow calved twin healthy female calves.
Out of 32 calves born, 16 were male and 16 were
female calves. During the period a total of 7 deaths
occurred in the herd. Calf mortality was 6.25%.
During the period, mean milk production per
day per cow was 7.65 L, which is 0.5 L higher than
the previous year. Average per day milk production
was maximum (243.54 L) during the autumn season
(October-November), followed by summer season
(236.12 L), while it was minimum during the winter
season (192.64 L). The average milk production per
cow per day was highest (8.41 L) during the rainy
season (July-Sept.), followed by autumn season (8.01
L), while it was lowest in the winter season (6.94 L).
During the period total cow days were 10691 and
average cows in milk per day were 29.22 giving a
total annual milk production of 81875.4 L with average
milk production per day 223.71 L.
The milk analysis revealed that mean fat%,
SNF%, protein% and density in the herd were 4.87
±0.03, 8.48 ±0.02, 2.94 ±0.01 and 28.04 ±0.07,
respectively. The average 305 days milk yield in the
first and other lactation was 2112.83 ±134.26 and
2395.74 ±110.52 L, respectively. Total lactation yield
and total lactation length in the herd was 2203.11
±103.83 L and 307.04 ±2.82 days, respectively. The
wet and herd average milk production of the farm
was 7.65 L and 5.22 L, respectively. During the period,
81875.40 L total milk was produced.
Average number of AI required per conception
was 2.6. Conception rate to the first AI was 42% and
overall conception rate to all AI was 39%. Wet: dry
cows' ratio in the herd was 66.04: 33.96. Production
data of cattle born from 1989-2005 at Experimental
Cattle Herd was computerized. Mean lactation milk
yield and 305 days milk yield were 2486.34 ± 26.70
(n=809) and 2240.53 ±20.21 L (n=633), respectively.
Average daily milk yield of cow was 6.91 ±0.06 L
(n=731). Mean lactation length, dry period and calving
interval were 363.59±2.95 (809), 83.36 ±2.64 (731)
and 447.73 ±9.07 (731) days, respectively. Mean age
at first calving was 1325.30 ±18.01 (248) days. Mean
herd life and number of calving were 3295.15 ±74.16
(189) days and 4.38 ±0.17 (189), respectively.
(13) EXPERIMENTAL GOAT FARM,
MUKTESWAR
The experimental goat farm at Surmane had
maintained an initial strength (on 01.04.11) of 167
goats comprising of 26 Pashmina, 84 local hill goats,
33 Jhakharana, 21 Jamunapari goats and 3 sheep.
On 31.03.12, it had a total strength of 86 goats
comprising of 9 Pashmina, 58 Local hill goats, 10
Jhakharana goats and 9 Jamunapari goats. During
the year there were 31 kiddings (2 Pashmina, 19 local
hill goats, 5 Jhakharana and 5 in Jamunapari).
Comparative study of birth weight and weight
gain among different breeds of goats at different time
7 2
interval till 12 months revealed that birth weight was
highest in Jamunapari (2.7 kg) followed by Jakhrana
goats (2.6 kg) and it was lowest in local hill goats
(1.8 kg). Similarly, body weight at 12 month age was
also highest in Jamunapari goats (18.0 kg) followed
by Jakharana female goats (17.6 kg) and lowest in
local hill goats (14.8 kg).
(14) LABORATORY ANIMAL PRODUCTIONSECTION, MUKTESWAR
The laboratory animals are being maintained
to meet out the needs of different laboratories of this
campus as well as other institutes. The laboratory
animal section maintained an initial strength of 19
NZW rabbits, 17 GG rabbits, 14 SC rabbits, 8 Angora
rabbits, 140 guinea pigs and 483 mice; with closing
strength of 31 NZW rabbits, 22 GG rabbits, 19 SC
rabbits, 4 Angora rabbits, 141 guinea pigs and 618
mice. During the period a total of 72 rabbits, 233
guinea pigs and 266 mice were issued to various
Institutions; and 9 rabbits, 24 guinea pigs and 140
mice, and 16.5 kg Angora wool were sold. Among
rabbit breeds litter size at birth and body weight at
day 50 was higher in GG (4.8 and 852.5 g) than NZW
(4.6 and 776.5 g) and SC (4.7 and 731.4 g).
(15) EQUINE FARM, MUKTESWAR
The equine section initially maintained 4 ponies.
During the period 2 ponies were auctioned and one
pony was issued to Izatnagar.
(16) POULTRY REARING, MUKTESWAR
Two batches of broiler chicks were reared in
cage as well as in litter system. In May batch (from
20.05.11 to 11.07.11) a total of 592 day old chicks
were reared in both the systems and 20 birds died
(3.4% mortality) and 572 birds were sold. Similarly,
in September batch (form 15.09.11 to 04.01.12) 903
day old chicks were reared in the two rearing systems,
206 birds died (22.8% mortality) and 697 birds were
sold.
Layer birds were reared in cage and litter
systems. During the period (01.04.11 to 23.08.11)
368.5 kg eggs were sold. 60 turkey birds aged 6
months (about 50% male/female each) were reared
(from 01.07.11 to 27.03.12) in semi-intensive type of
housing and in laying at about 8 months of age.
Average egg laying was on alternate day and average
egg wt. was 96 g.
(17) ESTABLISHMENT OF ELITE FLOCK OF
BLACK BENGAL GOAT, ERS, KOLKATA
One animal shed at IVRI, ERS Kalyani Farm
has been renovated and a total of 15 pure Black
Bengal goats (10 females and 5 males) have been
procured and maintained to establish an elite flock
of Black Bengal goat unit. A total of 56 ejaculates
were collected from 6 bucks and evaluated for their
physical characteristics (Table-8).
Table 8: Black Bengal buck semen characteristic at different seasons (mean ± SE)
Parameters May- June Sept- Nov Overall mean
Volume (ml) 0.65±0.32 0.56±0.05 0.60±0.04
Colour Creamy Creamy white
Progressive motility (%) 90.7±0.40 89.1±0.66 89.9± 0.8
Live sperm (%) 90.0±0.57 88.2±0.60 89.1±0.9
Abnormality (%) 6.6±0.38 8.0±0.60 7.3±0.7
Sperm Concentration (X 109/ml) 3.16±0.5 X 109 3.18±0.5 X 109 3.17± 0.10 X 109
pH 6.79± 0.31 6.71±0.03 6.75 ± 0.04
(18) HYPOXIA INDUCIBLE FACTOR-1 (HIF-1)AS MARKER OF ADAPTATION TO HIGHALTITUDE
(a) Expression of goat HIF-1 alpha protein
Primer pairs were designed using gene tool
software and custom synthesized. PCR amplification
was done as per the standard protocol and
amplification was confirmed by gel electrophoresis.
PCR product was purified using QIAGEN kit and
protocol. Purified product was cloned in BL21 host
cells using pET-32a vector and restriction enzymes
as Bam H-1 and Hind III. Cloned BL21 cells were
induced for protein expression using 100 mM IPTG
and ampicillin and chlormphenicol as antibiotics of
choice. It was found that protein expression was
highest at 6 hr of induction and a product of about 50
kda was seen in SDS PAGE.
For full length sequencing of HIF-1α, twooverlapping sets of primers (set1 F-5'
GGGCACCGATTCACCATGGAG 3' and R-5'
TCTTGAATCTGGGGCATGGTAAA 3' and set 2 F-5'
CTTTTACCATGCCCCAGATTCA 3' and R-5'
GCCACCAGTGTCCAAAAAAAGG 3') were designed
and standardized using GAPDH as internal control
and cDNA derived from Jakharana goats blood. The
amplified fragments were cloned in pGM-T easy
vector using Top 10' host cells. Positive clones were
sequenced from automated sequencer (from South
Campus, University of New Delhi). The obtained
sequences were rearranged and submitted to the
NCBI gene bank and accession No. JN897021.1 was
obtained. Obtained sequence was analyzed for
sequence homology using ClustalW method of
MegAlign module in Mega 5.0. It showed 99.2%
7 3
homology with cattle, 99.3% with antelope, 99.3%
with yak, 99.4% with sheep (partial), 96.7% with pig,
90.0% with mouse 78.9% with chicken and 95.1%
with human, which indicates close evolutionary
relationship. In phylogenetic analysis, goat, sheep,
cattle, yak and antelope HIF-1α genes showedidentical lineage. However, pig, human and chicken
sequences showed dissimilarities suggesting different
ancestry. Predicted HIF-1α protein of goat possessesmolecular weight of 92 kDa with 823 amino acids.
The deduced amino acid sequence of the goat HIF-
1α showed higher identities with the human (90%),bovine (92%), mouse (86%), Norway rat (86%),
chicken (76%), African claw flow (53%) and rainbow
trout (40%). Analyzed the specific functional portions
namely: basic-Helix-Loop-Helix (b-HLH) from position
23 to 78, Per/Arnt/Sim-A (PAS-A) from position 87
to 153, Per/Arnt/Sim-B (PAS-B) from position 230 to
296, Oxygen-dependent degradation domain (ODD),
N-Transactivation domain (N-TAD), C-Transactivation
domain (C-TAD) and Nuclear Localization Signal
domain (NLS).
(b) Glutathione peroxidase (GPx) assay
GPx assay was performed in preserved plasma
samples of poultry and goat using glutathione
peroxidase assay kit (Cayman chemical company).
GPx activity in chicken increased after transport to
Mukteswar and it was highest on day 2 of transport
and came to the normal level on day 35 indicating
that stress due to transport and hypoxia was
minimized after a week. It may be due to gradual
adaptation of birds to the prevailing climate. GPx
activity in goats also increased gradually after
transport to Mukteswar and it was highest on day 10
of transport and came to the normal level on day 35
indicating that stress due to transport and hypoxia
was minimized after a month. It may be due to gradual
adaptation of goats to the prevailing climate.
(c) Expression profile of HIF-1αααα mRNA in goatstransported from Makhdoom to Mukteswar
Blood samples were collected from six male
Jakharana goats before transport and at day 2, 5
and 10 of transport. cDNA was synthesized and PCR
and real time PCR was performed for HIF-1α usingGAPDH as internal control. Study revealed that there
was no significant change in mRNA expression after
transport of goats from plains to high altitude at IVRI,
Mukteswar.
14. REPRODUCTIVE MANAGEMENT AND
AUGMENTATION OF FERTILITY
(1) INNATE IMMUNITY MARKERS IN CATTLE
AND BUFFALOES IN RELATION TO UTERINE
INFECTIONS
The first experiment was conducted to
evaluate the relative mRNA expression profile of
cytokines i.e., IL-1β, IL-8, TNFα and IL-4 in peripheralblood mononuclear cells (PBMCs) in buffaloes with
and without endometritis.
A total of 15 buffaloes were included in this
study of which, 9 buffaloes were diagnosed positive
for endometritis based on presence of mucopurulent
discharge on vaginal inspection and positive colour
reaction to white side test of cervico-vaginal mucus,
whereas 6 buffaloes having no symptoms of
endometritis were considered as healthy control. All
the three target pro-inflammatory cytokines (IL-1β,IL-8 and TNF-α) mRNA were expressed differentiallyin PBMCs of endometritic buffaloes. The expression
level of IL-1β and IL-8 was increased 2.15 and 1.92fold (P<0.05), respectively in endometritic buffaloes
as compared to healthy control, whereas the
expression of TNF-α was found to be the highest(3.27 fold) in buffaloes with endometritis compared
to other pro-inflammatory cytokines. No significant
change was observed in IL-4 expression between
endometritic and non-endometritic buffaloes (P>0.05).
Second experiment was carried out to evaluate
the immune status and mRNA expression profile of
IL-2, IFN-γ and IL-4 cytokine gene in PBMCs duringperiparturient period in buffaloes. The blood
leucocytes count, PMN cell functions, plasma levels
of nitric oxide (NO) and 13, 14-dihydro-15-keto-
prostaglandin F2α (PGFM) were analyzed andcorrelated with the occurrence of postpartum
reproductive disorders.
A total of 20 pregnant Murrah buffaloes of 2nd
to 4th parity were observed during one week pre-
calving to four weeks post-calving period for
occurrence of retention or expulsion of foetal
membranes, metritis, pyometra, endometritis etc.
Those buffaloes did not develop any metritis, clinical
endometritis and delayed uterine involution,
cumulatively called as postpartum reproductive
disorders (PRD), of which a representative number
(n=6) was included in Gr. I (healthy), while the animals
which experienced PRD were assigned into Gr. II
(n=6).
The results revealed that the development of
PRD was related to increased TLC and neutrophil
count along with reduced PMN cells. A significant
decrease in lymphocytes count (%) during
periparturient period was observed in buffaloes that
developed PRD particularly at day of calving
(47.10±2.42 vs. 56.98±2.85), and 1st (48.77±2.71 vs.
56.29±3.00) and 4th (54.36±2.37 vs. 65.66±3.28) week
following calving as compared to healthy. The results
indicated a reduced superoxide (∆O.D./2×106 PMNs/30 min) and H
2O2 (µM/L) production by PMN cells in
buffaloes with PRD at different sampling time.
The buffaloes with PRD had elevated PGFM
levels (ng/ml) that indicate a kind of inflammation
during the periparturient period. The plasma PGFM
7 4
concentration was higher in buffaloes that developed
PRD as compared to healthy, during all sampling days
and found significant (P<0.05) at calving (2.51±0.43
vs. 1.267±0.30) and 2nd week postpartum (1.058±0.22
vs. 0.431±0.08).
The relative expression profile of IL-2, IFN-γ
and IL-4 was studied in PBMCs in buffaloes with and
without postpartum reproductive disorders. The
expression of IL-2 cytokine mRNA before parturition
was lower than those after parturition in both healthy
and PRD groups, however, a significantly higher
expression of IL-2 was observed in healthy buffaloes
at 2nd week (1.53 vs. 0.32 fold, P<0.05) and 4th week
postpartum (1.09 vs. 0.32 fold, P<0.10) as compared
to PRD buffaloes. Further, the expression of IL-2 was
significantly up-regulated from prepartum to day of
calving (P<0.05), and declined gradually during the
postpartum period in the buffaloes with PRD. The
expression profile IFN-γ was also tended to be greaterin healthy buffaloes during calving to 3rd weeks
postpartum. As a whole the mean fold change of IL-
4 cytokine mRNA was numerically higher throughout
the periparturient period in healthy buffaloes than PRD
and the expression was significantly greater (P<0.05)
during 1st week (3.33 vs. 0.69 fold), 2nd week (4.32
vs. 0.56 fold) and 4th week (5.57 vs. 0.19 fold).
From this study it can be concluded that
impaired PMN functions in terms of production of
superoxide and hydrogen peroxide before parturition
and during postpartum period may predispose
buffaloes to develop reproductive disorders. Higher
total leucocytes, neutrophil and band cells count and
sustained elevation in plasma levels of prostaglandin
metabolites and nitric oxide in buffaloes with PRD
may be due to uterine infections in postpartum period.
A lower expression in IL-2, IFN-γ and IL-4 mRNA inPBMC, at calving might impair activation of
inflammation and clearance of microbes and lead to
development of postpartum reproductive disorders.
(2) EXPRESSION AND LOCALISATION OFAUTOCRINE AND PARACRINE FACTORSAND THEIR RECEPTORS REGULATINGCORPUS LUTEUM FUNCTION DURING THEOESTRUS CYCLE OF BUFFALOES(BUBALUS BUBALIS)
Real time PCR conditions for amplifying
various angiogenic growth factors viz. VEGF 120,
VEGF164, VEGF188, Flt-1 and Flk-1 were optimized
using factor specific primers. For primer design the
Fast PCR. (Version: 6.2.73) software was used.
(3) AUGMENTATION OF OVARIAN FUNCTION,OESTRUS RESPONSE AND FERTILITY INDELAYED PUBERTAL HEIFERS USINGHERBAL PLANTS AND AREA SPECIFICMINERAL MIXTURE
Twenty three delayed pubertal heifers with the
history of anoestrus were treated with herbal plants
Aegle marmelos and Murraya koenigii (HERB @ 200
g powder/animal/day) for 9 days (n=13) and 10 were
with area specific mineral mixture (ASMM @ 40 g/
animal/day) supplemented in concentrate mixture for
one month or the earliest point of oestrus onset
whichever is earlier. 69.2% heifers in herbal and
90.0% in mineral mixture group showed cyclicity
within 20 days from the start of the treatment. The
mean interval between the start of treatment and the
appearance of first clinical signs of oestrus was
8.75±1.96 (range 3-16 days) and 18.88±13.21 days
(range 7-44 days) in HERB and ASMM groups,
respectively. Besides, 3 heifers in HERB group also
showed delayed response and exhibited oestrus
beyond 20 days and within 70 days from the start of
treatment. One heifer in each group showed silent
oestrus and was confirmed by the presence of corpus
luteum gynaeco-clinically between 10 and 12 days.
Under validation trial (conducted at DUVASU,
Mathura), 8 delayed pubertal heifers aged >3 years
were treated with HERB and 6 were kept as untreated
control. 87.5% and 16.7% heifers showed behavioural
signs of oestrus in herbal and control group,
respectively. The mean size of the largest follicles
monitored by trans-rectal ultrasonography was
12.77±0.08 mm and 8.70±0.62 mm in herbal and
untreated control groups, respectively. The present
study demonstrated the potential therapeutic use of
Aegle marmelos and Murraya koenigii leaves and area
specific mineral mixture for induction of oestrus and
cyclicity in delayed pubertal heifers.
(4) SEMEN QUALITY AND FREEZABILITY OF
INDIGENOUS AND CROSSBRED BULLS
Semen ejaculates were collected in winter
(Jan.-Feb.) and summer (May-June) seasons from
Tharparkar bulls to study the effect of season on
semen characteristics.
The mean reaction time was significantly
(P<0.05) higher in summer (157.63 ± 17.98 sec) than
in winter (107.75 ±26.94 sec). The overall mean
reaction time was 132.69 ±18.74 seconds. It varied
inversely with the testosterone concentration in both
the seasons. There was no significant difference in
testosterone concentrations (ng/ml) in winter
(10.67±1.63) and in summer (8.53±1.35).
The mean values of ejaculate volume, sperm
concentration, mass activity, per cent motile, live,
HOST positive sperm, acrosome integrity and
abnormality in fresh semen were 3.56±0.22,
1093.73±71.26 x 106/ml, 4.03±0.11, 84.00±3.03,
88.23±1.82, 81.43±1.49, 90.77±1.68 and 9.47±0.43
in winter season, whereas 4.45±0.18, 936.51±67.52
x 106/ml, 3.97±0.13, 83.00±2.16, 88.60±1.71,
78.20±1.94, 91.47±1.61 and 9.30±0.35 for summer
season, respectively. There were significantly
(P<0.01) higher volume in summer and higher HOST
7 5
reacted sperm in winter season ejaculates. There was
significant difference (P<0.05) in per cent intact
acrosome at both pre-freeze and post-thaw level
between winter and summer season ejaculates with
substantial reduction in motility, livability and HOST
reactive sperm after freezing in both seasons.
The concentration of Na+, K+ and Cl- did not
differ significantly between the winter and summer
seasons. Low level of potassium at post-thaw stage
indicated lesser membrane damage during
cryopreservation of semen.
The mean (±SE) of TSPP of the winter
(10.02±0.66 g%) showed no statistical difference from
the summer (9.75±0.25 g%). Similarly LPO (nmol/
108 sperm cells) did not differ significantly between
the summer and winter either in the fresh (1.13±0.05
and 1.22±0.05, respectively) or pre-freeze (1.6±0.04
and 1.69±0.05, respectively) stage. But significantly
lower LPO was observed in winter (4.26±0.07) than
in summer (4.48±0.07) at post-thaw stage.
LDH (P<0.05) and GOT (P<0.01) activity was
significantly higher in summer season in comparison
to winter season at pre-freeze stage. At post-thaw
stage, SOD (P<0.05) was significantly higher in winter
season while catalase was significantly (P<0.01)
higher in summer season ejaculates. Cholesterol
content was significantly (P<0.05) higher at pre-freeze
stage in winter as compared to summer season. A
significant lower value of motility, livability and HOST
positive sperm was observed during different
durations from 0 min to 120 min of post-thaw
incubation test. No significant difference was
observed in spermatozoal mRNA expression of HSP
70 and HSP 90 during winter and summer season in
Tharparkar bull semen.
(5) EFFECT OF LIQUID VS. FROZEN SEMEN ON
CONCEPTION RATE IN REPEAT BREEDER
VRINDAVANI AND THARPARKAR CATTLE
The investigation was carried out with the
objectives to evaluate the effect of liquid vs. frozen
semen on conception rate in repeat breeder
Vrindavani and Tharparkar cattle.
Out of total 41 repeat breeders (34 Vrindavani
and 7 Tharparkar) inseminated with liquid semen,
36.58% [11 Vrindavani (32.35%) and 4 Tharparkar
(57.14%)] animals were found pregnant. While, out
of 26 repeat breeders (20 Vrindavani and 6
Tharparkar) inseminated with frozen semen, only
19.23% [4 Vrindavani (20%) and 1 Tharparkar
(16.66%)] animals were settled. Hence, the per cent
repeat breeders settled and conception rate was found
to be almost doubled with liquid semen as compared
with frozen semen.
(6) ISOLATION AND CHARACTERIZATION OF
HEPARIN BINDING PROTEINS WITH
SPECIAL REFERENCE TO PDC-109 AS
FERTILITY MARKER IN BUFFALO BULLS
A total of 42 ejaculates were collected from 4
buffalo bulls with >75% progressive motility. These
ejaculated were evaluated and subjected to further
freezing. On the basis of post-thaw recovery
percentage these ejaculates were categorized in
freezable and non-freezable ejaculates. Ejaculates
of freezable nature had motility at fresh and post-
thaw stage as 78.14% and 50.53%, respectively;
however, those of non-freezable nature had motility
at fresh and post-thaw stage as 77.97% and 23.67%,
respectively. Seminal plasma of all these ejaculates
were separated and stored at -200C for further
estimation of heparin binding proteins and PDC-109.
Total seminal plasma protein was found 31.60-35.96
mg/ml and concentration of HBPs was found 1.07-
2.276 mg/ml of seminal plasma.
(7) STRATEGIES TO COMBAT REPEAT
BREEDING IN CATTLE WITH REFERENCE
TO ANTISPERM ANTIBODIES
Blood samples from 8 heifers, 8 pregnant, 41
normal and 43 repeat breeding cows were collected;
serum was separated and preserved at -20°C for
investigation of antisperm antibodies. The cervical
mucus was also collected from 15 animals after
screening with the White Side test for any nonspecific
infections and preserved. Sperm antigen was
prepared by 10 times intermittent freezing thawing in
LN2 and after sonication of spermatozoa. Antigen
was injected s.c. in three rabbits and subsequently
four boosters were given at 15 days interval. Blood
was collected from rabbits after last booster and
presence of antibodies was ascertained using sperm
agglutination and immuno-gel diffusion test. After
confirmation, blood was collected directly from heart
of each rabbits, serum was separated and preserved
at -20oC. Blood was also collected from guinea pigs,
serum was separated and preserved at -80oC to be
used as complement for detection of antisperm
antibodies in serum by sperm immobilization method.
(8) PROTEOME ANALYSIS OF BUFFALO
SPERM FOR PRE-SEXING OF SEMEN
(a) Expression of buffalo SRY gene
Expression was attempted with IPTG induction
from 1mM-5mM and incubation time from 2-8 h.
Optimum expression was observed at 2mM IPTG
induction and incubation time of 4 h (Fig.63). The
expressed protein was purified with cobalt immuno-
affinity column. The expressed protein was further
characterized by Western blotting using anti-histidine
antibodies. The protein showed a molecular weight
of ~28kDa on SDS-PAGE and Western blotting
7 6
(Fig.64). Further analysis of the SRY sequence data
using ExPaSy Proteomics Server predicted a
theoretical molecular weight of 28.268 kDa and
isoelectric point 9.21. Whole sequence analysis
revealed that the peptide sequence contains highest
percentage of serine residue (11.4%) and is rich in
positively charged protein with total number of 35
positively charged amino acid residues out of 245
(14.28%).
Fig.63: SDS-PAGE of showing expression of
recombinant SRY protein ~28kDa.
Lane 1, 2 and 3: Recombinant clone 1, 2, 3 post-induction;
Lane 4 and 5: Non-recombinant clone 6 hr post-induction;
Lane M: Molecular weight markers.
Fig.64: Western blot showing recombinant SRY protein~28kDa using anti-His antibodies. Lane M: Prestained
molecular weight markers; Lane 1: 2 h post-induction
whole cell lysate of recombinant clone; Lane 2: 2 h post-
induction whole cell lysate of non-recombinant clone.
(b) Sperm cell surface proteome analysis
The sperm cell surface proteins werebiotinylated and then purified by immuno affinity
column using cell surface protein isolation kit (Peirce).
The surface proteins were initially characterized by
SDS-PAGE stained by silver staining. Later the
proteins subjected 2D-Gel electrophoresis and few
spots were subjected to LC-MS/MS analysis forprotein identification. The proteins identified were
shown in table 9.
Table 9 : Sperm cell surface proteins identified by LC-MS/MS analysis
Sl. Accession No. Protein Mol. wt. (Da) Score pI valueNo
1 gi|189054178 Unnamed protein product 66151 530 7.62
2 gi|57100954 GTP-specific succinyl-CoA 47149 241 6.79
synthetase beta subunit
3 gi|28317 Unnamed protein product 59720 223 5.17
4 gi|27805977 Keratin, type I cytoskeletal 10 54815 135 5.05
5 gi|51092303 Try10-like trypsinogen 27255 49 4.83
6 gi|297469372 Seminal plasma protein A3-like 16657 194 7.42
7 gi|27807445 Peroxiredoxin-5, mitochondrial 23481 254 8.62
precursor
8 gi|23013704 ABC-type branched-chain amino 10314 53 5.61
acid transport systems, ATPase
component
(9) DEVELOPMENTALLY IMPORTANT GENES
IN BUFFALO PRE-IMPLANTATION
EMBRYOS
Expression pattern of essential oocyte marker
genes viz., BMP15 (bone morphogenic protein 15),
GDF9 (growth and differentiation factor 9), MATER
(Maternal Antigen That Embryo Requires), ZAR1
(Zygote Arrest 1) and IGFBP1 (insulin like growth
factor binding protein 1) revealed that transcripts for
these genes were found in significantly higher quantity
in oocytes and early stage embryos when compared
to later stages thus help in evaluating the
developmental competence of buffalo oocytes used
in IVEP. All the developmentally important genes
were up regulated for the in vivo produced embryos
except the thermo tolerance marker i.e. heat shock
protein, for which higher copy number was recorded
through Q-PCR, hence it could potentially be used
as a stress biomarker for the study of the
consequences of in vitro conditions on embryo quality
7 7
Glucose transporter-5 was absent during the transition
phase from maternal to zygotic transition. During the
period of preimplantation development, metabolism
switches from utilization of lactate and pyruvate to
glucose as main energy substrate which requires
glucose transporter molecules to facilitate glucose
transport and citrate synthase as a key regulatory
metabolic enzyme that catalyzes the first step in tri-
carboxylic acid (TCA) cycle. Temporal and spatial
pattern of pluripotency markers viz. OCT-4, NANOG
and SOX-2 showed that the embryos are in a state
of pleuripotency. Protein products of these genes
followed similar trend. Based on the findings, the
existing procedures and protocols may be modified
to better mimic the in vivo condition thereby improving
the efficiency of IVP.
(10) DEVELOPMENTAL POTENCY OF
PARTHENOGENETIC GOAT EMBRYOS
It was observed through micro array data
analysis that a large number of genes were up and
down regulated in diploid parthenogenetic caprine
embryos as compared to IVF derived embryos. The
comparative gene expression analysis has also been
done among parthenogenetic and SCNT embryos.
Six genes which showed up or down regulation in
diploid parthenogenetic embryos as compared to IVF
embryos were validated. One gene which may be
responsible for spontaneous parthenogenesis in
turkey was found expressing in caprine embryos.
15. NUTRITION FOR HEALTH AND
WELFARE OF LIVESTOCK, PETS AND
WILDLIFE
(1) EFFECT OF SOURCE OF PROTEIN ON THERESPONSE TO PROBIOTICSUPPLEMENTATION OF DOGS REARED ONHOME MADE DIETS
With an objective to ascertain the impact of
sources of protein on the response to probiotic
supplementation, 16 Labrador female dogs were
distributed into four equal groups. Two different
protein sources namely, a vegetable protein blend
(VPB) and poultry by-product meal (PBM), were used
for comparison, both with and without probiotic
supplementation (Lactobacillus acidophillus at 109cfu/
d). The experimental duration of 9-weeks had a
experimental protocol in terms of monitoring of BW
and DM intake, a 4-d digestion trial following 30d of
feeding, physical, biochemical and microbial
assessment of faecal quality, periodic assessment
of blood metabolic and erythrocytic antioxidant
profiles, and assessment of the humoral and cell-
mediated immunity. There were no variations among
the groups with respect to voluntary food intake. The
digestibility of DM remained similar irrespective of
dietary treatments. However, digestibility of ether
extract was found higher and that of crude protein
was lower when PBM was compared with VPB.
Further, crude protein digestibility was improved when
probiotics was supplemented to VPB-based diet, but
not in case of PBM-based diet. Physical
characteristics of faeces remained unaltered due to
dietary treatments. However, faecal biochemical
attributes including lactate and ammonia varied
differently based on the source of basal protein.
Faecal counts of health-positive and health-negative
bacteria revealed that lactobacillus count exhibited
higher values in both probiotics supplemented groups
compared to their respective controls, with a similar
trend for bifidobacteria. A reverse trend was apparent
for the health-negative clostridia and coliforms.
However, it was evident that the positive shifts in
faecal microbes were more pronounced in case of
probiotics supplementation of VPB- than PBM-based
diet. The data on general metabolic indices indicated
plasma glucose, total protein, albumin, globulin and
their ratio did not show any variations attributable to
dietary treatments. Overall, the results highlighted
that the response to probiotics supplementation
varied depending on the source of protein in the basal
diet.
(2) EFFECT OF SHORT-TERM HIGH LEVEL
SUPPLEMENTATION OF PHYTOCHEMICAL
FORMULATION (COMB1) ON NUTRIENT
METABOLISM, ANTIOXIDANT HEALTH AND
IMMUNITY OF GROWING KIDS
An experiment was conducted using goat kids
to assess the effect of supplementing the formulation
COMB1 at 0-4% (developed based on preliminary
studies) on nutrient metabolism, growth performance,
metabolic profile, erythrocytic antioxidant status and
immune response. Accordingly, 15 Jamunapari goats
of about 10 months of age were randomly distributed
into three equal groups, and fed the formulation
COMB1at 0%, 3.0% and 4.0% levels for a period of
6 weeks. Blood from individual animals were collected
at 0, 14, 28, and 42 days of experimental feeding to
assess the metabolic profile and erythrocytic
antioxidants profile. The cell-mediated immune (CMI)
response was assessed at the end of the feeding
trial. Humoral immune response was assessed by
inoculation of PPR antigen and monitoring the antigen
response by competitive ELISA. Growth and feed
conversion efficiency of the kids remained similar
(P>0.05) across the three groups. The results on the
metabolism trial conducted following 35 d of
experimental feeding indicated no effect of the dietary
intervention on nutrient intake and digestibility,
nitrogen retention or plane of nutrition by the goats.
Likewise, no positive effects in terms of growth, feed
consumption or feed efficiency were evident. The
effect of the short-term-high-level supplementation
on erythrocytic antioxidant indices indicated no major
influence except for a reduction in SOD (P=0.073)
7 8
and GST (P<0.05) in goats fed the supplement at
4% level. Blood metabolic profile of the goats under
the three groups also remained similar except for
higher serum total protein and globulin at 3% level of
supplementation. Delayed-type hypersensitivity
(CMI) response to intra-dermal PHA-P tended
(P=0.088) to have higher response at 3% level of
supplementation. Humoral immune response against
PPR antigen monitored weekly till 28 d post-inoculation
revealed no differences among the groups. The
available results are indicative of absence of any
significant effects of supplementing COMB1 on
voluntary feed intake, nutrient utilization and nitrogen
metabolism, except for subtle influence on selected
antioxidant indices and CMI response when
supplemented at a high rate for 6 weeks.
(3) EFFECT OF SHORT-TERM
SUPPLEMENTATION OF PHYTOCHEMICAL
FORMULATION (COMB2) ON NUTRIENT
METABOLISM, ANTIOXIDANT HEALTH ANDIMMUNITY OF GOATS
In light of the results obtained from previous
experiments, further experimentation was taken up
using the second formulation (COMB2). Accordingly,
15 adult Jamunapari goats of about 14-15 months of
age were randomly distributed into three equal groups,
and fed the COMB2 formulation at 0%, 2.0% and
3.0% levels for a period of 60 days. Blood from
individual animals were collected at 0, 15, 30, 45
and 60 days of experimental feeding to assess the
metabolic profile, erythrocytic antioxidants profile.
Both cell-mediated and humoral immune response
was assessed towards the end of the feeding trial.
There was no difference among the groups with
respect of voluntary feed consumption, although there
appears to be a linear positive effect of the
supplementation. Results of the metabolism trial
carried out towards the end of the study revealed
that the digestibility of nutrients especially the fibre
fractions were apparently higher in goats
supplemented at 2% level; similar improvements were
also observed in the nitrogen metabolism. The values
obtained for haematological and biochemical variables
in blood showed no variations among the three groups;
however, total protein level in the serum was
significantly higher in the group supplemented at 3%
level. A similar trend was evident with regard to serum
globulin as well. The activity of AST exhibited a
gradual decline with increased levels of
supplementation. The activity of catalase was found
to increase significantly (P<0.05) in group
supplemented at 2% level compared to control. There
was no effect of the polyherbal supplement on the
activities of other erythrocytic antioxidant indices.
Supplementation of the polyherbal formulation was,
however, effective in enhancing the cell mediated
immune response of the goats. The humoral immune
response data revealed that there were no variations
(P>0.05) in the antibody titre against chicken RBC
by the goats.
(4) EFFECT OF DIETARY CADMIUM ANDARSENIC ON HEALTH AND PRODUCTIVITYOF ANIMALS
(a) Effect of addition of 10 ppm Cd and differentameliorative agents in the diet on theperformance of guinea pigs
Seventy guinea pigs were divided into 7 equal
groups and fed a common basal diet, except for the
Cd and ameliorative agent supplementation. Group I
served as control, while groups II, III, IV, V, VI and
VII were supplemented with 10 ppm Cd along with
no ameliorative agent; 50 and 100 ppm Zn; 0.2 and
0.4 ppm Se; and 100 IU Vit E, respectively.
Experimental feeding was done for 91 days. Addition
of 10 ppm Cd in the diet had no effect on intake and
digestibility of DM, OM, CP, EE, NDF and
hemicelluloses, and retention of N, Ca, P, Cu, Fe,
Zn and Mn. Intake of TDN, DCP and TDN were also
comparable among the different groups. However,
intake, outgo and balance of Cd were significantly
higher in Cd treated groups (II, III, IV, V, VI and VII).
The retention of Cd was decreased in group IV (Zn-
100 ppm) and VII (Vit E-100 IU). Hb and PCV, TP,
albumin, globulin, A: G ratio and level of creatinine,
activity of AST and ALT, serum hormones (T3 and
T4), testis weight were adversely affected in group
II, but improved in the groups treated with any of the
ameliorative agents. The overall antibody production
was significantly reduced in group II as compared to
control, and supplementation of dietary ameliorative
agents invariably improved the levels of antibody titer
with best results in the group supplemented with 100
IU of Vit E. Cd concentration was significantly
increased in all the organs in Cd supplemented group
II as compared to other groups, and supplementation
of Zn, Se and Vit E significantly reduced the Cd
concentration in the vital organs. Growth rate was
significantly lower in group II (10 ppm Cd) but
improved in all the ameliorative agent treated groups
with best results in groups IV and VII. Liver, lungs,
kidneys and testes of Cd treated animals showed
moderate to severe degenerative changes in
comparison to improvement in the animals given
ameliorative agents, with best results in groups given
100 IU Vit E, followed by 100 ppm Zn.
(b) Effect of addition of 10 ppm Cd and differentameliorative agents in the diet on theperformance of kids
Twenty four healthy male goat kids (4-6 m)
were divided into 4 equal groups and offered a
common diet (NRC, 2007), except for the Cd and
ameliorative agent supplementation. Group I served
as control i.e. without any supplementation, while
other groups were supplemented with 10 ppm Cd
7 9
alone (Gr II) or with 100 ppm Zn (Gr III) and 100 IU
Vit E (Gr IV) for 180 days. Addition of 10 ppm Cd in
the diet had no effect on intake and digestibility of
the nutrients (DM, OM, CP, EE, NDF, ADF,
hemicelluloses, celluloses) and retention of N, Ca,
P, Cu, Fe, Zn and Mn but Cd intake, outgo through
faeces, urine, total outgo and balance were
significantly higher in Cd treated group (II) as
compared to control. However, Cd excretion
increased in groups III and IV. Intake of DM, CP,
TDN and DOM, and CP, DCP and TDN values of the
diets during metabolic trials were comparable
(P>0.05) among the groups.
Growth rate was significantly lower in group II
(10 ppm Cd) and improved in both the ameliorative
agent treated groups. It was observed that Hb and
PCV values significantly decreased in group II and
improved in groups III and IV. The supplementation
of 10 ppm of Cd had no effect on serum total protein,
albumin, A:G ratio, glucose, urea and creatinine
levels. The level of globulin significantly increased
and cholesterol significantly decreased in the group
II, which were improved with ameliorative agents.
Though the activity of AST and ALT was within the
normal range, their values were significantly higher
and ALP activity was lower in group II than other
groups, and ameliorative agents decreased the level
of these enzymes almost similar to control. Serum
hormones (T3 and T4) were reduced by 10 ppm Cd
and improved in groups III and IV. The activities of
most of the antioxidant enzymes such as catalase,
SOD, GSH-Px and GSH of erythrocytes were
significantly reduced and LPO was significantly
increased in group II, and improved in both the
ameliorative groups. Serum Ca and P levels were
low in group II in comparison to other groups. The
mean Cu, Fe, Zn, Se and Mn levels in serum of goat
kids were comparable (P>0.05) among different
groups. The serum Cd level was significantly higher
in all the Cd supplemented groups than control group.
The supplementation of dietary ameliorative agents
significantly increased serum Ca and P levels and
decreased Cd levels.
Antibody production was significantly reduced
in group II as compared to control, but
supplementation of ameliorative agents improved the
level of antibody titer. The testes weight was
significantly lower in Cd supplemented group. The
Zn levels in lungs, heart and spleen were significantly
lower and in kidney significantly higher in group II,
and supplementation of Zn and Vit E could ameliorate
the adverse effect of Cd on Zn metabolism. Cu
concentration was significantly reduced in liver, lungs
and spleen but significantly higher in kidney in group
II.
Supplementation of Zn, Se and Vit E
significantly (P<0.05) reduced the Cd concentration
in the vital organs. Cd treated animals showed
moderate to severe degenerative changes in
comparison with improvement in the animals given
ameliorative agents, with best results reported in
groups given 100 IU Vit E, followed by 100 ppm Zn.
(c) Effect of different sources of arsenic (As)exposure on the performance of guinea pigs
Twenty eight adult male guinea pigs
(584.2±10.66 g b.wt) were randomly divided into 4
groups and were fed a basal diet (NRC, 1995) added
with no arsenic (control, Gr. I) or 50 ppm arsenic
through feed from sodium arsenite (Gr. II) or arsenic
trioxide (Gr. III) or 200 ppb arsenic through water as
sodium arsenite for 77 days. Intake of DM, OM, and
other nutrients significantly reduced in the As
supplemented groups, but intake of digestible
nutrients was similar in all groups. There was no
adverse effect of As on haemoglobin, creatinine, urea,
cholesterol, glucose, total protein, albumin, calcium
and phosphorus. However, there was significant
increase in serum AST, ALT and ALP activities and
decrease in LDH activities particularly in the 50 ppm
As fed groups. Gr. II animals showed hypertrophied
liver and congested lungs. The growth rate
significantly reduced in all the As supplemented
groups being 0.91 g/d, 1.11 g/d and 1.64 g/d in Gr. II,
III, and IV, respectively as compared to 1.99 g/d in
the control. The worst performance was obtained in
the animals fed 50 ppm As (as sodium arsenite)
through feed.
(d) Effect of different levels of arsenic throughfeed and water on the performance of guineapigs
Seventy two male guinea pigs (390.1±10.4 g
b.wt) were randomly divided into 9 groups and fed
either control (NRC, 1995) diet (Gr. I) or supplemented
with arsenic either through feed @ 20 (Gr. II), 40 (Gr.
III), 60 ppm (Gr. IV) or through water @ 50 (Gr. V),
100 (Gr. VI), 200 (Gr. VII), 500 (Gr. VIII) and 1000
ppb (Gr. IX) for 189 days. Feed intake was
significantly reduced in Gr. IV and IX and digestibility
in Gr. IV only, indicating that oral supplementation of
60 ppm As in feed was the most harmful to the
animals. The growth rate was reduced in all the As
supplemented groups, with worst performance in the
animals fed 60 ppm As through feed. There was no
effect of As on haemoglobin, creatinine, urea,
cholesterol, calcium and phosphorus. However, there
was significant increase in serum glucose, total
protein, albumin, globulin, AST, ALT and ALP
activities and decrease in LDH activity in As fed
groups, particularly in Gr. III and IV. The animals
exposed to arsenic showed sluggishness, dull hair
coat and loss of alertness up to some extent when
compared to the control groups, which was
progressively higher as level of As increased. The
guinea pigs particularly those of Gr. II, III, IV, VIII
8 0
and IX showed edematous oral cavity with clearly
evident swelling around head after five months of
experiment. Some of the animals in groups III, IV,
VIII and IX showed reddish coloured urine. The
stomach of most of the high As treated animals were
atrophied being of 5.64-7.3 g (normal, 20 g). The liver,
testes, lungs, kidneys and heart also followed the
same trend except one or two animals in these groups
whose organs were similar in size to normal ones.
Vital organs, particularly liver, lungs, kidneys, testes
and heart showed atrophy with prominent
haemorrhages and congestion lesions in liver, lungs,
spleen and stomach.
(5) EFFECT OF INORGANIC AND ORGANIC
COPPER AND ZINC ON HEALTH AND
PRODUCTIVITY OF THE RUMINANTS
An experiment was conducted on 15 male goat
kids (Avg. b.wt 9.5 kg, aged 4-6 m) divided into 3
groups of 5 kids in each, on the basis of their body
weight. All the kids were offered wheat straw and
concentrate mixture in the ratio of 60:40 to meet their
nutrient requirement. The kids in group II were
supplemented with 7 ppm copper (copper sulphate)
and 40 ppm of zinc (zinc sulfate), and group III with
7 ppm copper (copper methionine) and 40 ppm of
zinc (zinc methionine), to their basal diet.
Supplementation of copper and zinc had no effect
on digestibility of proximate principles and cell wall
constituents. Balances of N, Ca, P, and Mo were
also similar (P>0.05) in three groups. Copper and
zinc retention (mg/d) was significantly (P<0.05) higher
in groups III and II as compared to group I. The
average daily body weight gain was, 34.1, 31.7 and
35.0 g/d in Gp I, II and III, respectively, which did
not differ (P>0.05) due to treatments. Hb and PCV in
blood, and glucose, total protein, albumin, globulin,
A:G ratio, urea, creatinine and cholesterol in serum
did not differ due to copper and zinc supplementation.
Activity of ALP, SGOT, SGPT and ceruloplasmin
were similar in three groups, while SOD showed
significantly (P<0.05) higher value in Gp III and Gp II
than Gp I. Concentration of serum T3 and T4 level
not affected by copper and zinc supplementation.
There was significant (P<0.05) improvement in cell
mediated immunity and humoral immune response
in Gp III and Gp II as compared to Gp I, the values
were significantly (P<0.05) higher in Gp III than Gp
II. It may be concluded that supplementation of copper
and zinc through inorganic (sulphate) or organic
(methionine) sources, to a basal diet containing 13.7
and 26.0 ppm of copper and zinc, respectively, had
no effect on growth, feed efficiency, digestibility of
nutrients, blood biochemicals and serum enzymes
except SOD. However, there was significant (P<0.05)
improvement in cell mediated immunity and humoral
immune response in Gp III and Gp II as compared to
Gp I, with a higher value in Gp III than Gp II.
(6) ASSESSMENT OF MAHUA SEED CAKE(SAPONIN) AS FUNCTIONAL FEED ON
COURSE OF FASCIOLOSIS ANDPERFORMANCE OF RUMINANTS
In vitro studies indicated 100% mortality of
juvenile flukes with 60 µg saponin/ml of extract at 3
h post incubation. BW gain and feed conversion
efficiency (FCE) were significantly (P<0.01)
depressed in control infected (CI), however, DMSC
supplementation significantly (P<0.01) improved the
performance. The nutrient intake, digestibility and
plane of nutrition were not affected by trickle infection
with F. gigantica/DMSC supplementation in crossbred
calves and lambs. The faecal fluke egg count was
significantly (P<0.01) lower in mahua cake fed
infected (MCI) group as compared to CI group
throughout the study period (150-180 days). Lower
values of Hb, PCV, total protein, albumin, AG ratio,
serum Ca and P, higher concentration of total
cholesterol, serum enzymes and antibody titre
compared to control group were the characteristic
features of infection in CI group. As a result of DMSC
supplementation, an improvement in the
concentration of Hb, PCV, total protein, albumin, AG
ratio, serum P was observed in MCI group. These
coupled with comparatively lower value of cholesterol,
antibody titre and serum enzymes revealed that
DMSC supplementation helped to minimise the
severity of trickle infection with F. gigantica.
Moreover, cytokine expression study revealed that
level of IL-6 was significantly (P<0.05) lower in MCI
group compared to CI group. During the recovery
period also, the CI group had lower body weight
(180.4kg vs 192.4kg) and FCE compared to control
group, whereas in MCI group, the above parameters
were comparable to control group. The MCI group
gained normal values of Hb, PCV, serum AST, LDH
and GGT earlier than CI group. The studies suggested
that supplementation of 10% DMSC in the
concentrate mixture of crossbred calves and lambs
were an effective strategy to reduce the severity of
trickle infection (30-35%) with F. gigantica.
(7) EFFECT OF UNCONVENTIONAL FEEDS ON
GASTRO INTESTINAL PARASITISM FORBETTER NUTRITIONAL EFFICIENCY OF
RUMINANTS
Among eight oil cakes tested, the extracts of
karanj and neem seed cake exhibited maximum effect
on motility and mortality (100% at 6 h) of H. contortus.
The other cakes viz., mustard oil cake, mahua cake,
cotton seed meal, castor bean meal, jatropha meal
and guar meal had varying effects from 43.8-56.3%.
The reduction of parasitic load (as EPG) and egg
hatchability was found in karanj and neem seed (at
5% level in concentrate mixture) cake fed lambs as
compared to infected positive control, however, the
reduction was more in karanj cake fed lambs. The
8 1
higher level of blood Hb, PCV, TEC, total serum
protein, serum albumin and A:G ratio and the
reduction of blood TLC, eosinophils, SGPT, SGOT
and ALP level were observed in karanj and neem
seed cake fed lambs. The humoral immune response
(against Brucella abortus S-99) was also significantly
(P<0.01) higher in karanj and neem seed cakes fed
lambs in comparison to infected lambs. However,
the overall performance of karanj cake fed lambs was
better (ADG: 48.6 vs 33.9) than neem seed cake fed
lambs. Therefore, based on overall performance
including general health, it is revealed that regularly
feeding of karanj cake at 5% level in the concentrate
mixture may be used to control the GI nematodes in
sheep. In another experiment, inclusion of karanj
plus neem seed cake (5% each in concentrate
mixture) was found better as compared to karanj cake
alone for controlling the GI nematodes.
(8) INFLUENCE OF DURATION AND LEVEL OF
FEEDING ON FEED CONSUMPTION,NUTRIENT UTILIZATION, SERUM
METABOLITE AND MINERAL STATUS INSEMI-CAPTIVE ASIATIC ELEPHANT
(ELAPHUS MAXIMUS)
(a) Comparative evaluation of nutrient utilization
in semi-captive Asiatic elephants (Elephasmaximus) fed different types of supplements
A feeding trial was conducted to evaluate
nutrient utilization in semi-captive Asiatic elephants
fed either wheat roti or rice-lentil mixture as a
supplement. Six sub-adults (7-12 yr old) were
distributed into two groups of 3 each. The design of
experiment was 3×2 (animals periods) switch over
design. Elephants in groups I and II received
concentrate supplement consisting of wheat roti and
rice-lentil, respectively. Cut grasses (Narkul) (Arundo
donox) were offered 20% in excess of intake to each
animal during night time. Rest of the time they were
allowed to graze in the nearby grasslands/forests.
During night time they were tied in respective
individual enclosures (night shelter) so that faeces
of each individual elephant were collected separately
and animals had no access to the feed materials of
other animals. Faeces voided during grazing were
collected in full, representative samples of browses
consumed were taken and intake during grazing was
measured indirectly using lignin as a marker. Intake
(kg/d) of cut grasses in both groups was similar.
Elephants in both groups consumed similar amount
of browses. Apparent digestibility of CP was higher
(P<0.05) in group II, but digestibility of other nutrients
was comparable in both groups. Intake of zinc was
also higher in elephants fed rice-lentil based
supplement. Intake, outgo as well as absorption of
Ca, Co and Cu did not differ between the groups.
Absorption of P, Fe and Zn was higher (P<0.05) in
group II. Blood metabolites, serum enzymes activities
and concentration of serum minerals were not altered
by type of supplement. It was concluded that rice-
lentils is a better source of supplement for growing
elephants in comparison to wheat roti.
(b) Faecal microbial profile of semi-captive
Asiatic elephant
The relative population of Fibrobacter
succinogenes and Ruminococcus flavefaciens and
total fungi numerically increased in working as
compared to non-working elephants. The relative
population of total bacteria numerically increased
10.25 fold in elephants supplemented with roti in
comparison to those supplemented with rice-lentil.
Relative population of Ruminococcus flavefaciens
and total fungi increased by 1.18 and 1.02 fold,
respectively, in elephants supplemented with wheat
roti. Relative population of Fibrobacter succinogenes
and methanogens reduced in elephants supplemented
with wheat roti. The relative population of cellulolytic
bacteria viz., Fibrobacter succinogenes and
Ruminococcus flavefaciens increased in elephants
fed 100 and 120 kg of Rohini tree in comparison to
those fed 80 kg of Rohini tree.
16. EXPENDING FEED RESOURCES AND
IMPROVING NUTRIENT EXTRACTION
FROM BIOMASS
(1) EFFECT OF DETOXIFIED OIL CAKES AS
ALTERNATE PROTEIN SUPPLEMENT FOR
SHEEP AND GOATS
Effect of supplementation of detoxified karanj(Pongamia glabra) cake on performance of
growing kids
The study was conducted to establish the
nutritive potential of karanj cake for small ruminants
following detoxification using the method developed
and reported earlier and to assess nutritive potential
in rats and kids. Based on the results of in vitro and
laboratory animal (rat) experiments, non-descriptive
kids (24) were randomly allocated to four dietary
treatments viz., control (dKC-0), dKC-25, dKC-50 and
dKC-75 substituting 0%, 25%, 50% and 75% crude
protein moiety of soyabean meal by detoxified karanj
cake (dKC), respectively. Voluntary feed intake data
during the 120-d experimental duration revealed no
untoward effects of feeding dKC on feed consumption
and palatability. However, digestibility of DM and OM
were significantly improved (P<0.01) in dKC fed
groups. The CP digestibility was significantly higher
(P<0.05) in dKC-75. Intake of DCP and TDN was
comparable among dietary treatments, however, DCP
and TDN content (%) of composite diets was
significantly lower (P<0.01) in control as compared
to dKC fed groups. Nitrogen retention (g d-1), final
body weights (kg), faecal egg count, metabolic profile
and immune response in kids were comparable
8 2
irrespective of treatments. However, total gain in
body weight, ADG and FCR were significantly
(P<0.05) compromised in kids under the group dKC-
75. Blood biochemical indices including liver function
specific enzymes and thyroid hormones were not
affected by dietary treatments. Cell-mediated immune
response in terms of DTH response to PHA-P and
humoral response to chicken-erythrocytes were
similar across the four groups. Carcass
characteristics, meat quality, chemical composition
and physico-chemical properties of L dorsi muscle
did not differ significantly among treatments. Residual
karanjin and pongamol were not detected in L dorsi
muscle or in the vital organs. Organoleptic evaluation
for appearance, flavour, juiciness, texture and overall
acceptability of chevon were comparable among all
the groups. It is concluded that following removal of
karanjin, pongamol and trypsin inhibitors through the
developed detoxification method, the detoxified cake
can safely replace soyabean meal protein moiety up
to 50% without any apparent adverse effect on DM
intake, nutrient utilization, growth rate, FCR,
metabolic profile, immune response, carcass
characteristics and meat quality in kids.
(2) FEED AND SOLID MULTI-NUTRIENTBLOCKS FOR IMPROVING LIVESTOCKHEALTH AND PRODUCTIVITY:FORMULATION OF COMPRESSEDCOMPLETE
To assess the effect of feeding compressed
complete feed block (CCFB) containing 5% DMSC
or 5% guar meal on the performance (body weight
gain, methane production and energy utilization) of
the crossbred calves, a study was conducted on 18
male growing crossbred calves (age, 6-12 months
and body weight, 141 kg) divided into three groups.
The animals of control group (T0) were fed CCFB
and of treatment groups were fed CCFB containing
5% DMSC (T1) or 5% guar meal (T2). All the diets
were iso-nitrogenous and formulated to meet the
requirement of 600 g/d growth (NRC, 2001). All the
animals were dewormed and vaccinated before the
start of experiment. The dry matter intake (kg/d or
per kg W0.75) among three groups was comparable.
The intake and digestibility coefficients of DM, OM,
CP, NDF and ADF did not differ significantly (P>0.05)
among three groups. Overall average daily gain (g)
was also not significantly (P>0.05) different among
the groups. Overall FCR (kg DM/ kg gain) also did
not differ significantly (P>0.05) among three groups.
The mean values for Hb (mg/dl), serum glucose (mg/
dl), total protein (g/dl), albumin (g/dl), globulin (g/dl),
A:G ratio and SGOT/ SGPT (IU/L) and serum urea-N
(mg/dl) of all the experimental calves remained
statistically similar (P>0.05) among three groups.
Methane production did not differ significantly
(P>0.05) among 3 groups, however total methane
production (L/d) was 11.97% and 17.4% lower in T1
and T2, respectively than control group (T0), but
methane production in L/kg DMI and L/kg DMD was,
respectively, lower in treatment groups (17.57% and
16.59% in T1; 13.75% and 16.87% in T2) in
comparison to control group (T0). The energy
metabolism studies showed non-significant
differences (P>0.05) with respect to total energy
intake, DE, ME, energy lost in faeces, urine and heat
production. The performance of crossbred calves was
comparatively better in treatment groups than control
group. Thus, inclusion of DMSC and Guar Meal @
5% in CCFB showed improvement in performance
vis-a-vis reduced (L/kg DMI) methane production
(13.75 to 17.57%).
(3) COMPARATIVE ASSESSMENT OFNUTRIENT UTILIZATION, ENERGYMETABOLISM AND RUMEN MICROBIALPROFILE IN CROSSBRED CATTLE ANDBUFFALOES
Comparative efficiency was assessed in terms
of nutrient utilization and microbial fermentation
pattern in cattle and buffaloes. Six adult cattle and 6
buffaloes were fed TMR having concentrate to wheat
straw ratio of 50:50, 20:80 and 80:20 in a 3x3 switch
over design. Metabolism trial was conducted after
21 days of feeding. The DM digestibility (%) was
comparable in cattle (60.25%) and buffaloes (60.34%).
Per cent DM intakes in cattle (1.83) and buffaloes
(1.76) were also similar. DM intake (DMI g/BW0.75)
in cattle (71.02) and buffaloes (72.92) was also
similar.
(4) UTILIZATION OF REGIONALLY AVAILABLEPROANTHOCYANIDIN-RICH TREEFORAGES AS SUPPLEMENTARY FEED FORENHANCED ANIMAL PRODUCTION
The proanthocyanidins (PAs) isolated from
mature leaves of selected tree forages were purified
and studied for their in vitro biological properties. The
protein precipitation capacity of PAs of tremal (Ficus
roxburghii) was lesser than the PAs of oak (Quercus
leucotrichophora), kachnar (Bauhinia variegata) and
biul (Grewia optiva) at equivalent concentration of
PAs and protein. The thin-layer chromatography of
F. roxburghii, Q. leucotrichophora, B. variegata and
G. optiva PAs gave multiple band profile with limited
resolution. The antioxidant activity of PAs of Q.
leucotrichophora, F. roxburghii, B. variegata and G.
optiva, was determined and it was highest in the PAs
of B. variegata, followed by Q. leucotrichophora, F.
roxburghii and G. optiva. These were compared to
the activity of standard PAs - catechin and
epicatechin. The antioxidant activity was also
evaluated by the IC50 values of these PAs. The
antibacterial activity of these tannins against strains
of Escherichia coli, Micrococcus luteus,
Staphylococcus aureus and Arthrobacter
protophormiae was evaluated and it also varied
between different tree forages. Based on their
8 3
antioxidant and antibacterial effects, the PAs of B.
variegata, had the highest activity followed by the
PAs of Q. leucotrichophora, F. roxburghii and G.
optiva.
(5) EFFECT OF DIFFERENT PHYSICAL
TREATMENTS ON TOTAL PHENOL ANDTANNIN FRACTIONS OF FICUSROXBURGHII LEAVES
The fresh mature tree leaves of Ficus
roxburghii were manually lopped from local forest area
of Kangra district and the leaves were subjected to
various physical treatments viz., chopping (T2) and
chopping and sun drying (T3). The chemical
composition and tannin fraction of fresh leaves and
treated leaves were estimated. Condensed tannin and
other fractions of tannins were estimated as per the
method described by Makkar (2003). The data
obtained were analysed by using SAS software (SAS,
2003).
F. roxburghii leaves contained 13.92% CP,
4.2% EE, 51.43% NDF and 35.92% ADF on DM
basis. Total phenol, non-tannin phenol, total tannin,
condensed tannin and hydrolysable tannin content
(% DM basis) of fresh F. roxburghii leaves were 6.27
± 0.17, 1.12 ± 0.01, 5.15 ± 0.17, 1.63 ± 0.04 and
3.52 ± 0.18, respectively. Both physical treatments,
chopping (T2), and chopping and sun drying (T3),
significantly (P<0.0001) reduced total phenol, total
tannin and hydrolysable tannin content (% DM basis)
of F. roxburghii leaves. However, condensed tannin
content significantly (P<0.0001) increased in both the
treatments. Though chopping reduced (P<0.0001)
non-tannin phenol content, chopping and sun drying
increased it.
(6) PROFILING AND DOCUMENTATION OFNUTRIENTS AND PLANT SECONDARY
METABOLITES IN COMMON FODDERS OFHIMACHAL PRADESH
The leaves of Salix spp. given to livestock as
unconventional supplementary feed in the region were
identified as S. tetrasperma and S. alba, and analysed
for nutrients and anti-nutrients. The nutrient value of
the mature leaves of S. tetrasperma and S. alba were
compared with the proximate composition of the
mature leaves of commonly used tree forages viz.,
Bauhinia variegata, Dendrocalamus hamiltonii, Ficus
roxburghii, Grewia optiva, Celtis australis and Quercus
leucotrichophora. It was inferred from the proximate
composition that the mature leaves of S. tetrasperma
and S. alba had the potential to be used for
maintenance of the animals during the winter season
when there is scarcity of green fodder.
(7) NUTRITIONAL MANAGEMENT OF ANIMALSIN TEMPERATE REGION
The nutritional values of different forage
grasses locally available in temperate sub Himalayas
were analyzed. Based on the biomass production and
chemical composition, it was observed that white
clover, Pennisetum clandestinum (Kikyu), Dactylis
glomerata (Guchhi), Lolium perenne (Rye) were most
suitable and good proteinaceous source in animal
diet amongst the locally available grasses. In winter
season, Oat (U.P 094, U.P 212 and Kent) was
cultivated in 1.5 acre of land. UP 094 variety was
found better in biomass production. Good quality
silage was prepared from about 100 tons of fodder
maize after chaffing through machine driven chaff
cutter and enrichment with molasses and salt. Milk
production was improved and fodder wastage was
prevented. A mixture of local grasses and white
clover as a leguminous source of fodder was supplied
to dairy animals at ECH to improve production
performance of animals and to reduce the wastage
of fodder.
17.STRATEGIC SUPPLEMENTATION OF
MACRO AND MICRO-NUTRIENTS
FOR IMPROVING LIVESTOCK
PRODUCTION
(1) EFFECT OF PRE-PARTUM STRATEGIC
FEEDING ON POST-PARTUM MILK YIELD
AND PERFORMANCE OF CALVES
Twenty pre-partum buffaloes (10-12 weeks
before calving) were randomly divided in two groups:
control (n=8) and treatment (n=12) to ascertain the
effect of strategic feeding during pre-partum and its
influence on birth weight of calves, total
immunoglobulin, colostrum yield and other related
parameters. After parturition the lactating buffaloes
of treatment group were further divided into two sub
groups (6 each) to receive either strategic
supplementation (2-2.5 kg concentrate mixture of
22% CP) (SS, n=6) or as per farmers' practices (NS;
n= 6) and control group remaining the same (n=8).
The on-farm trial continued for 120 days lactation
period during which the information about various
parameters (growth rate of calves, intake, daily milk
yield, milk composition, onset of oestrus, subsequent
oestrus and insemination and cost benefit ratio) was
collected.
Strategic feeding to pre-partum buffaloes (10-
12 weeks before calving) significantly (P<0.05)
improved nutrient availability (CP and ME) as
compared to control. The birth weight of calves (kg)
and colostrum yield were significantly (P<0.01) higher
and chemical composition of colostrum was better
in supplemented group. Total immunoglobulin in
colostrum and calf serum (at birth) was higher and
IgG levels in calves serum (at birth) were also
significantly (P<0.01) higher in treatment group as
compared to control. Strategic supplementation to
lactating buffaloes during 120 days lactation period
considerably increased the nutrient intake and
8 4
productivity in terms of total and daily milk yield (kg),
and 4% FCM (kg). Milk composition did not differ
significantly (P>0.05) among treatment groups;
however, daily yield of fat and protein (g) were
significantly (P<0.01) higher in treatment (SS)
groups. Strategic supplementation induced oestrus
in more number of buffaloes (SS: 83.3) than no
supplementation (NS: 66.6) and control (37.5)
animals. The average daily weight gain in buffalo
calves up to 120 days of age was significantly higher
in SS and NS groups as compared to control. The
blood biochemical profile of buffalo calves at birth
was comparable among treatment groups, however,
after 120 days hemoglobin, PCV and total serum
protein were significantly (P<0.05) lower in control
as compared to treatment group other bio-chemical
parameters remained comparable between treatment
and control groups. The mortality rate (%) in buffalo
calves was also higher in control group as compared
to treatment group.
(2) EVALUATION OF DIETARYSUPPLEMENTATION OF MICRO MINERALSWITH TANNIN CONTAINING TREE LEAVESON REPRODUCTIVE PERFORMANCE OFCROSSBRED HEIFERS IN TEMPERATESUB HIMALAYAS
(a) Nutrient composition, micromineral profile ofcommon forage grasses and anestrousheifers in Temperate Sub Himalayas
Different forage grasses (16 species) usually
fed to the livestock in high altitude of temperate hills
were collected from different locations of nearby
villages of IVRI, Mukteswar. The chemical
composition and micro mineral profile of the grasses
were analysed. Serum samples collected from
anestrous heifers at experimental cattle herd were
also analyzed for micro mineral profile.
The study revealed that the micro mineral
content of most of the forage grasses and serum
mineral profile of anestrous heifers were above normal
range of requirement, except for Cu, Zn and I. Further,
Pennisetum clandestinum (Kikyu), Dactylis glomerata
(Guchhi), Lolium perenne (Rye) were good
proteinaceous source in animal's diet amongst the
locally available grasses.
(b) Evaluation of the feeding methods andsupplementation of bovine colostrum onperformance of calves
Colostrum production characteristics of 13
cows were recorded. Mean total colostrum production
in first 8 milking (4 days post-natal period) was
29.60±1.62 L. Colostrum production in 1st, 2nd, 3rd,
4th, 5th, 6th, 7th and 8th milking were 2.58±0.11L,
2.92±0.15L, 3.44±0.28L, 3.55±0.28L, 3.95±0.27L,
4.01±0.35L, 4.53±0.42L and 4.62±0.34L,
respectively. Fat, SNF and protein percentage (n=13)
of colostrum in 1st, 2nd, 3rd, 4th, 5th, 6th, 7th and 8th
milking were 5.60±0.34, 20.42±0.25 and 14.81±0.18;
5.06±0.26, 15.42±0.26 and 10.12±0.26; 4.98±0.17,
11.88±0.34 and 6.58±0.34; 4.60±0.14, 10.56±0.21
and 5.26±0.21; 4.83±0.18, 9.86±0.10 and 4.56±0.10;
4.55±0.13, 9.27±0.11 and 3.97±0.11; 4.53±0.13,
8.91±0.08 and 3.67±0.08; 4.44±0.18, 8.53±0.04 and
3.16 ±0.03, respectively. Mean birth weight and five
months weight of calves in colostrum fed group was
26.69±0.46 (7) kg and 77.67±1.14 (3) kg and
colostrum pail fed group was 27.06±0.35 kg (n=7)
and 73.47±1.56 kg (n=3).
(c) Evaluation of feeding of live Saccharomyces
cerevisiae on growth performance in pigs
A study was carried out to investigate the
effect of live Saccharomyces cerevisiae feeding on
growth performance, nutrient utilization and immune
response in crossbred (Landrace x Desi) early weaned
piglets. A total of 48 (24 males and 24 females) piglets
were selected and assigned to four dietary treatments
for 120 days of experimental feeding. The results
indicated that weaning of piglets at an early age was
not accompanied by any detrimental effects on the
haematological and biochemical parameters;
however, supplementation of Saccharomyces
cerevisiae improved some blood biochemical
parameters such as reduction in total cholesterol level
and enhancement in glucose level. Supplementation
of live Saccharomyces cerevisiae was effective in
improving the overall performance of early weaned
piglets.
Another study was carried out to investigate
the effect of live Saccharomyces cerevisiae and
Lactobacillus acidophilus feeding on growth
performance, nutrient utilization and immune
response in piglets. A total of 36 crossbred (Landrace
x Desi) early weaned piglets (28 days) were selected
and assigned to three different treatments. The
parameters studied during the experimental trial were
weekly weight gain, daily feed intake, feed conversion
ratio, digestibility of proximate principles, balance of
N, blood glucose, serum proteins, total serum
cholesterol and triglycerides, yeast count and coliform
count in faeces, faecal lactic acid bacteria count,
humoral response against injecting SRBC (I/m) at
day 0, 14, 28; humoral immunity response (HA) and
cell mediated immunity (CMI) response by delay type
hypersensitivity test using PHA-P.
18. FEEDING PRACTICES FOR
OPTIMIZING ANIMAL PRODUCTIVITY
AND REDUCING ENVIRONMENTAL
POLLUTION
(1) ANTHELMINTIC EFFECT OF TANNIFEROUS
TREE LEAVES IN LAMBS
The study examined the comparative effects
of condensed tannins (CT) and anthelmintics in
8 5
lambs. Eighteen lambs (4 months old with natural GI
infection) were randomly divided into three groups
consisting 6 each in a completely randomized block
design. The lambs were randomly allocated into three
dietary treatments; control and 2 treatment groups,
DW and CT. In DW group lambs were dewormed at
the onset of experiment, and in CT group lambs were
given diet having 1.5% CT through leaf meal mixture.
Feeding of CT (1.5% of diet) based total mixed
ration (TMR) significantly (P<0.05) increased the
total DM and OM intake (g/d; g/kgW0.75) by lambs
as compared to DW and control groups, respectively.
However, when DM and OM intake expressed on
metabolic size of lambs (g/kgW0.75), DW group had
an intermediate position between CT and control
groups. The digestibility coefficient (%) of DM, OM,
CP, EE, NDF and ADF did not differ significantly
(P>0.05) among the treatment groups. Total-N intake
(g/d, g/ kgW0.75) by lambs was significantly (P<0.01;
07) higher in CT based TMR fed group as compared
to control. Feeding of CT based TMR significantly
(P<0.01) reduced the urinary-N excretion (% intake)
as compared to DW and control groups. Net N-
retention (g/d), as per cent of intake or as per cent of
absorbed-N was significantly (P<0.01) higher in CT
based TMR fed lambs followed by their counterparts
in DW and control group. Daily nutrient intake (g/d) in
terms of DOM, DCP and TDN was significantly
(P<0.01) higher in CT group followed by DW and
control groups. The nutrient density of TMR diets in
terms of per cent DCP and TDN did not differ
significantly (P>0.05) among the treatment groups.
Total body weight gain (kg) and average daily gain
(ADG, g) for the period of 120 days were significantly
(P<0.01) higher in CT fed TMR lambs followed by
DW and control group. The overall intake of TM rations
(g/d) by lambs was significantly (P<0.02) higher in
CT group as compared to control, however, DW has
an intermediate position between CT and control
groups. Feed conversion ratio (FCR) by lambs (kg
DMI/ kg gain) was significantly (P<0.06) better in
CT supplemented group as compared to control,
however, CT and DW groups did not differ significantly
(P>0.05) among dietary treatments. The levels of Hb
and PCV were lower in control group; however, level
of eosinophil count was significantly higher in control.
Mean serum urea level was significantly decreased
(P<0.05) in CT group as compared to DW and control
groups. Serum enzymes activities (ALT, AST, and
LDH) did not differ significantly (P>0.05) among
dietary treatments. Immune response was also found
better in CT group as compared to control. Feeding
of CT based TMR significantly (P<0.01) reduced
faecal egg counts (FEC) in lambs as compared to
control group (CT-0), however EFC were comparable
between DW and CT groups after 2 months of
deworming. Mean FEC were significantly (P<0.01)
higher in control group (CT-0) followed by DW, and
CT groups, respectively.
(2) RUMEN MICROBIAL DIVERSITY IN
DOMESTICATED AND WILD RUMINANTS
AND IMPACT OF ADDITIVES ON
METHANOGENESIS AND UTILIZATION OF
POOR QUALITY FIBROUS FEEDS
(a) Effect of nitrate on methane production and
microbial diversity in buffaloes
The buffaloes fed on diet where 20% of nitrogen
of diet was replaced with nitrate, there was 17%
inhibition in methane production without adversely
affecting the performance of the animals. The 16S
rRNA libraries of rumen archaea constructed for
control and treated animals revealed no difference in
the diversity between the two; however, there was a
shift among the populations, which might be
responsible for reduction in methane production. In
buffalo, Methanobrevibacter spp. was the
predominant genus of rumen archaeal methanogens.
(b) Effect of essential oil on methane production,
microbial diversity and growth performance
of buffalo calves
A feed additive (essential oil, EO1),
significantly inhibited (20.67%) methane production
in adult buffaloes; however, when it was fed to growing
buffalo calves with average body weight of 71.3 kg
@ 1 ml and 2 ml per day per head daily, there was
16% better weight gain in calves with 2 ml EO1 along
with improved feed conversion efficiency. There was
no effect on blood parameters, enzymes, purine
derivatives and immune response of the animals. The
16S rRNA library was constructed for rumen bacteria
of control and treated groups and it was found that
the number of clones belonging to fibre degrading
bacteria like Ruminococcus flavefacience,
Ruminococcus albus, Fibrobacter succinogenes,
Butyrivibrio fibrosolvens increased by feeding EO1.
(c) Effect of herbal feed additives on methane
production and nutrient utilization in buffaloes
(i) The feeding of a mixture of two plant products
(25 g garlic bulb mixed with 1 ml peppermint oil;
GP) @ 2.5% of DMI resulted in 13.0% reduction
in methane production (l/day), but when results
were expressed as l/kg DMI, the inhibition was
7% as compared to control animals. The results
indicated that the use of a mixture of garlic bulb
with peppermint oil as feed additive can be
explored to mitigate methane production in
buffaloes.
(ii) The feeding of a mixture of two plant products
@ 3% of DMI to buffaloes given wheat straw
and concentrate mixture in the ratio of 70:30
reduced 25% methane production (30.0 vs 22.3
l/kg DMI; and 53.8 vs 39.8 l/kg DDMI) without
any adverse effect on DM digestibility in
buffaloes.
8 6
(iii) Feeding of a mixture of Terminalia chebula and
Foeniculum vulgare in the ratio of 1:1 @ 0%,
1%, 2% and 3% of DMI resulted in methane
production 45.41, 43.55, 46.77 and 38.21 l/kg
DMI, respectively. The reduction in methane
production with 3% level was 15% in comparison
to control animals.
(iv) The effect of feeding 10% deoiled mahua seed
cake (DOMC) and Terminalia chebula pulp with
0%, 2%, and 4% on nutrient utilization and
methane production was studied in buffaloes.
Feeding of DOMC (M) + Terminalia chebula (H)
inhibited methane production by 14.68%, 17.48%
and 9.09% in terms of l/kg DMI and 16.95%,
15.77% and 5.14% in terms of l/kg DDMI in group
M10H0, M10H2 and M10H4, respectively,
without affecting intake, digestibility of nutrients
and rumen fermentation.
(3) ISOLATION AND CHARACTERIZATION OF
NITRATE REDUCING AND CELLULOSE
DEGRADING BACTERIA FROM BUFFALO
Among the 75 nitrate reducing bacteria isolated
from buffalo rumen, 11 were subjected to molecular
characterization. The isolate Nos. NRBB 57, 45, 43,
13 and 65 showed close association with Escherichia
spp., isolate Nos. NRBB 60, 73 and 75 belonged to
Clostridium family (showing 99 % similarity), whereas,
isolate NRBB 10 and 32 did not show similarity to
any of the known bacteria. Isolate NRBB57 had 100%
similarity with Escherichia coli O169H. Ten cellulose
degrading bacteria isolated from buffalo and 40 from
cattle rumen were short listed on the basis of their
fibre degrading enzyme activity.
(4) ISOLATION AND IDENTIFICATION OF
POTENTIAL MODULATORS OF RUMEN
FERMENTATION IN THE EXTRACTS OF
LOCALLY AVAILABLE PLANTS
Lonicera japonica leaf (LJL), Aesculus indica
fruit (AIF), Silene inflata stem (SIS), Silene inflata
aerial parts (SIA), Silene inflata root (SIR), Sapindus
mukorossi seed coat (SMS), Agave americana leaf
(AAl) and Asparagus racemosus root (ARR) saponins
have been isolated and analyzed by thin layer
chromatography, foam and haemolytic tests. The
yield of saponin was maximum for SMS and minimum
for SIS. The amount of crude saponins recovered
was (g/100 g) 10.1, 10.5, 4.2, 3.12, 4.0, 31.2, 3.9
and 7.05 in AIF, LJL, SIR, SIS, SIA, SMS, AAI and
ARR, respectively. Except Silene inflata root saponin,
all other saponins made stable foam. S. mukorossi
seed coat and A. indica fruit saponins gave higher
activity by foam test as compared to saponins from
other sources. The order of haemolytic activity was
in the order AIF>SIA>SMS>SIR>ARR>
SIS>AAL>LJL. Saponins from all the plants were
evaluated for effect on rumen fermentation by using
in vitro gas system with starch, white clover,
concentrate and mulberry as substrates in 30 ml of
buffered rumen liquor. The in vitro studies indicated
that there was decrease in ammonia, methane and
protozoa in the presence of LJL, SMS, ARR, AAL
and SIS saponins, and decrease in ammonia and
protozoa in the presence of AIF, SIA and SIR
saponins. All these changes implied a strongly
positive effect on rumen fermentation.
Extracts of the fruit of Terminalia bellerica and
T. chebula were analysed for total tannins phenols
(TTP), hydrolysable tannins (HT) and condensed
tannins (CT). The content (%) of TTP was 12.44 in
T. bellerica and 14.81 in T. chebula. The content
(%) of HT and CT was 12.67 and 0.09 in T. bellerica
and 14.76 and 0.053 in T. chebula.
The in vitro studies with the fruit powders of
T. bellerica (TBFP) and T. chebula (TCFP) and fruit
tannin extracts of T. bellerica (TBFTE) and T. chebula
(TCFTE) indicated that there was decrease in
ammonia nitrogen in all the fruit powder or tannin
extracts studied and decrease in protozoa in the
presence of TBFP, TBFTE and TCFTE, and methane
in the presence of TBFP, TCFP and TCFTE. Though
TBFTE was more effective in reducing protozoal
population as compared to TCFTE, the latter was
more effective in reducing in vitro methane production.
The in vitro results indicated that LJL, SMS, ARR,
AAL and SIS saponins and tannins of Terminalia
chebula may have potential in decreasing methane
production and improving rumen fermentation.
19.IMPACT OF ENVIRONMENTAL
STRESS ON HEALTH AND
PRODUCTION IN LIVESTOCK
(1) BIOPROSPECTING OF GENES AND ALLELE
MINING FOR ABIOTIC STRESS TOLERANCE
Analysis of expression of genes associated
with thermoregulatory mechanisms in goat
It was demonstrated through the experiments
that the expression of HSP60, HSP70, HSP90 and
UBQ in PBMCs during different seasons in three
different age groups (Group I, II and III with age of 0-
2, 2-5 and >5 years, respectively) of goats of tropical
and temperate regions. Real Time PCR was applied
to investigate mRNA expression of examined factors.
Specificity of the desired products was documented
using analysis of the melting temperature and high
resolution gel electrophoresis to verify that the
transcripts are of the exact molecular size predicted.
The mRNA expression of HSP60, HSP90 and UBQ
was significantly higher (P<0.05) in all age groups
during peak summer season as compared to peak
winter season in both tropical and temperate region
goats. HSP70 mRNA expression was significantly
higher (P<0.05) during summer season as compared
8 7
to winter season in tropical region goats. However,
in temperate region goats in all three age groups
studied, a non significant difference of HSP70
expression between summer and winter season was
noticed. In conclusion, results demonstrate that (i)
HSP genes are expressed in caprine PBMCs, and
(ii) higher expression of HSPs during thermal stress
suggest possible involvement of them to ameliorate
deleterious effect of thermal stress so as to maintain
cellular integrity and homeostasis in goats.
(2) ADAPTATION AND FACILITATION OF
LIVESTOCK TO IMPENDING CLIMATIC
CHANGES THROUGH SHELTER
MANAGEMENT
(a) Summer season
Physiological responses: Significantly
(P<0.05) lower rectal temperature and pulse rate were
recorded in Tharparkar calves in the morning.
Buffaloes had significantly (P<0.05) lower rectal
temperature in the morning, however, pulse and
respiration rates were significantly (P<0.05) higher
in the evening. In Vrindavani cows, the pulse rate
was significantly (P<0.05) lower in the morning and
evening; and the calves had significantly (P<0.05)
lower respiration rate in the evening. Among adult
groups, the buffaloes had significantly (P<0.05) lower
rectal temperature and respiration rate; Vrindavani
cattle had significantly (P<0.05) lower pulse rate both
in the morning and evening. Among the calves, the
buffalo calves had significantly (P<0.05) lower rectal
temperature in the morning and evening.
Biochemical and hormonal responses: Adult
buffaloes had significantly (P<0.05) lower T3
compared to Tharparkar in the morning. Vrindavani
cows had significantly (P<0.05) lower ALT and AST
compared to Tharparkar in the morning. However, in
the evening Vrindavani had significantly (P<0.05)
lower alkaline phosphatase as compared to
Tharparkar. In calves, Vrindavani had significantly
(P<0.05) higher T3 as compared to Tharparkar both
in the morning and evening. However, buffalo calves
had significantly (P<0.05) higher T4 and protein in
the evening as compared to Tharparkar.
Hematological responses: Adult buffaloes had
significantly (P<0.05) higher Hb as compared to
Tharparkar in the morning, however, Vrindavani had
significantly (P<0.05) higher Hb in the evening. Adult
buffaloes had significantly (P<0.05) higher PCV and
TEC both in the morning and evening as compared
to Tharparkar and Vrindavani. Buffaloes also had
significantly (P<0.05) higher TLC. Among calves,
Vrindavani had significantly (P<0.05) lower PCV and
TEC as compared to Tharparkar and buffaloes both
in the morning and evening. However, Tharparkar
had significantly (P<0.05) higher TLC in the evening
as compared to Vrindavani and buffalo calves.
(b) Rainy season
Physiological responses: In adult Tharparkar
and Vrindavani and in all the calf groups, the rectal
temperature increased significantly (P<0.05) from
morning to evening. In Tharparkar adults and calves,
the pulse rate increased significantly (P<0.05) from
morning to evening. In buffaloes and Vrindavani
adults and calves both, the respiratory rate increased
significantly (P<0.05) from the morning to evening.
Among adult groups, no significant change was
observed either in the morning or evening. In calves
the pulse rate was significantly (P<0.05) higher in
Vrindavani in the morning and evening.
Biochemical and hormonal responses: The
total protein concentration decreased significantly
(P<0.05) from morning to evening in Vrindavani. In
Tharparkar, Vrindavai and buffalo groups, the total
protein concentration was significantly (P<0.05) lower
in calves as compared to adults in the evening. In
adult Tharparkar and Vrindavani, the mean calcium
concentration decreased significantly (P<0.05) from
morning to evening. In contrast to adult groups, the
mean calcium concentration increased significantly
(P<0.05) in Vrindavani and buffalo calves from
morning to evening. Significantly (P<0.05) higher ALT
and AST activity was observed in the morning in
Tharparkar calves and ALT activity in Vrindavani
calves as compared to adults.
Haematological responses: Tharparkar calves
had significantly (P<0.05) higher Hb concentration
than adults in the morning and the TLC was
significantly (P<0.05) higher in calves both in the
morning and evening. The TLC concentration
increased significantly (P<0.05) from the morning to
evening. The buffalo and Vrindavani calves had
significantly (P<0.05) lower PCV than adults both in
the morning and evening. The PCV increased
significantly (P<0.05) from the morning to evening in
Vrindavani calves. The TEC was significantly
(P<0.05) lower in buffalo calves than adults in the
evening. Among adult groups, the buffaloes had
significantly (P<0.05) higher PCV at both morning
and evening. In Tharparkar adults, the TEC was
significantly (P<0.05) lower in the morning as
compared to Vrindavani and buffaloes, and also
significantly (P<0.05) lower in the evening as
compared to buffaloes. TLC was also found
significantly (P<0.05) higher in buffaloes in the
evening as compared to Tharparkar and Vrindavani.
Among the calves, Vrindavani had significantly
(P<0.05) higher Hb as compared to Tharparkar in the
morning, and Tharparkar and buffalo in the evening;
however, Vrindavani calves had significantly (P<0.05)
lower PCV as compared to Tharparkar and buffalo
calves both in the morning and evening. The TEC
was significantly (P<0.05) lower in Tharparkar in the
morning as compared to Vrindavani and in the
8 8
evening buffalo calves had significantly (P<0.05)
lower TEC than Tharparkar and Vrindavani.
(3) NATIONAL INITIATIVE ON CLIMATE
RESILIENT AGRICULTURE
(a) Selection of districts and collection of
disease/climate data
Total 147 districts have been selected by
simple stratified sampling method covering all 15
agro-climatic zones, states and union territories.
Questionnaire was developed to collect secondary
disease data. Important bacterial, viral and parasitic
diseases of animals were identified, like FMD, IBR,
HS, BQ, anthrax, brucellosis, leptospirosis,
amphistomosis, fasciolosis of cattle,
schistosomosis, and blood protozoan parasites of
cattle, PPR, FMD, goat and sheeppox, bluetongue,
CCPP, enterotoxiemia, tapeworms, haemonchosis
of sheep and goat, and swine fever, FMD and
pasteurellosis of pigs.
In order to sensitize state animal husbandry
machinery for their cooperation in disease data
collection, a meeting of Directors (AH) was conducted
on July 30, 2011 at IVRI, Izatnagar, where Directors
or their representatives from 13 states including Uttar
Pradesh, Gujarat, West Bengal, Chhatisgarh, Sikkim,
Bihar, Punjab, Uttarakhand, Maharashtra, Goa,
Pondicherry, Madhya Pradesh and Delhi participated.
The state animal husbandry departments were also
requested for their cooperation by letters, personal
visits and telephonic calls. Teams of scientists were
constituted to collect the disease data, which visited
different places and collected disease data and bio-
samples. The disease data of 19 states have been
collected so far and the same is entered in the
database.
For climate data, IVRI has got registered with
IMD, Pune. Weekly surface data (maximum/minimum
temperature, rainfall, relative humidity and weather
ata) of 108 stations for the period of latest 10 yr have
been received from IMD Pune. The data have been
entered in the database and analysis is under way.
(b) Development of database
A database was created in SQL server 2008
for storing disease and climate data. The database
provides flexibility to the user to get information on
climate zone-wise, state-wise, district-wise, disease-
wise and species-wise.
A web-based user interface application was
developed in C# & ASP.NET 3.5. The application
has the features of online addition, deletion and
updation of disease and climate data. The user can
easily navigate to desired records through grid
navigation. Parameter based search engine to get
the desired information for selected parameters like
zone, states, districts, years, months, species,
diseases, rainfall, temperature, humidity etc. The user
of the system has the option to fetch the report zone-
wise, state-wise, district-wise, species-wise and
disease-wise.
(c) Development of website
The website for NICRA project being operated
at IVRI has been developed and is available at
www.nicraivri.org. This will soon be linked with IVRI
and NICRA website.
20.DATABASE ON LIVESTOCK RELATED
STATISTICS AND DEVELOPMENT OF
STATISTICAL MODELS
(1) DEVELOPMENT OF DISEASE DATABASE
MANAGEMENT SYSTEM FOR AVIAN
INFLUENZA
The Disease Database Management System
for managing the data of avian influenza (AI) and a
single point of access to data, reports and status of
AI diagnosis is maintained with up to date entry of
samples and their results.
(2) STRENGTHENING STATISTICAL
COMPUTING FOR 'NARS'
The workshop-cum-SAS 9.3 installation
training was conducted, where 20 participants from
12 nodal centres attended the programme. Developed
statistical computing procedures for analysis of two
way unbalanced cross and nested data, estimation
of the genetic parameters, analysis of the repeated
measures designs, analysis of random and mixed
effect models, analysis of the interrupted growth
models, Probit and Logit analysis, analysis of the
nominal and ordinal data using generalized linear
models especially for animal science data. These
developed procedures were demonstrated for different
data sets through four researchers' trainings (90
participants) organized at GBPUA&T Pantnagar, IVRI
Izatnagar, CIRG Makhdoom and CSAUA&T Kanpur.
(3) DATABASE ON LIVESTOCK RELATED
STATISTICS
The secondary data related to livestock were
updated up to the year 2010-11 and analysed.
As per 18th Livestock Census-2007, there were
529.7 million livestock in India. Cattle, buffalo, sheep,
goat and pig population contributed 37.6%, 19.9%,
13.5%, 26.5% and 2.1% to total livestock. The other
species viz., horse, pony, mule, donkey and camel
contributed only 0.40%. As per FAO estimate, the
total livestock population in India was 539.6, 549.5
and 560.5 million in the years 2008, 2009 and 2010,
respectively.
India produced 121.8 million tons of milk in
the year 2010-11 and the share of crossbred cattle,
non-descript cattle, buffaloes, and goats was 24.26
8 9
million tons, 20.80 million tons, 51.17 million tons
and 3.77 million tons, respectively. The milk
production in India increased exponentially from 1979-
80 to 2010-11, which can be expressed as:
Y = 132.25 exp (0.041 X), R2 = 99.6%
Where X: 1979-80 = 1, 1980-81 = 2. It is
estimated that the milk production will touch the level
of 147 million tons in the year 2015-16.
The wool production in India was at stagnant
level of 43 million kg during the last three years 2008-
09, 2009-10 and 2010-11 and followed quadratic trend
during 1979-80 to 2010-11.
Y = 29.417 + 1.397 X - 0.030 X2, R2 = 84.0%
The cattle and buffalo hide production in India
showed decreasing and increasing trend during 1991
to 2010, and their respective production in the year
2010 was 4.62 lakh tons and 6.0 lakh tons,
respectively, which was 5.7% and 64.8% of world's
production. But the skin production from sheep and
goats showed linear increasing trend during the above
said period and contributed about 3.5% (0.67 lakh
tons) and 14.13% (1.60 lakh tons), respectively to
world's production for the year 2010.
About 6.27 million tons of meat was produced
in India in the year 2010, which was 2.14% of world's
meat production. The share of cattle, buffalo, sheep,
goat, pig and poultry meat was 17.34%, 23.33%,
4.61%, 9.36%, 5.31% and 37.29%, respectively. The
egg production in India followed exponential trend
during 1979-80 to 2010-11 and reached 63024 million
Nos. in 2010-11.
Y = 10062.42 exp (0.057X), R2= 99.5%
It is estimated that the production of eggs will
become 82914 million No. in 2015-16.
21.ECONOMIC EVALUATION OF
LIVESTOCK DISEASES AND
MARKETING OF LIVESTOCK
PRODUCTS
(1) ESTIMATION OF ECONOMIC LOSSES DUETO IMPORTANT DISEASES IN LIVESTOCK
IN INDIA
The study was conducted based on the five
years' (2006-10) data on morbidity and mortality due
to FMD in bovines, ovine and pigs taken from
Department of Animal Husbandry, Dairying and
Fisheries, Ministry of Agriculture, Govt. of India. The
results revealed that on an average 993 outbreaks of
FMD took place annually with decreasing order from
1646 outbreaks in 2006 to 422 in 2010. According to
18th Livestock Census-2007, India possessed 199.08
million cattle, 105.34 million buffaloes, 71.56 million
sheep, 140.54 million goats and 11.13 million pigs.
The average number (2006-2010) of infected and died
animals, belonging to these species were 28716,
8357, 888, 1724 and 93 and 437, 99, 33, 65 and 10,
respectively. Thus, the incidence and mortality rates
per million in cattle, buffaloes, sheep, goats and pigs
were 144, 79, 12, 12 and 8, and 2, 1, 0.5, 0.5 and 1
with case fatality rate of 1.52%, 1.18%, 3.72%, 3.77%
and 10.75%, respectively.
The total economic loss due to FMD was
worked out as sum of (a) loss from mortality, (b) direct
loss in milk yield (cattle, buffalo and goat) or wool
yield in sheep, (c) loss due reproductive failure in
affected animals, (d) loss in animal draught power
(cattle and buffalo), (e) body weight loss in sheep,
goat and pig, (f) reduction in growth of calves/lambs/
kids/piglets, (g) cost of treatment of affected animals
and (h) opportunity costs (the cost of higher feeding
and rearing inputs in surviving infected animal, loss
due to extra human labour on longer rearing time in
young stock, cost of permanent disability, extra
human labour for nursing of animal and disinfection
of shed, transportation of sick animals for treatment).
The economic losses were evaluated by using
probable values of parameters such as proportion of
herd in lactation, average annual milk yield, etc. based
on published papers/reports in different models/
formulae.
The average annual loss during the five years
(2006-2010) due to FMD was Rs. 48.56 crore. The
cattle, buffaloes, sheep, goats and pigs contributed
68.93%, 30.00%, 0.24%, 0.80% and 0.04%,
respectively to total economic loss. The highest loss
was observed due to milk loss (47.51%) followed by
reduction in growth/body weight (12.26%) and
treatment cost (9.76%). The major loss due to FMD
in India was in bovines. The annual average incidence
rate of FMD in bovines during 2006-2010 was 0.012%
as per reports of Govt. of India. The figure was very
low due to under reporting of cases of FMD in the
country. Survey studies regarding outbreaks of FMD
in India provide 2.4-6% incidence rate in the outbreak
area. If this is taken into consideration for computing
the economic losses due to FMD in India, the annual
loss would be Rs.10,000 - Rs.25,000 crores annually.
(2) STUDY OF MARKETING INTELLIGENCE OFLIVESTOCK, LIVESTOCK PRODUCTS ANDBYPRODUCTS
Directorate General of Commercial Intelligence
and Statistics (DGCIS), Calcutta, compiles the data
related to the import and export of different goods in
India. DGCIS, Calcutta grouped the import and the
export of the different livestock and livestock products
in the following groups: (1) Livestock, (2) Meat and
edible meat offals, (3) Dairy and poultry products and
honey, (4) Animal fodder and feed, (5) Raw hide and
skins and leather, and (6) Raw wool and animal hair.
The data on import and export values of the
livestock and livestock products were compiled from
9 0
the Basic Animal Husbandry Statistics for the period
2000-01 to 2009-10 and the results are given below.
(a) Import values of livestock products during
2000-01 to 2009-10
During the years 2000-01 to 2009-10 there was
an increase in import of livestock and livestock
products in India. The import value of livestock was
13.5 m rupees during 2000-01, which increased to
538.1 m rupees in 2009-10. During this period import
value increased with annual compound growth rate
of 5.45%. The import value of meat and edible meat
offals increased during 2000-01 to 2009-10. The import
value of meat and edible meat offals was 4.3 m rupees
in 2000-01, which increased to 54.3 m rupees in
2009-10. During this period import of meat and edible
meat offals increased with an annual growth rate of
38.01%. Minimum import value was 1.7 m rupees in
the year 2003-04 and maximum was 54.3 m rupees
in 2009-10.
In 2000-01 the import value of dairy and poultry
products and honey was 535.7 m rupees, which
increased to 3323.5 m rupees in 2009-10. During this
period (2000-01 to 2009-10) the import value increased
with an annual growth rate of 14.14%. On an average
the percentage contribution of import value of dairy
and poultry products and honey in the total import
value was 3.95%. The minimum import value was
Rs.393.1 m during the year 2001-02 and maximum
was 3323.5 m rupees during 2009-10.
In 2000-01 the import value of animal fodder
and feed was 818.5 m rupees, which increased to
8618.5 m rupees in 2009-10. During this period (2000-
01 to 2009-10) the import value increased with an
annual growth rate of 26.45%. On an average the
percentage contribution of import value of animal
fodder and feed in the total import value was 10.49%.
The minimum import value of animal fodder and feed
was 818.5 m rupees during the year 2000-01 and
maximum was 8618.5 m rupees during 2009-10.
In 2000-01 the import value of raw hide and
skins and leather was 8730.6 m rupees, which
increased to 19265.1 m rupees in the year 2009-10.
During this period the minimum import value of raw
hide and skins and leather was 8730.6 m rupees in
the year 2000-01 and maximum was 21108.9 m
rupees during 2008-09. During this period (2000-01
to 2009-10) the import value of raw hide and skins
and leather increased with annual growth rate of
10.83%. On an average the percentage contribution
of import value of raw hide and skins and leather in
the total import value was 50.60%.
In 2000-01 the import value of raw wool and
animal hair was 4686.8 m rupees, which increased
to 11753.5 m rupees in 2009-10. During this period
the minimum import value was 4686.8 m rupees in
the year 2000-01 and maximum was 12787 m rupees
during 2008-09. During the period 2000-01 to 2009-
10 the import value of raw wool and animal hair
increased with an annual growth rate of 9.47%. On
an average the percentage contribution of import value
of raw wool and animal hair in the total import value
was 34.34%.
During the period from 2000-01 to 2009-10
there was an increase in total import value of livestock
and livestock products in India. In 2000-01 the total
import value was 14789.4 m rupees which increased
to 43553.1 m rupees in 2009-10. During the period
from 2000-01 to 2009-10 the total import value
increased with an annual growth rate of 12.21%.
(b) Export values of livestock products during2000-01 to 2009-10
The export value of livestock was 76.3 m
rupees during 2000-01, which increased to 801.3 m
rupees in 2009-10. The minimum export value was
62.82 m rupees during the year 2002-03 and
maximum was 801.3 m rupees during 2009-10. During
this period export value of livestock increased with
an annual compound growth rate of 31.91%. On an
average the percentage contribution of export value
of livestock in the total export value was 0.36%.
The export value of meat and edible meat offals
was 14568.6 m rupees in 2000-01, which increased
to 62453.1 m rupees in 2009-10. The minimum export
value was 11828.4 m rupees during the year 2001-
02 and maximum was 62453.1 m rupees during 2009-
10. During the period from 2000-01 to 2009-10 export
value of meat and edible meat offals increased with
an annual growth rate of 20.81 %. The percentage
contribution of export value of meat and edible meat
offals in the total export value was 32.78%.
In 2000-01 the export value of dairy and poultry
products and honey was 2081.6 million rupees, which
increased to 9147 m rupees in the year 2009-10. The
minimum export value was 2081.6 m rupees during
the year 2000-01 and maximum was 15423.3 m
rupees during 2008-09. During the period from 2000-
01 to 2009-10 the export value of dairy and poultry
products and honey increased with an annual growth
rate of 22.12%. On an average the percentage
contribution of export value of dairy and poultry
products and honey in the total export value was
8.84%.
In 2000-01 the export value of animal fodder
and feed was 543.6 m rupees, which increased to
81916.8 m rupees in 2009-10. The minimum export
value of animal fodder and feed was 322.4 m rupees
during the year 2002-03 and maximum was 81916.8
m rupees during 2009-10. During the period from 2000-
01 to 2009-10 the export value of animal fodder and
feed increased with an annual growth rate of 70.02%.
The percentage contribution of export value of animal
fodder and feed in the total export value was 22.01%.
9 1
In 2000-01 the export values of raw hide and
skins and leather was 17455.7 m rupees, which
increased to 30430.3 m rupees in 2009-10. During
this period the minimum export value was 17455.7
m rupees in the year 2000-01 and maximum was
33833.1 m rupees during 2007-08. During the period
from 2000-01 to 2009-10 the export value of raw hide
and skins and leather increased with an annual growth
rate of 6.49%. On an average the percentage
contribution of export value of raw hide and skins
and leather in the total export value was 31.45%.
In 2000-01 the export value of raw wool and
animal hair was 34.2 m rupees, which increased to
5615.9 m rupees in 2009-10. During this period the
minimum export value was 18.8 million rupees in the
year 2001-02 and maximum was 28556.16 m rupees
during 2005-06. During the period from 2000-01 to
2009-10 the export value of raw wool and animal hair
increased with an annual growth rate of 73.66%. On
an average the percentage contribution of export value
of raw wool and animal hair in the total export value
was 4.55%.
During the period from 2000-01 to 2009-10
there was an increase in total export values of
livestock and livestock products in India. In 2000-01
the total export value was 34760 m rupees, which
increased to 190364 m rupees in 2009-10. During
this period the minimum total export value was 34760
m rupees in the year 2000-01 and maximum was
214421 m rupees during 2008-09. During the period
from 2000-01 to 2009-10, the total export value
increased with an annual growth rate of 22.13%.
22 EXTENSION INTERVENTIONS IN
LIVESTOCK PRODUCTION SYSTEMS
(1) DEVELOPMENT OF NEED BASED
INTERACTIVE INFORMATION SYSTEM FOR
LIVESTOCK PRODUCTION
As per the information needs of livestock
owners and other clients, an information system has
been developed in two languages i.e., english and
hindi .This english version of the system is entitled
"Livestock and Poultry Disease Information System"
and the Hindi Version is entitled "Pashudhan avum
Kukkut Rog Suchna Pranali". The system so
developed has been administered at field level among
the various groups of livestock owners / farmers and
paravets / veterinary officers. The data were collected
from them using semi-structured questionnaires/
interview schedule and were analysed. Results
revealed that both the systems were highly effective,
relevant, very precise and simple to understand, with
a very good audio and visual quality by majority of
the respondents. Further majority reported that both
the systems were very effective in raising curiosity
and interest among the clientele/ end users. Most of
them reported that the system was having very good
aesthetic component and were accurate with
complete information coverage. Majority of the
respondents were satisfied with the system and found
it very useful. As regards the observations of
respondents about their willingness to purchase the
system, majority of them were willing to purchase it.
Majority of the professionals and livestock owners
have given the system an excellent remark and said
that it is a complete information package providing
information on animal and poultry health.
(2) DEVELOPMENT AND APPLICATION OF
ELECTRONIC LEARNING AND DIAGNOSTICMODULES FOR HEALTH MANAGEMENT OF
DO GS
The study was taken up to assess the
information needs of dog owners of the country and
develop suitable electronic learning and disease
diagnostic modules for them. For assessing the
information need, a comprehensive review of literature
was done and variables were identified. Based on
the identified variables an interview schedule was
developed for assessment of information need of the
dog owners. The developed interview schedule was
pretested and finalized. The data has been collected
from 10 randomly selected cities of the country. From
each city primary data from 100 dog owners who were
visiting the private/government clinics during course
of study was collected. Thus a total responses of a
thousand dog owners has been collected for
assessment and prioritization of information need of
the dog owners.
(3) DEVELOPMENT OF PARTICIPATORYEDUCATIONAL AIDS FOR LIVESTOCK
PRODUCTION SYSTEM AND ITS IMPACTANALYSIS
The research work was taken up to develop
the participatory educational aids for livestock system
production and its impact analysis. During the year
the informations were collected, processed and
compiled from text books/research journals/magazine
for development of educational aids on the topics
as desired by the livestock owners. The information
was compiled to give the clientele a comprehensive
information package on management of new born
calf, calf feeding, colostrums feeding, managemental
practices for vaccination, deworming, pneumonia,
parasitic diseases, naval ill, calf diarrhoea, FMD and
HS. The audio recordings of the information on these
topics were completed and their impact analyses are
in progress in field with the help of livestock owners
to test the perceived effectiveness of developed audio
information.
(4) DIFFUSION AND ADOPTION OF LIVESTOCKTECHNOLOGIES
The data were compiled on status of
deworming and vaccination using secondary sources
9 2
of information. To collect information from primary
sources like livestock owners, one interview schedule
was developed for farmers' survey, which was
pretested on non sample respondents. On the basis
of pretesting, the schedule was suitably modified and
finalized. The information gathered so far revealed
that the vaccination and deworming both were not
being done to the desired extent. Farmers in some
parts, some categories, for certain diseases avoid
vaccinations. There are myths associated with
vaccinations that it cause low milk yield, infertility,
disease and fever. Farmers on their own did not get
animals vaccinated as also vaccinations we are not
done on time. Similarly, deworming was not a regular
feature in most of the regions. Lack of awareness on
importance of animal vaccinations and deworming
has been reported from many regions. However, the
concrete and updated information is expected from
the primary information to be collected in due course.
(5) POPULARIZATION OF ANIMAL SCIENCETECHNOLOGIES AMONG LIVESTOCKOWNERS THROUGH MOBILE TELEPHONY
The majority (91%) of the respondents using
cell phone were in the age bracket of 20-50 years
and 78% of respondents had above middle education.
Fifty four per cent respondents have large herd size
and main preferred animals were cows and buffaloes.
Half of the respondents were marginal land holders
and practising mixed farming. One third of
respondents said that they had regularly watched TV
and were reading newspaper for latest information,
and 28% reported that they attended training
programme related to animal husbandry. Actual calls
made and short text messages, texts sent show that
the predominant use of the mobile is for contacting
family members and friends, with work-related
reasons far less important. Para vets used the mobile
for A.I./P.D and other livestock related information
for sharing with livestock farmers, whereas livestock
owners used the mobile for social connectivity and
calling paravets for A.I./PD of their animals. Typically
mobile phone users call relatively infrequently, with
28% making calls less than once a day. A third of
respondents said that it would be difficult to do their
job properly without their mobile phone; this is
particularly the case for paravets. Half of respondents
think that mobile phones increase their workload, for
42% the effect was neutral, and a few (9%) thought
mobiles reduce their workload. Livestock owners
seeking various information, top 5 information were,
how to treat and look after sick animals (92%), where
to get veterinary help in emergency case (88%),
information about crop farming practices (94%),
where to get A.I and P.D. facilities for livestock (78%)
and information about services offered by the IVRI
for farmers(78%).
On the basis of information seeking behaviour,
short messages were prepared and delivered to alert
respondents weekly (2 messages/week), 24
messages were delivered till the end of March 2012
through cell phone to respondent's mobile phone. The
works on preparation and delivering of more
messages, information sharing behaviour of the
recipients with other livestock farmers (farmers to
farmers extension) and assessment of willingness
to pay for services on mobile telephony among
respondents is in progress.
(6) ENHANCING LIVELIHOOD OF RURAL
WOMEN THROUGH LIVESTOCK
PRODUCTION
The primary data from randomly selected 720
respondents were collected through survey
techniques using specially designed questionnaire.
The study revealed that majority of the families were
using the traditional method of herding the animals.
Role of women was found predominant in most of
the livestock production activities, with low adoption
scientific animal husbandry practices. There was
significant differences between the husband and
wives with respect to breeding, health care and
marketing related activities. Women were taking
decisions approximately 14% independently and 10%
jointly against 75% of the males.
About 30% of the males and 18% women
accessed to extension services. The major reasons
for not availing extension services were: non
availability of timely extension services at door step
and contact of extension workers to selected farmers.
Radio was the major source of information (47.78%
females and 46.94% males) in the category of mass
media. Group discussions / gosthies (45.56%
females and 47.50% males) were also found to be
the important sources of information in the studied
area.
Fig.65: Women health camp.
Appropriate interventions were selected and
refined, which were feeding area specific mineral
mixture, urea molasses mineral lick block,
conservation of fodder in silage pit for lean season,
distribution of crystoscope for timely insemination,
9 3
animal health camps for vaccination, deworming and
dealing the problem of infertility in dairy animals,
popularization of Vrindavani cattle breed through
distribution of semen straws to paravets, distribution
of revolving stool for milking (a drudgery reduction
tool) to rural women face mask for reducing the
occupational health hazards. Seven goat
demonstration units, four pig units and 33 backyard
poultry units were established in villages for improving
their livelihood. Three exposure visits to CIRG
Makhdoom, GBPUA&T Pantnagar and IVRI
Izatnagar were organized for 60 rural women to make
them aware about the improved technologies of
livestock farming. Under fodder interventions napier
grass (CO3) was promoted through demonstration.
Under capacity building programs, seven trainings
on scientific backyard poultry, goat rearing, pig
farming, dairy farming and value addition of milk were
organized for 130 farm women, the impact of which
were studied in terms of gain in knowledge and
increase in adoption. Extension literature was
developed in Hindi on 12 different topics for women
empowerment in livestock and related enterprises.
(7) LIVESTOCK EXTENSION AND HUMANRESOURCE DEVELOPMENT
PROGRAMMES
During the year, annual Kisan Mela Avam
Pashu Vigyan Pradarshini-2011 was organized during
18-20 October, 2011 at the Institute and 13046
farmers, students NGO personnel, government
personnel and industrialists participated. A total of
101 exhibitions were put up at different places viz.,
GBPUA&T Pantnagar, IARI Pusa, Haridwar,
Dehradun, IVRI Mukteswer in Uttarakhand,
Lakhimpurkhiri, Moradabad, Gorakhpur, Allahabad
and Badaun districts of Uttar Pradesh, CSWRI
Avikanagar in Rajasthan, CIRB Hissar, NDRI Karnal
in Haryana and Anand district in Gujarat. A total of
14 training programmes were organized on different
aspects viz., health and disease diagnosis,
production and management of livestock and
information and communication technology. In these
trainings 35 field veterinarians, 18 pharmacists and
202 youth/progressive farmers were trained. These
trainings were sponsored by Directorate of Animal
Husbandry UP, Directorate of Animal Husbandry
Uttrakhand, Directorate of Animal Husbandry
Himachal Pradesh, Directorate of Extension, Ministry
of Agriculture, Govt of India, ATMA of Bihar and Uttar
Pradesh. Further, an All India dog show was
organized on 10 January, 2012 wherein 108 dogs of
23 breeds participated.
A total of 51 kisan gosthies were organized in
Haridwar and Dehradun districts of Uttarakhand,
Lakhimpur Khiri, Gorakhpur, Badaun districts of Uttar
Pradesh, and Anand district of Gujarat. Further, 86
technology demonstrations were organized at different
places in the country for transfer of livestock
technologies and to disseminate the technical know-
how to the livestock owners. As far as tele-
consultancy is concerned a total of 463 queries of
farmers were replied through the Institute Help Line,
while 489 questions were answered through the Kisan
Call Centre. A total of 20,263 livestock owners/
farmers, students, entrepreneurs, rural youth, farm
women, kisan mitras and officials from non-
government organizations visited the Institute during
the year, wherein they were shown dairy farm, poly-
clinic, piggery farm, feed unit, Krishi Vigyan Kendra
and various research divisions of the Institute. Further,
a total of 45 animal health camps were organized in
different districts of Uttar Pradesh and Uttrakhand,
wherein a total of 1435 animals were treated.
Four interface meets of veterinary offices and
chief veterinary officers of Uttar Pradesh (Bareilly,
Moradabad Mandal) and Uttarakhand states were
organized during the year. One interface meet with
the VO of Bareilly, Moradabad and Agra
commissionaires of Uttar Pradesh was organized
at IVRI Izatnagar on 6.8.2011 and was attended by
35 veterinary officers. Further, an interface meet
with veterinary officers and NGOs of Uttarakhand was
organized at IVRI Mukteswar on 1.11.2011 and it
was attended by 39 veterinary officers and NGO
personnal. Further an interface meet with chief
veterinary officer and programme coordinators of KVK
and NGOs of Uttrakhand was organized at IVRI,
Mukteswar on 14.03.2012 and was attended by 15
delegates. An interface meet with AI inseminators
and paravets was organized in Gorakhpur district of
Uttar Pradesh, where 30 inseminators and paravets
participated.
An interaction meet with the ATIC kisan club
members was organized on 09.12.11, wherein a
total of 41 ATIC Kisan Club members and the officials
from banking and insurance sectors participated.
Further, media meet and show casing of technologies
was organized on 10.2.2012 wherein 50 media
personnel of daily news papers and electronic media
and 50 progressive farmers of Bareilly district
participated.
(8) ORGANIZING TRAINING PROGRAMS ANDCONDUCTING DEMONSTRATIONS
A total of 144 skill oriented trainings benefiting
2999 participants were organized on campus, off
campus, in-service, sponsored for farmers, rural
youths, rural women and extension functionaries for
disseminating the latest and advance technical know
how in their area of work. Out of total trainings, 570
rural women have been empowered technically in
home science, animal husbandry and crop science
areas. Out of total trainings, 23 trainings in crop
production covering 424 participants, 22 trainings in
animal science to 476 livestock owners, 18 trainings
9 4
in horticulture for 312 farmers, 31 trainings under
home science for 482 rural women and 13 trainings
in agricultural extension for 206 participants focusing
on formation of SHG and capacity building and
entrepreneurship development and 07 trainings for
128 fisherman in fisheries production were organized.
Besides the above, 06 scientist farmers interactions
were conducted for extension functionaries, contact
farmers, farm women and paravets. Thirty on-campus
trainings sponsored by line departments, NGOs,
National Fertilizer Ltd. and private agencies were
organized for 971 farmers, master trainers, livestock
owners and youths of Bareilly and adjoining districts.
A total of 58 demonstrations were conducted
under FLD on oilseeds and pulses covering 23 ha.
area on til, arhar, rai/mustard and lentil crops.
Demonstration on NRC-DR-2 (yellow) + Aphid control
in rai/mustard resulted in 30.05% increase in yield
over local check. Demonstration on Shekhar variety
of til+control of hairy caterpillar and leaf roller resulted
in 35.70% increase in yield over local check. Front
line demonstration of arhar on UPAS-120 variety +
Pod borer control by agro chemical resulted in 18.10%
increase in yield over local check. Demonstration on
soil treatment with Trichoderma for control of wild
disease in lentil resulted in 17.01% increase in yield
over farmers' practice.
Besides, 145 front line demonstrations were
organized on paddy, SRI technique in paddy, Napier
grass, Berseem + Oat, nutritional kitchen garden,
wheat, chilly, fodder sorghum, organic farming,
vegetables, bio-control of fruit fly, floriculture etc.
Under livestock production and management, 1295
animals were treated against tick control. Twelve
demonstration units were established on backyard
poultry and four on goatry in different villages.
KVK personnels acted as resource persons
in 56 training programs and Kisan Goshthies
organized by line state departments, cooperatives,
NGOs, Bank of Baroda, and other private agencies
in rural areas.
Seventeen animal health camps were
organized/participated wherein 2110 animals treated.
38 Kisan goshties were organized covering 18
different villages by KVK and participated in 04
exhibitions/ mela at national level by putting Institute
stall to display the technologies.
KVK published 21 folders, 4 leaflets and one
CD on scientific paddy cultivation for farmers and
extension personnels. Under extension activities,
advisory and consultancy services were provided to
approximately 4500 farmers, livestock owners
through personal contact, telephone, office call, kisan
call center, help line, personnel mobile,
correspondence on various aspects of animal health,
crop science, horticulture and fisheries etc.
One day kisan mela was organized in the
village Pitamberpur on 22 March, 2012, wherein
farmer goshti, technology exhibition, animal health
camp, animal competitions were organized. About
265 farmers/ women were benefited.
A total of 45 film shows were organized during
various training programs and about 1037 farmers,
students, dignitaries, extension personnel and other
visited the KVK, KVK farms etc.
Six OFT have been conducted on mineral
deficiency in goats reared under semi intensive
system, problems of high mortality and low
productivity in backyard poultry, problem of bacterial
leaf blight in Pusa basmati-1 variety of rice, low
productivity of late sown wheat crops, problem of
wilt disease in green chilies and problem of nutritional
insecurity among rural families. A total of 656 soil
samples were analyzed at KVK soil testing laboratory
and recommendations were made to the farmers.
(9) CONSERVATION OF SAHIWAL CATTLE
THROUGH FARMERS PARTIPATION
A herd of 121 Sahiwal cattle comprising of 2
bulls, 18 lactating cows, 44 hiefers, 38 pregnant cows
and 18 calves were inducted at Shri Mata Gaushala,
Barsana, Mathura. The test day milk yield of Sahiwal
cows in December to March was recorded as 5-10
liters per day. Apart from these, a total of 21 farmers
of Akha village, Bareilly were identified for
conservation of Sahiwal cattle through farmer's
participation approach. Beneficiary farmers or their
nominees along with a team of scientists from IVRI
participated in selection and purchase of Sahiwal
cattle from Abohar, Fazilka, Muktsar and Bhatinda
districts in Punjab. Average test day milk yield of 13
lactating cows was 9.92 liters at the farmer's door.
Sahiwal cows were screened for John's disease, T.B.
and Brucellosis. Present herd strength of Sahiwal
cattle in Akha village is 34, which comprise 11 cows
in milk, two cows having calf carrying lactation period
and 8 pregnant cows along with 13 calves. A total of
500 frozen semen doses of 5 Sahiwal bulls were
procured from NDRI, Karnal. Artificial insemination
will be used to inseminate the Sahiwal cows and non
descript indigenous cows in Akha village.
Polydactyl condition in cattle in Bareilly
About 20% indigenous cattle population of
Ramganga Katri were found to suffer by polydactyl
genetic defects in surveyed 21 villages of Bareilly
district located on the bank of Ramganga river.
Polydactyl is a congenital malformation, characterized
by the presence of one or more additional digits in
hoof of cattle. Polydactyl in cattle seems to be
influenced by a major dominant gene. As per the
information received from farmers, this condition has
spread in this region after import of 10 to 12 bulls
from Odisha during 2002 for natural service in Bareilly.
9 5
(10) RECYCLING OF ANIMAL AND FARM
WASTE AND APPLICATION OF THEIR
VALUE ADDED PRODUCTS IN
SUSTAINABLE CROP PRODUCTION AND
ANIMAL HUSBANDRY
A new garbage processing indigenous
earthworm strain "Perionyx ceylenesis" designated
as "Jai Gopal" was developed, which has high
fecundity heat tolerance and inhabiting ability on
animal and farm waste (Fig.66). A mechanical cow
composting system was designed and fabricated,
which manufacture compost within 7 to 14 days.
Similarly, vermibiomanure sieving machine was
designed and fabricated. Package of practices of
recycling of animal and farm waste using
vermibiotechnology and mechanical cow composting
machine were developed. Live demonstration of
transferable vermibiotechnologies were made to train/
educate 5000 to 7000 farmers, students and
extension workers in last five years. Vermiculture
hatcheries, earthworm breeding laboratory vermi
sheds and required infrastructure facilities for
vermibiotechnology project were developed. A total
of 79.40 quintals vermiculture of newly developed
Indian earthworm strain was supplied to farmers,
gaushala and government agencies. Doses of value
added organic products for various crops of cereals,
fruits, flowers and vegetables were standardize.
Ceolomic fluid was established as bio-agent to
enhance seed germination, seed vigour and crop
growth parameters. Attempts were made to develop
some novel products of therapeutic use in livestock.
Earthworm paste was developed for wound healing
in animals and found very effective.
Fig.66 : A. New garbage processing Indian earthworm
species "Jai Gopal" developed by IVRI., Izatnagar, B:
Coocons of new garbage processing Indian earthworm
species "Jai Gopal"
(11) IMPROVEMENT OF TRIBAL FARMING
SYSTEM IN EASTERN REGION WITH
SPECIAL REFERENCE TO DISEASECONTROL INCLUDING ZOONOSES OF
LIVESTOCK AND POULTRY
An extensive survey was carried out with the
help of structured interview schedule supplemented
with observation technique in randomly selected three
tribal villages of Hooghly district of West Bengal viz.,
Monsapota, Kankrajole and Bhagaldighi to study
socio-economic profile and animal husbandry
practices among tribal farmers. The number of
households having livestock constituted as sample
of the study and thus 71 respondents were selected
at random from the three villages. The overall literacy
rate (41%) of the respondents was poor. Most of the
respondents (89%) had no agriculture land and hence,
livestock was one of the important sources of
livelihood for them. Rearing of livestock was mostly
done by women (92 %). Out of total herd size (547)
of indigenous animals, the highest population was
recorded in case of goat (189) followed by chicken
(158), cattle (94), duck (72) and pig (34). All the
respodents were found to rear indigenous breeds of
livestock. Only 10 % of total respondents gave
vaccines and dewormers to their animals. Most of
the respodents were unaware about zoonotic
diseases although some cases of dog bites to
animals along with history of abortion were reported
by them. The majority of the farmers treated their
livestock either by themselves or through ojha,
paraveterinarians, medical shopkeepers etc. Most
of the respondents (61%) sold milk, goats, poultry
etc. to the middlemen, while 13 % respondents sold
the animal products directly to the consumers and
rest (26 %) could not sell anything as their production
was low. Almost all respondents preferred milk, egg
and meat of indigenous than crossbred/hybrid
animals.
Training along with consultancy was provided
to 50 respondents of two villages, (Kankrajole (30)
and Bhagaldighi (20) to create awareness about
scientific animal husbandry practices and integrated
livestock-cum-fish farming with special emphasis on
disease control management including zoonotic
diseases of livestock and poultry. Leaflets in local
language about vaccination schedules for cattle,
chicken, duck, farming systems of cattle, poultry and
duck, PPR, amphistomiasis, rabies etc. were
distributed among the literate respondents.
Animal health camps were organised in the
tribal villages, where vaccination was carried out
against Peste des petits ruminants (159) and goat
pox (157) in goats of tribal villages. Deworming
programme was also carried out in the three villages.
Health coverage was provided to sick animals for
various ailments. Further, sero-surviellence was
conducted in goats for brucellosis at Mansapota
(n=19) and Bhagaldighi (n=19) villages using Rose
Bengal Plate Test and Tube Agglutination Test,
where all the samples were tested negative. Few
representative animals were also tested for bovine
tuberculosis using single intradermal tuberculin test
and all were found negative. The respondents were
provided with mineral mixture supplements for their
livestock and poultry .
9 6
Fig.67: Animal Health camp in tribal villages
Fig. 68: Farmers' training in tribal villages
(12) EXTENSION ACTIVITIES AT ERS KOLKATA
Animal health camps were conducted in
collaboration with Animal Resource Department, Govt.
of West Bengal and KVK, Sri Ramkrishna Ashram,
Nimpith in different districts viz., Hooghly and South
24 Parganas including remote villages of Sunderban
area to attend local problems related to livestock and
poultry diseases through diagnosis, treatment,
vaccination, deworming programmes, awareness
campaign etc. Scientists of this station participated
as resource persons in different training programmes
conducted by Animal Resource Development
Department, Govt. of West Bengal at Dakhin
Dinajpur, South 24 Parganas, Coochbehar and Nadia
districts. Participated in five Krishi/ Pasu Mela and
exhibitions to improve awareness about scientific
animal husbandry practices, zoonotic diseases
among farmers.
Fig.69: Animal Health Camp
Strategic anthelmintic treatments in goats- as apackage of practice in tribal villages of Hooghlyand South 24 Parganas (Sundarban Delta)districts
Faecal samples from three tribal villages(Amropali village in Jejur Block, Bhagaldhighi and
Kahipur villages in Haripal Block) of Hooghly districtin West Bengal were screened in monthly intervalsfor monitoring season-wise variation of parasitic loads.
As package of practice, strategic anthelmintictreatments were introduced for controlling parasitic
load vis-à-vis increase in production efficiency ofgoats by monitoring monthly body weight gain.
Anthelmintic coverage during monsoon andpost-monsoon period was found to be effective fornot only reducing parasitic load but to increase of
body weight in animals (Fig.70).
Fig. 70: Month wise parasitic infection level and its effect
on weight gain in goat in Kashipur village of Hooghly
district.
23.VALUE ADDITION OF LIVESTOCK
PRODUCTS
(1) DEVELOPMENT OF FUNCTIONALRESTRUCTURED MEAT PRODUCTS
Restructured mutton chops extended with 5%
pea hull flour (hydrated 1:1) and 5% boiled and mashed
potato were formulated, with the objective to develop
a functional restructured product with good dietary
fibre and low cost. The product had comparatively
high cooked yield (87.02%) and very good
appearance, flavour and overall acceptability. Since
the product had limitation related to binding and
texture, it was envisaged to improve these attributes
with the help of bind enhancing agents. Accordingly,
incorporation of tamarind seed powder (0.5%, 1% and
1.5%), flaxseed flour (0.5%, 1% and 1.5%), gum
tragacanth (0.1%, 0.15% and 0.2%) and gum acacia
(0.5%, 1% and 1.5%) was attempted to enhance
binding. The findings indicated that incorporation of
1% tamarind seed powder or flaxseed flour and 0.1%
gum tragacanth or 0.5% gum acacia could
significantly (P<0.05) enhance the binding strength
and texture of extended restructured mutton chops.
Effect of extension and bind enhancing agents was
also studied on product profile including physico-
chemical properties, instrumental texture and colour
9 7
profile, water activity, etc. Storage studies based on
TBA value, microbiological as well as sensory quality
of aerobically packaged products prepared withoptimum level of bind enhancing agents revealed that
the products remain shelf stable at refrigerated
temperature (4+10C) for 15 days with sensory ratings
between good and very good. It was found that due
to higher yield, incorporation with 1% tamarind seed
powder would enhance the sensory quality of theextended product without incurring any additional cost.
Restructured buffalo meat steaks were
developed and fortified with fruit based antioxidants
to add functionality as well as to enhance shelf life.
Bael powder and mousambi peel powder, two rich
sources of total phenolics, were used for fortification.
Bael powder was tried at 0.5%, 1% and 1.5% levels,whereas mousambi peel powder was tried at 0.25%,
0.5% and 0.75% levels. Both powders were hydrated
(1:5), and added by replacing lean meat in the
standardized formulation. On the basis of sensory
quality and physico-chemical parameters, it was
inferred that bael powder at 1% and mousambi peelpowder at 0.5% were optimum for fortification of
restructured buffalo meat steaks, and cooked product
had significantly increased (P<0.01) total phenolic
content. Storage of fortified products at refrigerated
temperature (4+10C) revealed better colour, reduced
microbial load and TBARS values as compared tocontrol. The fortified products had a refrigerated shelf
life of 20 days with sensory ratings ranging between
good and very good.
(2) DEVELOPMENT OF NOVEL SHELF STABLEPRODUCTS FROM SPENT ANIMAL'S MEAT
Studies were conducted on ready to
reconstitute dehydrated meat cubes, ready to fry/
microwaved shelf stable meat snacks, meat rings,meat papad and dog biscuits. Experiments were
conducted to study shelf life of ready to cook/
reconstitute dried meat chunks. Formulations and
processing conditions for the preparation of shelf
stable microwavable meat based snacks from
chicken, chevon, mutton, pork and buffalo meat werestandardized. Experiments were conducted to
standardize processing conditions for preparation of
meat papad, meat rings and dog biscuits.
For preparation of ready to reconstitute
dehydrated meat cubes, black gram based binder
was found optimum in comparison to green gram,
lentil or soya based binders. Further, drying in hot airoven was found to be more desirable than drying in
microwave oven. Proximate composition of the
standardized product (containing 80% meat mince
and 20% black gram based binders) was: 8.10%
moisture, 49.86% protein, 5-45% fat and 8.48% ash.
Storage studies of dehydrated cubes revealed thatthere was no appreciable changes in the physico-
chemical, microbiological and sensory quality (after
rehydration) even after 90 days of storage at room
temperature.
Different types of microwaved ready to eat
snacks containing chicken, sheep, goat, pig andbuffalo meat were compared for physico-chemical
and sensory characteristics. Sensory scores were
significantly higher for the meat based snacks than
the control (without meat). Among different species,
scores were highest for mutton based snacks and
lowest for buffalo based snacks. Product yield andprotein content were also significantly higher for
mutton than other meat based snacks. Final
composition of microwaved mutton based snack was:
4.69% moisture, 13.85% protein, 0.73% fat and
4.90% ash. Thus use of mutton for preparation of
ready to eat microwaved snack was found mostsuitable than chicken or buffalo meat.
Formulation and processing conditions for
mutton based papad was also standardized. From
series of preliminary trials, formulation containing
50% meat was found optimum. Use of black gram
was found to be more advantageous over rice flour
as binder in the papad formulation. Sensory scoreswere higher for microwaved than deep fat fried
samples. Proximate composition of the microwaved
ready to eat mutton papad was: 7.4% moisture,
17.09% protein, 14.97% fat and 6.23% ash.
Series of experiments were conducted to
develop shelf stable ready to cook meat rings from
meat of spent hens. The standardized basicformulation contains 90% spent hen meat, 7% refined
wheat flour, 3% potato starch besides other additives
like salt, spices and condiments. Experiments were
conducted to partially replace meat with rice flour,
barnyard millet flour and texturized soya granules.
Products containing 10% rice flour were found to bemost acceptable. Composition analysis of product
showed 7.51% moisture, 47.76 % protein, 14.40%
fat and 5.49% ash. No marked changes in the quality
of product were observed up to 45th day of storage at
room temperature.
Dry pet food was developed by incorporation
of different buffalo offal. Meals from lung, liver andtripe were prepared by autoclaving, mincing and
overnight drying at 90ºC. Dry pet food was prepared
with incorporation of offal meals, soya meals and
cereal flours by baking at 150ºC for 1 hr. All the
variants were fairly acceptable.
(3) MEAT AUTHENTICATION: AN INTEGRATEDMOLECULAR APPROACH
The self designed gender specific primer pair
for amelogenin gene (AMELX/AMELY) and sex
determination region of the Y chromosome (SRY)
gene was tested on samples from closely related
species like cattle and buffalo, and sheep and goat,
to evaluate the efficacy of these primers as auniversal primer for sex determination. The meat/
blood samples from both the sexes of above animals
were collected for extraction of DNA for PCR assay.
The results revealed that the gender-specific primers
9 8
from amelogenin were effective in determining the
sexes in indigenous cattle as well as in sheep and
goat (Fig.71). The gender-specific primers from SRYwere effective in determining the sexes in indigenous
cattle, buffalo, sheep and goat.
Fig.71: Electrophoretic pattern of amplification fragmentsfrom the meat DNA using AML-FW and AML-RV primers.
Samples are: cattle male (Lane-1), cattle female (Lane-
2), sheep male (Lane-3), sheep female (Lane-4), goat
male (Lane-5) and goat female (Lane-6). Lane-M=marker
of molecular weight, 100-bp ladder (O'Gene Ruler,
Fermentas), N=Non-template control.
(4) MONITORING MEAT SAFETY IN SUPPLY
CHAIN
Cold chain break down in meat supply leads
to premature spoilage of meat and meat products
putting the health of the consumers at risk. Monitoring
of meat quality in supply chain from production
through to the consumer is necessary to assure the
customers of absolute product safety. Therefore, a
program has been designed to develop a field kit and
indicator based sensor to monitor the meat safety in
supply chain. In the first instance, attempts were
made to optimize different levels of indicator
chemicals, alkali and distilled water for developing a
chromogenic dye. The meat filtrate was added with
the developed dye and it was found that the colour
changed with an increase in microbial load in the
meat. Results have shown that the colour changed
from green to orange when the microbial load in the
meat exceeded 7 log cfu/g the point at which the
meat becomes unsafe for consumption. Further study
is in progress to develop an indicator based sensor
for use in the packaged meat and to validate the
field kit and indicator sensor by evaluating under
different storage conditions.
99
4. TECHNOLOGIES ASSESSED AND TRANSFERRED
The process of technology assessment and
transfer is one of the mandates of the institute.
Technology refinement, up-scaling and promoting
public private partnerships and start-up-companies
for technology led venture creation are important
activities of the institute. Another major activity of
the institute is the creation of awareness among the
farmers and other end-users on livestock health and
production, and to provide suitable package of
practices including the need based farm-livestock
oriented technologies. The technologies generated
by the institute in the areas of animal health,
production, reproduction, feeding and management,
livestock products, etc. are field validated and on
the basis of feedback received, are refined, if
required, before they are transferred to end-users and/
or commercialized and licensed to industry
entrepreneurs.
Some of the new technologies/techniques/
package of practices and those already in field use
that have been assessed during the year are as under:
Immunoprophylactics and immunodiagnostics
* Live attenuated goatpox vaccine
* Peste des petits ruminants (PPR) hybridoma
clone 4B11
Clinical technologies/techniques and protocols
* Urea molasses mineral block.
* Udder paste prepared with bio-organic
substances like trace minerals, essential oils,
fullers earth and herb extracts for teat and
udder lesions and for reducing SCC in lactating
cows.
* Ameliorative effects of spirulina and few herbal
extracts were evaluated on laboratory model.
* Olinall was prepared for transfer to end users
through ATIC.
* Area specific mineral mixture for UP was
prepared and sold through ATIC.
* Short wave diathermy, therapeutic ultrasound,
TENS, interferential therapy and static
magnetic field for early rehabilitation of dogs
with hind quarter weakness.
* Technique of interlocking nailing for fixation of
long bone (tibia, femur and humerus) fractures
in large ruminants.
* Technique of dental acrylic-pin external
skeletal fixation for management of open
fractures in small animals.
* A new design of tubular plate (without screws)
was developed and the technique was
evaluated for fixation of fractures in osteopenic
bones in small animals.
* A new technique of tied-in configuration of
interlocking nail and external skeletal fixation
system was developed and used for the
treatment of comminuted fractures of femur in
dogs.
* Technique of continuous intravenous infusion
of propofol for balanced anaesthesia in canine
orthopaedic patients.
* Technique of intravenous infusion of
dexmedetomidine/midazolam, pentazocine/
butorphanol, thiopental/propofol with isoflurane
for maintenance of general anaesthesia in
buffaloes.
* Technique of intravenous infusion of
dexmedetomidine, butorphanol and propofol/
ketamine for anaesthetic management of
uraemic goats.
* Technique of intravenous infusion of
dexmedetomidine, butorphanol and propofol /
ketamine for anaesthetic management of
buffalo calves suffering from urolithiasis.
* Technique of intravenous infusion of
medetomidine/dexmedetomidine, butorphanol/
midazolam and propofol for maintenance of
general anaesthesia in sheep.
* Tube cystostomy was assessed in goats,
buffalo calves and bullocks and the technology
was transferred to the veterinarians visiting the
institute.
* No scalpel surgery for goats and para-anal tube
cystostomy in bullocks were reassessed in
clinical cases and found very useful in the
management of urolithiasis, the technique was
transferred to the veterinarians visiting the
institute.
* Mesenchymal stem cells were assessed for
their efficacy in the management of full
thickness skin wounds and spinal cord injury.
The technology was transferred to field
veterinarians through lectures and
demonstrations during different training
courses.
* Technique of application of Calendula
officinalis Tridax procumbens, Adansonia
digitata, as dressings with oral graphites
(homeopathy) for wound healing in domestic
animals was developed.
Wildlife centre
* Technology pertaining to sex identification of
Gyps vultures on the basis of molecular
methods was assessed.
Livestock products technology
* Restructured chicken drumsticks, milk chips,
chicken snacks.
100
Livestock production management/farm
machinery
* Milk feeding device to feed orphan goats.
* Modified technology of feeding of green fodder
and hay to prevent wastage of feed in sheep
and goat.
* The concept of early weaning (at 2 months
instead of 3 months) was introduced in sheep
and goat.
Vermicomposting technologies popularized
* Improved three garbage processing earth worm
species viz., Eisenea foetida, Eudrilus
eugeniae and Perionyx ceylenesis as "Jai
Gopal"
* Package of practices for production of
vermibiomanure and nutriwash.
* Vermibiomanure sieving machine.
Extension interventions
Various extension programmes were
implemented during the year through which the
information about various technologies and package
of practices for livestock health, production and
management were disseminated to industries,
farmers, veterinary officers and other clients. The
details are given as under:
Exhibitions stalls (115) were put up at different
places like:
* KVK, Dhanauri, Haridwar, Uttrakhand.
* Kisan Mela, Hindustan Media Agency at Palia,
Lakhimpurkheri (UP).
* Lakshar Block of Haridwar district of
Uttrakhand.
* Gujjar Basti Gandi Khata Bahdtabad Block of
Haridwar district of Uttrakhand.
* Bhagwanpur Block of Haridwar district of
Uttrakhand.
* IX All India Farmer's Fair and Agro-Industrial
Exhibition, GBPUA&T, Pantnagar.
* XI IVRI Kisan Mela at IVRI, Izatnagar.
* Krishi Mela Kumbh, Commissionaires at
Moradabad district of Uttar Pradesh.
* Kisan Mela at CSWRI, Avikanagar, Rajasthan.
* IV IVRI Dog Show at IVRI, Izatnagar.
* Buffalo Mela at CIRB, Hissar.
* XIV Indian Agricultural Scientist and Farmers
Congress at Bioved, Allahabad.
* National Dairy Mela at NDRI, Karnal.
* Pusa Krishi Vigyan Mela at IARI, New Delhi.
* Interface Meet with CVO at IVRI Mukteswar.
* Gorakhpur district of Uttar Pradesh.
* X All India Farmer's Fair and Agro-Industrial
Exhibition at GBPA&TU, Pantnagar.
* Ratanpur village of Dehradun District of
Uttrakhand.
* Dandipur Jatowala village of Dehradun Dist. of
Uttrakhand.
* Shuklapur village of Dehradun district of
Uttrakhand.
* A total of 85 exhibitions were put up in different
villages of Bareilly and Badaun districts of Uttar
Pradesh.
* Animal health and infertility camps (45), Kisan
Gosthies (51) and technology demonstrations
(86) organized in different villages of Bareilly,
Lakhimpur Kheri and Gorakhpur districts of
Uttar Pradesh, Haridwar and Dehradun districts
of Uttrakhand, and Anand district of Gujarat.
* One interface meet with AI inseminators and
paravets, one interaction meet with the ATIC
kisan club members, and 7 interface meets of
veterinary offices of Uttar Pradesh and
Uttrakhand states were organized.
* A media meet and show casing of technologies
was organized.
* Mobile ATIC van visits were conducted (312)
covering 92 villages to popularize the
technologies.
* Information was disseminated by 463 calls
received through Kisan Call Centre and 489
calls received through Institute Help Line
regarding livestock management, extension
programmes, livestock feeding and nutrition,
livestock diseases, goattery, dog, poultry,
fisheries, bee keeping, horticulture and other
allied subjects of agriculture.
* 20,263 livestock owners/farmers, students,
and entrepreneurs and distinguished visitors
visited the Institute.
* Poultry rearing practices at high altitude was
assessed and knowledge disseminated to hill
farmers through kisan gosthis.
* Developed and maintained linkages with NGOs
(Chirag, Aarohi, UPASAC etc.) working in
Kumaon region and provided technical inputs
and leaflets/ pamphlets for onward transmission
of technical know how to the end users.
* Linkage was established with local radio station
"Kumaun Vani" and 4 radio talks (including live
broadcast of phoning programme) were given
through this programme, technologies of
modern animal husbandry practices and
solutions for animal health problems were
provided.
* Demonstrated scientific animal husbandry
practices through farmers' visit to different
Livestock Production Unit of the Division of
Temperate Animal Husbandry.
* Information system software developed for
farmers in Hindi on "Ik'kq/ku ,oa dqDdqV jksx lwpuk
101
iz.kkyh (PAKRSP)" and English on "Livestockand Poultry Diseases Information System
(LPDIS)" was sold to various clienteles such
as State Department of Animal Husbandry,
Uttar Pradesh, Haryana, Gujrat, Delhi,
Maharashtra, Andhra Pradesh, Uttrakhand,
Meghalaya, Orissa, Madhya Pradesh,
Karnataka and other private feed and
phamaceutial companies, National Dairy
Development Board, State Agricultural and
Veterinary Universities and individual farmers.
Farm literature
1. Two issues of half yearly magazine entitled
"Pashu Chiktsa Vigyan" were published from
ATIC for dissemination of scientific information
to livestock owners, farmers and rural youth.
2. One issue of "Gyan Vigyan" Newsletter was
published for the benefit of the farming
community and extension personnel.
102
5. EDUCATION AND TRAINING
The major goals of this Deemed University IVRI
are to establish a dynamic system of veterinary and
animal science education to train highly skilled and
competent manpower to address the challenging
tasks with new emerging areas of research, teaching,
extension and industry. It is undertaking pioneering
research in veterinary and animal sciences with
holistic approach, promoting high quality education
and training, developing systems and technologies
for better animal health care and production and their
dissemination to end users to function as an effective
instrument for nutritional security, poverty alleviation
and rural reconstruction. We are striving for excellence
in innovative research, human resource development,
technology generation and transfer for improved
animal health and productivity and responding to the
needs of animal owners and lovers with acknowledged
services and leadership among the world nations.
The significant features of this Deemed
University are to make postgraduate education in
veterinary and animal sciences responsive to the
needs of the livestock- farming sector and widen the
knowledge base by providing research training in
veterinary and animal sciences. It also aims at
developing newer cost effective, farmer friendly,
ecologically acceptable and sustainable strategies
to combat dreadful animal diseases, to augment
livestock production/products technology and to
develop human resource in order to meet out further
challenges in the field of animal health and production
in the country through students' research projects.
The university with its reputation for quality education
offers Master's degree programme in 22 disciplines
and Doctoral programme in 20 disciplines.
The institute admits students to its
postgraduate programmes through rigorous screening
procedure under five categories viz., open
competition, foreign students, in-service candidates
of SAUs under faculty up-gradation scheme,
departmental candidates of IVRI and ICAR in-service
nominees. For admission to M.V.Sc. courses in the
university, an All India written entrance examination
was conducted by ICAR and 136 students were
selected after counseling. The written entrance
examination for Ph.D. courses was conducted by the
institute on 03.07.2011 followed by an interview on
3rd-4th August, 2011 and a total of 104 students were
admitted including sponsored and foreign students.
Master's Degree Programme : Discipline-wise students admitted and degrees awarded were asfollows.
Sl. Name of Discipline On Roll as on Admitted in Awarded inNo. 01.09.2011 Academic Academic
year 2011 year 2011
1. Animal Biochemistry 12 05 05
2. Animal Biotechnology 13 06 08
3. Animal Genetics and Breeding 17 08 05
4. Animal Nutrition 19 09 05
5. Biostatistics 09 03 03
6. Epidemiology 06 02 03
7. Livestock Economics 04 02 02
8. Livestock Production and Management 10 06 04
9. Livestock Products Technology 13 05 04
10. Poultry Science 21 10 05
11. Veterinary Bacteriology 13 06 04
12. Veterinary Extension Education 11 05 06
13. Veterinary Gynaecology & Obstetrics 14 06 06
14. Veterinary Immunology 13 06 07
15. Veterinary Medicine 15 07 05
16. Veterinary Parasitology 16 07 07
17. Veterinary Pathology 17 08 06
18. Veterinary Pharmacology 15 06 03
19. Veterinary Physiology 15 07 03
20. Veterinary Public Health 13 06 04
21. Veterinary Surgery & Radiology 14 07 08
22. Veterinary Virology 18 09 06
TOTAL 298 136 109
103
Doctoral degree programme: Discipline-wise students admitted and degrees awarded were as
follows.
Sl. Discipline On Roll as on Admitted in Awarded in
No. 01.09.2011 Academic Academic
year 2011 year 2011
1. Animal Biochemistry 18 06 01
2. Animal Biotechnology 25 08 01
3. Animal Genetics & Breeding 25 07 05
4. Animal Nutrition 23 07 04
5.. Biostatistics - 02 -
6.. Livestock Production & Management 8 02 01
7. Livestock Products Technology 12 04 00
8. Poultry Science 17 06 04
9.. Vet. Bacteriology 20 07 02
10. Vet. Extension Education 16 04 02
11. Vet Gynaecology & Obstetrics 20 05 02
12. Vet. Immunology 11 03 03
13 Vet. Medicine 19 07 08
14. Vet. Parasitology 16 05 01
15 Vet. Pathology 21 06 01
16. Vet. Pharmacology 19 06 02
17. Vet. Physiology 15 03 04
18 Vet. Public Health 12 04 03
19 Vet. Surgery & Radiology 12 04 06
20 Vet. Virology 25 08 03
Total 334 104 53
Besides teaching programmes for M.V.Sc.
and Ph.D. students, the institute runs teaching and
training programmes and National Diploma Courses
of 10 months' duration in nine disciplines viz.,
Preventive Veterinary Medicine, Animal Husbandry,
Veterinary Biological Products, Animal Reproduction,
Poultry Husbandry, Medicine and Management, Meat
and Meat Products Technology and Fodder and Feed
technology. The National Diploma in Equine
Husbandry, Medicine and Surgery is mainly offered
to Army officers to apprise the latest advances in
health, breeding and management of equines.
Following National Diploma Course was conducted
by the university during this period.
LIST OF DIPLOMA COURSES
Course Name No. of participants Awarded during
admitted 2011-12
National Diploma in Equine Husbandry, Medicine and 6 6
Surgery (NDEHMS)
TOTAL 6 6
During this period, following number of students were admitted in different courses and submitted
theses for Master's and Ph.D. degrees.
Students Admitted Theses Submitted National Short term International
Diploma Training Training
M.V.Sc. Ph.D. M.V.Sc. Ph.D. Courses Courses Courses
136 104 109 56 1 15 1
students and in service candidates. The following
short term training courses were held during this
period.
Highly specialized short term training courses
are also conducted in different disciplines to provide
the recent advances and hands on training to the
104
SHORT TERM TRAINING COURSES ORGANIZED AT IVRI
Sl. Name of course Division in which Period Sponsoring
No. the course authority
was conducted
1. Laparoscopy Surgery in Animal Practices Surgery 10.10.11 to Animal Husbandry,
24.10.11 Thiruavananthapuram
2. Fracture Management in Animals Surgery 01.11.11 to A.H.& Fishery Dept.
30.11.11 Jharkhand
S.S.B. New Delhi
3. Anaesthesia and Pain Management Surgery 01.12.11 to AH Goa
31.12.11 AH Shillong
4. Production & Standardization of Poultry B.P. 31.10..11 to Institute of Veterinary
Vaccine [Ranikhet Disease 'F'Strain,Ranikhet 30.12.11 Biologicals , Guwahati
Disease M & Fowl Pox]
5. Production of Bacterial Biomass through B.P. 20.7.11 to Animal Husbandry,
Fermenter 5.8.11 Dept.
Thiruvananthapuram
6. Concept of Viral Vaccine B.P. 5.10.11 to Animal Husbandry &
4.11.11 Vety. Dept. Assam
7. Production & Standardization of PPR B.P. 1.12.11 to A.H. Kerala
Vaccine 7.12.11
8. Production & Standardization of Br. B.P. 3.12.11 to A.H. Kerala
Abortus strain-19 Vaccine 9.12.11
9. Standardization & Quality Control of Biological 1.11.11 to A.H.&Fishery Dept.
Veterinary Biologicals Stand. 30.11.11 Jharkhand
A.H. Punjab
10. Diagnosis & Control of Emerging and V.P.H. 14.11.11 to AH & Fishery Dept.
Important Zoonotic Diseases 21.11.11 Jharkhand
11. Diagnosis & Control of Emerging and V.P.H. 12.12.11 to A.H. Punjab
Important Food born Infections and Intoxications 19.12.11
12 Diagnosis of Brucellosis,IBR and CADRAD 12.9.11 to Animal Breeding
Campylobacteriosis 17.9.11 Centre, Raibareilly
13 Art of Disease investigation with emphasis CADRAD 5.12.11 to A.H. Bihar
on Collection, Preservation and Dispatch of 10.12.11 A.H..Punjab
Material
14 Diagnosis of Parasitic Diseases CADRAD 12.12.11 to Animal Husbandry,
17.12.11 Bihar
Animal Husbandry,Goa
A.H. Punjab
S.S.B. New Delhi
15 Mycotoxin and other Feed Poisons and their CADRAD 8.1.12 to A.H. Goa
Diagnosis. 13.1.12 A.H. Jharkhand
N.D.R.F. Kolkata
MEETINGS OF BOARD OF MANAGEMENT,ACADEMIC COUNCIL AND STANDINGCOMMITTEES
1. During this period 45th meeting of Board ofManagement was held on 16.8.11 at IVRIIzatnagar.
2. Meeting of Standing Committee on P.G.Faculty was held on 30.8.11, 13.9.11, 14.2.12
and 21.3.12
One international training course on 'Gene
based Techniques for Research in Biotechnology'
was held from Feb. 20 to March 11, 2012 . It was
sponsored by TCS -Colombo Plan, India Millennium
Fund, Colombo Plan Secretariat Colombo, Sri Lanka.
Ten participants from different Asian countries viz.
Iran, Malaysia, Fiji, Indonesia and Vietnam
participated in this course.
105
3. Meeting of Standing Committee on Course
Curricula and Academic Affairs was held on
29.6.11 and 24.11.11
4. Meeting of Standing Committee on
Scholarship, Financial Assistance and
Academic Progress held on 23.6.11, 26.8.11
and 26.11.11
Scholarships
The students admitted in this premier institute
are given financial assistance in the form of different
scholarships such as, Institute Scholarship, Indian
Council of Agricultural Research Fellowship, CSIR
Fellowship and University Grants Commission's
Junior Research Fellowship. In addition, students are
also provided contingency grant for M.V.Sc. and
Ph.D. degree programmes. During this period (2011-
12), ICAR Junior Research fellowship (JRF) was
given to 230 students amounting to Rs.1,41,09,152
and contingency amounting to Rs.6,99,325. ICAR
Senior Research Fellowship (SRF) was given to 34
students amounting to Rs.55,56,814 and contingency
amounting to Rs.1,00,787. Institute Scholarship was
given to 115 M.V.Sc. students amounting to
Rs.81,61,612 and contingency amounting to
Rs.481272. Same fellowship was given to 198 Ph.D.
students amounting to Rs.1,92,62,774 and
contingency amounting to Rs.11,10,133. CSIR JRF
was given to two students amounting to Rs.2,88,000.
INSPIRE Fellowship was given to seven students
amounting to Rs.9,21,600 and DBT-JRF was given
to one student and it amounted to Rs.2,16,000 .
Statement showing amount of receipt and expenditure for the year 2011-12 is as follows:
Scholarship/ No. of Amount Sanctioned Expenditure
fellowship Students Fellowship/ Contingency Fellowship/ Contingency
Scholarship Scholarship
ICAR JRF 230 22680000 918000 14109152 699325
ICAR SRF 34 5615984 300000 5556814 100787
Institute Scholarship
M.V.Sc. 115 9797760 690000 8161612 481272
Ph.D. 198 22806000 1880000 19262774 1110133
CSIR JRF 2 288000 29864 288000 -
ICMR JRF 2 384000 40000 384000 14316
UGC JRF 1 192000 10000 192000 -
Inspire Fellowship 7 1188000 120000 921600 61797
DBT-JRF 1 216000 42286 216000 29479
P.G. Education
Funds received under the scheme "Strengthening and Development of Agricultural Education (P.G.
Education)" from Education Division of ICAR during the year 2011-2012 are as follows:
(Rs. in lakhs)
S.N. Items ICAR share
1 Works
1.1 Construction of Boys/Girls hostel at IVRI, Izatnagar 100.00
1.2 Repair, refurnishing/renovation modernization of educational structure/ 154.50
infrastructure and other works related to teaching and learning including
Model-Class rooms and PG laboratories.
2 Equipment
2.1 Equipments/Computers/Implements for education : 23.00
Purchases, repair and maintenance of equipments including those for
cutting-edge-technologies, e-learning and distance education, AMCs;
Central instrumentation facility and Computers.
3 Curriculum development and delivery
3. Preparation of quality instructional material, practical manuals and e-resources; 22.00
Contingency grants for practical for UG/PG students.
106
4 Strengthening of UG and PG teaching
4.1 Faculty development, facilitating within country participation in symposia, 9.00
seminars, training (other than CAS/CAFT); JRD for technical/paraprofessionals
and administrative staff; development of facilities for UG practicals, computer labs;
repair, maintenance and AMC of equipments; students study/educational tours.
5 Amenities
5.1 Students amenities: Students counseling and placement, health facilities, 8.00
faculty amenities.
5.2 Personality development : Counseling of UG/PG students, tutorials for SC/ST 0.50
students.
6 Support to Dean
6.1 Education Technology Cell, Examinational Cell. 7.00
6.2 Faculty specific requirements for improving education and development and 6.00
strengthening of facilities.
Total: 330.00
107
6. AWARDS AND RECOGNITION
Institutaional awards
* ICAR Ganesh Shanker Vidyarthi Sarvshrestha
Hindi Patrika Puruskar
* Best National Agribusiness Incubator Award
National and institutional awards
* Dr. D.N. Kamra (Bharat Ratna Dr. C.
Subramaniam ICAR Outstanding Teacher
Award, 2009 - 2010)
* Dr. Mahesh Chander (Bharat Ratna Dr. C.
Subramaniam ICAR Outstanding Teacher
Award, 2009 - 2010)
* Dr. Narayan Dutta (ICAR Hari Om Ashram Trust
Award for the Biennium 2008-09)
* Dr. A.K. Pattanaik (ICAR Hari Om Ashram
Trust Award for the Biennium 2008-09)
* Dr. Akila Natarajan (ICAR Jawaharlal Nehru
Award under the guidance of Dr. Mahesh
Chander)
* Dr. Richa Sood (Norman Borlaug Fellowship)
* Dr. Rupasi Tiwari (ICAR Swami Sahajanand
Saraswati Outstanding Extension Scientist
Award - year 2010)
* Dr. Hema Tripathi (Best KVK award, 2010, -
zone IV)
* Dr B.H.M. Patel (ICAR Jawaharlal Nehru
Award)
* Dr. Sandeep Bhatia (National Fellow, ICAR)
* Dr. A. Mitra (National Fellow, ICAR)
* Dr. C. Madhan Mohan (Commonwealth
Academic Staff Fellowship)
Fellow admittance/membership
* Dr. K.P. Singh (Fellow, NAVS)
* Dr. Rajendra Singh (Fellow, Indian Association
of Veterinary Pathologists)
* Dr. K.P. Singh (Fellow, Indian Association of
Veterinary Pathologists)
* Dr. Mahesh Chander (Fellow, Range
Management Society of India)
* Dr. V. Bhanuprakash (Fellow, Society for
Applied Biotechnology)
Best paper/poster presentation awards
* Dr. Narayan Dutta (Indian Academy of
Veterinary Nutrition and Animal Welfare)
* Drs. Narayan Dutta and A. K. Pattanaik (Indian
Academy of Veterinary Nutrition and Animal
Welfare)
* Dr. L.C. Chaudhary (Animal Nutrition Society
of India)
* Drs. R. Sood, D. Swarup, S. Bhatia, M. Saini,
D.D. Kulkarni, S. Dey, and S.C. Dubey
(ISVM)
* Dr. Rupasi Tiwari (Society for Community
Mobilization for Sustainable Development)
* Dr. D.B. Mondal (ISVM)
* Dr K. Mahendran (ISVM)
* Drs. G. Gupta, A.S. More, R.R. Kumari, A.
Kumar, D. Kumar, A.K. Sharma, S.K. Mishra,
and S.K. Tandan (J. V. Anjaria award, Indian
Society of Veterinary Pharmacology and
Toxicology)
* Drs. S.M. Bhojane, S. Choudhury, T.U. Singh,
S. Parida and S.K. Mishra (R. Natarajan Award,
Indian Society of Veterinary Pharmacology and
Toxicology)
* Drs. D.N. Madhu, R. Kumar, S. Khatri, H.P.
Aithal, P. Kinjavdekar, Amarpal, A.M. Pawde,
and M.M.S. Zama (ISVS)
* Drs. J. Singh, D.N. Madhu, A.C. Saxena, P.
Kinjavdekar, Amarpal, H.P. Aithal, A.
Gopinathan, A.M. Pawde, and M.M.S. Zama
(ISVS)
* Dr. Amarpal and Dr. G. Taru Sharma (Gyan
Dipika, Rajbhasha Smarika)
* Dr. Prejit and Dr. R.K. Agarwal (Journal of
Veterinary Public Health)
* Drs. A. Patyal, R.S. Rathore, A. Kumar, H.V.
Mohan and V. Sudan (IAVPHS)
* Drs. A.K. Tiwari, G. Ravi Kumar, A.P. Sahoo
and Satish Kumar (ISVIB)
* Drs. R.S. Rajmani, P.K. Singh, J. Doley. L.
Saxena, R. Kumar, Ravi Kumar, A.P. Sahoo,
S. Saxena, U. Chaturvedi, S. Kumar., P.C.
Verma, A.K. Tiwari (International Symposium
on Cancer Biology, New Delhi).
* Drs. R.S. Rajmani, P.K. Singh, Juwar Doley,
Ravi Kumar, A.P. Sahoo, L. Saxena, Uttara
Chaturvedi, Shikha Saxena, P.C. Verma and
A.K. Tiwari. (Annual Conference on New
Paradigm in Laboratory Animal Science in an
Era of Advanced Biomedical Research)
* Drs. Sohini Dey and C. Madhan Mohan
(Association of Avian Health Professionals)
* Dr. M. Sankar (IAAVP)
* Dr. N.H. Mohan. (Young Investigator Award,
International Society of Nutrigenetics/
Nutrigenomics Beijing, China.)
* Drs. S. Hajra and R. Somvanshi (Indian Journal
of Veterinary Pathology)
* Dr. S. Dandapat (IAVMI)
* Dr. Y.P.S. Malik (Indian Virological Society)
* Drs. B.C Saravanan, M. sankar, G.C. Bansal,
C. Sreekumar, A.K. Tewari and J.R. Rao
(IAAVP)
* Drs. A. Varghese, O.K. Raina, S. Kumar, C.
Kantaraja, D. Chandra, S.C. Gupta, S.
Samanta, P.S. Banerjee, R. Garg and B.R.
Maharana (IAAVP)
108
Honours/recognitions
* Dr. Mahesh Chander (Member, International
Standards Requirements Committee of
IFOAM, Germany)
* Dr. D.D. Kulkarni (DISCONTOOLS Nipah Virus
Infection Experts Group Meeting, European
Commission, Brussels)
* Dr. S.K. Agarwal (President, Indian Society for
Study of Animal Reproduction (ISSAR)
* Dr. S.K. Agarwal (Member, RAC, NRC,
Equines, Hissar)
* Dr. Bhaskar Sharma (Member DBT Task Force,
Animal Biotechnology)
* Dr. P. Joshi (Member DBT task Force, Animal
Biotechnology)
* Dr. P. Joshi (Member National Fund
Committee, ICAR)
* Dr A.K. Sharma (Member Thematic Expert
Group on Conservation and Management of
Wildlife and Animal Welfare, MoEF)
* Dr. Rishendra Verma (Member, DBT Task
Force, Translational Research, Veterinary
Vaccines and Diagnostics)
* Dr. Rishendra Verma (Coordinator, Indo-UK
BBSRC Monitoring and Intervention Strategies
for BT Virus Epidemics in Rural India)
* Dr. Rishendra Verma (Expert Member,
Workshop on SPS issues and GAP Analysis
at National Institute of Plant Health
management (NIPHM), Govt. of India,
Hyderabad)
* Dr. Rishendra Verma (Coordinator and Expert,
Veterinary Monograph, Indian Pharmacopoeia,
Ministry of Health and Family Welfare, Govt.
of India)
* Dr. Rishendra Verma (Member, Committee of
Experts, Department of Animal Husbandry,
Dairying & Fisheries, Ministry of Agriculture,
New Delhi)
* Dr. A.K. Sharma (Member, Vulture Advocacy
Programme, SAVE Consortium)
* Dr. Mohini Saini (Member, Technical Advisory
Committee, SAVE Consortium)
* Dr. Asit Das (Member, ICAR Committee for
Upgration of Nutrient Requirement)
* Dr. Asit Das (Certificate of Appreciation, Royal
Society for Protection of Birds, UK)
* Dr. C. Tosh (Technical Expert, Microbiology,
Serology and Mol. Biology, NABL)
* Dr. S. Nagarajan (National Reference Expert
for the NAIP sponsored National Training at
TANUVAS, Chennai)
* Dr. Rupasi Tiwari (Award of Honour, Canine
Practitioner's Club, Lucknow and felicitated by
His Excellency Governor of Uttar Pradesh).
* Dr. G. Taru Sharma (Felicitation from His
Excellency Governor of U.P.)
* Dr. Rupasi Tiwari (Imerti Devi Woman Scientist
Award- 2011, Society for Community
Mobilization for Sustainable Development.
* Dr. G.K. Gaur (Executive Member, Indian
Academy of Veterinary Nutrition and Animal
Welfare)
* Dr. A.K. Verma (Vice President, Central Zone,
Animal Nutrition Society of India)
* Dr. A.K. Verma (Editor, Animal Nutrition and
Feed Technology)
* Dr. B.H.M. Patel (Assoc. Editor, Indian Journal
of Animal Production and Management)
* Dr. S.K. Mondal (Joint Treasurer, Animal
Nutrition Association)
* Dr. S.K. Mondal (Chapter Secretary, IVRI
Chapter, ISAPM)
* Dr. H.O. Pandey (Executive Member of Animal
Nutrition Association)
* Dr. B.D. Sharma (Vice-President, Indian Meat
Science Association)
* Dr. B.D. Sharma (Principal Member, Bureau
of Indian Standards - FAD-18)
* Dr. B.D. Sharma (Expert Member, ICMR-ICAR
Technical Working Group on Food Safety)
* Dr. S.K. Mendiratta (Member, Scientific Panel
Food Safety and Standard Authority of India)
* Dr. Umesh Dimri (Fellow Mobilization Award,
Society for Community Mobilization for
Sustainable Development)
* Dr. Pankaj Kumar (Young Professional Award,
Society for Mobilization)
* Dr. U. K. De (Letter of Appreciation, Hindustan
Private Limited)
* Dr. P.S. Banerjee ( Editor-in-Chief, Journal of
Veterinary Parasitology)
* Dr. D.B. Mondal (Associate Editor, IJVM)
* Dr. Reena Mukherjee (Member Editorial Board,
Indian Journal of Field Veterinarians)
* Dr. U.K. De (Member Editorial Board, Journal
of Medicinal Plants Research)
* Dr. N.P. Kurade (Editor, Indian Journal of
Veterinary Pathology)
* Dr. H.P. Aithal (Certificate of Appreciation,
NAVS)
* Dr H.P. Aithal (Associate Editor, IJVS)
* Dr. Amarpal (Award of Honour, Lucknow Canine
Practitioners Club)
* Dr. Amarpal (Editor, IJVS)
* Dr. S.K. Maiti (Travel Grant, Department of
Biotechnology)
* Dr. S.K. Maiti (Priyadarshini Gold Medal Award
2011, Global Economic Progress and
Research Association, Tamil Nadu)
* Dr. S.V.S. Malik (Editor, Indian J. Comp.
Microbiol. Immunol. Infect. Dis.)
* Dr. Ashok Kumar (General Secretary, Indian
Association of Veterinary Public Health
Specialists)
109
* Dr. K.N. Bhilegaonkar (Editor, Journal of
Veterinary Public Health)
* Dr. Ashok Kumar (Member, ICMR - ICAR Joint
Working Group on Zoonoses)
* Dr. Ashok Kumar (Vice President, Swine
Production Society of India)
* Dr. K.N. Bhilegaonkar (Member, International
Commission of Microbiological Specifications
for Food)
* Dr. K.N. Bhilegaonkar (Member, Scientific
Panel on Pesticide and Antibiotic Residues,
Food Safety and Standards Authority, India).
* Dr. K.N. Bhilegaonkar (Member, FAD 15, Expert
Committee on Food Hygiene Safety
Management and Other Systems, Bureau of
Indian Standards, New Delhi)
* Dr. K.N. Bhilegaonkar (Expert, Annual Meeting
of International Commission of Microbiological
Specifications, Melbourne, Australia)
* Dr. R.K. Agarwal (Member, FAD 15, Expert
Committee on Food Hygiene Safety
Management and Other Systems, Bureau of
Indian Standards, New Delhi)
* Dr. R.K. Agarwal (Member, Food and
Agriculture Division Council, Bureau of Indian
Standards, New Delhi)
* Dr. R.K. Agarwal (Member, Academic Council,
Sam Higginbottom Agricultural Institute
Deemed University, Allahabad)
* Dr. D.K. Sinha (Treasurer, Indian Assoc. of
Veterinary Public Health Specialists)
* Dr. B.P. Mishra (Certificate of Honour, Kachchh
District Cooperative Milk Producers' Union,
Sarhad Dairy, Bhuj-Kachchh.)
* Dr. P. Thirumurugan (Judge, National Dairy
Mela, NDRI, Karnal)
* Dr. S.D. Singh (Member, Board of Management
CARI, Izatnagar)
* Dr. S.D. Singh (DBT nominee, Biosafety
Committee CARI, Izatnagar)
* Dr. K. Dhama (Member, Species Survival
Commission (SSC), Wildlife Health Specialist
Group, (International Union for Conservation
of Nature).
* Dr. K. Dhama (Editor, Indian Journal of
Comparative Microbiology Immunology
Infectious Diseases)
* Dr. K. Dhama (Editor, International Journal of
Cow Science)
* Dr. K. Dhama (Associate Editor, Journal of
Immunology and Immunopathology)
* Dr. R. Somvanshi, (Hony. Registrar, Indian
College of Veterinary Pathologists).
* Dr. B.R. Singh (International Research Project
Evaluator by Govt. of Kazakhstan)
* Dr. K.P. Singh (Chief Editor, IJVP)
* Dr. K.P. Singh (Secretary, AIZW)
* Dr. Dinesh Chandra (Treasurer, Indian
Association for Advancement of Veterinary
Parasitology)
* Dr. Rajender Singh (Treasurer, IAVP)
* Dr. Manjunatha Reddy (Best Thesis Award
under the guidance of Dr. Rajendra Singh).
Young scientist award
* Dr. Prejit (IAVPHS for the work under the
guidance of Dr. R.K. Agarwal).
* Drs. P.K. Gupta, N.K. Singh, C.D. Meshram,
R.P. Singh, S.S. Pawar, S.P. Gupta (Indian
Virological Society).
* Drs. R.S. Rajmani, L. Saxena, P.K. Singh, J.
Doley, Rajiv Kumar, S. Saxena, U. Chaturvedi,
A.P. Sahoo, Ravi Kumar, Sudesh Kumar, R.K.
Chittlangia, P.C. Verma, A.K. Tiwari
(International Conference on Stem Cells and
Cancer, Pune)
* Drs. R.S. Rajmani, L. Saxena, P.K. Singh, J.
Doley, Rajiv Kumar, S. Saxena, U. Chaturvedi,
A.P. Sahoo, Ravi Kumar, Sudesh Kumar, R.K.
Chittlangia, P.C. Verma, A.K. Tiwari (17th IBC
Beijing).
* Dr. A. Gupta and G. Saikumar (Indian
Association of Veterinary Pathologists)
* Dr. S.B. Shivachandra (National Academy of
Sciences-India and Elsevier Science - Scopus
Young Scientist Award-2011)
Other awards
* Team award for best exhibition at Krishi Vigyan
Kendra, Dhanauri, Haridwar (UK)
* Team award for best exhibition at Kisan Mela
at Palia, Lakhimpurkheri (UP).
* Excellent exhibition stall award at All India
Industrial Kisan Mela, G.B. Pant Univ. of Agri.
and Tech., Pantnagar
* Team award for best exhibition Krishi Mela
Kumbh, Commissionaires, Moradabad
* Team award for best exhibition Kisan Mela at
CSWRI, Avikanagar
* Team award for best exhibition Buffalo Mela,
CIRB, Hissar
* Team award for best exhibition at Indian
Agricultural Scientist and Farmers Congress
* Team award for best exhibition at National
Dairy Mela 2012, NDRI, Karnal
* Team award for best exhibition at Pusa Krishi
Vigyan Mela, IARI, Pusa, New Delhi.
* Team award for best exhibition at All India
Industrial Kisan Mela at G.B. Pant Univ. of
Agri. & Tech., Pantnagar
* Best Incubatee to Mr. Sukhjinder Singh of All
India Development Trust (AIDT), a registered
member of ZTM-BPD Unit, IVRI
* Award for Excellent Achievements at 7th Food
and Technology Expo 2011, Pragati Maidan,
New Delhi
* Sir F.M. Burnett Memorial Award (ISVIP) to
Drs. A.K.Tiwari, G. Ravi Kumar, A.P. Sahoo,
Satish Kumar.
110
7. LINKAGES AND COLLABORATION IN INDIA AND ABROAD
INCLUDING FUNDED PROJECTS
Appropriate linkages and collaboration with
other scientific agencies are essential for creating
opportunities for sustainable development, effective
integration with local and national expertise, To have
mutual benefit of the achievements in research and
education, the institute has established linkages with
various national and international agencies through
a large number of funded projects under DBT, DST,
DAE, ICMR, NPRE, DAH&D, APEDA, CZA, DRDO,
CCRH, BNHS, UPCAR, Ministry of Environment and
Forestry, Ministry of Agriculture, ICAR (through
AICRP, Network projects, Niche Area of Excellence
and NAIP) at national level, and BBSRC and DFID,
UK and USDA at International level are in operation.
The lists of the projects are as under:
ALL INDIA COORDINATED RESEARCH PROJECTS
Sl. Title of the Project Name of the Project Date of Sanctioned LocationNo. Coordinator Start funds
(Rs.in lakhs)
1. AICRP on Pigs A.K. Verma(PI) 1970 - LPM Section
2. Improvement of feed resources N.Dutta (PI) 2003 36.35 AN Division
and nutrient utilization for A.K. Pattanaik
raising animal production S.K. Singh
ALL INDIA NETWORK PROGRAMMES
Sl. Title of the Project Name of the PI Date of Sanctioned LocationNo. & Associates Start funds
(Rs. in lakhs)
1. Haemorrahagic septicemia V.P. Singh (PI) 2001 97.78 B&M Division
D.K. Sinha
S.K. Gupta
P. Thomas
2. Bluetongue R. Verma (PC) 2001 67.00 CADRAD
K.P. Singh
R.P. Singh
B. Mondal (Mukt.)
V. Bhanuprakash (Mukt.)
3. Gastrointestinal parasitism A. Prasad (PI) 2001 74.55 Parasitology
Rajat Garg Division
M. Sankar, (TAH, Mukt.)
4. Performance of Murrah buffalo A.K.S. Tomar (PI) 2001 - LPM Section
herd H.N. Pandey
S.C. Joshi
Dr. Triveni Dutt
S. Mehmood
Mukesh Singh
T.A. Khan
5. Adaptation and facilitation of Gyanendra Singh (PI) 2009 Total outlay P & C Division
livestock to impending climatic Triveni Dutt 900.00
changes through shelter A.K.S. Tomar IVRI share
management Mihir Sarkar 100.00
A.K. Verma
B.D. Sharma
Puneet Kumar
6. Enhancing livelihood of rural Hema Tripathi (CC-PI) 2009 Total outlay KVK
women through livestock Triveni Dutt 60.52
production IVRI share
11.04
7. Outreach programme on S. Dey (PI & PC) 2009 Total outlay Medicine Div.
Ethnoveterinary Medicine M. Saini 1000.00
A.K. Sharma IVRI share
U.K. De 80.00
Pankaj Kumar
111
8. Monitoring of drug residues J.M. Kataria (PC) 2009 Total outlay NRL APEDA
and environmental pollutants S. Kalpana (PI) 1321.00 Lab., P&T Div.
Sameer Srivastava IVRI share
Praveen Singh 163.50
9. Zoonotic diseases Ashok Kumar (PI&PC) 2009 Total outlay VPH Div.
D.K. Singh 1100.00
K.N. Bhilegaonkar IVRI share
S.V.S. Malik 223.40
R.S. Rathore
R.K. Agarwal
Rishendra Verma
P.S. Banerjee
S. Samanta
Component 2H.V. Murugkar (PI) 2009 73.04 HSADL, Bhopal
DBT PROJECTS
Sl. Title of the Project Name of the PI & Duration Sanctioned LocationNo. Associates funds
(Rs. in lakhs)
1. Detoxification and utilization A.K. Pattaniak (PI) Five years 249.00 AN Division
of key agro-forest based non- S.K. Saha (w.e.f. Feb.,
conventional oil cakes in the Naryan Dutta 2008)
feeding of livestock (Network)
2. Effect of phytochemicals on A.K. Pattaniak (PI) Three years 70.74 AN Division
livestock health, production D.N. Kamra (w.e.f. June, IVRI Component:
and emission of green house Naryan Dutta 2008) 52.17
gases P.K. Gupta to 19.12.2011
(Ms.) Deepti Rai
(Ayurvet Res.
Foundation, Delhi)
3. Development of embryonic Sadhan Bag (PI) Three years 40.35 P&C Division
stem cell lines from IVF A.C. Mazumdar (w.e.f.
derived early stage embryos Bharat Bhushan 20.11.08)
in buffalo Pallab Chaudhary
S.K. Maiti
B.C. Das
4. Network Project on G. Sai Kumar (PI) Five years 221.20 Pathology Div.
classical swine fever with (CSF-1 Component) (w.e.f.
special reference to K.K. Rajak (PI) 24.11.2008) 131.32 IVRI,
northeastern region (CSF-4 Component) Mukteswar
5. Development of 3-D bio- Naveen Kumar (PI) Three years 82.264 Surgery Division
degradable dermal matrices Satish Kumar (w.e.f.
for reconstructive surgery. Sameer Shrivastava 25.5.2009)
A. K. Sharma
S.K. Maiti
6. Novel intelligent peptides for Satish Kumar (PI) Three years 86.872 Vet. Biotechno-
targeting peptide nuclic acids Sameer Shrivastava (w.e.f. logy Division
(PNAs) into cells as antiviral A.K. Tiwari 25.5.2009)
therapeutics
7. Evaluation of anti-rabies effect P.K. Gupta (PI) Three years 56.35 Vet. Biotechno-
of small interfering RNA R.P. Singh (w.e.f. logy Division
(siRNA) delivered through A.A. Raut 22.6.2009)
viral vector
8. Development of recombinant Sohini Dey (PI) Three years 27.71 Vet. Biotechno-
vaccine for infectious bursal C. Madan Mohan (w.e.f. logy Division
disease virus (Indo-US) J.M. Kataria 29.12.2009)
9. Component C3 binding protein P. Joshi (PI) Three years 34.00 Biochemistry
of Haemonchus Contortus and B.P. Singh (w.e.f. Section
its significance in host-parasite S.C. Gupta 21.9.2010)
interaction
112
10. Mesenchymal stem cells S.K. Maiti (PI) Three Years 38.881 Surgery Division
construct on osteogenesis for Naveen Kumar (11.3.2010 to
repairing large bone defects in A.K. Sharma 10.3.2013)
animal model S. Dandapat
Anil Kumar Sharma
Sadhan Bag
11. Expression and localisation Mihir Sarkar (PI) Four Years 50.063 P&C Division
of autocrine and paracrine G. Taru Sharma (w.e.f.
factors and their receptors Gyanendra Singh 14.3.2011)
regulating corpus luteum
function during the estrous
cycle of buffaloes (Bubalus
bubalis)
12. Development of user friendly Ajay Kumar (PI) Three Years 16.58 Vet. Biotechno-
diagnostic kit for detection of V. Upmanyu (w.e.f. logy Division
bovine herpes virus - 1 (RGYI) Deepak Kumar 9.3.2011)
13. Identification of the potential K.N. Viswas (PI) Three Years 23.70 B & M Division
vaccine candidate antigens of V.P. Singh (26.6.2011
Clostridium chauvoei (RGYI) Pallab Chaudhuri to 19.6.2014)
A.K. Tiwari
Mayank Rawat
14. Development of diagnostic Satish B. Three Years 27.86 Virology
assays based on recombinant Shivachandra (PI) (30.6.2011 to Division,
antigens for pasteurellosis in S.K. Gupta 29.6.2014) Mukteswar
livestock (RGYI) K.N. Viswas
M.A. Ramakrishnan
15. Generation of an improved C. Madhan Mohan(PI) Three Years 77.054 Vet.
Newcastle disease virus J.M. Kataria (23.9.2011 to Biotechnology
vaccine candidate using a R. Sarvanan 22.9.2014) Division
novel reverse genetics Sohini Dey
technology
16. Epidemiological studies on G. Sai Kumar (PI) Three Years 77.85 Pathology
porcine Circo Virus - 2 T.K. Rajkhowa (PI) (20.10.2011 to Division
associated diseases in pigs Collaborator Institute 19.10.2014)
of 3 North- Eastern states viz.,
Mizoram, Meghalaya & Assam
(Biotech Consortium India
Limited -DBT Twinning
programme)
17. Development of composite Rekha Pathak (PI) Three Years 47.69305 Surgery Division
scaffolds for bone and tendon MMS Zama (24.02.2012 to
repair using tissue engineering A.M. Pawde 23.02.2015)
techniques A.K. Tiwari
N.P. Kurade
Amarpal
P. Kinjavdekar
H.P. Aithal
ICAR FUNDED PROJECTS
Sl. Title of the Project Name of the PI & Duration Sanctioned Location
No. Associates funds(Rs. in lakhs)
1. Niche Area of Excellence - A.B. Pandey (PI) Long-term 93.00 IVRI,
Production and quality control V. Bhanuprakash (w.e.f. Mukteswar
of veterinary immuno- D. Muthuchelvan 15.2.2005)
diagnostics and immuno- V. Gnanavel
prophylactics (Plan Scheme P.N. Gandhale
on "Strengthening & A.K. Tewari
Development of Agricultural Rajat Garg
Education) M. Sankar
K.Dhama
R.Somvanshi
113
2. Development of animal virus Sameer w.e.f. 15.00 Vet.
derived peptide nanosystems Srivastava (PI) 1.1.2011 Biotechnology
for targeted intracellular to 31.12.2012 Division
delivery of bio-molecules (Two years)
(ICAR-LBS Young Scientist
Award)
3. Niche Area of Excellence B.P. Mishra (PI) 2011 465.00 Vet.
NAE - Development of Sameer Srivastava Biotechnology
Bio-sensors for diagnosis of Praveen Singh Division
peste des petits ruminants
(PPR) and Brucellosis
NATIONAL FUND FOR BASIC AND STRATEGIC FRONTIER AREA RESEARCH IN AGRICULTURE
Sl. Title of the Project Name of the PI & Duration Sanctioned LocationNo. Associates funds (Rs.
in lakhs)
1. Application of reverse genetics: V.V.S. 199.5545 IVRI, Bangalore
A novel approach for studying Suryanarayana(C-PI) Five Years
the molecular basis of immune G.R. Reddy (w.e.f.
response in Indian cattle breeds H.J. Dechamma 1.12.2006 to
(Lead Institute) M.S. Shaila, IISc.,B'lore 30.11.2011)
M.V. Rao, NDRI, B'lore
D.N. Das, NDRI, B'lore
2. Transcriptional level of G. Taru Sharma (C-PI) Five Years 194.266 P&C Division
developmentally important G. Sai Kumar (w.e.f.
genes in buffalo pre- 1.12.2006)
implantation (Lead Institute)
3. Antiluteolytic strategies: a S.K. Agarwal (C-PI) Five Years 143.05 AR Division
novel approach to enhance S.K. Singh (w.e.f. (IVRI
fertility in buffalo (Lead Institute) Uma Shankar 1.2.2007) Component)
Abhijit Mitra Total cost
P. Joshi 301.68
Triveni Dutt
4. Endocrine profiles and Abhijit Mitra (CC-PI) Five Years 215.87 AG Division
characterization of candidate (w.e.f.
genes influencing prolificacy in 1.2.2007)
Black Bengal goats (Consortium
partner)
5. Rumen microbial mani-pulations L.C.Chaudhary(CC-PI) Five Years 50.00 AN Division
for mitigation of methane D.N. Kamra (w.e.f. (IVRI
emission and productivity (Ms.) Neeta Agarwal 1.2.2007) Component)
enhancement in dairy animals R. Bhar Total cost
(Consortium partner) 245.46
6. Regulation of fatty acid S.K. Dhara (C-PI) 10.1.2011 to 150.9944 Vet.
synthesis by RNA interference Soumen Naskar,NRCP, 31.12.2015 (IVRI Biotechnology
in pig Rani, Guwahati (CC-PI) Component) Division
Total cost
243.050
7. RNAi mediated comparative Abhijit Mitra (C-PI) 1.1.2011 to 76.65890 AG Division
functional analysis of immune S.Mazumdar (CCPI), 31.12.2015 (IVRI
response genes in ruminants Delhi University Component)
and fish against Mycobacterium B.N. Tripathi (CC-PI), Total cost
avium ssp. paratuberculosis CSWRI 298.0780
and M. fortuitum (Lead Institute)
NATIONAL AGRICULTURAL INNOVATION PROJECT
Sl. Title of the Project Name of the PI & Duration Sanctioned LocationNo. Associates funds (Rs.
in lakhs)
1. Arsenic in food-chain: cause, A.K. Bera (CC-PI) Four Years 22.966 ERS, Kolkata
effect and mitigation. S.C. Das (w.e.f. 2007) Centre
(Component 4) (Consortium D. Bhattacharya
partner) S.K. Das
114
2. Study of herbal acaricides as Srikant Ghosh (C-PI) Four Years NAIP Parasitology
means to overcome the D.D. Ray (w.e.f. 389.39 Division
development of resistance in O.K. Raina 22.7.2008)
ticks to conventional acaricides Pallab Chaudhuri
(Component 4) (Lead Institute) D.B. Mondal
P. Joshi
3. Rumen microbial diversity in D.N. Kamra (C-PI) Five Years 360.48 AN Division
domesticated and wild L.C. Chaudhrary (w.e.f.
ruminants and impact of Neeta Agarwal July, 2008)
additives on methanogenesis
and utilization of poor quality
fibrous feeds (Component 4)
(Lead Institute)
4. Development of goat having Abhijit Mitra (CC-PI) Four Years 131.19 AG Division
knocked down of myostatin Subodh Kumar (w.e.f. (IVRI
gene through RNA interference July, 2008 to Component)
technology to enhance the meat March, 2012) Total cost
production (Component 4) 421.17
(Consortium partner)
5. Toll-like receptors in farm animals- Y.P.S. Malik (CC-PI) Four Years 86.521 Virology
evolutionary linkages and K.K. Rajak (w.e.f. (IVRI Division
application in disease resistance M. Sankar 7.7.2008 Component)
(Component 4) (Consortium partner) Total cost
308.483
6. Bovine mastitis: Unraveling V.V.S. Suryanarayan Four Years 29.26805 Bangalore
molecular details of host- (CC-PI) (w.e.f. (IVRI Campus
microbe interaction and develop- 23.12.2008) Component)
ment of molecular diagnostic Total cost
methods (Component 4) 462.060
(Consortium partner)
7. Genetic basis of inferior quality Subodh Kumar (CC-PI) 14.1.2009 72.2645 AG Division
and fertility of crossbred bulls to (IVRI
(Component 4) (Consortium March, 2012 Component)
partner) Total cost
333.5468
8. Developmental potency of Sadhan Bag (C-PI) 6.1.2009 to 233.774 P&C Division
parthenogenetic goat embryos A.C. Majumdar 31.3.2012 (IVRI (IVRI
(Component 4) (Lead Institute) B.C. Das Component)
P.K. Gupta Total cost
Subodh Kumar 447.096
9. Identification of oncolytic viral A.K. Tiwari (C-PI) 16.1.2009 to 391.572
genes and development of Satish Kumar March, 2012 (IVRI
tumor targeted nano-delivery Sameer Srivastava Component) Vet. Biotech
vehicle for cancer therapy in Rajendra Singh Total cost
bovines (Component 4) S.K. Maiti 420.96
(Lead Institute)
10. Strengthening statistical comput- B. Singh (C-PI) 1.4.2009 to 46.608 LE&S Division
ing for NARS (Component-1) 31.3.2012 (IVRI
(Consortium partner) Component)
Total cost
1377.216
11. Holistic approach for improving R.B. Rai (C-PI) 13.04.2009 188.23 Pathology
livelihood security through H. Kumar to 31.3.2012 (IVRI Division
livestock based farmimg system Component)
in Barabanki and Raibareli Total cost
districts of U.P. (Component-3) 417.97
(Lead Institute)
115
12. Bioprospecting of genes and Mihir Sarkar (CC-PI) 4.5.2009 to 51.525 P&C
allele mining for abiotic stress Abhijit Mitra 31.3.2012 (IVRI Division
tolerance (Component-4) Gyanendra Singh Component)
(Consortium partner) Total cost
13. Zonal Technology Management Puneet Kumar (C-PI) April 2009 to 477.332 LE&S Division
Centre & Business Planning and R.P. Singh March, 2013
Development (BPD) Unit at IVRI, Rupasi Tiwari
Izatnagar (Component-1)
(Lead Institute)
14. Strengthening of digital library S.S. Rawat (CC-PI) April 2009 to 149.332 National Library
and information Management K.N. Kandpal 31.3.2012 (IVRI of Vetey.Science
under NARS (e-GRANTH) Component)
(Component-1) (Consortium Total cost
partner) 861.481
15. Developing, commissioning, M. Hoque (C-PI) 1.4.2009 to 33.5 JD (Academic)
operating and managing an 31.3.2012 (IVRI
online system for Net/ARS - Component)
Prelim examination by ASRB, Total cost
ICAR (Component - I) 3055.30
(Consortium partner)
OTHER FUNDED PROJECTS
Sl. Title of the Project Name of the PI & Duration Sanctioned Location
No. Associates funds (Rs.
in lakhs)
1. Quality assurance of rinderpest V.K. Chaturvedi (PI) Long-term 3.94 BP Division
and PPR vaccines maintained as R.P. Singh
vaccine banks in various states
(NPRE)
2. Monitoring of extraneous chemical S. Kalpana (PI) Long term 27.78 P&T Division
substances and their residues in
animal products (APEDA)
3. Establishment of vermi culture Ranvir Singh (PI) Three years 22.50 AG Division
hatcheries for animal and A.K.S. Tomar (w.e.f. 1.7.2007
agrowaste harbour earthworm to
species (National Centre of December 2011)
Organic Farming, Ministry of
Agriculture)
4. Establishment of model project Ranvir Singh (PI) Three years 20.00 AG Division
on recycling of animal and agro- A.K.S. Tomar (w.e.f. 1.7.2007
waste management (National to
Centre of Organic Farming, December 2011)
Ministry of Agriculture)
5. To evaluate certain homeopathic Umesh Dimri (PI) Three years 16.45 Medicine Division
medicines for their immune- M.C. Sharma (w.e.f. March,
modulatory and/or antioxidant Bhaskar Sharma 2008 to
potential (CCRH, NEW DELHI) (Mrs.) M. Kataria June 2012)
S.Dey
6. Molecular typing and development Sohini Dey (PI) 3 years 5.64 Vet.
of virus like nano-particles (w.e.f. 31.3.2009) Biotechnology
towards generation of novel Division
vaccine for infectious bursal
disease virus (IBDV) of chicken
(DST)
7. Development of diagnostic and D.D. Kulkarni (PI) (w.e.f. 1.6.2009 29.90 HSADL, Bhopal
zoo epidemiology of Nipah virus C. Tosh to 31.5.2012)
infection in India (ICMR) Ms. Baswati
Bandyopadhyay,
School of Tropical
Medicine, Kolkata
116
8. Elucidation of molecular A.K. Tiwari (PI) w.e.f. 20.7.2009 37.926 Vet.
mechanisms involved in New K.P. Singh to 19.7.2012 Biotechnology
Castle disease virus induced Division
oncolysis (DST)
9. To evaluate the potential of Umesh Dimri (PI) Three years 14.9864 Medicine Division
homoeopathic system for clinical (w.e.f. 2.12.2009)
management of common
conditions like mastitis, fever,
diarrhea, skin ailment and injury
(UPCAR)
10. Development of an immuno- G. Venkatesh (PI) Three Years 42.91 HSADL, Bhopal
chromatographic test for the S. Bhatia (w.e.f. March
diagnosis of avian influenza virus A.K. Pateriya 2010 to
infection in chicken (NABARD) S.C. Dubey March 2013)
(up to Oct 2011)
11. The role of extracellular matrix P. Joshi (PI) Three Years 3.50 /year Biochemistry
proteins vitronectin and fibronectin D.K. Singh (w.e.f. April 2010) (6,05,228/- Section
in the establishment of Staphylo- from 15.11.10
coccus aureus infection (ICMR) to 14.11.11)
12. Alterations in immuno-competent K. Rajukumar (PI) Two years 30.13 HSADL, Bhopal
cells and cytokines in the patho- S. Kalaiyarasu (w.e.f. April,
genesis of acute bovine viral 2010)
diarrhea virus infection in sheep
(DST)
13. Studies on antioxidant, cell (Mrs.) Alpana Kumar Three Years 15.12 P&T Division
apoptotic and antimicrobial Gupta (PI) (w.e.f. 3.5.2010
activities of some newly synthe- Mentor: Dr. S Kalpana
sized indole derivatives (DST,
Women Scientist Scheme (WOS-A)
14. Development of biosensor surfaces Praveen Singh (PI) Two years 3.14 BEMI
for pathogen specific proteins Satish Kumar (w.e.f. June, Section
(DST) Indo-Japan R.P. Singh 2010)
15. Pathogenesis of animal bacterial S.K. Srivastava (PI) Two years 6.21 B & M Division
diseases (DST) (w.e.f. 9.9.2010)
16. Diclofenac monitoring in cattle Mohini Saini (PI) One Year 13.40,240 Wildlife Section
and buffalo carcasses surveyed A.K. Sharma (w.e.f.
in 2009-10 and investigating other Asit Das September
causes of mortality in vultures in Praveen Gupta 2010
India (BNHS) to 30.9.2012)
17. Structural and functional analysis S.C. Das (PI) Three years 12.00 ERS, Kolkata
of the locus of enterocyte T. Ramamurthy (w.e.f.
effacement (LEE) - a pathogeni- (NIC ED) September
city island in Shiga toxigenic 2010)
Escherichia coli (STEC) strains
from human and animals with
special reference to its patho-
genicity (ICMR)
18. Conservation of Sahiwal cattle Ranvir Singh (PI) Three Years 14.46940 AG Division
through farmers participation in Sardar Mahmood (w.e.f.
Uttar Pradesh (UPCAR) A.K.S. Tomar 21.12.2010)
S.K. Ghosh
19. National initiative on climate A.K. Tiwari (PI) w.e.f. April 2011 473.00049 Vet.
resilient agriculture (NICRA) G. Taru Sharma Biotechnology
Puneet Kumar Division
Rupasi Tiwari
Rajendra Singh
Pushpendra Kumar
Yash Pal
D.K. Sinha
Gyanendra Singh
117
Pankaj Kumar
Deepak Kumar
Mahesh Kumar
(GBPUAT)
20. Development of molecular Y.P.S. Malik (PI) 1.1.2012 8.00 Vet. Virology
approaches for improved diagno- Vineeta Rawat (two years) Division
sis and effective monitoring of (Govt. Medical
entesic viral infections in animals College, Haldwani)
and humans of Uttarakhand
(State Biotech Dept. Ministy of
S&T, Dehradoon, UKD)
21. Development and quality evaluation Dr. Geeta Chauhan (PI) 28.2.2012 42.25 LPT Division
of innovative convenience food (Three years)
products from milk (Min. of Food
processing Industries)
INTERNATIONAL COLLABORATIVE RESEARCH PROJECTS
Sl. Title of the Project Name of the PI & Duration Sanctioned Location
No. Associates funds (Rs.
in lakhs)
1. Antigenic and genetic characteriza- R.Venkataramanan (PI) Two Years $453,000/- IVRI,
tion of foot and mouth disease B. Pattanaik (w.e.f. July Total Cost Bangalore
viruses in India: Application to PC-FMD, Mukteswar 2010 to June $179402/-
effective molecular vaccines 2013) (IVRI
(USDA, USA) Component)
2. Anticoccidial vaccine develop- P.S. Banerjee (PI) Three Years £65653.70 Parasitology
ment: The importance of genetic A.K. Tewari (w.e.f. Division
diversity and delivery strategy Rajat Garg Nov 2011 to
(BBSRC and DFID, U.K.) M. Sankar Sept. 2013)
3. Molecular characterization of V.P. Singh (PI) Three years £57887.00 B & M Division
commensal and pathogenic S.K. Gupta (Co-PI) 2011-2014
Pasteurella multocida strains
and their interaction with bovids
during hemorrhagic septicemia
(Indo-UK Commonwealth)
4. The use of irradiated vaccine in A.K. Tewari (PI) Five Years •5,000 / Parasitology
the control of trypanosomosis (24.02.2012 year Division
caused by Trypanosome evansi to March 2016) (Total Cost)
in livestock (IAEA), Vienna, •17,280.80
Austria (IVRI
Component)
118
8. LIST OF PUBLICATIONS
DIVISION OF BACTERIOLOGY AND MYCOLOGY
1. Agarwal, R.K., Singh, S., Bhilegaonkar, K.N. and
Singh, V.P. (2011). Optimization of microtitre plate
assay for the testing of biofilm formation ability in
different Salmonella serotypes. Int. Food Res. J.,
18: 1493-1498.*
2. Devatkal, S.K., Jaiswal, P., Jha, S.N., Bharadwaj,
R. and Viswas, K.N. (2011). Antibacterial activity
of aqueous extract of pomegranate peel against
Pseudomonas stutzeri isolated from poultry meat.
J. Food Sci. Technol., (DOI 10.1007/s13197-011-
0351-y).*
3. Kashoo, Z.A., Singh, V.P., Rana, R., Sankar, M.,
Gazalli, H. and Cheema, P.S. (2011). Molecular
characterization of p80 gene of Indian
Mycoplasma agalactiae isolates. Indian J. Anim.
Sci., 81: 435-439.
4. Kashoo, Z.A., Singh, V.P., Rana, R., Sankar, M.,
Gazalli, H. and Jacob, S.S. (2011). Evaluation of
different serological tests for diagnosis of
contagious agalactia in goats. Indian J. Anim.
Sci, 81: 1201-1203.
5. Menghistu, H.T., Rathore, R., Dhama, K. and
Agarwal, R.K. (2011). Isolation, identification and
polymerase chain reaction (PCR) detection of
Salmonella species from field materials of poultry
origin. Int. J. Microbiol. Res. 2: 135-142.*
6. Mishra, A.K, Rawat, M. and Verma, R. and
Abhisehk (2011).Immunoreactivity of sera of
calves vaccinated with haemorrhagic septicaemia
vaccine to outer membrane proteins of Pasteurella
multocida (B:2) strain P52. Indian J. Vet. Res., 20:
8-11.
7. Mishra, A.K., Rawat, M. and Abhishek (2011).
Characterization and assessment of in vitro lytic
activity of Staphylococcus aureus phage SA4.
Indian Vet. J., 88: 58-60.
8. Neveu, W.A., Bernardo, E., Allard, J.L., Viswas,
K.N., Wargo, M.J., Davis, R.J., Iwakura, Y.,
Whittaker, L.A. and Rincon, M. (2011). Fungal
allergen -glucans trigger p38 MAPK-mediated
IL-6 translation in lung epithelial cells. Am. J. Resp.
Cell Mol. Biol., 45:1133-1141.*
9. Noubade, R., Krementsov, D.N., del Rio, R.,
Thornton, T., Viswas, K.N., Saligrama, N., Spitzack,
A., Spach, K., Sabio, G., Davis, R.J., Rincon, M.
and Teuscher, C. (2011). Activation of P38 MAPK
in CD4 T cells controls IL-17 production and
autoimmune encephalomyelitis. Blood, 118: 3290-
3300.*
10. Petersen, E., Chaudhuri, P., Gourley, C., Harms,
J. and Splitter, G. (2011). Brucella melitensis
Cyclic-di-GMP phosphodiesterase BpdA controls
expression of flagellar genes. J. Bacteriol., 193:
5683-5689.*
11. Sachan, N., Agarwal, R.K. and Singh, V.P. (2011).
Identification of a common protein moiety of
Aeromonas strains using Western Blot Technique.
Int. J. Livestock Res., 1: 37-44.*
12. Singh, S., Agarwal, R.K., Tiwari, S.C. and Singh,
H. (2011). Antibiotic resistance pattern among the
Salmonella isolated from human, animal and meat
in India. Trop. Anim. Health Prod., DOI 10.1007/
s11250-011-9953-7.*
13. Singha, H., Mallick, A.I., Jana, C., Fatima, N.,
Owais, M. and Chaudhuri, P. (2011). Co-
immunization with interlukin-18 enhances the
protective efficacy of liposomes encapsulated
recombinant Cu-Zn superoxide dismutase protein
against Brucella abortus. Vaccine, 29: 4720-
4727.*
DIVISION OF BIOLOGICAL PRODUCTS
14. Chaturvedi, V.K., Sridevi, R., Kumar, B., Joseph,
B. and Asgola, H.S. (2011). Anticandidal activity
of some of the common chemicals and dyes. J.
Vet. Publ. Health, 9: 51-53.
15. Kannaki, T.R., Shanmugan, M. and Verma, P.C.
(2011). Toll Like receptors and their role in animal
reproduction. Anim. Reprod. Sci., 125: 1-12.*
16. Kannaki, T.R., Verma, P.C. and Reddy, M.R.
(2012). Differential gene expression of
antimicrobial pepides β-defensin in thegastrointestinal tract of Salmonella Serovar
pulloram infected broiler chicken. Vet. Res.
Comm., 36: 57-62.*
17. Kannaki, T.R., Verma, P.C. and Shanmugam, M.
(2011). Molecular characterization and coding
sequence and mRNA expression of TLR-15 in
Japanese Quail (Cofimix Japanica) and
indigenous Chicken breeds (Ased and
Kadaknath). J. Poultry Sci., 48:168-175.*
18. Kavitha, R., Chaturvedi, V.K., Pandey, K.D. and
Joseph (2010). Congo-red binding assay-a non
discriminatory test of pathogenicity in S. enterica
Weltevreden. Indian J. Comp. Microbiol. Immunol.
Infect. Dis., 31: 73-74.
19. Kavitha, R., Chaturvedi, V.K., Pandey, K.D. and
Joseph (2011). Random amplified polymorphic
DNA pattern analysis of Salmonella enterica
Weltevreden isolates. J. Vet. Pub. Health, 9: 47-
50.
20. Kumar Bablu, Chaturvedi, V.K., Somrajan, S.R.,
Kumar, P., Sreedevi, R., Kumar, S. and Kaushik,
P. (2011). Comparative immune response of
purified native OmpH protein derived from
Pasteurella multocida P52 and oil adjuvant
vaccine against hemorrhagic septicemia in mice.
Indian J. Anim. Sci., 81: 1193-1196.
21. Kumar Sujeet, Chaturvedi, V.K., Kumar, B. and
Kumar, P. (2011). Immune response and viscosity
of haemorrhagic septicaemia oil adjuvant vaccine
at different water-oil proportion. Indian J. Anim.
Sci., 81:1000-1004.
22. Singh, R.P. (2011). Control strategies for Peste
des petits ruminants in small ruminants of India.
Rev. Sci. Tech. Off. Int. Epiz., 30: 879-887.*
119
CENTRE FOR ANIMAL DISEASE RESEARCH AND
DIAGNOSIS
23. Chandra, D., Singh, K.P., Rathore, R., Raina, O.K
and Varghese, A. (2011). Acute fasciolosis in cattle
and buffaloes in Bareilly District. Indian J. Vet.
Pathol., 35: 133-135.
24. Channakeshava, S.U., Singh, K.P., Rudragouda,
C., Sharma, K., Nanjundappa, R.H., Saxena, M.,
Singh, R. and Sharma, A.K. (2011). A comparison
of intradermal and intravenous inoculation of
bluetongue virus serotype 23 in sheep for clinico-
pathology, and viral and immune responses. Vet.
Immunol, Immunopathol., 141: 230-238.*
25. Channappanavar, R., Singh, K.P., Singh, R.,
Umeshappa, C.S., Ingale, S.L. and Pandey, A.B.
(2012).Enhanced proinflammatory cytokines
activity during experimental bluetongue virus-1
infection in Indian native sheep. Vet. Immunol.
Immunopathol., 145: 485-492.*
26. Khan, S., Vala, J.A., Nabi, S.U., Gupta, G., Kumar,
D., Telang, A.G. and Malik, J.K. (2011). Protective
effect of curcumin against arsenic induced
apoptosis in murine splenocytes in vitro. J.
Immunotoxicol., (DOI: 10.3109/
1547691X.2011.637530).*
27. Kumar, M., Chidri, S. and Nandi, S. (2011). A
sensitive method to detect parvoviral DNA in faecal
samples by nested polymerase chain reaction.
Indian J. Biotechnol., 10: 183-187.
28. Kumar, M., Manohar, M. and Nandi, S. (2011). A
rapid PCR for detection of BHV-1 genomic DNA
in semen samples. Indian Vet. J., 88: 14-16.
29. Kumar, M., Varghese, A., Gaurav, N., Chandra,
D., Samanta, S., Gupta, S.C., Adappa, J. and
Raina, O.K. (2012). Vaccination of buffaloes with
Fasciola gigantica recombinant gluathione-S-
transferase and fatty acid binding protein.
Parasitol. Res., 11: 419-426.*
30. Kumar, S.N., Telang, A.G., Singh, K.P., Jain, A.K.,
Afroz, M. and Patil, R.D. (2011). Experimentally
induced toxicity of ochratoxin A and Endosulfan
in male wistar rats: A hormonal disorder. J. Anim.
Vet. Adv., 10: 1750-1755.
31. Manjunatha Reddy, G.B., Singh, R., Singh, R.P.,
Singh, K.P., Gupta, P.K., Madhavan, A., Shankar,
S.K., Ramakrishnan, M.M. and Verma, R. (2011).
Molecular characterization of Indian rabies virus
isolates by partial sequencing of nucleoprotein
(n) and phosphoprotein (p) genes. Virus Genes.,
43: 13-17.*
32. Nandi, S. and Kumar, M. (2011). Comparison of
ELISA and virus neutralization test in assaying
serum antibodies to bovine herpesvirus 1. Acta
Virol., 55:175-177.*
33. Nandi, S., Kumar, M. and Manohar, M. (2011).
Diagnosis of classical swine fever using AGPT in
serum samples of swine. Indian J. Vet. Med., 30:
81-83.
34. Nandi, S., Kumar, M., Yadav, V. and Chander, V.
(2011) Serological evidences of bovine
herpesvirus-1 infection in bovines of organized
farms in India. Transboundary Emerg. Dis., 58:
105-109.*
35. Nandi, S., Muthuchelvan, D., Ahuja, A., Bisht, S.,
Chander, V. and Pandey, A.B. (2011).
Prevalence of classical swine fever (CSF) virus in
India: A six year study (2004 to 2010) 58: 461-
463.
36. Sharma, B., Sinha, D.K. and Singh, D.K. (2011).
Immunochemical characterization of antigens of
Brucella canis and their use in seroprevalece study
of canine brucellosis. Asian Pacific J. Trop. Med.,
4: 857-861.*
37. Shivasharanappa, N., Singh, R., Singh, K.P. and
Madhu, B.P. (2011). NK cell and macrophage
activity in experimentally induced rabies in mice.
Indian J. Vet. Pathol., 35: 159-161.
38. Singh, B.R. (2012) Effect of aerobic and
microaerobic growth conditions on antimicrobial
sensitivity of important bacterial isolates from
clinical samples and on minimum inhibitory
concentration of gentamicin, vancomycin,
ciprofloxacin and tetracycline. NOTO-Are-
Medicine, (https://www.notoare.com/index.php/
index/explorer/getPDF/14687587).*
39. Singh, B.R. (2012). Drug resistance in
enteroptahogens of zoonotic significance isolated
from diarrhoeic pigs and house sparrow perching
in piggery in Jharnapani, Nagaland. NOTO-Are-
Medicine,(https://www.notoare.com/index.php/
index/explorer/getPDF/ 17378234).*
40. Singh, B.R., Gulati, B.R., Virmani, N. and Chauhan,
M. (2011). Outbreak of abortions and infertility in
thoroughbred mares associated with waterborne
Aeromonas hydrophila. Indian J. Microbio., 51:
212-216.
41. Singh, B.R., Singh, V., Singh, R.K. and Ebibeni,
N. (2011). Antimicrobial activity of lemongrass
(Cymbopogon citratus) oil against microbes of
environmental, clinical and food origin. Int. Res.
Pharmacy Pharmacol., 1: 228-236.*
42. Singh, B.R., Singh, V., Singh, R.K., Toppo, S.,
Haque, N. and Ebibeni, N. (2011). Antimicrobial
effect of Artemisia Vulgaris essential oil. Natural
Prod., 7: 5-12.
43. Sinha, D.K. and Singh, B.R. (2011). Detection of
Salmonella from clinical samples of dogs by PCR.
Indian J. Anim. Sci., 81: 552-555.
44. Verma, A.K., Sinha, D.K. and Singh, B.R. (2011).
Seroprevalence study on salmonellosis in
apparently healthy dogs by enzyme-linked
immunosorbent assay. Indian J. Anim. Sci., 81: 3-
5.
45. Verma, R., Sena, D., Sharma, S., Alex, N.K.,
Pamane, R.S., Singh, R. and Pathak, K.M.L.
(2011). Molecular diagnosis of Mycobacterium
bovis as the cause of tuberculosis in a camel.
Indian J. Anim. Sci., 81: 1126-1128.
DIVISION OF MEDICINE
46. Behera, S.K., Dimri, U and Singh, S.K. (2011).
Immunomodulatory and antioxidant potential of
indigenous herbs. Indian Vet. J., 88: 80-82.
47. Behera, S.K., Dimri, U., Singh, S.K. and Mohanta,
R.K. (2011). The curative and antioxidative
120
efficiency of ivermectin and ivermectin + vitamin
E-selenium treatment on canine Sarcoptes scabiei
infestation. Vet. Res. Comm., 35: 237-244.*
48. Dahiya, S.S., Saini, M., Kumar, P. and Gupta, P.K.
(2011). An oral Sindbis virus replicon-based DNA
vaccine containing VP2 gene of canine parvovirus
delivered by Escherichia coli elicits immune
responses in dogs. Acta Virol., 55: 289-294.*
49. De, U.K, Girish, K.S., Dey, S. and Swarup, D.
(2011). Therapeutic management of acute
Trypanosomiasis in equine. Indian Vet. J., 88: 60-
61.
50. De, U.K. and Mukherjee, R. (2011). Potential of
indigenous enzymatic activities, nitric oxide and
ceruloplasmin in bovine milk to diagnose
subclinical mastitis. Trends Biomat. Artif. Organs,
25:, 2:3, doi 10.4172/2157-7579.1000109*
51. Dey, S., Swarup, D., Saxena, A. and Dan, A.
(2011). In vivo efficacy of tamarind (Tamarindus
indica) fruit extract on experimental fluoride
exposure in rat. Res. Vet. Sci., 91: 422-425.*
52. Dimri, U., Sharma, M.C., Sarkar, T.K., Tiwari, R.,
Shukla, S. and Mendiratta, S.K. (2011). Indigenous
herbal preparation against skin mycotic infection
in goats. Indian J. Anim. Sci., 81: 440-444.
53. Dimri, U., Singh, S.K., Sharma, M.C., Behera, S.K.,
Kumar, D. and Tiwari, P. (2011). Oxidant/
antioxidant balance, minerals status and
apoptosis in peripheral blood of dogs naturally
infected with Dirofilaria immitis. Res. Vet. Sci.,
(doi:10.1016/j.rvsc.2011. 04.022).*
54. Kumar, A., Mahendran, K. and Dey, S. (2011).
Diagnosis and therapeutic management of
sinoatrial block (sinus arrest) in a dog. Intas
Polivet, 12: 274-275.
55. Kumar, M., Behra, S.K., Singh, S.K., Mishra, K.K.
and Mondal, D.B. (2011). Therapeutic
management of colic in equines. Indian Vet. J.,
88: 118.
56. Kumar, M., Mondal, D.B. and Dan, A. (2011).
Quantification of catechin and lycopene in
calendula officinalis extracts using hptlc method.
Academic Sciences: Asian J. Pharma. Clin. Res.,
4 (Suppl 2): 128-129.*
57. Kumar, M., Sarma, K., Behra, S.K. and Mondal,
D.B. (2011). Pregnancy toxaemia in doe-a case
report. Vet. Pract., 12: 187.
58. Kumar, M., Sarma, K., Saravanan, M. and Mondal,
D.B. (2011). Dietary management of chronic renal
failure cases in dogs. Vet. Pract., 12: 40- 43.
59. Kumar, M., Singh, S.K., Mondal, D.B. and Nirala
R. (2011). Therapeutic management of
haemorrhagic septicemia in buffalo calves. Indian
J. Anim. Prod. Management, 27: 110-111.
60. Mukherjee, R. and Sharma, N. (2011).
Development of non antibiotic and preventive
measures against bovine mastitis. Livestock Int.,
15: 6.
61. Mukherjee, R. and Sharma, N. (2011). Prevention
and treatment of bovine mastitis with non
conventional therapeutic agents. Indian J. Field
Vet., 6: 69-70.
62. Nandi, S., De, U.K. and Chowdhury, S. (2011).
Current status of contagious ecthyma or Orf
disease in goat and sheep-a global perspective.
Small Rum. Res., 96: 73-82.*
63. Saravanan, M., Sasikala, V., Ranjithkumar, M.,
Sarma, K. and Mondal, D.B. (2011).
Dermatophytosis due to Trichophyton
mentagrophytes in a kid. Indian Vet. J., 89: 63.
64. Saravanan, M., Sharma, K.., Kumar, M.,
Vijaykumar, H. and Mondal, D.B. (2012). Analysis
of serum ascites albumin gradient test in ascitic
dogs. Vet. World, 5: 285-287.
65. Sarkar, T.K., Dimri, U., Sharma, M.C., Sharma, R.
and Somvanshi, R. (2011). Toxico-pathological
studies of ethanolic extract of Asparagus
racemosus wild and Terminalia chebula retz in
rats. Indian J. Vet. Pathol., 35: 162-167.
66. Singh, S.K., Dimri, U., Kataria, M. and Kumari, P.
(2011). Ameliorative activity of Withania somnifera
root extract on paraquat-induced oxidative stress
in mice. J. Pharmacol. Toxicol., 6: 443-449.*
67. Singh, S.K., Dimri, U., Sharma, B., Saxena, M. and
Behera, S.K. (2011). Treatment of generalized
canine demodicosis by Withania somnifera root
extract. Indian Vet. J., 88: 29-31.
68. Singh, S.K., Dimri, U., Sharma, M.C., Swarup, D.
and Sharma, B. (2011). Determination of oxidative
status and apoptosis in peripheral blood of dogs
with sarcoptic mange. Vet. Parasitol., 178: 330-
338.*
69. Singh, S.K., Dimri, U., Sharma, M.C., Swarup, D.,
Kumar, M. and Tiwari, R. (2012). Psoroptes
cuniculi induced oxidative imbalance in rabbits
and its alleviation by using vitamins A, D3, E, and
H as adjunctive remedial. Trop. Anim. Health Prod.,
44: 43-48.*
70. Singh, S.K., Dimri, U., Sharma, M.C., Swarup, D.,
Sharma, B., Pandey, H.O. and Kumari, P. (2011).
The role of apoptosis in immunosuppression of
dogs with demodicosis. Vet. Immunol.
Immunopathol., 144: 487-492.*
71. Yatoo, M.I., Devi, S., Kumar, P., Tiwari, R. and
Sharma, M.C. (2011). Soil-plant-animal micro-
mineral status and their interrelation in Kashmir
valley. Indian J. Anim. Sci., 81: 68-70.
REFERRAL VETERINARY POLYCLINIC
72. Lokesh, J.V., Kurade, N.P. Shivkumar, M.U. and
Maiti, S.K. (2011). Multiple primary tumours in
bitch: a case report. Indian J. Vet. Pathol., 35: 83-
86.
73. Ranjithkumar, M., Kamili, N.M., Saxena, A.,
Ananya Dan, Dey, S. and Raut, S.S. (2011).
Disturbance of oxidant/antioxidant equilibrium in
horses naturally infected with Trypanosoma
evansi. Vet. Parasitol., 180: 349-353.*
74. Ranjithkumar, M., Mishra, K.K., Vijayakumar, H.,
Dey, S. and Nabi, S.U. (2011). Cushing's syndrome
in a dog-a case report. Indian Vet. J., 88: 60-61.
75. Ranjithkumar, M., Nabi, S.U., Dey, S., Dan, A. and
Ahmad, A. (2011). Infectious canine hepatitis in
dogs. Indian Vet. J., 88: 122-123.
121
76. Ranjithkumar, M., Girish, K.S., Vijayakumar, H.,
Dey, S. and Ahmad, A. (2011). Pasteurellosis in a
dog - A case report. Indian Vet. J., 88: 65-66.
CENTRE FOR WILDLIFE
77. Cuthbert, R., Taggart, M.A., Prakash, V., Saini, M.,
Swarup, D., Upreti, S., Mateo, R., Chakraborty,
S.S., Deori, P. and Green, R.E. (2011).
Effectiveness of action in India to reduce exposure
of Gyps vultures to the toxic veterinary drug
diclofenac. PLoS One, 6: e19069. doi:10.1371/
journal.pone.0019069*
78. Cuthbert, R.J., Prakash, V., Saini, M., Upreti, S.,
Swarup, D., Das, A., Green, R.E. and Taggart, M.A.
(2011). Are conservation actions effective at
reducing the threat to India's threatened vulture
populations? Current Sci., 101: 1480-1484.
79. Das, A., De, D. and Katole, S. (2011). Seasonal
variation in eating behaviour and nutritive value
of mixed jungle grass for goats. Anim. Nutr. Feed
Technol., 11:195-202.
80. Das, A., Katole, S., Choubey, M., Gupta, S.P.,
Saini, M., Kumar, V. and Swarup, D. (2011). Feed
consumption, diet digestibility and mineral
utilization in captive blackbuck (Antelope
cervicapra) fed different levels of concentrates.
Feed consumption, diet digestibility and mineral
utilization in captive blackbuck (Antelope
cervicapra) fed different levels of concentrates. J.
Anim. Physiol. Anim. Nutr. (Berl). doi: 10.1111/
j.1439-0396.2011.01245.x.*
81. Das, A., Katole, S., Kumar, A., Gupta, S.P., Saini,
M. and Swarup, D. (2011). Feed consumption,
nutrient utilization and serum metabolite profile of
captive blackbucks (Antelope cervicapra) fed diets
varying in crude protein content. J. Anim. Physiol.
Nutr., DOI: 10.1111/j.1439-0396.2011.01162.x*
82. Ramesh, D., Saini, M., Swarup, D., Singh, V.K.,
Upreti, S., Das, A. and Gupta, P.K. (2012).
Molecular cloning of IFN-alpha in Goat (Capra
hircus) and Black buck (Antelope cervicapra) and
evaluation of its expression in Goat PBM cells.
Indian J. Anim. Sci., 82: 40-43.
83. Saini, M., Taggart, M.A., Knopp, D., Upreti, S.,
Swarup, D., Das, A., Gupta, P.K., Niessner, R.,
Prakash, V., Mateo, R. and Cuthbert, R.J. (2012).
Detecting diclofenac in livestock carcasses in
India with an ELISA: A tool to prevent widespread
vulture poisoning. Environ. Pollution 160: 11-16.*
84. Shynu, M., Gupta, P.K and Saini, M. (2011).
Antineoplastic potential of medicinal plants.
Recent Patents Biotechnol., 5: 85-94*
DIVISION OF PARASITOLOGY
85. Allaie, I.M., Prasad, A., Sankar, M., Raina, O.K.
and Maharana, B.R. (2011). Cloning and
characterization of glutamate dehydrogenase
gene of Haemonchus contortus. J. Vet. Parasitol.,
25: 113-117.
86. Ghosh, S., Sharma, A.K., Kumar, S., Tiwari, S.S.,
Rastogi, S., Srivastava, S., Singh, M., Kumar, R.,
Paul, S., Ray, D.D., Chaudhuri, P.and Rawat,
A.K.S. (2010). In vitro and in vivo efficacy of Acorus
calamus extract against Rhipicephalus
(Boophilus) microplus. Parasitol. Res., 108: 361-
370.*
87. Kumar, M.U., Mishra, A.K., Rao, J.R. and Tewari,
A.K. (2011). Theoretical sensitivity of 200-300 fold
repetitive 529 bp gene in detecting Toxoplasma
gondii infection in mouse. J. Vet. Parasitol., 25:
129-131.
88. Kumar, R., Paul, S., Kumar, S. Sharma, A.K., Gupta,
S., Rawat, A.K.S., Chaudhuri, P., Ray, D.D. and
Ghosh, S. (2011). Nucleotide specific changes in
the hypervariable region of 16S rDNA gene as
possible marker to differentiate the tick genera.
Indian J. Anim. Sci., 81: 1204-1207.
89. Kumar, S., Paul, S., Sharma, A.K., Rinesh Kumar,
Tewari, S.S., Chaudhuri, P., Ray, D.D., Rawat,
A.K.S. and Ghosh, S. (2011). Diazinon resistant
status in Rhipicephalus (Boophilus) microplus
collected from different agro-climatic zones of
India. Vet. Parasitol., 181: 274-281.*
90. Kurup, S.P. and Tewari, A.K. (2012). Induction of
protective immune response in mice by a DNA
vaccine encoding Trypanosoma evansi beta
tubulin gene. Vet. Parasitol. (doi:10. 1016/
j.vetpar.2012.01.009).*
91. Maharana, B.R., Rao, J.R., Tewari, A.K. and
Singh, H. (2011). Cloning and expression of
paraflagellar rod protein 2 (PFR2) gene of
Trypanosoma evansi. J. Vet. Parasitol., 25: 118-
123.
92. Maharana, B.R., Rao, J.R., Tewari, A.K. and
Singh, H. (2011). Isolation and characterization
of para flagellar rod protein gene (PFRI) in
Trypanosoma evansi and its conservation among
other kinetoplastid parasites. Indian J. Anim. Res.,
45: 283-288.
93. Nair, A.S., Ravindran, R., Lakshmanan, B., Kumar,
S.S., Tresamol, P.V., Saseendranath, M.R.I,
Senthilvel, K., Rao, J.R., Tewari, A.K. and Ghosh,
S. (2011). Haemoprotozoa of cattle in Northern
Kerala, India. Trop. Biomed., 28: 68-75.*
94. Pourouchottamane, R., Kataktalware, M.A.,
Ramesha, K.P., Saravanan, B.C., Ghosh, M.K.,
Sarkar, M., Mishra, A. and Pankaj, P.K. (2011).
Lactation performance and milk characteristics of
yaks (Poephagus grunniens L) under sub alpine
temperate zone of north eastern India. Vet. Prac.,
12: 229-232.
95. Ramesha, K.P., Prasanna Kumar, K.V.,
Chandrashekar, K., Das, S., Saravanan, B.C.,
Pourouchottamane, R. and Kataktalware, M.
(2011). Genetic variability of Indian yaks using
random amplified polymorphic DNA markers. Afr.
J. Biotech., 10: 8558-8561.*
96. Ranjithkumar, M., Saravanan, B.C., Saravanan,
M., Mahendran, K. and Dey, S. (2012). Cutaneous
habronemosis in a gelding. Indian Vet. J., 89: 66-
67.
97. Saravanan, B.C., Bansal, G.C., Manigandan, L.,
Sankar, M., Ravindran, R. and Rao, J.R. (2011).
Development of a non-radioactive probe
generated by RAPD-PCR for the detection of
Theileria annulata. Indian J. Anim. Sci., 81: 1089-
1092.
122
98. Sharma, A.K., Kumar, S., Tiwari, S.S., Srivastava,
S., Rastogi, S. Kumar, R., Paul, S., Ray, D.D.,
Chaudhuri, P., Rawat, A.K.S., Bandyopadhyay, A.
and Ghosh, S. (2012). Comparative acaricidal
properties of different solvents and surfactants on
Rhipicephalus (Boophilus) microplus (Acari:
Ixodidae). Indian J. Anim. Sci., 82: (<http://
epubs.icar.org. in/ejournal/index.php/IJAnS/
article/view/15255).
99. Singh, H., Tewari, A.K., Mishra, A.K., Maharana,
B.R., Rao, J.R. and Raina, O.K. (2011). Molecular
cloning, comparative sequence analysis and
prokaryotic expression of GRA5 protein of
Toxoplasma gondii. Indian J. Anim. Sci., 81: 209-
215.
100. Singh, H., Tewari, A.K., Mishra, A.K., Maharana,
B.R., Rao, J.R. and Raina, O.K. (2011). Molecular
cloning and comparative sequence analysis of
open reading frame of SAG2 gene of Toxoplasma
gondii. J. Vet. Parasitol., 25: 107-112.
101. Sudan, V., Tewari, A.K., Singh, H., Saravanan,
B.C. and Sankar, M. (2012). Molecular
characterization of surface antigen 3 (SAG 3) gene
of Toxoplasma gondii RH-IVRI strain. J. Parasit.
Dis., (10.1007/s12639-012-0107-2).*
102. Varghese, A., Raina, O.K., Nagar, G., Garg, R.,
Banerjee, P.S., Maharana, B.R. and Kollannur,
J.D. (2012). Development of cathepsin-L cysteine
proteinase based Dot-enzyme-linked
immunosorbent assay for the diagnosis of
Fasciola gigantica infection in buffaloes. Vet.
Parasitol., 183: 382-385.*
103. Vatsya, S., Banerjee, P.S., Yadav, C.L. and Kumar,
R.R. (2011). Prevalence of Linguatula serrata
infection in small ruminants in and around
Pantnagar, Uttarakhand. Indian J. Anim. Sci., 81:
249-250.
104. Verma, A., Manchanda, S., Kumar, N., Sharma,
A., Goel, M., Banerjee, P.S., Garg, R., Singh, B.P.,
Balharbi, F., Lejon, V., Deborggraeve, S., Rana,
U.V.S. and Puliyel, J. (2011). Case report:
Trypanosoma lewisi or T. lewisi-like infection in a
37-day-old Indian infant. Am. J. Trop. Med. Hyg.,
85: 221-224.*
DIVISION OF PATHOLOGY
105. De, U.K., Dey, S., Banarjee, P.S., Sahoo, M. and
Gupta, S.K. (2012). Correlations among
Anaplasma marginale parasitemia and markers
of oxidative stress in Indian crossbred calves.
Trop. Anim. Health Prod., 44: 385-388.
106. Dhama, K., Mahendran, M., Tiwari, R., Singh, S.D.,
Kumar, D., Singh, S.V. and Sawant P.M. (2011).
Tuberculosis in birds: Insights into the
Mycobacterium avium infections. Vet. Med. Int.,
(doi:10.4061/2011/712369).*
107. Dhama, K., Verma, V., Sawant, P.M., Tiwari, R.,
Vaid, R.K. and Chauhan, R.S. (2011). Applications
of probiotics in poultry: Enhancing immunity and
beneficial effects on production performances and
health- A Review. J. Immunol. Immunopathol., 13:
1-19.*
108. Gowthaman, V., Singh, S.D., Dhama, K., Anjaneya,
B.R. and Ramakrishnan, M.A. (2012). Pathology
and molecular diagnosis of Newcastle disease
virus infection in broiler breeders. Indian J. Vet.
Pathol., 35: 168-170.
109. Manoharan, S, Vadivoo, V.S., Aiswaryadevi, J.,
Latha, S., Kumanan, K. and Saikumar, G. (2011).
Outbreak of classical swine fever in Andhra
Pradesh. Indian Vet. J., 88: 13-15.
110. Pangty, K., Punetha, N., Lauren, D.R., Jensen,
D.J. and Somvanshi, R. (2011). Detection of
Ptaquiloside in certain from districts Champawat
and Pithoragarh, Uttarakhand (India). Proceed.
Nat. Acad. Sci., India, Section B-Bio. Sci., 81 (B):
341-347.
111. Pathania, S., Dhama, K., Saikumar, G., Shahi, S.
and Somvanshi, R. (2011). Detection and
quantification of bovine papilloma virus Type 2
(BPV-2) by real-time PCR in urine and urinary
bladder lesions in enzootic bovine haematuria
(EBH)-affected cows. Transbound. Emerg. Dis.,
(DOI: 10.1111/j.1865-1682.2011. 01248.x).*
112. Pathania, S., Kumar, P., Leishangthem, G.D.,
Kumar, D., Dhama, K. and Somvanshi, R. (2011).
Preliminary assessment of binary ethylenimine
inactivated and saponized cutaneous warts (BPV-
2) therapeutic vaccine for enzootic bovine
haematuria in hill cows. Vaccine, (DOI: 10.1016/j.
vaccine.2011.07.065).*
113. Pawaiya, R.V.S., Sharma, A.K., Swarup, D. and
Somvanshi, R. (2011). Pathology of mycotic
gastritis in a wild Indian freshwater/marsh
crocodile (mugger; Crocodylus palustris): A case
report. Vet. Med., 56: 135-138.*
114. Rai, R.B., Hansha, A., Rai, S., Singh, B., Kumar,
H., Singh, A.K., Damodaran, T. and Dhama, K.
(2011). Prevalence of rota and corona virus
infections in calves of Barabanki and Raebareli
districts of U.P. Indian J. Vet. Path., 35: 73-74.
115. Rai, R.B., Rahman, S., Dixit, H., Rai, S., Singh, B.,
Kumar, H. and Damodaran, T. (2011). Analysis of
feed ingredients for Afla and T-2 mycotoxins by
ELISA in rural areas of Uttar Pradesh. Indian J.
Vet. Pathol., 35: 238-240.
116. Rout, M. and Saikumar, G. (2011). Virus load in
pigs affected with different clinical forms of
classical swine fever. Transbound. Emerg. Dis.,
(doi:10.1111/j.1865-1682.2011. 01251.x).*
117. Sahoo, M., Mohapatra, H.K., Sahoo, N.R., Panda,
S.K. and Nath, I. (2012). Pulmonary tuberculosis
in captive black buck. Indian Vet. J., 89 (1): 68-
69.
118. Shahi, N., Sahoo, M., Malik, S.K., Sharma, D. and
Das, P. (2012). The microcystins-induced DNA
damage in the liver and the heart of zebrafish,
Danio rerio. Toxicol. Environment. Chem., 94: 340-
349.
119. Singh, N.D., Sharma, A.K., Dwivedi, P., Kumar, M
and Patil, R.D. (2011). Immuno-suppressive effect
of combined citrinin and endosulfan toxicity in
pregnant Wistar rats. Vet. Arhiv, 81: 751-763.*
123
120. Singh, S.D. (2012). Fibrosarcoma in a racing
pigeon (Columba livia). Indian J. Vet. Pathol., 35:
236-237.
121. Somvanshi, R., Pathania, S., Nagarajan, N.,
Pangty, K. and Kumar, P. (2011). Pathological
study of non-neoplastic urinary bladder lesions in
cattle and buffaloes: a preliminary report. Trop.
Anim. Health Prod., (doi: 10.1007/s11250-011-
9978-y).*
122. Sumi, V., Singh, S.D., Dhama, K., Gowthaman, V.
and Sukumar, K. (2012). Isolation and molecular
characterization of infectious bronchitis virus from
recent outbreaks in broiler flocks reveals
emergence of novel strain in India. Trop. Anim.
Health Prod., (DOI: 10.1007/s11250-012-0140-
2).*
123. Suresh, T., Rai, R.B., Dhama, K., Bhatt, P., Sawant,
P.M. and Sharma, A.K. (2011). Detection of Group-
A bovine rotavirus in diarrhoeic calves by reverse
transcriptase polymerase chain reaction (RT-PCR)
and electropherotyping. Vet. Pract., 12: 133-137.
124. Suresh, T., Rai, R.B., Dhama, K., Rai, S., Sawant,
P.M. and Sharma, A.K. (2011). Pathology of
rotavirus infection in calves and detection of viral
antigen by ELISA and FAT. Indian J. Vet. Path.,
35: 1-3.
125. Tripathi, M.K., Mondal, D., Somvanshi, R. and
Karim, S.A. (2011). Haematology, blood
biochemistry and tissue histopathology of lambs
maintained on diets containing an insect
controlling protein (Cry1Ac) in Bt-cottonseed. J.
Anim. Physiol. Anim. Nutr. 95: 45-55.*
DIVISION OF PHARMACOLOGY AND TOXICOLOGY
126. Ahanger, A.A., Prawez, S., Kumar, D., Prasad, R.,
Amarpal, Tandan, S.K., and Kumar, D. (2011).
Wound healing activity of carbon monoxide
liberated from CO-releasing molecule (CO-RM).
Naunyn-Schmiedeberg"s Arch. Pharmacol., 384:
93-102.*
127. Ahmad, W., Prawez, S., Chanderashekara, H.H.,
Tandan, S.K., Sankar, P. and Sarka,r S.N. (2012).
Subacute arsenic exposure through drinking
water reduces the pharmacodynamic effects of
ketoprofen in male rats. Environ. Toxicol.
Pharmacol., 33: 267-276.*
128. Choudhury, S., Garg, S.K., Singh, T.U., Mishra,
S.K. (2011). Functional and molecular
characterization of maxi K+-channel (BKCa) in
buffalo myometrium. Anim. Reprod. Sci., 126: 173-
178.*
129. Kathirvel, K., Prawez, S., Choudhury, S., More,
A.S., Ahanger, A.A., Singh, T.U., Parida, S., Mishra,
S.K. (2011). Atorvastatin prevents vascular
hyporeactivity to noradrenaline in sepsis: role of
nitric oxide and α1-adrenoceptor mRNAexpression. Shock, 36: 76-82.*
130. Majhi, C.R., Khan, S., Leo M.D., Manimaran, A.,
Sankar, P. and Sarkar, S.N. (2011). Effects of
acetaminophen on reactive oxygen species and
nitric oxide redox signaling in kidney of arsenic
exposed rats. Food Chem. Toxicol., 49: 974-982.*
131. Manimaran, A., Sarkar, S.N. and Sankar, P. (2011).
Repeated preexposure or coexposure to arsenic
differentially alters acetaminophen-induced
oxidative stress in rat kidney. Environ. Toxicol.,
26: 250-259.*
132. Singh, T.U., Choudhury, S., Parida, S., Bhojane,
S., Mishra, S.K. (2012). Arachidonic acid inhibits
Na+-K+-ATPase via cytochrome P-450,
lipooxygenase and protein kinase C-dependent
pathways in sheep pulmonary artery. Vascular
Pharmacol., 56: 84-90.*
DIVISION OF SURGERY
133. Ahmad, R.A., Amarpal, Kinjavdekar, P., Aithal,
H.P., Pawde, A.M. and Kumar, D. (2011). Effects
of midazolam or midazolam-fentanyl on sedation
and analgesia produced by intramuscular
dexmedetomidine in dogs. Asian J. Anim. Sci., 5:
302-316.*
134. Aithal, H.P., Amarpal, Kinjavdekar, P., Pawde,
A.M., Pratap, K. and Singh, G.R. (2011).
Intravenous administration of halothane in ethanol
(5% v/v) for general anaesthesia in sheep: A
preliminary study. Indian J. Anim. Sci., 81: 461-
462.
135. Amarpal, Kinjavdekar, P., Aithal, H.P., Pawde, A.M.
and Pratap, K. (2011). Evaluation of Gokhru and
Pashanbhed for management of experimental
urolithiasis in rabbits. Indian J. Anim. Sci., 81: 251-
253.
136. Amarpal, Kinjavdekar, P., Aithal, H.P., Pawde,
A.M., Singh, J. and Udehiya, R. (2010). Evaluation
of xylazine, acepromazine and medetomidine with
ketamine for general anaesthesia in rabbits.
Scand. J. Lab. Anim. Sci., 37: 223-229.*
137. Bhardwaj, H.R., Amarpal, Aithal, H.P.,
Kinjavdekar, P., Pawde A.M. and Changal, N.A.
(2011). Role of preemptive epidural blockade with
lignocaine, ketamine or pethidine in inhibition of
anaesthetic and surgical stress response typified
by levels of plasma cortisol in dogs. Indian J. Vet.
Surg., 32: 19-22.
138. Dewangan, R., Sharma, A.K., Kumar, N., Maiti, S.
K., Singh, H., Gangwar, A.K., Shrivastava, S.,
Sonal and Amit Kumar (2011). In-vitro
biocompatibility determination of bladder acellular
matrix graft. Trends Biomat. Artif. Organs, 25: 161-
171.*
139. Dewangan, R., Sharma, A.K., Kumar, N., Maiti,
S.K., Singh Himani, Kumar, A., Shrivastava, S.,
Sonal and Singh, R. (2012). In-vivo determination
of biocompatibility of bladder acellular matrix in a
rabbit model. Trends Biomat. Artif. Organs, 26: 43-
55.*
140. Kumar, V., Devarathnam, J., Gangwar, A.K.,
Kumar, N., Sharma, A.K., Pawde, A.M. and Singh,
H. (2012). Use of acellular aortic matrix for
reconstruction of abdominal hernias in buffaloes.
Vet. Rec. (doi: 10.1136/vr.100594).*
141. Kushwaha, R.B., Aithal, H.P., Amarpal,
Kinjavdekar, P., Pawde, A.M., Singh, G.R.,
124
Varshney, V.P. and Setia, H.C. (2011). Therapeutic
management of hyperpara-thyroidism in growing
dogs. Indian Vet. J., 88: 79-82.
142. Maiti, S.K., Ajith, P., Dutta, A., Kumar, N. and
Sharma, A.K. (2011). Laparoscopic-assisted
cholecystocentesis and cholecystocholangio-
graphy in canines. J. Appl. Anim. Res., 39: 29-
32.*
143. Maiti, S.K., Manikandan, N., Shivakumar, M.U.,
Kumar, N., Saikumar, G. and Gupta, O.P. (2011).
Therapeutic evaluation of methotrexate with or
without Cox-2 inhibitors in the management of
canine mammary tumours. Indian J. Canine
Pract., 3: 117-126.
144. Malik, V., Kinjavdekar, P., Amarpal, Aithal, H.P.
and Pawde, A.M. (2011). Continuous intravenous
infusion anaesthesia with propofol in
medetomidine and midazolam premedicated
buffaloes: a quantitative electrocardiographic and
haematobiochemical study. Indian J. Vet. Surg.,
32: 14-18.
145. Malik, V., Kinjavdekar, P., Amarpal, Aithal, H.P.,
Pawde A.M. and Surbhi (2011).
Electrocardiographic and haematobiochemical
changes during continuous intravenous infusion
anaesthesia with ketamine in medetomidine or
midazolam premedicated buffaloes. Indian J. Vet.
Surg., 32: 9-13.
146. Malik, V., Kinjavdekar, P., Amarpal, Aithal, H.P.,
Pawde, A.M. and Surbhi (2011). Comparative
evaluation of halothane anaesthesia in
medetomidine-butorphanol and midazolam-
butorphanol premedicated water buffaloes
(Bubalus bubalis). J. South Afr. Vet. Assoc., 82: 8-
17.*
147. Malik, V., Kinjavdekar, P., Amarpal, Aithal, H.P.,
Pawde, A.M. and Surbhi (2011). Sedative,
analgesic, cardiopulmonary and haemodynamic
effects of medetomidine-butorphanol and
midazolam-butorphanol on thiopental-propofol
anaesthesia in water buffaloes (Bubalus bubalis).
J. Appl. Anim. Res., 39: 284-287.*
148. Malik, V., Kinjavdekar, P., Amarpal, Aithal, H.P.,
Pawde, A.M. and Surbhi (2011). Continuous
intravenous infusion anaesthesia with ketamine
in medetomidine, midazolam, butorphanol
premedicated and thiopental induced buffaloes.
Indian J. Anim. Sci., 81: 116-122; 224-230.
149. Parti, M., Aithal, H.P., Kinjavdekar, P., Amarpal
and Pawde, A.M. (2011). Management of femoral
fractures using modified interlocking nailing in
growing dogs with osteopenic bones. Intas
Polivet, 12: 80-84.
150. Ranganath, G.J., Ramkumar, A.P., Reddy, V.,
Mayilkumar, K., Pawaiya R.V.S. and Maiti, S.K.
(2011). Comparative study on the expression
pattern of the proliferating cell markers PCNA and
Ki67 in canine mammary tumours. Indian J. Vet.
Pathol., 35: 13-17.
151. Reddy, A.P.V., Sunil Kumar, B.V., Ranganath, G.J.,
Aswani Kumar, K., Maiti, S.K. and Kataria, M.
(2011). Isolation, purification and identification of
matrilysin protein from canine mammary tumours
and its quantification by indirect ELISA. Indian J.
Vet. Pathol., 35: 08-12.
152. Santosh, K.M., Amarpal, Ahmad, R.A.,
Kinjavdekar, P., Aithal, H.P. and Pawde, A.M.
(2012). Effect of increased dose of
dexmedetomidine vis-à-vis addition of fentanyl on
clinical and cardiorespiratory actions on
dexmedetomidine-midazolam-ketamine
anaesthesia in dogs. Asian J. Anim. Sci., 6: 51-
64.*
153. Sharma, A, Gupta, O.P., Singh, G.R., Maiti, S.K.
and Pawde, A.M. (20011) Effectiveness of
therapeutic ultrasound in the treatment of
paraperesis in dogs. Indian J. Vet. Surg., 32: 135-
137.
154. Sharma, A., Singh, G.R., Pawde, A.M. and Maiti
S.K. (2011). Interferential therapy for treatment of
hindquarter weakness in dogs. Indian Vet. J., 88:
31-32.
155. Singh, H., Kumar, N., Sharma, A.K., Kataria, M.
and Ashok Munjal (2011). Biochemical changes
in rabbit organs after subcutaneous implantation
with bovine pericardium and diaphragm. Int. J.
Genetic Eng. Biotechnol., 2: 77-89.*
156. Singh, H., Kumar, N., Sharma, A.K., Kataria, M.
and Ashok Munjal (2011). In-vitro study of matrix
metalloproteinases in decellularized extracellular
matrix of bovine diaphragm. Indian J. Anim. Sci.,
81: 453-455.
157. Singh, H., Kumar, N., Sharma, A.K., Kumar, A.,
Dewangan, R., Kataria, M. and Sharma, R. (2011).
Host tissue response to subcutaneously implanted
native and acellular scaffold in a rabbit model,
Trends Biomat. Artif. Organs, 25: 37-42.*
158. Singh, J., Monsang, S.W., Madhu, D.N., Sarode,
I.P., Kinjavdekar, P., Amarpal, Pawde, A.M., Aithal,
H.P. and Zama, M.M.S. (2011). Surgical
management of caecal faecolithiasis in a non-
descript dog. Indian J. Canine Pract., 3: 134-137.
159. Singh, K., Kinjavdekar, P., Aithal, H.P.,
Gopinathan, A., Amarpal and Pawde, A.M. (2011).
Use of homeopathic drugs in angular limb
deformities in growing dogs. Indian Vet. J., 88:
32-35.
160. Suneja, B.B., Amarpal, Rathore, R., Kinjavdekar,
P., Aithal, H.P. and Pawde, A.M. (2011). Survey
on microbial inhabitants of common surgical
conditions in dogs and cattle. Indian J. Vet. Surg.,
32: 121-123.
161. Zama, M.M.S., Ansari, M.M., Hoque, M., Aithal,
H.P., Maiti, S.K., John, R. and Shakya, G. (2011).
Clinical evaluation of ultrasound therapy in equine
peripheral myopathy. Indian J. Vet. Surg., 32: 133-
134.
DIVISION OF VETERINARY BIOTECHNOLOGY
162. Dahiya, S.S., Saini, M., Kumar, P. and Gupta, P.K.
(2012). Immunogenicity of a DNA-launched
replicon-based canine parvovirus DNA vaccine
125
expressing VP2 antigen in dogs. Res. Vet. Sci.,
(doi:10.1016/j.rvsc.2012.01.017).*
163. Deb, R. and Goswami, P.P. (2011). Coexpression
of PPE 34.9 Antigen of Mycobacterium avium
subsp. paratuberculosis with murine interferon
gamma in HeLa cell line and study of their
immunogenicity in murine model. Biotech. Res.
Int., (Article ID 632705, 10 pages).*
164. Deb, R., Goswami, P.P., Saxena, V.K. and Prasad,
N.S. (2010). Molecular cloning of a DNA fragment
encoding 34.9 kDa caboxy terminus PPE protein
of Mycobacterium avium subsp. paratuberculosis
in E. coli. Indian J. Anim. Res., 44: 131-134.
165. Dhara, S.K., Majumder, A., Dodla, M.C. and Stice,
S.L. (2011). Nonviral gene delivery in neural
progenitors derived from human pluripotent stem
cells, Methods Mol. Biol., 767: 343-354.*
166. Gupta, P.K., Sonwane, A.A., Singh, N.K.,
Meshram, C.D., Dahiya, S.S., Pawar, S.S., Gupta,
S.P., Chaturvedi, V.K. and Saini, M. (2012).
Intracerebral delivery of small interfering RNAs
(siRNAs) using adenoviral vector protects mice
against lethal peripheral rabies challenge. Virus
Res., 163: 11-18.*
167. Jadon, N.S., Tiwari, A.K., Pandey, P. and Singh,
G.K. (2011). Cancer cell cultivation: A review.
Indian J. Vet. Surg., 32: 81-87.
168. Pandey, P., Jadon, N.S., Chauhan, U.K., Tiwari,
A.K. and Singh, G.K. (2011). Anti-neoplastic effect
of chicken anemia virus VP3 gene in In vitro
cultured malignant tumour cells. Indian J. Vet.
Surg., 32: 88-91.
169. Rajmani R.S., Doley, J., Singh, P.K., Kumar, R.,
Barathidasan, R., Kumar, P., Verma, P.C. and
Tiwari, A.K. (2011). Induction of skin tumour using
DMBA in wistar Rat and histopathological
evaluation. Indian J. Vet. Pathol., 35: 217-220.
170. Rajmani, R.S., Doley, J., Singh, P.K., Kumar, R.,
Barathidasan, R., Kumar, P., Verma P.C. and
Tiwari A.K. (2011). Induction of mammary gland
tumour in rats using N-methyl-N-nitroso urea and
their histopathology. Indian J. Vet. Pathol., 35:
142-146.
171. Saxena L., Chaturvedi, U., Saxena, S., Kumar,
G.R., Sahoo, A.P., Kumar, S., Juwar, D., Rajmani,
R.S., Singh, P.K., Kumar, R. and Tiwari, A.K.
(2011). Characterization and in vitro expression
of non-structural 1 protein of canine parvopvirus-
2 (CPV-2) in mammalian cell line. Indian J. Exp.
Biol., 49: 654-659.
172. Sonwane, A.A., Dahiya, S.S., Saini, M.,
Chaturvedi, V.K., Singh, R.P. and Gupta, P.K.
(2011). Inhibition of rabies virus multiplication by
siRNA delivered through adenoviral vector in vitro
in BHK-21 cells and in vivo in mice. Res. Vet. Sci.,
(doi:10.1016/ j.rvsc.2011.06.008).*
173. Young, A., Machacek, D.W., Dhara, S.K., Gerwe,
B.A., MacLeish, P., Benveniste, M., Dodla, M.C.,
Majumder, A., Sturkie, C.D. and Stice, S.L. (2011).
Ion channel and ionotropic receptor expression
in a human embryonic stem cell derived neural
progenitors. Neurosci., 192: 793-805.*
IMMUNOLOGY SECTION
174. Goswami, T. K. (2011). Tribute to Frank and
Fenner an eminent virologist who contributed for
the eradication of small pox. Indian J. Virol., 22:
152-153.
175. Goswami, T.K. (2011). Ozone therapy as an
alternative medicine for bovine mastitits. Indian
Dairyman, 63: 52-56.
176. Sawant, P.M., Verma, P.C., Subidhi, P.K.,
Chaturvedi, U., Singh, M., Kumar, R., Tiwary, A.K.
(2011). Immunomodulation of bivalent ND DNA
vaccine induced immuneresponse by co-delivery
of chicken IFNγ and IL4 genes. Vet. Immunol.Immunopath., 144: 36-44.*
177. Singh, M., Goswami, T.K., Kumar, D., Chauhan,
R.S. and Ishore, D.P. (2011). In vitro effect of
Salmonella falgellin on mouse spleenocyte in
relation to ammonium chloride treatment for
blocking the MHC-II antigen presentation. J.
Immunol. Immunopath., 13: 25-29.
DIVISION OF VETERINARY PUBLIC HEALTH
178. Kaushik, P. and Singh, D.K. (2011). Cytokine
profile of mice immunized with 28 kDa outer
membrane protein of Brucella melitensis. Indian
Vet. J., 88: 15-17.
179. Kaushik, P., Singh, D.K., Tiwari, A.K. and Kataria,
R.S. (2012). Rapid detection of Brucella species
in cattle semen by PCR. J. Appl. Anim. Res., 30:
25-28.*
180. Kumar, M., Bhilegaonkar, K.N. and Agarwal, R.K.
(2011). Comparative evaluation of RT-PCR and
PAGE for detection of rotavirus from complex fecal
matrix of children and animals. Indian J. Anim.
Sci., 81: 993-999.
181. Patyal, A., Rathore, R.S., Mohan, H.V., Dhama, K.
and Kumar, A. (2011). Prevalence of Arcobacter
spp. in humans, animals and foods of animal
origin including sea food from India.
Transboundary Emerg. Dis., 58: 402-410.*
182. Prejit, Agarwal, R.K., Porteen, K., Kumar, K.,
Shweta Singh, Singh, S. and Asha, K. (2010).
Cloning and sequencing of outer membrane
protein C (ompc) gene from Salmonella
Typhimurium. J. Vet. Pub. Health, 8: 111-115.
183. Purshottam, Shefali, Agarwal, R.K., Bhilegaonkar,
K.N., Tomar, A. and Prasad, L. (2011). Isolation
and characterization of E. coli from food and
environment samples. Vegetos, 24: 142-146.*
184. Samanta, S., Agarwal, R.K., Sahu, S., Sudhakar,
N.R., Raina, O.K., Gupta, S.C. and Bhilegaonkar,
K.N. (2011). Occurrence of parasitic contamination
in raw vegetables particularly used in salads. J.
Vet. Public. Health, 9: 7-11.
DIVISION OF VIROLOGY
185. Balamurugan, V., Krishnamoorthy, P.,
Veeregowda, B.M., Sen, A., Rajak, K.K.,
Bhanuprakash, V., Gajendragad, M.R. and
Prabhudas, K. (2012). Seroprevalence of Peste
des petits ruminants in cattle and buffaloes from
Southern Peninsular India. Trop. Anim. Health
Prod., 44: 301-306.*
126
186. Balamurugan, V., Saravanan, P., Sen, A., Rajak,
K.K., Bhanuprakash, V., Krishnamoorthy, P. and
Singh, R.K. (2011). Sero epidemiological study of
Peste des petits ruminants in suspected sheep
and goats during 2003-2009 in India. Rev. Sci.
Tech. Off. Int. Epiz, 30: 889-896.*
187. Bera, B.C., Shanmugasundaram, K., Barua, S.,
Venkatesan, G., Virmani, N., Riyesh, T., Gulati,
B.R., Bhanuprakash, V., Vaid, R.K., Kakker, N.K.,
Malik, P., Bansal, M., Gadvi, S., Singh, R.V., Yadav,
V., Sardarilal, Nagarajan, G., Balamurugan, V.,
Hosamani, M., Pathak, K.M. and Singh, R.K.
(2011). Zoonotic cases of camelpox infection in
India. Vet. Microbiol., 152: 29-38.*
188. Biswas, S.K., Jana, C., Chand, K., Rehman, W.
and Mondal, B. (2011). Detection of fowlpox virus
integrated with reticuloendotheliosis virus
sequences from an outbreak in backyard
chickens. Vet. Italiana, 47: 147-153.*
189. Bora, D.P., Venkatesan, G., Bhanuprakash, V.,
Balamurugan, V., Prabhu, M., Siva Sankar, M.S.
and Yogisharadhya, R (2011). TaqMan real-time
PCR assay based on DNA polymerase gene for
rapid detection of Orf infection. J. Virol. Methods,
178: 249-252.*
190. Chandrasekhar, KM., Sharma, K.and Malik, Y.P.S.
(2011). Detection and characterization of group A
rotaviruses (RVA) detected in diarrhoeic children
during 2007-2008 in Madhya Pradesh, central
India. Nat. J. Integr. Res. Med., 2: 72-76.
191. Dadawala, A.I., Biswas, S.K., Rehman, W., Chand,
K., De, A., Mathapati, B.S., Kumar, P., Chauhan,
H.C., Chandel, B.S. and Mondal, B. (2011).
Isolation of bluetongue virus serotype 1 from
culicoides vector captured in livestock farms and
sequence analysis of the viral genome segment-
2. Transbound. Emerg. Dis., (doi:10.1111/j.1865-
1682.2011. 01279.x.).*
192. Jagtap, S.P., Rajak, K.K., Garg, U.K., Sen, A.,
Bhanuprakash, V., Sudhakar, S.B., Patel, A., Ahuja,
A., Singh, R.K. and Vanamayya, P.R. (2012). Effect
of immunosuppression on pathogenesis of peste
des petits ruminants (PPR) virus infection in goats.
Microbial Pathogenesis, 52: 217-226.*
193. Malik, Y.P.S., Chakravarti, S., Sharma, K., Vaid,
N., Rajak, K.K., Balamurgan, V., Biswas, S.,
Mondal, B., Kataria, R.S. and Singh, R.K. (2011).
Genomic analyses of Toll-like receptor 4 and 7
exons of Bos indicus from temperate sub-
Himalayan region of India. Asian Aust. J. Anim.
Sci., 24: 1019-1025*
194. Malik, Y.P.S., Chander, Y., Olsen, K. and Goyal,
S.M. (2011). Antimicrobial resistance in enteric
pathogens isolated from Minnesota pigs from
1995 to 2004. Can. J. Vet. Res., 75: 117-121.*
195. Malik, Y.P.S., Chandrashekar, K.M., Sharma, K.,
Adil, Vaid, N., Chakarvarti, S., Batra, M. and
Pandey, A.B. (2011). Picobirnavirus detection in
bovine and buffalo calves from foothills of
Himalaya and central India. Trop. Anim. Health
Prod., 43:1475-1478.*
196. Malik, Y.P.S., Chandrashekar, K.M., Sharma, K.,
Minakshi and Prasad, G. (2011). Evidence for
occurrence of human group B rotavirus in central
India based on characterization of NSP2 gene.
Indian J. Virol., 22: 98-103.
197. Malik, Y.P.S., Singh, D., Chandrashekar, K.M.,
Shukla, S., Sharma, K., Vaid, N. and Chakravarti,
S. (2011). Occurrence of dual infection of peste-
des-petits-ruminants and goatpox in indigenous
goats of central India. Transbound. Emerg. Dis.,
58: 268-273.*
198. Prabhu, M., Siva Sankar, M.S., Bhanuprakash, V.,
Venkatesan, G., Bora, D.P., Yogisharadhya, R.
and Balamurugan, V. (2012). Real time PCR: a
rapid tool for potency estimation of live attenuated
camelpox and buffalopox vaccines. Biologicals,
40: 92-95.*
199. Shivachandra, S.B., Viswas, K.N. and Kumar, A.A.
(2011). A review of haemorrhagic septicaemia in
cattle and buffalo. Anim. Health Res. Rev., 12: 67-
82*
200. Shivachandra, S.B., Yogisharadya, R., Ahuja, A.,
and Bhanuprakash, V. (2012). Expression and
purification of recombinant type IV fimbrial subunit
protein of Pasteurella multocida serogroup B:2 in
Escherichia coli. Res. Vet. Sci., (PMID 22398154).*
201. Venkatesan, G., Balamurugan, V., Bora, D.P.,
Yogisharadhya, R., Prabhu, M. and
Bhanuprakash, V. (2011). Sequence and
phylogenetic analyses of an Indian isolate of orf
virus from sheep. Vet. Ital., 47: 323-332.*
202. Venkatesan, G., Bhanuprakash, V., Balamurugan,
V., Bora, D.P., Prabhu, M., Yogisharadhya, R. and
Pandey, A.B. (2012). Rapid detection and
quantification of Orf virus from infected scab
materials of sheep and goats. Acta Virol., 56: 81-
83.*
203. Venkatesan, G., Bhanuprakash, V., Balamurugan,
V., Prabhu, M.and Pandey, A.B. (2012). TaqMan
hydrolysis probe based real time PCR for
detection and quantitation of camelpox virus in
skin scabs. J. Virol. Methods, 181: 192-196.*
204. Yogisharadya, R., Bhanuprakash, V., Venkatesan,
G., Balamurugan, V., Pandey, A.B. and
Shivachandra, S.B. (2012). Comparative
sequence analysis of pox viral A32 gene encoding
for ATPase proteins and carboxyl terminal
heterogeneity of Indian Orf viruses. Vet. Microbiol.,
156: 72-80.*
BIOPHYSICS, ELECTRON MICROSCOPY AND
INSTRUMENTATION SECTION
205. Karthik, K., Singh, P. and Das, P. (2011) Gold
Nanoparticles based dipstick immunoassay for
rapid diagnosis of paratuberculosis in small
ruminant. Small Rum. Res., 99: 214-221.*
206. Onodera, T., Mizuta, Y., Horikawa, K., Singh, P.,
Matsumoto, K., Miura, N. and Toko, K., (2011).
Displacement immunosensor based on surface
plasmon resonance for rapid and highly sensitive
detection of 2,4,6-trinitrotoluene,Sensors and
Materials, 23: 38-52*
127
HIGH SECURITY ANIMAL DISEASE LABORATORY,
BHOPAL
207. Dubey, S.C., Dahal, N., Nagarajan, S., Tosh, C.,
Murugkar, H.V., Rinzin, K., Sharma, B., Jain, R.,
Katare, M., Patil, S., Khandia, R., Syed, Z., Tripathi,
S., Behera, P., Kumar, M., Kulkarni, D.D. and Lal
Krishna. (2011). Isolation and characterization of
influenza A virus (subtype H5N1) that caused the
first highly pathogenic avian influenza outbreak
in chicken in Bhutan. Vet. Microbiol. 155: 100-
105.*
208. Mishra, N., Rajukumar, K., Kalaiyarasu, S. and
Dubey, S.C. (2011). Pestivirus infection, an
emerging threat to ruminants in India: A review.
Indian J. Anim. Sci., 81: 545-551.
209. Mishra, N., Rajukumar, K., Kalaiyarasu, S., Behera
S.P., Nema, R.K. and Dubey, S.C. (2011). Small
interfering RNAs targeting viral structural
envelope protein genes and the 5'-UTR inhibit
replication of bovine viral diarrhea virus in MDBK
cells. Acta Virol., 55: 279-282.*
210. Nagarajan, S., Murugkar, H.V., Tosh, C., Behera,
P., Khandia, R., Jain, R., Katare, M., Syed, Z.,
Tripati S. and Dubey, S.C. (2011). Comparison of
a nucleoprotein gene based RT-PCR with real
time RT-PCR for diagnosis of avian influenza in
clinical specimens. Res Vet. Sci. ( doi:10.1016/
j.rvsc.2011.06.005).*
211. Nagarajan, S., Tosh, C., Peiris, J.S.M., Murugkar,
H.V., Sridevi, R., Kumar, M., Katare, M., Jain, R.,
Syed, Z., Behera, P., Cheung, C.L., Khandia, R.,
Tripathi, S., Yi Guan and Dubey, S.C. (2012). Avian
Influenza (H5N1) virus of clade 2.3.2 in domestic
poultry in India. PLoS One 7: e31844. doi:10.1371/
journal.pone.0031844.*
212. Sood, R., Swarup, D., Bhatia, S., Kulkarni, D.D.,
Dey, S., Saini, M. and Dubey, S.C. (2012). Antiviral
activity of crude extracts of Eugenia jambolana
Lam. against highly pathogenic avian influenza
(H5N1) virus. Indian J. Exp. Biol., 50: 179-186.
I.V.R.I., BANGALORE
213. Dechamma, H.J., Kumar, S., Gaikwad, S., Reddy,
G.R., Banumathi and Suryanaryana, V.V.S.
(2011). Evaluation of stability, bio-distribution and
toxicity of foot and mouth disease DNA vaccine
delivered by calcium phosphate nanoparticles. Int.
J. Curr. Res., 33: 113-119.*
214. Maddur, M.S., Rao, S., Chockalingam, A.K.,
Kishore, S., Gopalakrishna, S., Singh, N.,
Suryanarayana, V.V.S. and Gajendragad, M.R.
(2011). Absence of heat intolerance (panting)
syndrome in foot-and-mouth disease-affected
Indian cattle (Bos indicus) is associated with intact
thyroid gland function. Transbound. Emerg. Dis.,
58: 274-279.*
215. Nagarajan, G., Ravikumar, P., Ashok Kumar, C.,
Reddy, G.R., Dechamma, H.J. and
Suryanarayana, V.V.S. (2011). Self replicating
gene vaccine carrying P1-2A gene of FMDV
Serotype O and its effects on the immune
responses of cattle. Indian J. Virol., 22: 50-58.
216. Pradhan, P., Gopinath, S.M., Reddy, G.R.,
Dechamma, H.J. and Suryanarayana, V.V.S.
(2011). Detection of major pathogens in bovine
sub-clinical mastitis by multiplex pcr directly from
milk samples in presence of an internal control.
Indian J. Fundamental Appl. Life Sci., 4: 209-218.
217. Sameer, K., Jadav, K., Reddy, S., Rashmi, B.R.,
Dechamma, H.J., Ganesh, K., Suryanarayana,
V.V.S., Reddy, G.R. (2011). Improved immune
response by ID-pVAC: A secretory DNA vaccine
construct delivered by PLG micro particles against
foot and mouth disease in guinea pigs. Res. Vet.
Sci., 91: 86-89.*
EASTERN REGIONAL STATION, KOLKATA
218. Ahmed, M., Singh, M.N., Bera, A.K.,
Bandyopadhyay, S. and Bhattacharya, D. (2011).
Molecular basis for identification of species/
isolates of gastrointestinal nematode parasites.
Asian Pacific J. Trop. Med., 4: 589-593.*
219. Bandyopadhyay, S., Lodh, C., Rahaman, H.,
Bhattacharya, D., Bera, A.K., Ahmed, F.A.,
Mahanti, A., Samanta, I., Mondal, D.K.,
Bandyopadhyay, S., Sarkar, S., Dutta, T.K., Maity,
S., Paul, V., Ghosh, M.K., Sarkar, M. and Baruah,
K.K. (2012). Characterization of shiga toxin
producing (STEC) and enteropathogenic
Escherichia coli (EPEC) in raw yak (Poephagus
grunniens) milk and milk products. Res. Vet. Sci.,
(PubMed PMID: 22226073).*
220. Bandyopadhyay, S., Lodh, C., Sarkar, M., Ghosh,
M.K., Bera, A.K., Bhattacharyya, D., Mondal, D.K.
and Baruah, K.K. (2012). Prevalence, molecular
fingerprinting and drug resistance profileof
enterovirulent Escherichia coli isolates from free-
ranging yaks of Tawang district, Arunachal
Pradesh, India. Trop. Anim. Health Prod., (PubMed
PMID: 22228494).*
221. Bandyopadhyay, S., Mahanti, A., Samata, I., Dutta,
T.K., Ghosh, M.K., Bera, A.K., Bandyopadhyay, S.
and Bhattacharya, D. (2011). Virulence repertoire
of Shiga toxin-producing Escherichia coli (STEC)
and enterotoxigenic Escherichia coli (ETEC) from
diarrhoeic lambs of Arunachal Pradesh, India.
Trop. Anim. Health Prod., 43: 705-710
(DOI:10.1007/s11250-010-9757-1).*
222. Bera, A.K., Rana, T., Das, S., Bhattacharya, D.,
Pan, D., Bandyopadhyay, S. and Das, S.K. (2011).
Mitigation of arsenic-mediated renal oxidative
stress in rat by Pleurotus florida lectin. Human
Exp. Toxicol., 30: 940-951.*
223. Dandapat, P., Nanda, P.K., Bandyopadhyay, S.,
Kaushal, A. and Sikdar, A. (2011). Prevalence of
Deg Nala disease in eastern India and its
reproduction in buffaloes by feeding Fusarium
oxysporum infested rice straw. Asian Pacific J.
Trop. Med., 4: 54-57.*
224. De, S., Pan, D., Bera, A.K., Sreevatsava, V.,
Bandyopadhyay, S., Chaudhuri, D., Kumar, S.,
Rana, T., Das, S., Das, S.K., Suryanaryana, V.V.,
Singh, M.N. and Bhattacharya, D. (2011). In vitro
128
assessment of praziquantel and a novel
nanomaterial against protoscoleces of
Echinococcus granulosus. J. Helminthol., 31: 1-
4.*
225. Dutta, T.K., Roychoudhury, P., Bandyopadhyay,
S., Wani, S.A. and Hussain, I. (2011). Detection
and characterization of Shiga toxin producing
Escherichia coli (STEC) & enteropathogenic
Escherichia coli (EPEC) in poultry birds with
diarrhoea. Indian J. Med. Res., 133: 541-555.
(PubMed PMID: 21623041).
226. Kumar, V., Das, S.C., Guin, S. and Mallick, S.V.S.
(2012). Virulance enterotoxigenicity and antibiotic
profile of Staphylococcus aureus from buffalo
clinical mastitis. Indian J. Anim. Sci., 82: 48-51.
227. Rana, T., Bera, A.K., Das, S., Bhattacharya, D.,
Pan, D., Bandyopadhyay, D., Mondal, D.K.,
Samanta, S., Bandyopadhyay, S. and Das, S.K.
(2011). Pleurotus florida lectin normalizes duration
dependent hepatic oxidative stress responses
caused by arsenic in rat. Exp. Toxicol. Pathol.,
(doi 10.1016/j.etp.2010.12.010.*
DIVISION OF ANIMAL GENETICS
228. Bhushan, B., Singh, S.K., Umang, Agrawal, N.,
Dutt, T., Kumar, P., Sharma, A. and Ahlawat, S.P.S.
(2010). Effect of education levels on adoption of
management practices among livestock owners
in urban areas of Bareilly district of Uttar Pradesh.
Indian J. Dairy Sci., 63: 1-5.
229. Dayal, S., Kumar, P., Sharma, A., Tiwari, A.K. and
Kaushik, P. (2012). Molecular cloning and
characterization of serum lysozyme gene in
Muzaffarnagri breed of sheep. J. Appl. Anim. Res.
(DOI:10.1080/09712119.2011.627136).
230. Dige, M.S., Ahlawat, S.P.S., Bhushan, B., Tiwari,
A.K., Sonawane, A., Kumar, P., Inamdar, B. and
Dutt, T. (2011). PCR-SSCP and sequencing of
CXCR2 receptor gene in vrindavani cattle. J. Adv.
Vet. Res., 1: 52-56.
231. Dige, M.S., Kumar, A, Kumar, P., Dubey, P.P. and
Bhushan, B. (2011). Estimation of variance
components and genetic parameters for growth
traits in New Zeeland White rabbit (Oryctolagus
cuniculus). J. Appl. Anim. Res., (doi:10.1080/
09712119.2011.645037).*
232. Ganguly, I., Sharma, A., Mitra, A., Kumar, N. and
Ganguly, A. (2011) Analysis of genetic variations
of complete TM4 of buffalo (Bubalus bubalis)
Slc11A1 gene. J. Appl. Anim. Res., 39: 324-327.
233. Geetha, T., Kumar, S., Dubey, P.P., Sivamani, B.,
Ghosh, S.K., Mitra, A., Tomar, A.K.S and Sharma,
A. (2011). Sequence variability in CatSper1 gene
in Vrindavani crossbred cattle. Indian J. Anim. Sci.,
81: 83-84.
234. Kandasamy, S. and Mitra, A. (2011). Cloning of
actin, beta (ACTB) cDNA and assessment of its
suitability as a reference gene in uterine
endometrial tissue of buffalo (Bubalus bubalis).
Indian J. Anim. Sci., 81: 763-768.
235. Kumar, A. and Gandhi, R.S. (2011). Evaluation of
pooled lactation production and reproduction traits
in Sahiwal cattle. Indian J. Anim. Sci., 81 (6): 600-
604.
236. Kumar, A., Gandhi, R.S. and Haile, A. (2011).
Estimation of variance components of milk yield
and genetic evaluation of Sahiwal cattle using
mixed linear models. Indian J. Anim. Sci., 81: 605-
609.
237. Kumar, N., Ganguly, I., Singh, R., Deb, S.M.,
Kumar, S., Sharma, A. and Mitra, A. (2011). DNA
polymorphism in SLC11A1 gene and its
association with brucellosis resistance in Indian
Zebu (Bos indicus) and crossbred (Bos
indicus×Bos taurus) cattle. Asian-Aust. J. Anim.
Sci., 24: 898 - 904.*
238. Manoj, M., Gandhi, R.S., Raja, T.V. and Kumar, A.
(2011). Selection indices using body weights in
sahiwal cattle. Indian J. Dairy Sci., 63: XXXX
239. Mishra, C., Das, D., Kumar, P., Khanna, K., Singh,
A.P., Dayal, S., Selvaramesh, Bhattacharya, T.K.,
Bhushan, B. and Sharma, A. (2011). Nucleotide
sequencing and PCR-SSCP of MX1 gene in
chicken. Indian J. Anim. Res., 45: 276-282.
240. Mishra, C., Kumar, P., Das, D., and Sharma, A.
(2011). PCR-RFLP and nucleotide sequencing
of Mx1 gene in chicken. Indian J. Anim. Sci., 81:
718-722.
241. Naskar, S., Deb, S.M., Niranjan, S.K., Kumar, S.,
Sharma, D., Sakaram, D. and Sharma, A. (2012).
Molecular characterization of MHC-DRB cDNA in
water buffalo (Bubalus bubalis) Genet. Mol. Biol.,
35: 95-98.
242. Panigrahi, M., Kumar, S., Deb, S.M., Mitra, A.,
Sharma, A. and Bujarbaruah, K.M. (2012).
Characterization of Insulin like Growth Factor-1
(IGF-1) partial gene in mithun. Indian J. Anim. Sci.,
82: 89-91.
243. Parasar, P., Bhushan, B., Yadav, J.S., Sharma, A.
and Dutt, T. (2011). DNA polymorphism of major
histocompatibility complex class II DQA and DQB
genes in crossbred cattle (Bos taurus x Bos
indicus). Indian J. Anim. Sci., 81: 769-772.
244. Sinha, R.R.K., Dutt, T., Bhushan, B., Singh, R.R.,
Singh, M. and Kumar, S. (2010). Comparative
studies of calf rearing and milking management
practices in rural, semi-urban and urban areas of
Bareilly district of Uttar Pradesh. Indian J. Anim.
Sci., 80: 483-485.
LIVESTOCK PRODUCTION AND MANAGEMENT
SECTION
245. Bhadauria, P., Tomar, A.K.S., Jadoun, Y.S. and
Bhadauria, S.S. (2011). Selection of breedable
females of Vrindavani cattle by using different dam
evaluation methods. Indian J. Anim. Res., 45: 120-
124.
246. Deshpande, K.Y., Mehra, U.R., Singh, P. and
Verma, A.K. (2011). Purine derivatives
concentration in body fluids as influenced by
different energy levels in dairy cows. Indian J.
Anim. Sci., 81: 1244-1247.
129
247. Dutt, R., Mehrotra, S., Shanker, U. and Singh, G.
(2011). Effect of Murraya koenigii and Aegle
marmelos feeding on anestrus buffaloes. Indian
J. Anim. Reprod., 32: 47-49.
248. Fahim, A., Patel, B.H.M., Singh, M., Dutt, T.,
Mondal, S.K. and Ram Govind (2011). Studies on
certain phenotypic characteristics of local goat of
Rohilkhand region. Indian J. Anim. Prod.
Management, 27: 218-221.
249. George, S.K., Verma, A.K., Mehra, U.R., Singh, P.
and Dipu, M.T. (2011). Nitrogen utilization in goats
fed various oil cakes. Arch. Zootech., 14: 76-91.
250. Gupta, R.K., Joshi, H.C. and Patel, M. (2011). Man-
power utilization in hand and machine milking
operations of crossbred cows in organized farm.
Indian J. Anim. Prod. Management, 27: 70-74.
251. Jacob, A.B., Mooyottu, S., Singh, P., Pathania, S.,
Anees, C., Raina, O.K. and Verma, A.K. (2011).
Fasciola gigantica egg induced granuloma in the
liver of experimentally infected cross bred calf.
Indian J. Vet. Pathol., 35: 75-76.
252. Kumar, R., Kumar, A., Kumar, A., Patel, M., Ameha,
N. and Kumar, R.R. (2011). Role of ruminants in
global warming: their mitigation through improved
management. Prog. Res., 5: 165-168.
253. Kumar, R., Kumar, A., Patel, M. and Yadav, A.K.
(2011). Prediction of body weight based on body
measurement of pigs. Indian J. Vet. Res. 20: 9-14.
254. Mondal, S.K., Das, B.C., Saikia, P., Das, G.K. and
Bhar, R. (2012). Birth weight and biometry of
purebred Landrace pigs under farm conditions. J.
Livestock Sci., 3: 1-5.
255. Mondal, S.K., De, U.K., Das, G.K., Pawde, A.M.
and Verma, A.K. (2012). Pattern of mortality of
crossbred pigs under organized farm conditions.
J. Livestock Sci., 3: 37-44.
256. Mondal, S.K., Joshi, H.C., Majumdar, A.C., Deb,
S.M., Pandey, H.N., Varshney, V.P. and Dutt, T.
(2011). The male effect in indigenous
Muzaffarnagari sheep. 1. Behavioural and ovarian
responses of anoestrous ewes to male
introduction. J. Appl. Anim. Res., 39: 275-278.
257. Patel, M., Sharma, R.J., Kumar, S., Kumar, A.,
Tiwari, D.P. and Kumar, R. (2011). Effect of feeding
different levels of jaggery filter cake on blood
biochemical and mineral profile in Yorkshire pigs.
Indian J. Anim. Sci., 81:180-183.
258. Patoo, R.A., Kumar, S. and Patel, M. (2011).
Formulation of concentrate jaggery scum feed
blocks for pigs. Indian Vet. J., 88: 148-149.
259. Prasanna, S.B., Chhabra, A.K., Bhar, R., Reddy,
G.B.M., Rajeshwari, Y.B. and Patel M. (2011).
Influence of kitchen waste and poultry offals on
water intake in Landrace crossbred pigs. Indian
Vet. J., 88: 68-69.
260. Ram Govind, Joshi, H.C., Patel, B.H.M., Verma,
M.R. and Dutt, T. (2011). Comparative behaviour
study of orphan kids under different milk feeding
systems. Indian J. Anim. Prod. Management, 27:
183-186.
261. Sakkariya, I.N.P., Dutt, T., Singh, M. and Kumar,
A. (2011). Prevalence of digestive and respiratory
disorders in Vrindavani cattle. Indian J. Anim. Sci.,
81: 463-464.
262. Sakkariya, I.N.P., Dutt, T., Singh, M. and Kumar,
A. (2011). Prevalence of reproductive disorders
in Vrindavani cows. Indian Vet. J., 88: 36-37.
263. Sarath, T., Suguna, K., Mehrotra, S., Arunmozhi,
N., Agarwal, S.K. and Shanker, U. (2010). Serum
triiodothyronine and thyroxine profile in insulin
treated acyclic goats, Indian J. Anim. Reprod., 31:
33-34.
264. Singh, R.R., Dutt, T., Kumar, A., Tomar, A.K.S. and
Singh, M. (2011). On-farm characterization of
Vrindawani cattle in India. Indian J. Anim. Sci., 81:
267-271.
265. Singh, R.R., Dutt, T., Kumar, A., Tomar, A.K.S. and
Singh, M. (2011). Evaluation of production and
reproduction traits in Vrindawani cattle. Indian J.
Anim. Sci, 81: 296-298.
266. Vijayakumar, P., Dutt, T., Singh, M. and Pandey,
H.N. (2011). Effect of heat ameliorative measures
on the biochemical and hormonal responses of
buffalo heifers. J. Appl. Anim. Res., 39: 181-184.
DIVISION OF TEMPERATE ANIMAL HUSBANDRY
267. Lacroix-Pepin, N., Danyod, G., Narayanan, K.,
Mondal, S., Chapdelaine, P. and Fortier, M.A.
(2011). The multidrug resistance associated
protein 4 (MRP4) appears as a functional carrier
of prostaglandins regulated by oxytocin in the
bovine endometrium. Endocrinol., 152: 4993-
5004.*
268. Ranjan, A., Sahoo, B., Singh, V.K., Srivastava, S.,
Singh, S.P. and Pattanaik, A.K. (2012). Effect of
bypass fat supplementation on productive
performance and blood biochemical profile in
lactating Murrah (Bubalus bubalis) buffaloes. Trop.
Anim. Health Prod., Published online: 29 February
2012.*
269. Sahoo, B., Tiwari, D.P., Kumar, P., Mondal, B.C.,
Singh, D.V. and Joshi, Y.P. (2012). Effect of
probiotic supplementation on growth performance
and blood biochemicals in crossbred calves.
Indian J. Anim. Sci., 82: 328-330.
270. Thirumurugan, P., Chhabra, A.K and Bhar, R.
(2011). Nutrient Utilization in pregnant crossbred
gilts fed diet containing different levels of rice bran.
Indian Vet. J., 88: 13-16.
DIVISION OF ANIMAL REPRODUCTION
271. Ahmad, S., Kumar, H., Singh, G. and Patra, M.K.
(2011). The administration of GnRH plus PGF2
alpha synchronizes the estrus in anestrus
crossbred cows exposed to bull urine. Indian J.
Vet. Res., 20: 42-45.
272. Das, G.K., Murugan, M.M., Sarvanan, S. and
Prasad, J.K. (2011). Simultaneous presentation
of twins with postural defects causing dystocia in
a non-descript doe. Indian J. Small Rum., 17: 254-
255.
130
273. Jan, M.H., Khan, F.A., Pande, M., Kumar, B., Das,
G.K. and Sarkar, M. (2011). Follicular attributes
and intra-follicular nitric oxide and ascorbic acid
concentrations in cyclic and acyclic buffaloes
during summer season. Theriogenol. Insight, 1:
83-88.*
274. Jerome, A., Singh, S.K. and Agarwal, S.K. (2011).
Structural modeling and analysis of pregnancy
associated glycoprotein-1 of buffalo. (Bubalus
bubalis). ISRN Molecular Biology (ID 481539, 8
pages. doi:10.5402/2012/481539).*
275. Jerome, A., Singh, S.K., Agarwal, S.K., Saini, M.
and Raut, A. (2011). Characterization and in silico
analysis of pregnancy associated glycoprotein-1
gene of buffalo (Bubalus bubalis). Gen. Res. Int.,
(ID 436138, doi10.4061/2011/436138).*
276. Khan, F.A. and Das, G.K. (2011). Follicular fluid
nitric oxide and ascorbic acid concentrations in
relation to follicle size, functional status and stage
of estrous cycle in buffalo. Anim. Reprod. Sci.,
125: 62-68.*
277. Khan, F.A. and Das, G.K. (2012). Follicular
characteristics and intrafollicular concentrations
of nitric oxide and ascorbic acid during ovarian
acyclicity in water buffalo (Bubalus bubalis). Trop.
Anim. Health Prod., 44: 125-131.*
278. Khan, F.A., Das, G.K., Pande, M., Mir, R.A. and
Uma Shankar (2011). Changes in biochemical
composition of follicular fluid during reproductive
acyclicity in water buffalo (Bubalus bubalis). Anim.
Reprod. Sci., 127: 38-42.*
279. Khan, F.A., Das, G.K., Pande, M., Sarkar, M.,
Mahapatra, R.K. and Uma Shankar (2012).
Alterations in follicular fluid estradiol,
progesterone and insulin concentrations during
ovarian acyclicity in water buffalo (Bubalus
bubalis). Anim. Reprod. Sci., 130: 27-32.*
280. Khan, F.A., Nabi, S.U., Pande, M., Das, G.K. and
Sarkar, M. (2011). Bilateral follicular cysts in a
water buffalo. Trop. Anim. Health Prod., 43: 539-
541.*
281. Kumar, P. and Srivastava, S.K. (2011). Effect of
Tinospora cordifolia and autologous blood plasma
on activity of certain enzymes in genital secretion
of post partum buffaloes. Indian J. Anim. Sci., 81:
824-826.
282. Perumal, P. and Srivastava, S.K. (2011). Semen
collection and artificial insemination in canine
species. Indian Pet J., 11: 36-46.
283. Perumal, P., Srivastava, N., Nagarajan, N. and
Srivastava, S.K. (2011). Medical termination of
pregnancy in bitch. Indian Pet J., 11: 10-14.
284. Prasad, J.K., Binsila, B.K., Pandey, M., Kumar, A.,
Das, G.K. and Ghosh, S.K. (2012). Cervical
stenosis due to uterine inertia leading to dystocia
in a crossbred cattle. J. Indian Vet. Assoc., 9: 62-
63.
285. Shukla, S.N., Agarwal, S.K., Singh, S.K., Shankar,
U and Mitra, A. (2011). Effect of COX-2 modulator
on estrous cycle and prostaglandins secretion in
buffalo (Bubalus bubalis). Indian J. Anim. Sci., 81:
582-585.
286. Srivastava, N., Srivastava, S.K., Ghosh, S.K.,
Singh, L.P., Prasad, J.K., Kumar, A., Perumal, P.,
Jerome, A. and Thamizharasan, A. (2012).
Sequestration of PDC-109 protein improves
freezability of crossbred bull spermatozoa Anim.
Reprod. Sci., 131: 54-62. (http://dx.doi.org/
10.1016/j.anireprosci.2012.02.003).*
287. Srivastava, S.K. (2011). A case of habitual
abortion in bitch. Indian Pet J., 11: 51-53.
DIVISION OF ANIMAL NUTRITION
288. Chaudhary, L.C., Agarwal, N., Verma, V. and
Kamra, D.N. (2011). Effect of feeding superior
strain of tannin degrading bacteria (Isolate-6) on
growth performance, nutrient utilization and rumen
fermentation in goats fed on Ficus infectoria
leaves. Small Rum. Res., 99: 143-147.*
289. Dass, R.S., Mendiratta, S.K., Bhadane, K.P,
Mudgal, V. and Lakshmanan, V. (2011). Effect of
vitamin E supplementation on growth and meat
quality of male Murrah buffalo (Bubalus bubalis)
calves. Anim. Nutr. Feed Technol., 11: 221-231.
290. Deshpande, K.Y., Mehra, U.R., Singh, P. and
Verma, A.K. (2011). Influence of dietary energy
levels on nutrient utilization, purine derivatives
excretion and PDC index in dairy cows. Indian J.
Anim. Sci., 81: 1244-1247.
291. Dhayagude, R.S, Garg, A.K., Dass, R.S. and
Bhadane, K.P (2012). Nutrient utilization and
growth performance of guinea pigs (Cavia
porcellus) exposed to different levels of dietary
cadmium. Anim. Nutr. Feed Technol., 12: 25-34.
292. Dubey, M., Dutta, N., Banerjee, P.S., Pattanaik,
A.K., Sharma, K. and Singh, M. (2011). Effect of
condensed tannin supplementation through a tree
leaves mixture on erythrocytic antioxidant status
and gastrointestinal nematodes in kids. Anim. Nutr.
Feed Technol., 12: 91-102.
293. Dubey, M., Dutta, N., Sharma, K., Pattanaik, A.K.,
Banerjee, P.S. and Singh, M. (2011). Effect of
condensed tannins supplementation from
tanniferous tree leaves on in vitro nitrogen and
substrate degradation. Anim. Nutr. Feed Technol.,
11: 115-122.
294. Dutta, N., Dubey, M., Banerjee, P.S., Pattanaik,
A.K., Sharma, K., Kumar, P. and Narang, A. (2012).
Effect of supplementing tanniferous tree leaves
mixture on immune response and GI nematodes
in kids. Liv. Res. Rural Dev., 24, http://
www.lrrd.org/lrrd24/2/dutt 24035.htm*
295. George, S.K., Verma, A.K., Mehra, U.R., Dipu, M.T.
and Singh, P. (2011). Nitrogen utilization in goats
fed various oil cakes. Archiva Zootechnica, 14:
76-91.*
296. George, S.K., Verma, A.K., Mehra, U.R., Dipu, M.T.
and Singh, P. 2011. Evaluation of purine
metabolites- creatinine index to predict the rumen
microbial protein synthesis from urinary spot
samples in Barbari goats. J. Anim. Feed Sci., 20:
509-525.*
297. Katole, S., Saha, S. K., Sastry, V.R.B., Lade Munna
and Prakash, B. (2011). Intake, blood metabolites
131
and hormonal profile in sheep fed processed
Jatropha (Jatropha curcas) meal. Anim. Feed Sci.
Technol., 170: 21-26.*
298. Kore, K.B., Pattanaik, A.K., Das, A. and Sharma,
K. (2011). Evaluation of prebiotics
(mannanoligosaccharide) as functional food in
dogs: effect on nutrient digestibility, hind gut health
and plasma metabolic profile. Indian J. Anim. Sci.,
82: 81-86.
299. Kore, K.B., Pattanaik, A.K., Sharma, K. and
Mirajkar, P.P. (2012). Effect of feeding traditionally
prepared fermented milk dahi (curd) as a
probiotics on nutritional status, hindgut health and
haematology in dogs. Indian J. Traditional
Knowledge, 11: 35-39.
300. Kumar, R., Kamra, D.N., Agarwal, N. and
Chaudhary, L.C. (2011). Effect of feeding plant
part mixture and peppermint oil on rumen
fermentation, microbial profile and nutrient
digestibility in fistulated buffaloes. Indian J. Anim.
Sci., 81: 488-492.
301. Kumar, R., Kamra, D.N., Agarwal, N., Chaudhary,
L.C. and Zadbuke, S.S. (2011). Effect of tree leaves
containing plant secondary metabolites on in vitro
methanogenesis and fermentation of feed with
buffalo rumen liquor. Anim. Nutr. Feed Technol.,
11: 103-114.
302. Lohakare, J.D., Pattanaik, A.K. and Khan, S.A.
(2011). Metabolic effects of short-term
administration of fluoride to calves fed graded
protein levels in their diets. Fluoride, 44: 95-102.*
303. Mudgal, V., Garg, A.K., Dass, R.S. and Varshney,
V.P. (2012). Effect of selenium, zinc and copper
supplementation on blood metabolic profile in
male buffalo (Bubalus bubalis) calves. Biol. Trace
Element Res., 145: 304-311.*
304. Patra, A.K., Kamra, D.N., Bhar, R., Kumar, R. and
Agarwal, N. (2011). Effect of Terminalia chebula
and Allium sativum on in vivo methane emission
by sheep. J. Anim. Physiol. Anim. Nutr., 95: 187-
191.*
305. Patra, R.C., Pattanaik, A.K., Puneet Kumar,
Ranjan, R., Sahoo, A. and Swarup, D. (2011).
Clinico-biochemical alterations in zero-grazed
riverine buffaloes on dry roughage based ration.
Veterinarski Arhiv, 80: 379-390.*
306. Pattanaik, A.K., Khan, S.A. and Goswami, T.K.
2011. Iodine supplementation to a diet containing
Leucaena leucocephala leaf meal: Effects on
nutrient metabolism, clinical chemistry and
immunity of goats. Anim. Prod. Sci., 51: 541-548.*
307. Prakash, B., Saha, S.K., Khate, K., Agarwal, N.,
Katole, S., Haq, N. and Rajkhowa, C. (2011).
Rumen Microbial variation and nutrients
Utilization in mithun (Bos frontalis) under different
feeding regimes. J. Anim. Physiol. Anim. Nutr.,
DOI: 10.1111/j,1439-0396.2011.01270.x.*
308. Samal, L. and Garg, A.K. (2012). Status of toxic
heavy metals in cereal grains and pulses in
Bareilly district of Uttar Pradesh. Indian Vet. J., 89:
25-27.
309. Samal, L., Pattanaik, A.K. and Mishra, C. (2011).
Application of molecular tools for gut health of pet
animals: a review. J. Adv. Vet. Res., 1: 38-46.*
310. Sethy, K., Dass, R.S., Garg, A.K. and Badhane,
K.P. (2011). Effect of dietary cadmium on
hematology, blood metabolic profile, serum
minerals and hormone status in kids (Capra
hircus). Indian J. Anim. Nutr., 28: 366-371.
311. Singh, B., Chaudhary, L.C., Agarwal, N., and
Kamra, D.N. (2011). Phenotypic and phylogenetic
characterisation of tannin degrading/tolerating
bacterial isolates from the rumen of goats fed on
pakar (Ficus infectoria) leaves. J. Appl. Anim. Res.,
39: 120-124.*
312. Singh, P., Verma, A.K., Bency, J.A., Gupta, S.C.
and Mehra, U.R. (2011). Haematological and
biochemical changes in Fasciola gigantica
infected buffaloes fed on diet containing deoiled
mahua (Bassia latifolia) seed cake. J. Appl. Anim.
Res., 39: 185-188.*
313. Singh, V.K., Pattanaik, A.K., Sharma, K. and Saini,
M. (2011). Effect of reduced dietary energy intake
on erythrocytic antioxidant defense in lambs. Anim.
Prod. Sci., 51: 642-649.*
314. Singh, B., Chaudhary, L.C., Agarwal, N. and
Kamra, D.N. (2011). Effect of feeding Ficus
infectoria leaves on rumen microbial profile and
nutrient utilization in goats. Asian-Aust. J. Anim.
Sci., 24: 810-817.*
DIVISION OF PHYSIOLOGY & CLIMATOLOGY
315. Bhakat, M., Mohanty, T.K., Raina, V.S., Gupta, A.K.,
Khan, H.M., Mahapatra, R.K. and Sarkar, M.
(2011). Effect of age and season on semen quality
parameters in Sahiwal bulls. Trop. Anim. Health
Prod., 43: 1161-1168.*
316. Bhakat, M., Mohanty, T.K., Raina, V.S., Gupta, A.K.,
Pankaj, P.K., Mahapatra, R.K. and Sarkar, M.
(2011). Study on suitable semen additives
incorporation into the extender stored at
refrigerated temperature. Asian Aust. J. Anim. Sci.,
24: 1348-1357.*
317. Dangi, S.S., Gupta, M., Maurya, D., Yadav, V.P.,
Panda, R.P., Singh, G., Mohan, N.H., Bhure, S.K.,
Das, B.C., Bag, S., Mahapatra, R.K., Sharma, G.T.
and Sarkar, M. (2012) .Expression profile of HSP
genes during different seasons in goats (Capra
hircus). Trop. Anim. Health Prod. (DOI 10.1007/
s11250-012-0155-8).*
318. Dubey, P.K., Tripathi, V., Singh, R.P. and Sharma,
G.T. (2011). Effects of nitric oxide on the in vitro
growth, survival, steroidogenesis and apoptosis
of buffalo preantral follicles. J. Vet. Sci., 12: 257-
265.*
319. Dubey, P.K., Tripathi, V., Singh, R.P. and Sharma,
G.T. (2011). Influence of nitric oxide on steroid
synthesis, growth and apoptosis of buffalo
(Bubalus bubalis) granulosa cells in vitro. Asian
Aust. J. Anim. Sci., 24: 1204-1210.*
320. Dubey, P.K., Tripathi, V., Singh, R.P., Saikumar,
G., Amar Nath, Pratheesh, M.D., Gade, N.E. and
132
Sharma, G.T. (2012). Expression of nitric oxide
synthase isoforms in different stages of buffalo
(Bubalus bubalis) ovarian follicles: effect of nitric
oxide on in vitro development of preantral follicle.
Theriogenol., 77: 280-291.*
321. Eswari, S, Saikumar, G. and Sharma, G.T. (2011)
Expression of messenger RNA encoding LIF
receptor beta in buffalo preimplantation embryos
produced in vitro. Indian J. Anim. Sci., 81: 12-14.
322. Eswari, S., Rajarajan, K., Saikumar, G. and
Sharma, G.T. (2011). Supplementation of
leukemia inhibitory factor on in vitro development
of buffalo embryos. Tamilnadu J. Anim. Sci., 6:
255-261.
323. Gade, N.E., Pratheesh, M.D., Amar Nath, Dubey,
P.K., Amarpal and Sharma, G.T. (2012).
Therapeutic potential of stem cells in veterinary
practice. Vet. World, 5: 499-507.
324. Kumar, V., Kumar, P., Mohan, K., Sarkar, M.,
Suresh, K.P., Chauhan, M.S. and Prakash, B.S.
(2011). Temporal changes in circulating levels of
plasma interleukin-8 during peripartum period in
Murrah buffaloes (Bubalus bubalis) under
subtropical climate. Trop. Anim. Health Prod., 43:
669-674.*
325. Mankuzhy, P.D., Dubey, P.K., Amar Nath, Gade,
N.E., Kumar, R, and Sharma, G.T. (2011).
Mesenchymal stem cells and it's characterization,
Vet. World, 4: 571-574.
326. Maurya, V.P, Sejian, V. and Naqvi, S.M.K. (2011).
Body condition score and sexual behavior of
Malpura ewes. Indian Vet. J., 88: 18-20.
327. Mohan, N.H, Das, B.C., Bag, S. and Sharma, G.T.
(2011). Relative expression of an "H19 like" gene
in stomach and intestine of mouse. Indian J. Anim.
Sci., 81: 55-57.
328. Puri, G., Das, B.C. and Bag, S. (2011).
Comparative study of FBS and Extract Egg on
embryo generation in buffalo.Vet. Pract., 13.
329. Puri, G., Das, B.C. and Bag, S. (2011).
Development of buffalo embryonic stem cell
clones in hanging drop using different culture
medium.Vet. Pract., 13.
330. Sarkar, M., Schilffarth, S., Meyer, H., Schams, D.
and Berisha, B. (2011). Expression of
thrombopoietin and its receptor during different
physiological stages in the bovine ovary. Reprod.
Domest. Anim., 46:757-762.*
331. Sharma, G.T., Dubey, P.K. and Saikumar, G.
(2011). Localization and expression of follicle-
stimulating hormone receptor in buffalo preantral
follicles. Reprod. Domest. Anim., 46: 114-120.*
332. Sharma, G.T., Dubey, P.K., Amar Nath and
Saikumar, G. (2011). Localization and expression
of proliferating cell nuclear antigen (PCNA) and
cyclin B1 in buffalo (Bubalus bubalis) ovary during
different stages of follicular development. Indian
J. Anim. Sci., 81: 231-234.
333. Sharma, G.T., Dubey, P.K., Amar Nath and
Saikumar, G. (2012). Co-culture of buffalo
(Buabalus bubalis) pre-antral follicle with antral
follicle: A comparative study of developmental
competence of oocytes derived from in vivo
developed and in vitro cultured antral follicles.
Zygote. P 1-9, (DOI:10.1017/
S0967199411000700).*
334. Sharma, G.T., Shiv Prasad, Amar Nath, Singhal,
S., Singh, N., Gade, N.E. and Saikumar, G. (2012).
Expression and characterization of constitutive
heat shock protein 70.1 (hspa-1a) gene in in-vitro
produced and in-vivo derived buffalo (bubalus
bubalis) embryos. Reprod. Domest. Anim., (DOI:
10.1111/j.1439-0531.2012.02002.x).*
335. Sharma, M., Kumar, R., Dubey, P.K., Verma, O.P.,
Amar Nath, Saikumar, G. and Sharma, G.T. (2012).
Expression and quantification of Oct-4 gene in
blastocyst and embryonic stem cells derived from
in vitro produced buffalo embryos. In Vitro Cell.
Develop. Biol. Anim., 48: 229-235.*
336. Singh, G., Hooda, O.K., Mahapatra, R.K., Meur,
S.K. and Varshney, V.P. (2011). Heat stress in
buffalo calves: Effect of humidity on physiological
and biochemical responses. Indian Vet. J., 87:
924- 925.
337. Verma, O.P., Kumar, R., Amar Nath, Sharma, M.,
Dubey, P.K, Saikumar, G and Sharma, G.T. (2012).
In vivo differentiation potential of buffalo
embryonic stem cell (Bubalus bubalis). In Vitro
Cell. Develop. Biol. Anim. (DOI: 10.1007/s11626-
012-9515-y).*
338. Vikash Chandra, Saikumar, G. and Sharma, G.T.
(2011). Temporal expression pattern of Insulin-
like growth factors (IGF-I and IGF-2) ligands and
their receptors (IGF-1R and IGF-2R) in buffalo
(Bubalus bubalis) embryos produced in vitro.
Livestock Sci., 135: 225_230.*
DIVISION OF BIOCHEMISTRY
339. Khangembam Victoria Chanu, M. and Kumar, A.
(2011). Buffalo hepcidin: characterization of cDNA
and study of antimicrobial property. Vet. Res.
Com., 35: 79-87.*
340. Khangembam Victoria Chanu, M., Kumar, A. and
Kumar, S. (2011). Structure activity relationship of
buffalo antibacterial hepcidin analogs. Indian J.
Biochem. Biophys., 48: 325-330.
341. Khangembam Victoria Chanu, M., Ayub Ali and
Kataria, M. (2012). Antioxidant activities of two
medicinal vegetables: Parkia javanica and
Phlogacanthus thyrsiflorus. Int. J. Pharmacy
Pharmaceutical Sci., 4: 102-106.*
342. Goswami, R., Singh, S.M., Kataria, M. and
Somvanshi, R. (2011). Clinicopathological studies
on spontaneous hymenolepis diminuta infection
in wild and laboratory rats. Braz. J. Vet. Pathol., 4:
103-111.*
343. Sadeesh, E.M., John, J.M. and Kataria, M. (2012).
Elucidation of estradiol and progesterone
hormonal profiles in goat ovarian cyst. Int. J.
Livestock Res., 2: 192-196.*
344. Sunil Kumar, B.V., Kumar, A. and Kataria, M.
(2011). Effect of heat stress in tropical livestock
and different strategies for its amelioration. J.
Stress Physiol. Biochem., 7: 45-54.
133
345. Sunil Kumar, B.V., Singh, G., Kumar, A., Kataria,
M. and Meur, S.K. (2011). Modulation of heat stress
in buffaloes by supplementing electrolytes,
ascorbate and zinc. Indian J. Vet. Res., 20: 1-8.
346. Sunil Kumar, B.V., Kataria, M. and Meur, S.K.
(2011). Detection of protein bound volatile
compounds in buffalo urine. J. Adv. Vet. Res., 1:
21-23.*
347. Sunil Kumar, B.V., Kataria, M., Ravi Kumar,
G.V.P.P.S., Aswani Kumar, K. and Vishwanatha
Reddy, A.P. (2011). Partial sequence clone of
canine mammary tumor metalloproteases MMP-
11 catalytic domain. Online J. Vet. Res., 12: 66-
73.*
348. Vishwanath Reddy, A.P., Sunil Kumar, B.V.,
Rangnath, G.J., Aswani Kumar, K., Maiti, S.K. and
Kataria, M. (2011). Isolation, purification and
identification of matrilysin protein from canine
mammary tumors and its quantification by indirect
ELISA. Indian J. Vet. Path., 35: 8-12.
349. Yadav, B.S, Kumar, A., Khan, Md F., Barate, A.,
Kumar, A. and Sharma, B. (2012). Molecular
modeling and docking characterization of Dectin-
1 (PAMP) receptor of Bubalus bubalis. Exp. Mol.
Pathol., 92: 7-12.*
DIVISION OF EXTENSION EDUCATION/JOINT
DIRECTORATE OF EXTENSION EDUCATION
350. Buraman, C. D., Singh, B.P. and Tiwari, R. (2010).
Socio-cultural traditions and source of information
used by Yak pastoralist of Eastern Himalayan
Regin in India. J. Comm. Mobil. Sust. Develop., 5:
7-12.
351. Chander, M.B., Subrahmanyeswari, Reena
Mukherjee and Kumar, S. (2011). Organic
livestock production: an emerging opportunity with
new challenges to producers in tropical countries.
Rev. Sci. Tech. Off. Int. Epiz, 30: 969-983*.
352. Dwivedi, P.K., Singh, B.P., Kumar, V. and Waila
Taruna (2011). Socio-economic profile of animal
traders and their constraints in following animal
welfare practices. Indian J. Soc. Res., 52: 449-
454.
353. Kumar, V., Singh, B.P. and Kumar, R. (2011).
Welfare practices in calf rearing: A comparative
study in Madhubani district of Bihar. Indian J. Field
Vet., 7: 29-31.
354. Meena, H.R., Ram, H. and Seth, P. (2012).
Livestock diseases in sub-Himalayan temperate
region- a Garrett's ranking analysis. Int. J. Livestock
Res (online), 2: 160-172.
355. Meena, M.S., Singh, K.M., Meena, H.R., Kanwat,
M. (2012). Attitude: a determinant of agricultural
graduates' participation in videoconferencing
technology. J. Agri. Sci., 4: 136-142.*
356. Rajak, S.K., Tiwari, R. and Sharma, M.C. (2010).
Livestock information coverage through 'Kheti
Kisani" and 'Kisan Vaani' programme broadcast
by All India Radio, Bareilly. J. Comm. Mobil. Sust.
Develop., 5: 34-37.
357. Ramesh, D., Meena, H.R. and Meena, K.L.
(2012). The small ruminant market system in India:
A study in different agro-climatic zones. Vet. World,
5: 288-293.
358. Ravikumar, R.K. and Mahesh Chander (2011).
Livestock extension education activities of the
State Departments of Animal Husbandry (SDAH)
in India: A case of Tamil Nadu state. Indian J.Anim.
Sci., 81: 757-762.
359. Sahai, A., Tiwari, R., Sharma, M.C. and Roy, R.
(2011). A study on technical facilities in municipal
slaughter house and retail meat shops in Bareilly.
J. Meat Sci., 7: 46-49.
360. Sahai, A., Tiwari, R., Sharma, M.C. and Roy, R.
(2011). Awareness and training needs in hygienic
meat production among butchers and meat
retailers. Livestock Int., 15: 10-11.
361. Senthilkumar, S. and Mahesh Chander. (2011).
Perceived information needs of dairy farmers in
accessing ict-enabled village information centres.
J. Dairy. Foods Home Sci., 30: 239-241.
362. Singh, B.P., Tiwari, R. and Sharma, M.C. (2010).
Extension strategy for improving buffalo
production system: A case of Rohilkhand region
of Uttar Pradesh. J. Comm. Mobil. Sust. Develop.,
5: 7-12.
363. Singh, R.R., Triveni Dutt, Singh, M. and Kumar, A.
(2010). Association of udder and teat dimensions
with production traits in Vrindavani cattle. Indian
J. Dairy Sci., 63: 455-458.
364. Subrahmanyeswari, B. and Mahesh Chander
(2011).Organic agriculture: a way forward to
achieve gender equality in India. J. Organic
Systems, 6: 13-19.*
365. Tiwari, R., Sharma, M.C. and Singh, B.P. (2011).
Health and management practices in commercial
dairy farms. Indian J.Vet. Med., 31: 34-35.
KRISHI VIGYAN KENDRA
366. Das, S.K. and Tripathi, H. (2011). Social change
in Gangetic delta of India: a participatory rural
appraisal. Int. J. Bioresource Stress Management,
9: 175-178.*
367. Kumar, R. and Tripathi, H. (2011). Profitability of
cross breeding interventions on income and
employment generation among the dairy farmers.
Indian Res. J. Ext. Edu., 11: 32-38.
368. Kumar, R. and Tripathi, H. (2011). Sustainability
of crossbreeding practice perceived by the dairy
farmers in mid western plain zone of Uttar Pradesh.
J. Appl. Anim. Res., 39: 257-260.*
369. Tripathi, H. and Rakesh Pandey (2011). Impact of
drudgery reducing technology of rural women
engaged in milking of drudgery reducing
technology of rural women engaged in milking of
animals. J. Dairy. Food Home Sci., 30: 174-177.
DIVISION OF LIVESTOCK ECONOMICS,
STATISTICS AND INFORMATION TECHNOLOGY
370. Biswal, A. and Kumar, S. (2011). Economics of
livestock marketing in Orrisa. Int. J. Market.
Management Res., 2: 165-174.
371. Biswal, A. and Kumar, S. (2011). Factors affecting
market price of cattle and buffalo in Odisha. Indian
J. Anim. Sci., 81: 1189-1190.
134
372. Kumar, S. and Singh, Y.P. (2011). Entrepreneurial
behavior of dairy farmers - A case study from
Bareilly district of UP. Indian J. Field Vet., 2: 37-
41.
373. Kumar, S., Mirajkar, P., Singh, Y.P. and Singh, R.
(2011). Analysis of willingness to pay for veterinary
services of the livestock owners of Sangli District
of Maharashtra. Agr. Econ. Res. Rev., 24: 149-
153.
374. Mirajkar, P., Kumar, S. and Singh, Y.P. (2011).
Preference of service providers for the veterinary
service- A case study of Sangli District,
Maharashtra. Vet. World, 4: 106-108.
375. Singh, B. (2011). Probability of misclassification
for multiple groups sample linear discriminant
function. J. Indian Soc. Agri. Stat., 65: 317-322.
376. Verma, M.R., Mandal, S. and Tripathi A.K. (2011).
Dynamics of milch bovine population in
Meghalaya. Indian J. Anim. Sci., 81: 521-524.
I.V.R.I., PALAMPUR
377. Dev, K., Gautam, S.K., Giri, S.K., Kumar, A., Yadav,
A., Verma, V., Kumar, P. and Singh, B. (2012).
Isolation, culturing and characterization of feeder-
independent amniotic fluid stem cells in buffalo
(Bubalus bubalis). Res. Vet. Sci., (doi:10.1016/
j.rvsc.2011.09.007).*
378. Kannan, A., Garg, M.R. and Mahesh Kumar, B.V.
(2011). Effect of ration balancing on milk
production, microbial protein synthesis and
methane emission in crossbred cows under field
conditions in Chittoor district of Andhra Pradesh.
Indian J. Anim. Nutr., 28:117-123.
379. Karabasanavar, N.S., Singh, S.P., Umapathi, V.,
Girish, P.S., Shebannavar, S.N. and Kumar, D.
(2011). Authentication of carabeef (water buffalo,
Bubalus bubalis) using highly specific polymerase
chain reaction. Eur. Food Res. Technol., 233: 985-
989.*
380. Kumar, A. and Umapathi, V. (2011) Sequence
analysis of a part of hypervariable region of VP2
gene of chicken embryo fibroblast adapted
infectious bursal disease virus isolates of
Uttarakhand. Biotechnol. Bioinf. Bioeng., 1: 109-
118.*
381. Kumar, M., Verma, V., Nagpal, R., Kumar, A.,
Behare, P.V., Singh, B., Aggarwal, P.K. (2011).
Anticarcinogenic effect of probiotic fermented milk
and chlorophyllin on aflatoxin-B1-induced liver
carcinogenesis in rats. Brit. J. Nutr., (doi:10.1017/
S0007114511003953).*
382. Nagappa, S., Karabasanavar, S.P., Singh, V.,
Umapathi, Deepak Kumar and Shebannavar, S.N.
(2011). Identification of goat meat using highly
species-specific polymerase chain reaction. J.
Food Quality, 34: 142-149.*
383. Nagappa, S., Karabasanavar, S.P., Singh, V.,
Umapathi, Kumar, D., Patil, G. and Shebannavar,
S.N. (2011). A highly specific PCR assay for
identification of raw and heat treated mutton (Ovis
aries). Small Rum. Res., 100: 153-158.*
384. Prasanna, S.B., Chhabra, A.K., Bhar, R., Reddy,
G.B., Manjunatha, Rajeshwari, Y.B. and Patel, M.
(2011). Influence of kitchen wastes and poultry
offals feeding on water intake in Landrace
crossbred pigs. Indian Vet. J., 88: 68-69.
385. Sharma, O.P., Kumar, N., Singh, B. and Bhat, T.K.
(2012). An improved method for thin layer
chromatographic analysis of saponins. Food
Chem., 132: 671-674.*
386. Singh, A., Bhat, T.K. and Sharma, O.P. (2011).
Clinical biochemistry of hepatotoxicity. J. Clin.
Toxicol., S4:0012. doi: 10.4172/2161-0495-S4-
001.
387. Singh, B., Bhat, T.K., Sharma, O.P., Kanwar, S.S.,
Rahi, P. and Gulati, A. (2011). Isolation of tannase-
producing Enterobacter ludwigii GRT-1 from the
rumen of migratory goats. Small Rum. Res.,
(doi:10.1016/j.smallrumres. 2011.06.013).*
388. Sourabh, A., Kanwar, S.S. and Sharma, O.P.
(2011). Screening of indigenous yeast isolates
obtained from traditional fermented foods of
Western Himalayas for probiotic attributes. J. Yeast
Fungal Res., 2: 117-126.*
389. Verma, V., Gautam, S.K., Singh, B., Kumar, M. and
Chauhan, M.S. (2011). Development of water
buffalo (Bubalus bubalis) embryos after
parthenogenetic activation of oocytes with calcium
ionophore, ethanol and 6-dimethylaminopurine.
Indian J. Anim. Sci., 81: 24-27.
DIVISION OF LIVESTOCK PRODUCTS
TECHNOLOGY
390. Gokulakrishnan, P., Kumar, R.R., Sharma, B.D.,
and Sharma, D. (2012). A duplex PCR assay for
sex determination of meat from cattle, buffalo,
sheep and goat by amplification of the male
specific SRY gene. Indian J. Anim. Sci., 82: 423-
426.
391. Gokulakrishnan, P., Kumar, R.R., Sharma, B.D.,
Mendiratta, S.K. and Sharma, D. (2012). A duplex
PCR assay for sex determination of cattle meat by
simultaneous amplification of SRY, AMEX and
AMELY genes. Food Biotechnol., 26: 75-84.*
392. Gurikar, A.M., Lakshmanan, V., Gadekar, Y.P.,
Sharma, B.D. and Anjaneyulu, A.S.R. (2012).
Effect of meat chunk size, massaging time and
cooking time on quality of restructured pork blocks.
J. Food Sci. Technol., (DOI 10.1007/s13197-012-
0644-9).
393. Kandeepan, G., Anjaneyulu, A.S.R., Kondaiah, N.
and Mendiratta, S.K. (2011). Evaluation of
changes in quality attributes of processed buffalo
meat keema at ambient storage. Fleischwirtschaft
Int., 26: 79-84.*
394. Kandeepan,G., Anjaneyulu, A.S.R., Kondaiah, N.,
Mendiratta, S.K. and Rajkumar, R.S. (2011).
Evaluation of quality and shelf life of buffalo meat
keema at refrigerated storage. J. Food Sci.
Technol., (DOI: 10.1007/s13197-011-0454-5).*
395. Kumar, P., Sharma, B.D. and Kumar, R.R. (2010).
Storage stability of analogue meat nuggets under
135
refrigeration (4 10C). J. Vet. Public Health, 8: 117-
120.
396. Malav, O.P., Sharma, B.D., Gokulakrishnan, P.,
Talukder, S. and Kumar, R.R. (2012). Quality
characteristics of functional restructured chicken
meat blocks extended with sorghum flour. Indian
Vet. J., 89: 49-51.
397. Malik, A.H. and Sharma, B.D. (2011). Shelf life
study of hurdle treated ready-to-eat spiced buffalo
meat product stored at 300C for 7 weeks under
vacuum and aerobic packaging. J. Food Sci.
Technol., ( DOI: 10.1007/s3197-011-0592-9).
398. Malik, A.H. and Sharma, B.D. (2011). Use of
hurdle techniques to maintain the quality of
vacuum packed buffalo meat during ambient
storage temperatures. Afr. J. Food Sci., 5: 626-
636.*
399. Mane, B.G., Mendiratta, S.K., Tiwari, A.K and
Bhilegaokar, K.N. (2012). Detection of adulteration
of meat and meat products with buffalo meat
employing polymerase chain reaction assay.
Food Anal. Methods, 5: 296-300.*
400. Mane, B.G., Mendirattra, S.K., Tiwari, A.K., Sharma,
B.D., Bhilegaonkar, K.N. and Anjaneyulu, A.S.R.
(2011). Detection of pork in admixed meat and
meat products by species-specific PCR technique.
Indian J. Anim. Sci., 81:1178-1181.
401. Mehta, N., Sharma, B.D. and Kumar P. (2011).
Standardization of the level of sunflower oil in the
development of the low fat chicken meat patties.
J. Anim. Res., 1: 15-20.
402. Mendiretta, S.K, Sharma, B.D., Majhi, M. and
Kumar, R.R. (2012). Effect of post-mortem
handling conditions on the quality of spent hen
meat curry. J. Food Sci. Technol., 49: 246-251.
NATIONAL LIBRARY OF VETERINARY SCIENCES
403. Kandpal, K.N., Khan, F. Md. and Rawat, S.S.
(2010). Resource BIT: A bioinformation library
catalog database for agricultural scientist. Indian
J. Agri. Lib. Inform. Services, 26: 58-63.
404. Khan, M.F., Chauhan, G. and Jaitly, A.K. (2011).
An approach to overcome imbalance dataset of
eukaryotic genome during the analysis by machine
learning technique. Indian J. Sci. Technol., 4: 520-
524.
405. Kandpal, K.N., Khan, M.F. and Rawat, S.S. (2011).
Resourse BIT: Bioinformation catalog database
for biological scientific community. Indian J. Lib.
Inform. Sci., 24: 582-585.
*Published in foreign journals
136
Sl. Project Code Title of the project Name of the PI/ Year
No. Associate(s) Start Completion
BACTERIOLOGY & MYCOLOGY DIVISION
1. IVRI/B&M/08-12/001 Construction of an aroA gene P. Chaudhuri (PI) June May
knock-out mutant of Pasteurella V.P. Singh 2008 2012
multocida and evaluation of its D.K. Sinha
virulence and antigenic potential
2. IVRI/B&M/09-12/002 Development of combined vaccine R. Rana (PI) June May
for caprine pneumonia using V.P. Singh 2009 2012
Mycoplasma mycoides subsp. S.K. Gupta
capri and Pasteurella multocida
serotype A
3. IVRI/B&M/09-12/003 Studies on the diagnostic Sabarinath T. (PI) June May
potential of recombinant Lig B (up to Sept, 2011) 2009 2012
protein of Leptospira interrogans P. Chaudhury (PI)
serovar pomona (w.e.f. Sept. 2011)
K.N. Viswas (w.e.f.
Sept. 2011)
BIOLOGICAL PRODUCTS DIVISION
4. IVRI/BP/09-12/001 Development of recombinant R. Saravanan (PI) May April
antigen based diagnostic test to C.Madhan Mohan 2009 2012
detect Egg Drop Syndrome 76 Sohini Dey
antibodies in chicken (Institute) P.C.Verma
5. IVRI/BP/11-13/002 Production of RBPT antigen for P. Das (PI) Dec. Dec.
serodiagnosis of Glanders Chandan Prakash 2011 2013
CADRAD/EPIDEMIOLOGY
6. IVRI/CADRAD/11-14/ Etio-pathology of aborted foetus and K.P. Singh (PI) June May
001 placenta in dairy animals R. Singh 2011 2014
Vishal Chander
B.R. Singh
S. Mehrotra
7. IVRI/CADRAD/11-14/ Conventional and DNA based B.R. Singh (PI) August July
002 diagnostic tests for selected bacterial Rishendra Verma 2011 2014
pathogens of animals R. Rathore
Chandan Prakash
MEDICINE DIVISION
8. IVRI/MED/09-13/001 Development of biodynamic R. Mukherjee (PI) June July
therapeutic regime against bovine K.N.Bhilegaonkar 2009 2013
sub-clinical mastitis T. Uttam Singh
V.K. Gupta
9. IVRI/MED/09-12/002 Development of diagnostic D.B. Mondal (PI) June June
markers and catalytic therapy for K. Mahendran 2009 2012
management of hepatobiliary M. Kataria
dysfunctions M. Sahoo
10. IVRI/MED/09-12/003 Development of herbo mineral P. Kumar (PI) June June
formulation for amelioration of lead S. Dey 2009 2012
toxicity M. Saini
D. Kumar
11. IVRI/MED/10-13/004 Comparative evaluation of imaging K. Mahendran (PI) July June
techniques, electrocardiographic S. Dey 2010 2013
changes and blood biochemical D.B. Mondal
findings to evolve diagnostic markers A.C. Saxena
for cardiopulmonary and urogenital K.K. Mishra
disorders in canines
9. LIST OF RESEARCH PROJECTS
137
12. IVRI/MED/11-13/005 Development of alternative therapy V.K. Gupta (PI) Aug July
for calf diarrhoea K.L. Khurana 2011 2013
R.S. Rathore
VETERINARY POLYCLINIC
13. IVRI/RVP/09-12/001 Evaluation of cytological techniques N.P. Kurade (PI) July June
for rapid diagnosis of pet animal S. Dey 2009 2012
diseases A.K. Sharma
A.M. Pawde
S.K. Maiti
14. IVRI/RVP/10-13/002 Studies on incidence of helminthic K.L. Khurana (PI) July June
infection in canines brought for S. Dey 2010 2013
treatment to referral veterinary N.P. Kurade
polyclinic and development of V. K. Gupta
immunodiagnostics to identify sub- R. Garg
clinical parasitic infections in field K. Mahendran
cases
PARASITOLOGY DIVISION
15. IVRI/PARA/11-13/002 Development of suitable diagnostic Hira Ram (PI) Aug. July
test(s) for early detection of immature R. Garg 2011 2013
paramphistomasis in ruminants
16. IVRI/PARA/11-12/003 Development of immunodiagnostic B.C. Sarvanan (PI) Sept. Aug.
test(s) for some important helminthic A.K. Tewari 2011 2012
infections S.C. Gupta
IVRI/PARA/11-12/003A Sub Project 1: Development of O.K. Raina (PI)
recombinant antigen based Hira Ram
diagnostic test for detection of
Taenia solium cysticercosis in pigs
IVRI/PARA/11-12/003B Sub Project 2: Development of R. Garg (PI) Sept. Aug.
immunodiagnostic test(s) for visceral Hira Ram 2011 2012
schistosomosis in ruminants O.K. Raina
D.C. Sonal
PATHOLOGY DIVISION
17. IVRI/PATH/08-11/001 Diagnosis of infectious bronchitis S.D. Singh (PI) June Sept.
virus (IBV) infection in poultry using K. Dhama 2008 2011
molecular biological techniques A.K. Tewari
18. IVRI/PATH/09-12/002 T-2 mycotoxicosis in animals: A.K. Sharma (PI) June May
pathology, pathogenesis, diagnosis A.G.Telang 2009 2012
and ameliorative measures S. Dandapat
19. IVRI/PATH/11-14/003 Streptococcus suis infections in pig: M. Sahoo (PI) Aug. July
prevalance, pathology and molecular V.K. Chaturvedi 2011 2014
diagnosis R. Rana
S. Sahoo
U.K. De
CENTRE FOR WILDLIFE
20. IVRI/CWL/09-12/001 Influence of duration and level of A. Das (PI) April March
feeding on feed consumption, M. Saini 2009 2012
nutrient utilization, serum metabolite
and mineral status in semi-captive
Asiatic elephant (Elaphus maximus)
PHARMACOLOGY & TOXICOLOGY DIVISION
21. IVRI/P&T/08-12/001 Efficacy studies of some promising Dinesh Kumar (PI) June March
essential oil preparations in S.K. Tandan 2008 2012
experimental and clinical A. Prasad
haemonchosis and fasciolosis S.C. Gupta
U. Dimri
22. IVRI/P&T/09-12/002 Pharmacodynamic investigations of S.K. Tandan (PI) June May
Entada pursaetha and its therapeutic Dinesh Kumar 2009 2012
potential Dhirendra Kumar
138
23. IVRI/P&T/09-12/003 Evaluation of toxic influence of S.N. Sarkar (PI) Dec May
arsenic on the pharmacodynamics S.K. Tandan 2009 2012
of nonsteroidal anti-inflammatory A.K. Tiwari (Biotech)
drugs M. Sankar
24. IVRI/P&T/11-12/004 Evaluation of therapeutic potential of P. Sankar (PI) Aug. July
polymeric nanoparticle-encapsulated R. Mukherjee 2011 2012
curcumin for management of S. Srivastava
subclincal mastitis P. Singh
A.G. Telang
S.N. Sarkar
25. IVRI/P&T/11-14/005 Assessment of cardioprotective T.U. Singh (PI) Sept. August
effect of herbal preparations S.K. Mishra 2011 2014
U. Dimri
M. Hoque
S. Parida
STANDARDIZATION DIVISION
26. IVRI/STAND/10-12/001 Detection of extraneous agents in V. Upamanyu (PI) July June
viral vaccines by nucleic acid R. Verma 2010 2012
amplification techniques S. Srivastava
SURGERY DIVISION
27. IVRI/SURG/09-12/001 Studies on halothane and isoflurane P. Kinjavdekar (PI) June May
inhalation anaesthesia in large H.P. Aithal 2009 2012
ruminants Amarpal
28. IVRI/SURG/09-12/002 Clinical evaluation of herbal and A.M. Pawde (PI) July March
homeopathic agents for augmenta- R. Pathak 2009 2012
tion of wound healing in domestic Dinesh Kumar
animals A. Gopinathan
29. IVRI/SURG/09-12/003 A new therapeutic approach to S.K. Maiti (PI) June May
canine mammary tumours M. Kataria 2009 2012
N. Kumar
A.K. Sharma (Path.)
A.K. Sharma (Surg.)
30. IVRI/SURG/09-12/004 Studies on cardiac structural and M. Hoque (PI) June May
functional assessment in dogs with S. Dey 2009 2012
special reference to cardiac imaging M.C. Sharma
31. IVRI/SURG/09-12/005 Development and evaluation of H.P. Aithal (PI) June May
interlocking nails and locking plates M.M.S. Zama 2009 2012
for internal fixation of fractures in P. Kinjavdekar
large animals A.M. Pawde
32. IVRI/SURG/09-12/006 Development of bioengineered A.K. Sharma (PI) July June
collagen matrices for reconstructive R.B. Rai 2009 2012
surgery S. Srivastava
S.K. Maiti
N. Kumar
33. IVRI/SURG/09-12/007 Development of physical therapy M.M.S. Zama (PI) June May
and rehabilitation protocol in M. Hoque 2009 2012
veterinary patients P. Singh
U. Dimri
34. IVRI/SURG/10-12/008 Isolation, culture, characterization Amarpal (PI) July June
and evaluation of bone marrow M.M.S. Zama 2010 2012
derived mesenchymal stem cells for P. Kinjavdekar
the healing of skin and cartilage H.P. Aithal
defects A.M. Pawde
R. Pathak
G. Taru Sharma
G. Sai Kumar
139
35. IVRI/SURG/11-14/009 Development of bioengineered R. Pathak (PI) July June
composite scaffolds for bone repair Amarpal 2011 2014
using fetal cells
VETERINARY PUBLIC HEALTH DIVISION
36. IVRI/VPH/10-13/001 Detection of Coxiella burnetii in S.V.S. Malik (PI) July June
foods of animal origin and high risk A. Kumar 2010 2013
groups of man and animals by R.S. Rathore
different diagnostic tests R. Singh
S. Shrivastava
D. Rawool
VIROLOGY DIVISION
37. IVRI/VIROL/07-12/001 Production of monoclonal antibody A.B. Pandey (PI) June May
against bovine herpes virus 1 and P.N. Gandhale 2007 2012
development of ELISA
38. IVRI/VIROL/09-12/002 Studies on atypical and mixed K.K. Rajak (PI) Nov. Oct.
infections of PPR infected small S.B. Sudhakar 2009 2012
ruminants S.K. Biswas
B. Mondal
V. Bhanuprakash
39. IVRI/VIROL/09-12/003 Prevalence, characterization and (1) Y.P.S. Malik (PI) Oct. Sept.
development of indigenous S. Chakarvati 2009 2012
diagnostics for animal rotaviruses A. Sen
P.N. Gandhale
G. Venkatesan
IVRI/VIROL/09-12/ Sub projects: (1) Detection and (2) K.N. Bhilegaonkar (PI)
003A molecular characterization of animal R.K. Agarwal
rotaviruses and development of M.A. Ramakrishna
diagnostic kit/reagents S.B. Shivachandra
IVRI/VIROL/09-12/ (2) Prevalence and characterization
003B of animal rotaviruses
TEMPERATE ANIMAL HUSBANDRY
40. IVRI/TAH/09-12/001 Hypoxia Inducible Factor-1 (HIF-1) Vikas Chandra (PI) Oct. Sept.
as marker for adaptation at high A.K. Sharma 2009 2012
altitude Hira Ram
41. IVRI/TAH/10-13/002 Evaluation of dietry spplementation B. Sahoo (PI) Sept. Aug.
of macro minerals with tannin A.K. Sharma 2010 2013
containing tree leaves on reproduc- A.K. Garg
tive performance of crossbred P. Thirumuragan
heifers in temperate sub-Himalayas Vikash Chandra
42. IVRI/TAH/11-14/003 Evaluation of feeding methods P. Thirumuragan (PI) Sept. Aug.
and supplementation of bovine B. Sahoo 2011 2014
colostrum on performances of K. Narayanan
calves
43. IVRI/PARA/08-12/001 Development of molecular tool/ M. Sankar (PI) Oct. March
kit for detection and monitoring of B.C. Saravanan 2008 2012
benzimidazole resistance in common B.P. Singh
gastrointestinal nematodes of small A. Prasad
ruminants S.C. Gupta
VETERINARY BIOTECHNOLOGY DIVISION
44. IVRI/BIOTECH/09-12/ Development of multigene constructs P.P. Goswami (PI) June March
001 expressing proteins of M. a. R. Rathore 2009 2012
paratuberculosis for development S. Chakravarti
45. IVRI/BIOTECH/10-13/ Development of DIVA based vaccine P.K. Gupta (PI) April March
002 and diagnostic against infectious A. Kumar 2010 2013
bovine rhinotracheitis (IBR) A.B. Pandey
in cattle
140
46. IVRI/BIOTECH/10-13/ Development of monoclonal G.V.P.P.S. June May
003 antibodies against newcastle Ravi Kumar (PI) 2010 2013
disease virus A.K.Tiwari
D. Kumar
A.P. Sahoo
A. Kumar
47. IVRI/BIOTECH/11-12/ Generation of Newcastle disease C. Madan Mohan (PI) Aug. July
004 virus vector using reverse genetics 2011 2012
technology
48. IVRI/BIOTECH/11-14/ Nanobiotechnology for diagnostic
005 and vaccine in poultry
IVRI/BIOTECH/11-14/ Sub project 1: Development of Deepak Kumar (PI) Sept. Aug.
005A nanoparticule based diagnostic test K. Dhama 2011 2014
for avian reovirus infection A. Kumar
IVRI/BIOTECH/11-14/ Sub project 2: Development of S. Dandapat (PI) Sept. Aug.
005B polymeric nanoparticle delivery B.P. Mishra 2011 2014
system for mucosal immunization S. Nandi
with NDV antigens in chickens Sonal
IMMUNOLOGY SECTION
49. IVRI/VIM/10-12/001 Field testing of TfAg in detection of Alka Tomar (PI) July June
avian leukosis virus infections of V.K. Saxena (CARI) 2010 2012
chickens B. Singh
50. IVRI/VIM/10-12/002 Immunomodulatory role of endotoxin T.K. Goswami (PI) July June
in host immune response during M. K. Singh 2010 2012
health and sepsis R. Singh
Abhisek
HSADL, BHOPAL
51. IVRI/HSADL/09-12/001 Micro RNA profiling of lung A. Mishra (PI) June May
tissues of chicken infected with avian S. Bhatia 2009 2012
influenza virus S. Nagarajan
52. IVRI/HSADL/11-12/002 Genetic and antigenic characteriza- C. Tosh (PI) Sept. Aug.
tion of avian influenza viruses S. Nagarajan 2011 2012
isolated in India
53. IVRI/HSADL/11-13/003 Development and evaluation of S. Nagarajan (PI) Sept. Aug.
referral group specific diagnostic K. Rajukumar 2011 2013
reagents for avian influenza R. Sood
M. Kumar
54. IVRI/HSADL/11-12/004 Development of Real Time PCR for A.A. Raut (PI) Sept . Aug.
diagnosis of Crimean Congo D.D. Kulkarni 2011 2012
Haemorrhagic Fever K. Rajukumar
D. Senthil Kumar
ANIMAL GENETICS DIVISION
55. IVRI/AG/08-12/001 Exploration of DNA markers for B. Bhushan (PI) June May
resistance/susceptibility to mastistis T. Dutt 2008 2012
in crossbred cattle P. Kumar
A.K.S. Tomar
R. Mukherjee
A. Sonawane
56. IVRI/AG/08-12/002 Identification of miRNAs expressed B. Bhushan (PI) Oct. Sept.
in bubaline mammary tissue A. Sharma 2008 2012
P. Kumar
C. Madan Mohan
S. De
A. Sonwane
57. IVRI/AG/08-12/003 Development of adenoviral vector A. Sonwane (PI) Sept. Aug.
mediated gene therapy for mastitis B. Bhushan 2008 2012
in cattle R. Mukherjee
A.K.S. Tomar
A. Chauhan
141
58. IVRI/AG/09-12/004 Recycling of animal and farm waste R.V. Singh (PI) & March Feb.
and application of their value Collobrators from 2009 2012
added products in sustainable crops IVRI, IARI, CARI,
production and animal husbandry IIT-Roorkee
59. IVRI/AG/09-12/005 Allele mining for IGFBPs family A. Kumar (PI) June May
and Leptin gene affecting body P. Kumar 2009 2012
weight of rabbit B. Shivmani
(w.e.f. Sept 2011)
60. IVRI/AG/09-12/006 Analysis of DNA-Protein interactions A. Chauhan (PI) June May
involved in regulation of genes (up to Aug 2011) 2009 2012
governing immune response in cattle M. Panigrahi (PI)
(w.e.f. Sept 2011)
P. Kumar
A. Sonwane
61. IVRI/AG/11-12/007 SNP mining, expression profiling P. Kumar (PI) Oct. Sept.
and association studies of genes A. Chauhan 2011 2012
governing heat tolerance in cattle A. Kumar
G. Singh
62. IVRI/AG/11-14/008 Identification of allelles in FCGRT B. Sivamani (PI) Oct. Sept.
and 2M genes and their association S. Kumar 2011 2014
with passive transfer of immunity in A. Kumar
neonatal buffalo calves
LIVESTOCK PRODUCTION AND MANAGEMENT SECTION
63. IVRI/LPM/06-12/001 Multiplication and evaluation of T. Dutt (PI) April Long-term
synthetic crossbred cattle strain - H.C. Joshi 2006
Vrindavani S. Mehrotra
A.K.S. Tomar
S.K. Ghosh
M. Singh
V.B. Chaturvedi
T.A. Khan
B. Bhushan
64. IVRI/LPM/06-12/002 Establishment of pure Landrace S.K. Mondal (PI) July June
nucleus herd in swine production B.C. Das (up to 2006 2012
farm Dec. 2011)
S.K. Ghosh
65. IVRI/LPM/10-13/003 Genetic improvement, conservation A.K.S. Tomar (PI) August July
and multiplication of Tharparkar S. Mehrotra 2010 2013
native cattle V.B. Chaturvedi
T.A. Khan
H.O. Pandey
M. Singh
B.H.M. Patel
S.K. Singh
S. Mendiratta
U.K. De
V.K. Gupta
S.K. Ghosh
O. Singh
U. Shankar
B. Bhushan
66. IVRI/LPM/10-13/004 Development of package of practices H.O. Pandey (PI) July June
for weaning of Murrah buffalo calves A.K.S. Tomar 2010 2013
T.A. Khan
V.B. Chaturvedi
M. Singh
S. Mehrotra
B.H.M. Patel
S.K. Singh
B. Bhushan
142
67. IVRI/LPM/10-13/005 Characterization and documentation B.H.M. Patel (PI) Aug. July
of Rohilkhandi goats A.K.S. Tomar 2010 2013
T.A. Khan
M. Singh
S.K. Mondal
H.O. Pandey
B. Bhushan
68. IVRI/LPM/10-12/006 Development of mixed farming O. Singh (PI) Aug. July
system modules involving crop and A.K.S. Tomar 2010 2012
livestock for enhancing farm V.B. Chaturvedi
production
69. IVRI/LPM/11-14/007 Effect of liquid vs frozen semen on S. Mehrotra (PI) April March
conception rate in repeat breeder H. Kumar 2011 2014
Vrindavani and Tharparkar cattle S.K. Singh
S.K. Ghosh
J.K. Prasad
70. IVRI/LPM/11-13/008 Level of inbreeding in Vrindavani G. K. Gaur (PI) Aug. July
herd and its impact on growth, B. Bhushan 2011 2013
production and reproduction A.K.S. Tomar
performance T.A. Khan
M. Singh
71. IVRI/LPM/11-14/009 Design and development of M. Singh (PI) Aug. July
cleaning and collection equipments S.S. Tripathi 2011 2014
for livestock farm B.H.M. Patel
72. IVRI/LPM/11-13/010 Development of databased package T.A Khan (PI) Aug. July
for processing of Vrindavani cattle G.K. Gaur 2011 2013
data
ANIMAL REPRODUCTION DIVISION
73. IVRI/AR/07-11/001 Studies on the semen quality and S.K. Ghosh (PI) Nov. Oct.
preservative of indigenous and J.K. Prasad 2007 2011
crossbred bulls S.K. Srivastava
P. Kumar
R.P. Tripathi
74. IVRI/AR/09-12/002 Studies on innate immunity markers H. Kumar (PI) June May
in cattle and buffaloes in relation to S. Nandi 2009 2012
uterine infections S. Mahmood
S. Dandapat
75. IVRI/AR/11-14/003 Strategies to combat repeat breeding S.K.Srivastava (PI) Aug. July
in cattle with reference to antisperm H. Kumar 2011 2014
antibodies S.K. Singh
T.K.Goswami
S. K. Bhure
76. IVRI/AR/11-14/004 Isolation and characterization of J.K. Prasad (PI) Aug. July
heparin binding proteins with special S.K. Ghosh 2011 2014
reference to PDC-109 as fertility A. Kumar
marker in buffalo bulls N. Srivastava
77. IVRI/AR/11-13/005 Augmentation of ovarian function, G.K. Das (PI) Oct . Sept.
estrus response and fertility in S. Mehrotra 2011 2013
delayed pubertal heifers using herbal P. Kumar
plants (Aegle marmelos and Murraya
koenigii) and area specific mineral
mixture
PHYSIOLOGY AND CLIMATOLOGY DIVISION
78. IVRI/P&C/08-12/001 Development of embryonic stem cells S. Bag (PI) July June
from parthenogenetic and IVF B.C. Das 2008 2012
derived embryos and their compari- A. Saxena
son in buffaloes
143
79. IVRI/P&C/10-14/002 Studies on thermal, radiation and P. Kumar (PI) July July
dehydration stresses on physiolo- V.P.Maurya 2010 2014
gical adaptability, production and G. Singh
reproduction of farm animals in N.H. Mohan
changing climate
80. IVRI/P&C/11-14/003 Ex-vivo expansion and characteriza- G. Taru Sharma (PI) Aug. July
tion of mesenchymal stem cells for Amarpal 2011 2014
its therapeutic application G. Sai Kumar
H.P. Aithal
81. IVRI/P&C/11-12/004 Isolation, culture and characteriza- B.C. Das (PI) Sept. Aug.
tion of animal neural stem cells up to Dec. 2011 2011 2012
N.H. Mohan (PI)
w.e.f. Dec. 2011
S. Bag
S.K. Bhure
BIOCHEMISTRY DIVISION
82. IVRI/BIOCHEM/08-11/ Evaluation of recombinant forms of P. Joshi (PI) July Dec.
001 H. contortus excretory/secretory B.P. Singh 2008 2011
antigen(s) as vaccine candidate(s) S.C. Gupta
S. Sahoo
83. IVRI/BIOCHEM/09-12/ Proteome analysis of buffalo sperm S.K. Bhure (PI) July June
002 for pre-sexing of semen B. Sharma 2009 2012
S.K. Ghosh
84. IVRI/BIOCHEM/11-14/ Studies on recombinant matrix M. Kataria (PI) Aug. June
003 mettalloprotease as target antigen S.K. Maiti 2011 2014
for immuno-therapy of cancer S. Dandapat
BEMI SECTION
85. IVRI/BEMI/08-12/001 Bioconjugation and biolabeling of P. Singh (PI) July June
gold, magnetic and quantum dots S. Kumar 2008 2012
nanoparticles for biosensing R.P. Singh
applications in veterinary and
biomedical sciences
ANIMAL NUTRITION DIVISION
86. IVRI/AN/07-12/001 Effect of dietary cadmium and arsenic A. K. Garg (PI) Sept. March
on health and productivity of the R.S. Dass 2007 2012
animals V.K. Chaturvedi
A.K. Sharma
87. IVRI/AN/08-12/002 Utilization of inorganic and organic R.S. Dass (PI) July March
zinc, copper and selenium in A.K. Garg 2008 2012
ruminants and their effect on their V.K. Chaturvedi
health and production S.K. Mendiratta
88. IVRI/AN/08-12/003 Exploration and validation of A.K. Pattanaik (PI) July June
potential synbiotics as functional N. Dutta 2008 2012
foods for nutritional health of dogs A. Kumar
89. IVRI/AN/09-12/004 Development of supplements and N. Dutta (PI) June May
complete rations containing A.K. Pattanaik 2009 2012
leaves based condensed tannins K. Sharma
for improving performance of P.S. Banerjee
ruminants
90. IVRI/AN/09-11/005 Assessment of mahua seed cake P. Singh (PI) July Nov.
(saponin) as functional feed on A.K. Verma 2009 2011
course of fasciolosis and perfor- V.B. Chaturvedi
mance of ruminants. S.C. Gupta
O.K. Raina
91. IVRI/AN/11-12/006 Comparative assessment of nutrient V.B. Chaturvedi (PI) Aug. July
utilization, energy metabolism and P. Singh 2011 2012
rumen microbial profile in crossbred N. Agarwal
cattle and buffaloes
144
92. IVRI/AN/11-12/007 Formulation of compressed P. Singh (PI) Jan. Dec.
complete feed and solid multi- A.K. Verma 2012 2013
nutrient blocks for improving V.B. Chaturvedi
livestock health and productivity O.K. Raina
G.K. Gaur
REGIONAL STATION, PALAMPUR
93. IVRI/PALAM/06-12/001 Isolation and identification of potentialO.P. Sharma (PI) Oct. March
modulators of rumen fermentation in T.K. Bhat 2006 2012
the extracts of locally available plants B. Singh
R. Bhar
A. Kannan
94. IVRI/PALAM/08-12/002 Utilization of regionally available T.K. Bhat (PI) June May
proenthocyanadin-rich tree O.P. Sharma 2008 2012
forages as supplementary feed for R. Bhar
enhanced animal production B. Singh
95. IVRI/PALAM/09-12/003 Molecular epidemiology of verotoxic U.S. Pati (PI) June May
Escherichia coli infection of animals B. Singh 2009 2012
from North West Himalayan region
96. IVRI/PALAM/10-13/004 Bio-prospecting of locally available V. Umapathi (PI) Aug. July
medicinal plants with particular O.P. Sharma 2010 2013
reference to Seabuckthorn T.K. Bhat
(Hippophae) species for biomole-
cules with therapeutic potential
97. IVRI/PALAM/11-13/005 Profiling and documentation of T.K. Bhatt (PI) Oct. Sept.
nutrients and plant secondary A. Kannan 2011 2013
metabolites in common fodders of B. Singh
Himachal Pradesh
JD (EE)/ EXTENSION EDUCATION DIVISION/KVK
98. IVRI/EXTN/09-12/001 Development of participatory educa- B.P. Singh (PI) June May
tional aids for livestock system R. Tiwari 2009 2012
production and Its impact analysis Y.P. Singh
H.R. Meena
99. IVRI/EXTN/11-14/002 Development and application of R. Tiwari (PI) April March
electronic learning and diagnostic M.C. Sharma 2011 2014
module for health management of T. Dutt
dog B.P. Singh
Y.P. Singh
K.K. Mishra
100. IVRI/EXTN/11-14/003 Diffusion and adoption of livestock M. Chander (PI) July June
technologies in different agro- H.R. Meena 2011 2014
climatic zones S. Kumar
T. Dutt
H. Tripathi
P.S. Banerjee
R.S. Rathore
101. IVRI/EXTN/11-12/004 A pilot study on popularization of H.R. Meena (PI) Aug. July
animal science technologies among M. Chander 2011 2012
livestock owners through mobile Y.P. Singh
telephony
LIVESTOCK PRODUCTS TECHNOLOGY DIVISION
102. IVRI/LPT/09-12/001 Meat authentication: An integrated R.R. Kumar (PI) April April
molecular approach (up to Sept. 2011) 2009 2012
S. Talukdar (PI)
(w.e.f. Sept. 2011)
A.K.Tewari
S.K. Mendiratta
D. Sharma, CARI
145
103. IVRI/LPT/10-12/002 Development of novel shelf stable S.K. Mendiratta (PI) July June
products from spent animal's meat B.D. Sharma 2010 2013
G. Chauhan
S. Talukdar
R.R. Kumar
(up to Sept. 2011)
104. IVRI/LPT/10-12/003 Studies on the development of B.D. Sharma (PI) July June
functional restructured meat S. K. Mendiratta 2010 2013
products R.R. Kumar
(up to Sept. 2011)
S. Talukdar
105. IVRI/LPT/11-13/004 Monitoring meat safety in supply D.G. Kandeepan (PI) July June
chain R.K. Agarwal 2011 2013
B.D. Sharma
S.K. Mendiratta
LIVESTOCK ECONOMICS, STATISTICS AND INFORMATION TECHNOLOGY DIVISION/ARIS
106. IVRI/LES/11-14/001 Estimation of economic losses due B. Singh (PI) Sept. Aug.
to important diseases in livestock in K.P. Singh 2011 2014
India R. Singh
P. Kumar
S. Prasad
D.K. Sinha
M.R. Verma
ERS, KOLKATA
107. IVRI/ERSK/08-12/001 Bacteriocidal effect of 2-nitropropanol S.C. Das (PI) June March
against selective food-borne bacterial 2008 2012
pathogens
108. IVRI/ERSK/08-11/002 Development of recombinant somatic S. Bandyopadhyay (PI) Dec. Dec.
antigen based diagnostic kit for sero- D. Bhattacharya 2008 2011
monitoring of Oesphagostomum A.K. Bera
and Bunostomum parasitic infection
in ruminants
109. IVRI/ERSK/09-12/003 Establishment of elite flock of Black S.K. Naskar (PI) Aug. March
Bengal goat to study the various S. Bandyopadhyay 2009 2012
aspect of germplasm processing, U.K. Bandopadhyay
preservation and its propagation D. Bhattacharya
A.K. Samanta
(WBUA&FSc.)
110. IVRI/ERSK/11-13/004 Improvement of tribal farming U.K. Bandyopadhyay Sept. Aug.
system through scientific (PI) 2011 2013
approach with special reference to S.C. Das
disease control management S. Bandyopadhyay
including zoonoses of livestock and P.K. Nanda
poultry S. Naskar
S. Bandopadhyay
B.C. Das
P. Dandapat
111. IVRI/ERSK/11-14/005 Studies on prevelance of fish borne P.K. Nanda (PI) Sept . Aug.
parasites with special reference to S. Bandyopadhyay 2011 2014
helminths in peri-urban areas of P. Dandapat
Kolkata and its public health signi- S.C. Das
ficance S. Bandopadhyay
146
10. CONSULTANCY, PATENTS, COMMERCIALIZATION OF
TECHNOLOGIES
Research, education and training, and their
integration with technology transfer activities are the
core activities of the institute. Besides these, the
institute also provides consultancy and advisory
services in various areas of animal health, production
and products technology to the farmers,
entrepreneurs, industries, central and state
government agencies SAUs/SVUs CAUs, etc. The
institute disseminates the technologies generated to
the end-users through field extension programmes
and Krishi Vigayan Kendra. The issues like IPR,
patenting and commercialization of technologies are
managed through the Institute Technology
Management Unit (ITMU) and the institute has been
identified as one of the five Zonal Technology
Management Centres (ZTMC) of ICAR for promoting
the IPR portfolio and commercialization of
technologies of the 20 institutes of North Zone - II. In
addition to these activities, the business planning
and development component of NAIP is designed to
supplement the efforts at the zonal level to enhance
capacity building for intellectual property and
technology management, and improve efficiency for
effective execution of technology transfer/
commercialization through the technology business
incubators setup at the institute.
A. CONSULTANCY SERVICES PROVIDED
Consultancy services were provided at
polyclinic, IVRI to several pet animal owners and
livestock owners on prophylactic and therapeutic
health-care, and to field veterinarians on latest
approaches in treatment of animal diseases, surgical
techniques and advanced diagnostic techniques like
ultrasound, ECG, etc. Consultancy services were
provided by CADRAD to the state animal husbandry
departments for the diagnosis of diseases and their
management, including prevention and control
measures. Besides attending and investigating
outbreaks of diseases in animals and testing of
samples, CADRAD and various other divisions also
provided solutions to the disease problems.
1. BRAUP Police Academy, Moradabad (UP)
2. Military Dairy Farm, Bareilly
3. Central Avian Research Institute, Izatnagar (UP)
4. Department of Animal Husbandry, Govt. of Uttar
Pradesh
5. Department of Animal Husbandry, Govt. of
Gujarat
6. Department of Animal Husbandry, Govt of
Uttarakhand
7. Department of Police, Uttar Pradesh
8. Remount Veterinary Corps, New Delhi (CMVL,
Meerut, EBS Hisar and Babugarh)
Consultancy services were provided to following
zoos and national parks:
1. Jodhpur Zoo, Rajasthan for investigation of tigers
suffering from leptospirosis
2. M.C. Zoological Park, Chhatbir Zoo, Punjab for
treatment of ailing lion, surgery and treatment of
rescued wild Eagle, and investigation of
leptospira outbreaks
3. Pt. G.B. Pant High Altitude Zoo, Nainital for health
evaluation of animals
4. Social Forestry Department, Bareilly for
Treatment of injured Black buck and injured
peacock
5. Kukrail Rehabilitation Centre, Lucknow (UP) for
health evaluation of Gharials
6. Sahaswan, Badaun for treatment of Blackbuck
7. Nanadankanan Zoo, Bhubaneswar, for expert
opinion for healthcare of rescued Sloth bear
8. Dudhwa Tiger Reserve, Palia Khiri (UP) for
treatment of wounded rhinoceros
B. PATENT APPLICATIONS FILED
1. Novel Sindbis RNA dependent RNA polymerase
based self replicating DNA vaccine vector for
humoral response: V.V.S. Suryanarayana,
Pranaya Pradhan, Sarika Sasi, G.R. Reddy, and
H.J. Dechamma (160/DEL/2011).
2. Attenuated Pasteurella multocida with
determinant marker: P. Chaudhuri and V.P.
Singh (2195/DEL/2011).
3. An eco-friendly herbal acaricide to control ticks
including acaricide resistant species infesting
livestock and pet animals: S. Ghosh, A.K.S.
Rawat, M.C. Sharma, D. Ray, S. Srivastava and
S. Kumar (2196/DEL/2011).
4. Pestivirus replicase-based self-replicating RNA-
replicon vector for heterologous gene expression
in mammalian cells: P.K. Gupta and C.L. Patel
(3805/DEL/2011).
5. A novel foot and mouth disease viral Asia 1
(Indian vaccine strain) replicon based viral vector
for vaccine research and development: V.V.S.
Suryanarayana , S. Chandra Sekar, T.
Saravanan, C.A. Kumar, G.R. Reddy and H.J.
Dechamma (3806/DEL/2011).
6. A novel ready to eat (RTE) salty crisp milk
product (Milk Nimiki): G. Chauhan, B.D. Sharma
and S.K. Mendiratta (3807/DEL/2011)
147
7. A novel bio-marker based detection of bovine
sub-clinical mastitis: V.V.S. Suryanarayana, P.
Pradhan, S. Isloor and B.R. Shome (3808/DEL/
2011).
8. Ready to cook milk chips: G. Chauhan, B.D.
Sharma and S.K. Mendiratta (3809/DEL/2011)
9. Full-length infectious cDNA clone for Indian
vaccine strain of foot-and-mouth disease virus
serotype O (IND-R2/75): M. Hosamani, R.
Rajasekhar, H.B. Suresh and R.
Venkataramanan (626/DEL/2012
10. A rapid, sensitive and user-friendly visual LAMP-
based assay for detection of infectious bovine
rhinotracheitis (IBR) virus in bovine semen: P.K.
Gupta, S.S. Pawar, C.D. Meshram and B.P.
Mishra (627/DEL/2012)
11. Recombinant antigen based sero-diagnosis of
Newcastle disease: C.M. Mohan, Sohini Dey and
J.M. Kataria (628/DEL/2012)
12. An essential oil for inhibition of methane
emission in buffaloes (Methane Suppressor): D.N.
Kamra, M. Pawar, Neeta Agarwal, L.C.
Chaudhary and V.B. Charurvedi (629/DEL/2012)
C. COPYRIGHT APPLICATIONS FILED
1. Livestock and poultry disease information
System: R. Tiwari and M.C. Sharma (5473/2011-
COSW)
2. Digital pashuswasthya avaum pashupalan
prashnottri: R. Tiwari and M.C. Sharma (5474/
2011-COSW)
3. Pashudhan avam kukkut rog suchna: R. Tiwari
and M.C. Sharma (5475/2011-COSW)
D. DESIGN REGISTRATIONS APPLIED
1. Thresher cum treatment machine: P. Singh, U.R.
Mehra , R.S. Dass, A.K. Verma and S.S. Tripathi
(238547)
2. Multi-nutrients feed block making machine: P.
Singh and S.S. Tripathi (238548)
3. Bulk milk feeder for kids: H.C. Joshi, R. Govind
and B.H.M. Patel (240116)
4. Grass cutter: H.C. Joshi (240117)
E. TECHNOLOGIES COMMERCIALIZED
Sl.No. Name of technology Commercialized to Revenue generated
1. Area specific mineral mixture M/s Margdarshak Social Rs.5,51,500.00
Project and Consulting Pvt.
Lucknow
2. Urea molasses mineral block M/s Margdarshak Social Rs.2,20,600.00
Project and Consulting Pvt.
Lucknow
3. Peste des petits ruminants (PPR) M/s Intervet India Pvt. Ltd. Rs.5,00,000.00
hybridoma clone 4B11 Pune
4. Live attenuated goatpox vaccine M/s VBRI Animal Husbandry, Technology transfer
Hyderabad through NRDC
Revenue generated out of earlier commercialized technologies
1. Royalty received from NRDC Rs. 2,79,583.00
2. License fee received for technology commercialization of last year Rs. 9,23,763.00
Total revenue generated (earlier and new technologies) Rs. 24,75,446.00
F. PUBLIC PRIVATE PARTNERSHIPPROPOSAL ON FMD VACCINEPRODUCTION
A public private partnership proposal for
producing the improved FMD vaccine is under
process.
G. TECHNOLOGIES READY FORCOMMERCIAL TRANSFER
Vaccines
* Live attenuated homologous Peste des petits
ruminants (PPR) vaccine for small ruminants
* A low-volume saponified haemorrhagic
septicaemia (HS) vaccine
* A vero cell based live attenuated vaccine for
control of goat pox in goats
* Vero cell based sheep pox vaccine
* Swine fever virus cell culture vaccine
* Aluminum hydroxide gel-concentrated, oil
adjuvanted vaccine for FMD
Diagnostics and diagnostic kits
* Monoclonal antibody based sandwich ELISA
kit for detection of Peste des petits ruminants
virus antigen
* Monoclonal antibody based competitive ELISA
kit for detection of Peste des petits ruminants
virus antibodies
* Recombinant antigen based ELISA for
diagnosis of animal leptospirosis
* Recombinant yeast expressed VP2 antigen
based latex agglutination test for the sero-
148
diagnosis of infectious bursal disease virus
infection
* Diagnostic kit for caprine pleuropneumonia for
field use
Herbal drug formulations for livestock
* Development of post milking teat dip based
on a novel herbal formulation for the prevention
of bovine sub clinical mastitis
* Herbo-mineral acaricide formulations against
Boophilus ticks in cattle
* A process of preparing a bio-organo-mineral
formulation for the therapy of skin ailments in
animals
Biotechnology products
* A novel peptide as transfection reagent for
protein and nucleic acids
* A noval transfer vector for transferring genes
into sheeppox virus; useful for developing
vectored vaccines.
* 3 AB protein of foot and mouth disease virus
expressed in pichia pastoris as a diagnostic
tool to differentiate infected animals from the
vaccinated.
* A process for expression of variable surface
glycoprotein of Trypanosoma evansi in Pichia
pastoris
* Hybridoma clones for monoclonal antibodies
against PPR virus (H and N proteins).
Surgical devices for livestock and other tools
* A novel bilateral external skeletal fixation
device for the management of long bone
fractures in large animals
* Circular and hybrid external skeletal fixators
for large animals
* Epoxy-pin external skeletal fixator for
management of compound fractures in small
animals and birds
* An indigenous methodology IVRI Crystoscope
as field tool for determining optimum time for
fertile insemination in animals
Technologies for value addition in meat products
* Emulsion based chicken products
* Emulsion based mutton and chevon products
* Chicken chips from spent hen meat
* Incorporation of vegetables in meat products
* Hurdle tech meat pickle
* Functional mutton nuggets with low salt, low
fat and high dietary fibre
* A chitosan based biopreservative mix for
buffalo meat mince.
149
11. MEETINGS OF MANAGEMENT COMMITTEE, ACADEMIC
COUNCIL, RAC, IRC etc. WITH SIGNIFICANT DECISIONS
COMPOSITION OF BOARD OF MANAGEMENT OF I.V.R.I.
Sl. Composition Name & Designation Status Tenure
No.
1. Rule No.2.01(i) Dr. M.C. Sharma Chairman By virtue of post
Director, IVRI
2. Rule No.2.01(ii) Dr. V.P. Singh Member By virtue of post
Joint Director (Acad.)
3. Rule No.2.01(iii) 1. Shri Thangso Baite, MP (LS), 88 Member 24.11.10 to
Two members of Governing Body Super Market, Lamphel, Imphal, 23.11.12
nominated by the President Manipur.
2. Shri Sudhir Kumar Bhargava Member 24.11.10 to
Director Agroman System Pvt. Ltd., 23.11.12
25/2, Tardeo AC Market, Tardeo,
Mumbai, Mah.
4. Rule No.2.01(iv) 1. Dr. S.C. Dubey Member 24.11.10 to
Jt. Directors/Head of Division of JD(HSADL) 23.11.12
related groups of disciplines and
Project Coordinators to be nomi- 2. Dr. R. Venkatramanan Member 24.11.10 to
nated by the President of the JD (Bangalore) 23.11.12
Society for a period of two years
total numbers not to exceeded 3. Dr.(Mrs.) G. Taru Sharma Member 24.11.10 to
to eight. HD/P&C 23.11.12
4. Dr. Kusumakar Sharma, Member 24.11.10 to
ADG (HRD), ICAR, New Delhi 23.11.12
5. Dr. Habibur Rehman, PD, Member 24.11.10 to
ADMAS, Hebbal, Bangalore 23.11.12
6. Dr. S.K. Shukla, Prof. & Head Member 24.11.10 to
Vety. Medicine, GBUA&T, Pantnagar. 23.11.12
7. Dr. B.K. Sahu, Dean, OUAT, Member 24.11.10 to
Bhubaneswar 23.11.12
8. Dr. B. Pattnaik, PD, PDFMD, Member 24.11.10 to
Mukteswar. 23.11.12
5. Rule No.2.01(v) Dr. J.M. Kataria Member By virtue of post
Joint Director (Research)
6. Rule No.2.01(vi) Dr. Triveni Dutt Member By virtue of post
Joint Director (Ext. Edu.)
7. Rule No.2.01(vii) Dr. A.P. Singh, VC, DVASU, Member 24.11.10 to
Vice Chancellor of Agril. Univ. Mathura 23.11.12
8. Rule No.2.01(viii) Dr. K.M.L. Pathak Member 24.11.10 to
One Representative from ICAR DDG (AS), ICAR, 23.11.12
Krishi Bhawan, New Delhi 23.11.12
9. Rule No.2.01(ix) Dr. A.K. Srivastava Member 24.11.10 to
Director, IARI/NDRI Director, NDRI 23.11.12
10. Rule No.2.01(x) Animal Husbandry Commissioner Member By virtue of post
Animal Husbandry Commissioner Deptt. of Animal Husbandry &
Deptt. of Agril., Min. of Agril. Dairying, Min. of Agril., Krishi Bhavan
New Delhi.
11. Rule No.2.01(xi) Dr. S.N. Maurya, Member 24.11.10 to
One Eminent Scientists in the Ex-VC, DVASU, Mathura 23.11.12
field of Research 15, Foot Hill City, Vill. & Post : Kamalua
Ganja, Haldwani - 263139 (UK)
150
12. Rule No.2.01(xii) Dr. P. Thangaraju, Member 24.11.10 to
One eminent educationist (Ex. Vice Chancellor, TANVASU), 23.11.12
concerned with the research A 5-14, VOC Street, Officers Colony Extn.,
Mogappair East, Chennai-600050
13. Rule No.2.01(xiii) 1. Sri Praveen Singh Aron, MP (LS), Member 24.11.10 to
Two non-official persons B-236, Sector-50, Noida, UP [297, 23.11.12
representing agriculture interest Salvation Army Road, Bareilly (U.P.)]
2. Sri P.G. Bhatol, Chairman, Member 24.11.10 to
Banaskantha District Cooperative 23.11.12
Milk Producers Union Ltd., PB No.20,
Banas Dairy, Palanpur-385001 (Guj)
14. Rule No.2.01(xiv) Dr. V.R. Srinivasan Member 24.11.10 to
Financial Advisor, ICAR or his Dy. Director Finance-I, ICAR, 23.11.12
nominee Krishi Bhawan, New Delhi
15. Rule No.2.01(xv) Commissioner, Rohilkhand Division, Member By virtue of post
Commissioner, Rohilkhand Bareilly.
Division
16. Rule No.2.01(xvi) Sri G.R. Desh Bandhu Member By virtue of post
Joint Director (Admn.)
17. Registrar Sri G.R. Desh Bandhu Member Secy. By virtue of post
COMPOSITION OF ACADEMIC COUNCIL OF IVRI
Sl. Composition Name & Designation Status
No.
1. Director, IVRI Dr. M.C. Sharma Chairman
2. Jt. Director (Acad.) Dr. V.P. Singh Vice-chairman
3. Jt. Director (Res.) Dr. J.M. Kataria Member
4. Jt. Director (EE) Dr. Triveni Dutt Member
5. Four Eminent Scientist from Outside 1. Dr. Amresh Kumar, Former Dean, Member
the IVRI distinguished in the field of College of Vety. Sci., Pantnagar, 35
Edn. Including Animal Science Green Park, Bisalpur Road, Bareilly
Education 243006.
2. Dr. R.M. Acharya, Former DDG (AS) Member
ICAR, House No. 784, Sector-9,
Faridabad-121001(Har.)
3. Dr. S.K. Garg, Former VC, Member
UPPDDUPCVV & GAS, Mathura and
Director, College of Applied Education
and Health Sciences, gangotri, Roorkee
Road, Meerut.
4. Dr. S.N.S. Gaur, Flat No. 502, Maitri Member
Apartments, Plot No. 17, Sector 10,
Dwarka, New Delhi 110075
6. One Sr. Scientist from each of the 1. Dr. R. Verma, JD (CADRAD) /HD/Stand. Member
Division 2. Dr. R. Somvanshi, HD/Path. Member
3. Dr. S.K. Agarwal, HD/AR Member
4. Dr. B. Singh, HD/LES Member
5. Dr. Bharat Bhushan, HD/AG Member
6. Dr. P.S. Banerjee, HD/Para Member
7. Dr. U. Dimri, HD/Medicine Member
8. Dr. S.K. Mishra, HD/P&T Member
9. Dr. B.D. Sharma, HD/LPT Member
10. Dr. R.K. Agarwal, HD/B&M Member
11. Dr. D.N. Kamra, HD/AN Member
12. Dr. Mahesh Chander, HD/EE Member
151
13. Dr. B.P. Mishra, HD/Biotech. Member
14. Dr. P. Joshi, I/c Biochem. Member
15. Dr. T.K. Goswami, I/c Immunology Member
16. Dr. A.B. Pandey, HD/Virology Member
17. Dr. V.K. Chaturvedi, HD/BP Member
18. Dr. Ashok Kumar, HD/VPH Member
19. Dr. G. Taru Sharma, HD/P&C Member
20. Dr. M.M.S. Zama, HD/Surgery Member
21. Dr. Bharat Bhushan, I/c LPM Member
22. Sr. Most scientist of Epid. Section Member
7. Director, CARI Dr. R.P. Singh, Director Member
8. Master of Halls Dr. B.P. Singh, PS & Chief Hostel Warden Member
9. Two Repr. From P.G. Faculty 1. Dr. Sanjeev Kumar, PS, CARI Member
2. Dr. A.M. Pawde, PS, Surg. Div. Member
10. The student representative to AC 1. Dr. Mohd. Irfan Shah, P&T Div. Member
2. Dr. Beddyuti Singh, AN Div. Member
11. Jt. Director (Admin.) By virtue of post Member
12. Repr. From UGC Vacant Member
13. DDG (Edn.) or his nominee DDG (Edn.), ICAR, Krishi Anusandhan Member
Bhawan, Pusa, New Delhi-12
14. Registrar By virtue of post Member Secy.
COMPOSITION OF THE RESEARCH ADVISORY COMMITTEE (RAC)
Rule No. & Position Designation Name Approved by the Authority
71 A(a)1
An eminent Scientist from outside the Chairman Dr. M.L. Madan
ICAR System nominated by DG, ICAR. Ex-Vice Chancellor, MVU, Mathura, Madan Lodge,
842/6, Urban Estate, Karnal - 132 001 (Haryana)
71 A(a)2
4-5 External Members (including retired Members 1. Dr. P. Thangaraju, Ex.-V.C. TANVASU,
Scientists of ICAR) representing the Madhavaram Milk Colony Campus,
major areas of research & development Chennai - 600 051 (Tamilnadu)
programme of the Institute nominated Residence: No.5/14, V.O.C., Street,
by DG, ICAR Officers Colony Extn., Mogappair East,
Chennai - 600 050
2. Dr. V.A. Srinivasan, Director Research, Indian
Immunologicals Ltd., Road-44, Jubilee Hills,
Hyderabad - 500 033 (A.P.)
3. Dr. Amresh Kumar, Ex-Dean, 35, Green Park,
Bisalpur Road, Bareilly - 243 006 (U.P)
4. Dr. Ramesh Chand, Director, National Center
for Agricultural Economics & Policy Research,
DPS Marg, PUSA, Post Box No.11305, New
Delhi - 110 012 (India)
5. Dr. A.K. Purohit, Ex.-Director (Extn. Edu.),
Hakeem Saheb Ki Haveli, Jala Mahal, Jodhpur
342 001 (Rajasthan).
6. Dr. S.K. Dwivedi, Ex-Director, NRC on
Equines, Hisar. B-3, Kiran Residency, Plot
No.GS-79, Sector-56, Gurgaon - 122 011
152
71 A(a)3
Directors of the Institute Member Director, IVRI, Izatnagar
71 A(a)4
DDG, concerned with the Institute in Member Dr. K.M.L. Pathak, D.D.G. (AS), ICAR, Krishi
case of IARI, IVRI, NDRI & NAARM in Bhavan, New Delhi -110 001
case of other Institutes ADG concerned
with Institute.
71 A(a)5
Two persons representing Agril./ Rural Member Shri P.G. Bhatol, Chairman, Banaskantha District
interest of the IMC to the Institute in Cooperative Milk Producers Union Ltd. Post Box
terms of rules 66 (a)5 for a period of their No.20, Banas Dairy, Palanpur - 385 001 (Gujarat)
membership of the IMC.
Hon'ble Shri Praveen Singh Aron,
Member of Parliament (Lok Sabha),
B-236, Sector - 50, NOIDA - (U.P.)
71 A(a)6
One Sr. level Scientist of the concerned Member Joint Director (Research)
Institute nominated by the Director of Secretary
the Institute.
COMPOSITION OF INSTITUTE RESEARCH COMMITTEE
Sl.No. Composition Name & Designation Status
1. Dr. M.C. Sharma Director, IVRI Chairman
2. Dr. J.M Kataria Joint Director (Res.) Member Secretary
3. ICAR Nominee D.D.G. (ICAR) Member
4. Heads of Divisions, IVRI Members
5. Principal Scientists, IVRI Members
6. Dr. S.K. Garg Former VC, UPPDDUPCVV & GAS, Expert Member
Mathura
7. Dr. N.N. Pathak Former Director, CIRB, Hisar Expert Member
8. Dr. V.K. Singh Former Director, CSWRI, Avikanagar Expert Member
9. Dr. J.P. Sharma Head, IARI, New Delhi Expert Member
10. Dr. Amresh Kumar Former Dean, COVS, Pantnagar Expert Member
11. Dr. B.B.L. Mathur Former I/c RCM Unit, IVRI Expert Member
12. Dr. D.C. Shukla Former Head, P & C, IVRI Expert Member
13. Dr. R.P. Mishra Former FAO Expert Expert Member
14. Dr. S.K Chattopadhyay Former Head Pathology, IVRI Expert Member
15. Dr Mahesh Kumar Head, GBPUAT, Pantnagar Expert Member
COMPOSITION OF THE EXTENSION COUNCIL
Rule Name
6.01 (i) Director, IVRI, Chairman Dr Mahesh Chandra Sharma
(ii) Jt. Director (Research ), Member Dr J M Kataria
(iii) Jt. Director (Academic ), Member Dr V P Singh
(iii) Jt. Director (Extension Education), Member Dr Triveni Dutt
(iv) DDG(AE) or his nominee, Member Dr K D Kokate, DDG (AE), ICAR
(v) Head, Division of Extension Education - Member Dr. Mahesh Chander
Secretary
(vi) Four Scientists in Management position of the 1. Dr B.D.Sharma, HD,LPT
Institute, Members 2. Dr Ashok Kumar, HD, VPH
3. Dr S K Agarwal, HD,AR
4. Dr Umesh Dimri, HD, Medicine
(vii) Five Scientists of IVRI nominated by Board of 1. Dr Hema Tripathi, PS & PC, KVK, IVRI
Management as Members for 2 years 2. Dr Sanjay Kumar, Sr..Sci, ARIS Cell
153
3. Dr Rupasi Tiwari, I/c ATIC
4. Dr S V S Malik, PS, VPH Div
5. Dr Putan Singh,PS & Coordinator,
IVRI Farm
(viii) One Scientist from the Regional Research Station Dr A KSharma, Sr. Sci. & Head, TAH Div.
as Member for 2 years IVRI-Mukteshwar Campus
(ix) One Representative of Ministry of Agriculture, Govt. Dr A S Nanda,
of India, Member Animal Husbandry Commissioner
Govt. of India or his Nominee
(x) One Project Coordinator for 2 years, Member Dr A B Pandey, Project Coordinator (Blue
Tongue Network Project)
(xi) Two Representatives of State Govt., Members 1. Dy. Director (AH), Bareilly
2. Jt. Director (Agriculture), Bareilly
(xii) One Extension Scientist representing NDRI/IVRI Dr J P Sharma, Head,
nominated by BOM as Member for 2 years Division of Agril. Extension, IARI, New Delhi
(xiii) Director (Farm Information), Ministry of Agriculture, Sri S M H Kazmi
Government of India, Member
(xiv) Joint Director (Administration), Member Sri G R Deshbandhu
and drug delivery system, bioinformatics needs and
applications, impact analysis and mitigation strategies
of climate on animal health, emergence and re-
emergence of diseases; modernization and revamping
of Veterinary Biotechnology with initiation of
programmes on therapeutic proteins, introgression of
selected gene, genomic analysis for DNA chips, gut
microbiology and rumen microbe genomics, application
of DNA based gene silencing, silencing gene
expression, etc; maintenance of veterinary type culture
and a repository for vectors, clones, gene constructs,
etc.
XII MEETING OF EXTENSION COUNCIL
The XII Meeting of the Extension Council of
IVRI was held on 21st September, 2011. The chairman
of the extension council highlighted the achievements
of IVRI and challenges for the extension system in
the face of rapidly changing global scenario of
agricultural development which is going to be even
more competitive in future. The IVRI has augmented
extension activities not only in the Bareilly district
but also in other states considering the national
mandate of the institute. The collaborative activities
with the NGOs were also emphasized in the action
plan of extension activities of IVRI. The support of
line departments was considered valuable in
organization of extension activities like exhibitions,
Kisan Mela, gosthi, whenever being organized by
IVRI. The animal health camps, exhibitions, Kisan
Mela, gosthi, technology demonstrations were the
major focus of extension activities being undertaken
by the IVRI. The XII plan priorities for livestock
technology transfer were the special focus of
discussion in the meeting as the members felt that
the extension activities should be carried out in line
with the national priorities identified for XII plan.
SIGNIFICANT DECISIONS OF VARIOUS
COMMITTEES
BOARD OF MANAGEMENT
During this period 45th meeting of Board of
Management was held on 16.8.2011 at IVRI
Izatnagar, Various suggestions/decisions taken by
the on different activities of the Institute are: decisions
on matters related to works and equipment
purchases; Five Year Plan and Annual Plan with
periodical review of progress of schemes of the
Institute; proposals for annual budget of the Institute
and allotment of funds to various Divisions/Projects;
periodical reviews and assessment of primary
activities of Institute.
XIII RAC MEETING
The meeting of XIII Research Advisory
Committee (RAC) was held on 20th and 21st April,
2011 in the Committee Room of Administrative Block,
IVRI, Izatnagar under the Chairmanship of Prof. M.L.
Madan. Prof. M.L. Madan emphasised on the vital
role of RAC as a facilitator of the research in the
Institute. Dr. J.M. Kataria, Joint Director (Res.) and
Member Secretary RAC presented the agenda items
for consideration and approval. The RAC discussed
various agenda items and made several
recommendations, which included: Revisiting total
research programmes; strengthening of clinical facilities
with emphasis on capacity building and clinical super-
specialty such as regenerative medicine, neonate
medicine, transfusion medicine, sports medicine,
traumatology, ophthalmology, anesthesiology, dentistry,
orthopedics etc.; research programs in an interdivisional,
interdisciplinary and inter-institutional mode on various
key areas such as -risk assessment, biohazard/bio-
safety, early warning and response systems, food safety
and hygiene, Nanotechnology applications in vaccine
154
12. PARTICIPATION OF SCIENTISTS IN CONFERENCES,
WORKSHOPS, SYMPOSIA, AND TRAININGS IN INDIA AND
ABROAD
Sl. Name of the Symposium/Seminar/Workshop Number of
No. Scientists
Attended
International
1. Advances in Reproductive Biology and Genetics Meeting, Columbia, 1
16-17 May, 2011.
2. XIV International Veterinary Biosafety Workgroup Conference at National 1
Center for Animal Health Copenhagen/Lindholm, Denmark, 16-19 May, 2011.
3. OIE Ad-hoc Group Meeting on PPR, Paris, 14-16 June, 2011. 1
4. LXXI Scientific Sessions of American Diabetes Association Meeting, 1
San Diego, 24-28 June, 2011.
5. Workshop on Biosafety, Virus Sequestration and Risk Analysis for 1
Laboratories Holding Rinderpest Virus Infective Material, Debre Zeit,
Ethiopia, 4-7th July, 2011.
6. Swine in Biomedical Research Conference, Chicago, USA, 17-19 July, 2011. 1
7. III International Conference on Sustainable Animal Agriculture for Developing 1
Countries, Ratchasima, Thailand, 26-29 July, 2011.
8. VII International Conference on Ticks and Tick Borne Pathogens, Zaragoza, 2
Spain, 28 Aug, 2011.
9. OR Feome Symposium 2011, Boston, USA, 20-22 Sep, 2011. 1
10. XVII IFOAM Organic World Congress, Gyeonggi Paldang, Republic of Korea, 1
26 Sep - 5 Oct, 2011.
11. V Workshop on Asian Zoo and Wildlife Medicine/Conservation, Kathmandu, 2
Nepal, 20-25 Oct, 2011.
12. I-III Scientific Conference of ISOFAR, Namyangju, Republic of Korea, 1
28 Sep - 1 Oct, 2011.
13. John H and Amy Bowlers Lawrence Foundation Symposium on Global Frontiers 1
in Vaccine Development, Sanford Center, South Dakota, USA, 6-7 Oct, 2011.
14. XXXVI World Small Animal Veterinary Association (WSAVA-11) World 1
Congress, Jeju, South Korea. 14-17 Oct, 2011.
15. V Congress of International Society of Nutrigenetics/Nutrigenomics, Beijing, 1
China, 16-18 Oct 2011.
16. Agri-Business Forum at Johannesburg, South Africa, 16-20 Oct 2011.1
17. FAO Training on Advanced Biorisk Training, Geelong, Australia, Nov. 14-18, 2011 1
18. Lab Engineering & Equipment Maintenance Training, Geelong, Australia, 4
21- 25 Nov. 2011.
19. Laboratory Information Management Systems: Workshop to Identifying Needs, 1
Resources and Ways Forward, Phuket, Thailand, 8-9 Dec, 2011.
National
1. National Seminar on Recent Advances in the Development of Fermented Foods, 1
Varanasi, 8-9 April, 2011.
2. India-Denmark Workshop on Genomic Selection in Cattle and Buffaloes, 1
New Delhi, 11-12 April, 2011.
3. Workshop on Intellectual Property Rights, Bhimtal, 26 April, 2011. 2
4. Training on Mitigation Strategies for Methane Production from Dairy Animals, 1
Karnal, 2-16 May, 2011.
5. Annual KVK Zonal Workshop, Pantnagar, 13-14 May, 2011. 2
6. V National Seminar on Multisectorial Innovation for Rural Prosperity, Karnal, 2
19-21 May, 2011.
155
7. ICAR Industry Meet 2011, New Delhi, 23 May, 2011. 6
8. National Accreditation Board for Testing and Calibration Laboratories 2
Assessor's Training Course, Bhubaneswar, 23-27 May, 2011.
9. Transfer of Strategic Pesticides Use to Enhance Agricultural Production and 1
Food Security, New Delhi, 31 May- 2 June, 2011.
10. Krishi Takniki Sangosthi and Exhibition, Haridwar, 4 June 2011. 10
11. XXV Annual Convention of Indian Association of Veterinary Microbiologists and 8
Specialists in Infectious Diseases, Bangalore, 9-11 June, 2011.
12. Meeting-cum-Workshop of Head of Divisions and Regional Stations, Bhopal, 2
14-15 June, 2011.
13. NABL ISO/IEC 17025 Assessor Training Course, Jaipur, 20-24 June, 2011. 1
14. Indo-NZ Work Shop on Food and Agriculture, 20-24 June, 2011. 1
15. Annual Conference of Solvent Extractors Association of India and CLFMA 1
Feed & Feed Ingredients Conclave, Jaipur, 4 July, 2011.
16. Sarkari Karyon mein Rajbhasha Prayog ki Sthiti va Sangh ki Rajbhasa Neeti, 3
28 July, 2011.
17. VII Food and Technology Expo 2011, New Delhi, 29-31 July, 2011. 5
18. National Consortium on Gender Prospective in Agriculture, New Delhi, 8-9 Aug, 2011. 1
19. ICAR-ILRI Pilot Study on 'Economic Impact of Foot-and-Mouth Disease in 2
Selected Regions of India, New Delhi, 9-10 Aug, 2011.
20. Workshop on Laboratory Biosafety and Biosecurity, Bhopal, 17-19 Aug, 2011. 15
21. Conference on Business Opportunity Workshop, Izatnagar, 25 Aug, 2011. 1
22. Therapeutic Application of Stem Cells in Livestock, Izatnagar, 25 Aug-14 Sept, 2011. 1
23. National Workshop on Advanced Concept in Animal Welfare: Holistic Approaches 1
for Integrating Animal Welfare in Veterinary Education, Hassan, Karnataka,
26-27 Aug, 2011.
24. Bioinformatics in Agriculture, New Delhi, 29 Aug - 7 Sept, 2011. 2
25. Meeting to Develop a Regional Field Epidemiology Training Programme for 1
Veterinarians (FETP-V) in India, Chennai and New Delhi, 29-30 Aug, 2011
and 14 Nov, 2011.
26. Microbial and Functional Feed Supplements to Improve Livestock Productivity, 1
Izatnagar, 1- 21 Sept, 2011.
27. In vitro Toxicodynamics, Izatnagar, 5-14 Sept, 2011. 9
28. Bioinformatics Workshop on Genomics, Proteomics and Drug Design, Delhi 1
6-16 Sept, 2011.
29. ICAR Short Course on Molecular Approaches for Laboratory Diagnosis of BVDV, 3
Bhopal, 7-16 Sept, 2011.
30. ICAR Interaction Meet with NGOs and Farmer Entrepreneurs, New Delhi, 4
17 Sept, 2011.
31. Genetics/Genomics Data Analysis using SAS, New Delhi, 19-24 Sept, 2011. 1
32. International Conference on Emerging Trends on Food and Health Security in 1
Cold Desert, Leh, Ladakh, 23-25 Sept 2011.
33. Symposium of Indian Academy of Veterinary Nutrition and Animal Welfare, Durg, 8
24-25 Sept, 2011.
34. Exhibition cum Technology Fair at Rakhra, Patiala, Punjab, 24 Sept, 2011. 4
35. National Symposium on Reproductive Biotechnologies for Augmenting Fertility 3
and Conservation of Animal Species with Special Reference to North Eastern
Hill Region, Aizawl, Mizoram, 27-29 Sept, 2011.
36. Annual Workshop of DBT Network Project on Detoxification and Utilization of key 1
Agro-forest Based Non-conventional Oil Cakes in the Feeding of Livestock, New
Delhi, 30 Sept, 2011.
37. Genomics Platform Workshop, Karnal, 30 Sept, 2011. 1
38. ICAR Sponsored Winter School on Advanced Molecular Biology Tools Used in 1
Animal Disease Diagnosis and Development of New Generation Vaccine,
Ludhiana, 3-23 Oct, 2011.
156
39. XI Symposium on Vectors and Vector Borne Diseases, Jabalpur, 15-17 Oct, 2011. 1
40. VI Convention of UP Chapter of Indian Society for Veterinary Surgery, Lucknow, 4
16 Oct, 2011.
41. Seminar on the New Dimensions on Control of Animal Diseases, Lucknow, 1
22 Oct, 2011.
42. Advances in Reproductive Techniques to Augment Fertility in Farm Animals, 1
Izatnagar, 1-21 Nov, 2011.
43. XIV Biennial Conference of Animal Nutrition Society of India - 2011 on 6
Livestock Productivity Enhancement with Available Feed Resources, Pantnagar,
3-5 Nov, 2011.
44. CAFT Training on Immunological and Molecular Techniques in Animal Sciences, 1
Hisar, 3-23 Nov, 2011.
45. International Conference on Alternative Approaches for Agricultural Knowledge 1
Management, Global Extension Education, New Delhi, 9-12 Nov, 2011.
46. XXXV Annual Congress of Indian Society for Veterinary Surgery, Kolkata, 1
11-13 Nov, 2011.
47. National Conference on Organic Meat, Poultry & Fish: Value Chain Management, 1
University of Agricultural Sciences, Bengaluru, 12-13 Nov 2011.
48. Review meeting of Component-I NAIP, NASC Complex, New Delhi, 15th - 16th 1
Nov 2011.
49. XI Annual Conference of Indian Society of Veterinary Pharmacology and Toxicology, 16
Izatnagar, 17-19 Nov, 2011.
50. Researchers Training - VI: Analysis of Veterinary Science Data using SAS, 1
Izatnagar, 21-26 Nov, 2011.
51. Workshop on Biotechnology and Bioinformatics, Meerut, 21-22 Nov, 2011. 1
52. National Training on Cloning Research for Quality Animal Production, Karnal, 1
21-30 Nov, 2011.
53. Interaction Meet with Scientists Trained Abroad in Frontier Areas of Agricultural 1
Sciences at NASC, New Delhi, 28-30 Nov, 2011.
54. Workshop on Improvement of livestock Breeding in SE Asia, New Delhi, 1
29- 30 Nov, 2011.
55. National Conference of KVK, Jabalpur, 3-5 Dec, 2011. 1
56. LXV Annual Conference of Indian Society of Agricultural Statistics, Karnal 2
3-5 Dec, 2011.
57. National Seminar by ISSGP&U on Prospects of Small Ruminant and Rabbit 4
Production, Jaipur, 7-9 Dec, 2011.
58. Agribusiness Incubator Programme, New Delhi, 12-14 Dec, 2011. 1
59. National Extension Education Congress, Goa, 17-19 Dec, 2011. 3
60. Kisan Club Entrepreneurship Development Workshop, Izatnagar, 19 Dec, 2011. 2
61. XXVIII Annual Conference and International Symposium on Rural Employment 1
Generation and Nutritional Security through Poultry Production, Patna,
22-24 Dec, 2011.
62. Mid-term cum Review Workshop cum Action Plan Workshop of KVK, Kanpur, 2
23-25 Dec, 2011.
63. XXVIII Annual Conference of Indian Association of Veterinary Pathologists, 2
Chennai, 29-30 Dec, 2011.
64. XX National Conference of Indian Virological Society, Hisar, 29-31 Dec, 2011. 1
65. Second DADF Expert Committee Meeting, Bangalore, 7 Jan, 2012 1
66. Application of Nanotechnology in Agriculture. Central Institute for Research 1
on Cotton Technology, Mumbai, 2-12 Jan, 2012.
67. National Workshop on Dissemination of Horticulture Technologies Generated by 1
IIHR, Bangalore, 18-9 Jan, 2012.
68. Refresher Course on Agricultural Research Management, Hyderabad, 2
19 Jan - 8 Feb, 2012.
69. ISVM National Symposium on Production Strategies for Pigs with Special Reference 6
to Nutritional and Housing Management, Aizawl, Mizoram, 1-3 Feb, 2012.
70. Short Training Course on Applications of Nanotechnology in Animal Sciences, 2
Hisar, 1-10 Feb, 2012.
157
71. XL Dairy Industry Conference, New Delhi, 2-5 Feb, 2012. 2
72. II National Conference on Antimicrobial Resistance, Allahabad, Uttar Pradesh, 1
6-8 Feb, 2012.
73. Network of Indian Agri Business Incubators (NIABI)-2012, New Delhi, 6-8 Feb, 2012. 5
74. National Training on Embryonic and Spermatogonial Stem Cell Biology, Karnal, 1
03-23 Feb, 2012.
75. International Symposium on Emerging Challenges in Poultry Health and Disease 2
Control and the First Annual Conference of Association of Avian Health
Professionals, Hyderabad, 3-4 Feb, 2012.
76. DBT-BBSRC, UK Workshop on Livestock Health and Diseases, New Delhi, 1
7-8 Feb, 2012.
77. International Congress on Modern Concepts in Canine Health and Diseases of 2
Human Concern, Bikaner, 9-11 Feb, 2012.
78. Annual Workshop of NAIP 2012, New Delhi, 19-20 March, 2012. 1
79. FAO-ICAR International Conference on FMD (Scientific Developments and 8
Technical Challenges in the Progressive Control of FMD in South Asia), New
Delhi, 13-15 Feb, 2012.
80. Hands on Training on Disease Management and Diagnostic in Brackishwater 1
Aquaculture , Kakdwip, 13-17 Feb, 2012.
81. Workshop on Project Proposal Development under NFBSFARA , Hyderabad, 1
15-18 Feb, 2012.
82. X Annual Conference of Indian Association of Veterinary Public Health Specialists, 3
Thrissur, Kerala, 16-17 Feb, 2012.
83. National Conference Emerging Trends in Biotechnology and Pharmaceutical 2
Research, Aligarh, 18-19 Feb, 2012.
84. International Conference and 22nd Annual Meeting of ISSRF, New Delhi, 1
19- 21 Feb, 2012.
85. National Conference on Biotechnology, Bioinformatics and Bioengineering, 2
Kolhapur, Maharashtra, 24 Feb, 2012.
86. International Workshop on Transcriptosomics, Proteomics and Structural 4
Biology, Karnal, 27-29 Feb, 2012.
87. Media Meet and Show Casing of Technologies, Izatnagar, 28 Feb, 2012. 2
88. Newer Approaches for Feed Security and Safety, Izatnagar, 9-29 Feb, 2012. 1
89. Short Course on Livestock Production and Health under Impending Climate 1
Change, Izatnagar, 28 Feb - 19 March, 2012.
90. International Conference on Regulatory Network Architecture in Bacteria, 1
Thanjavur, Tamil Nadu, 9 -11 March, 2012.
91. ICAR-NAE Short Training on Molecular Techniques in Diagnosis and Prophylaxis 1
of Diseases of Farm Animals and Poultry, Izatnagar, 12-17 March, 2012.
92. I Global Conference on Women in Agriculture, New Delhi, 13-15 March, 2012. 1
93. XXII National Congress of IAAVP and National Symposium, Mathura, 15-17 4
March, 2012.
94. Global Conference on Women in Agriculture, New Delhi, 13-15 March, 2012. 1
95. National Workshop on Strategies for Moderinization/Upgradation of Service 1
Abattoirs in India, Hyderabad, 16-17 March, 2012.
96. Symposium on Challenges in Control of Trypanosomiasis in Working Equines, 1
Ghaziabad, 18 March, 2012.
97. Annual Day Celebration of Zone IV, Kanpur, 19 March, 2012. 2
98. National Training Programme on Advanced Statistical Tools for Analysis of 1
Animal Breeding Data, Karnal, 10-30 March, 2012.
99. International Conference on Holistic Approaches for Combating Anthelmintics 1
Resistance-An Update in Parasitology, Channai, 26-27 March, 2012.
158
13. WORKSHOPS, SEMINARS, SUMMER INSTITUTES, SHORT
COURSES AND TRAININGS CONVENED AT THE
INSTITUTE
Sl. No. Particulars of the Event
1. Innovative Awareness Programme on e- campaign on IPR, April, 2011.
2. World Veterinary Day, 30 April, 2011.
3. Capacity Building Programme on Preparation of Various Meat Products through Technology
Incubator, 8-9 June, 2011.
4. Workshop with Directors of State Animal Husbandry Department to Sensitize about NICRA Project
and Sharing of Disease Outbreak Information for Creating Database, 30 July, 2011.
5. Business Opportunity Workshop on Exploring the New Horizons in Animal and Avian Nutrition
Technologies, 25 Aug, 2011.
6. WHO Sponsored Workshop on Laboratory Biosafety and Biosecurity, 17-19 Aug, 2011.
7. Short term training on Production of Bacterial Biomass through Fermentor, 20-25 Aug, 2011.
8. Short Course on Feeding Management of Dairy Animals, 22-24 Aug, 2011.
9. CAFT Short Course on Therapeutic Application of Stem Cells in Livestock, 25 Aug. - 14 Sept,
2011.
10. Advanced Short Course on Microbial and Functional Feed Supplements to Improve Livestock
Productivity, 1 Sept.- 21 Sept, 2011.
11. ICAR Sponsored Short Course on In- Vitro Toxicodynamics, 5-14 Sept, 2011.
12. ICAR Short Course on Molecular Approaches for Laboratory Diagnosis of Bovine Viral Diarrhoea
Virus, 7 Sept. -16 Sept, 2011.
13. Short Term Training on Diagnosis of Brucellosis, IBR and Campylobacteriosis, 12-17 Sept, 2011.
14. Short Term Training on Art of Disease Investigation, 12-18 Sept, 2011.
15. Short Term Training on Art of Disease Investigation, 19-25 Sept, 2011.
16. Short Term Training on Concept in Viral Vaccines Production, 5 Oct. - 4 Nov, 2011.
17. Training Course in Laparoscopy, 10-24 Oct, 2011.
18. Workshop cum SAS (9.3 Version) Software Installation Training, 28-29 Oct, 2011.
19. Short Term Training on Production and Standardization of Poultry Vaccine, 31 Oct.- 30 Dec, 2011.
20. ICAR Sponsored Winter school on Advances in Reproductive Technologies to Augment Fertility in
Farm Animals, 1-21 Nov, 2011.
21. Short Course in Fracture Management in Animals, 1-30 Nov, 2011.
22. Short Term Training on Standardization and Quality Control of Veterinary Biologicals, 1-30 Nov,
2011.
23. Laboratory Diagnosis on Animal Diseases and Zoonoses, 3-16 Nov, 2011.
24. Ms;jh Ik"kqvksa esa LokLF; izcU/ku, 4-9 Nov 2011.25. Short Term Training on Diagnosis and Control of Emerging and Important Zoonotic Diseases, 14
Nov, 2011.
26. XI Annual Conference of Indian Society of Veterinary Pharmacology and Toxicology and National
Symposia on Bioinformatics in Drug Designing and Challenges and Opportunities in Veterinary
Drug Development, 17-19 Nov, 2011.
27. Short Term Training on Analysis of Veterinary Science Data Using SAS, 21-26 Nov, 2011,
9-14 Jan, 19-24 March, 2012.
28. Short Term Training on Production and Standardization of PPR Vaccine, 1-7 Dec, 2011.
29. Short Course in Anaesthesia and Pain Management, 1-31 Dec, 2011.
30. Short Term Training on Advances in Livestock Production Management Technologies, 2-15 Dec,
2011.
159
31. Short Term Training on Production and Standardization of Brucella Abortus Strain-19 Vaccine, 3-
9 Dec, 2011.
32. Short Term Training on Art of Disease Investigation with Emphasis on Collection, Preservation
and Dispatch of Material, 5-10 Dec, 2011.
33. Short Term Training on Diagnosis of Parasitic Diseases, 12-17 Dec, 2011.
34. Short Term Training on Diagnosis and Control of Emerging and Important Foodborne Infections
and Intoxications, 12-19 Dec, 2011.
35. Short Course on Nutritional Interventions for Improving Reproductive Efficiency in Dairy Cattle, 13-
17 Dec, 2011.
36. Short Term Training on Art of Disease Investigation, 19-23 Dec, 2011.
37. Short Term Training on Art of Disease Investigation, 26-30 Dec, 2011.
38. Short Term Training on Art of Disease Investigation, 2-6 Jan, 2012.
39. Short Term Training on Mycotoxin and other Feed Poison and their Diagnosis, 8-13 Jan, 2012.
40. Short Term Training on Cross Farming of Livestock, 9-10 Jan, 2012.
41. Short Term Training on Art of Disease Investigation, 9-13 Jan, 2012.
42. Short Term Training on Art of Disease Investigation, 16-20 Jan, 2012.
43. Short Term Training on Animal Disease Diagnosis and their Treatment, 16-23 Jan, 2012.
44. Short Term Training on Animal Health, Breed Improvement and Fodder Management in Dairy
Animals, 18-20 Jan, 2012.
45. NABARD Sponsored Training Programme on Ms;jh Ik"kqvksa esa LokLF; izcU/ku uLy lq/kkj ,oa vkgkj izcU/ku, 27-28 Jan, 2012
46. Short Term Training on Art of Disease Investigation, 30 Jan -3 Feb, 2012.
47. NABARD Sponsored Training Programme on Ms;jh Ik"kqvksa esa LokLF; izcU/ku,1-3 Feb, 2012.48. Short Term Training on Animal Health, Breed Improvement and Fodder Management in Dairy
Animals, 5-7 Feb, 2012.
49. Short Term Training on Animal Health, Breed Improvement and Fodder Management in Dairy
Animals, 9-11 Feb, 2012.
50. Advanced Short Course on Newer Approaches for Feed Security and Safety, 9-29 Feb, 2012.
51. Short Term Training on Information and Communication Technology Application, 13-20 Feb, 2012.
52. Short Term Training on Animal Health, Breed Improvement and Fodder Management in Dairy
Animals, 15-17 Feb, 2012.
53. International Training Course on Gene Based Techniques for Research in Biotechnology, 20 Feb -
11 March, 2012.
54. CAFT Short Course on Livestock Production and Health under Impending Climate Change, 28 Feb -
19 March, 2012.
55. XXXVIII NDEHMS Course, Feb, 2012.
56. Short Term Training on Animal Disease Control and Management, 12-19 March, 2012.
57. Short Term Training on Radiology and Ultrasonography, 12-26 March, 2012.
58. Short Term Training on Animal Health, Breed Improvement and Fodder Management in Dairy
Animals, 16-18 March, 2012.
59. Short Term Training on Milk Production, Milk Products, Control of Milk Quality and Value Addition
of Milk Products, 20-22 March, 2012.
60. National Workshop cum Training Programme on In-silico Approach for Genome Analysis, 22-24
March, 2012.
61. Short Term Training on Milk Production, Milk Products, Control of Milk Quality and Value Addition
of Milk Products, 24-26 March, 2012.
160
14. DISTINGUISHED VISITORS
1. Dr. A.B. Negi, National Project Coordinator,
ECTAD - India, FAO
2. Dr. A.J. Kachhia Patel Director of A.H., Gujarat
3. Dr. A.K. Bakshi, Vice chancellor, Sardar
V.B.P.U.A.&T., Meerut
4. Dr. A.K. Srivastava, Director & VC, NDRI,
Karnal
5. Dr. A.S. Nanda, Animal Husbandry
Commissioner, Govt. of India, New Delhi
6. Dr. Akhilesh Kumar Pandey, Chairman, MP
Private University Regulatory Authority, Bhopal
7. Dr. Amresh Kumar, Ex.-Dean, College of Vety.
Science, GBPUA&T, Pantnagar & DG, KCMT,
Bareilly
8. Dr. Anil. P. Joshi, Executive Director, HESCO,
Uttarakhand
9. Dr. Anjani Kumar Director, CPCSEA, Ministry
of Environment & Forests, Govt. of India
10. Dr. Arun Varma, Ex- ADG (AN&P), ICAR, New
Delhi
11. Dr. Arvind Kumar, DDG (Edn.), ICAR, New
Delhi
12. Dr. Bhushan Jayrao, Director, ADL,
Pensylvania State University, USA
13. Dr. Bryan Charleston and Dr. Don King, Institute
of Animal Health, Pirbright, UK
14. Dr. C. Rajkhowa, Director, NRC on Mithun,
Nagaland
15. Dr. D. Swarup, Director, CIRG, Makhdoom,
Mathura
16. Dr. Gaya Prasad, ADG (AH), ICAR, New Delhi
17. Dr. Gress Bevier Bill & Melina Gates
Foundation
18. Dr. Guss Koch, Central Veterinary Institute of
Wageningen UR, Department of Virology,
Netherlands
19. Dr. H Rahman, Project Director, PD-ADMAS,
Bangalore
20. Dr. John Weaver, Team Leader, ECTAD - India,
FAO
21. Dr. K.K. Saha, Director (ARD Department),
Govt. of West Bengal.
22. Dr. K. Saha Director of A.H. & V.S., West
Bengal
23. Dr. K.M.L. Pathak Dy. Director General, ICAR,
New Delhi
24. Dr. Lesley Hepwe BBSRC, UK
25. Dr. M.L. Madan, Ex-DDG (AS), ICAR and Ex-
VC, UPPDDUPCVV Evam GAS, Mathura
26. Dr. M.P. Yadav, Ex-Director, IVRI and Ex-VC,
SVPUA&T, Meerut
27. Dr. M.V. Subba Rao, National Project
Consultant, FAO, New Delhi, India
28. Dr. Madhur Dhingra, National Consultant
(Epidemiologist), ECTAD - India, FAO
29. Dr. Michael Johnson, Head of Laboratory,
Institute of Animal Health, Surrey, UK
30. Dr. N.N. Pathak, Ex-Director, CIRB, Hisar
31. Dr. O.P. Dhanda, Ex-ADG, ANP, ICAR, New
Delhi
32. Dr. P.P. Bhat, Director, ICAR-RCER, Patna
33. Dr. P.K. Uppal, Ex-Director, NRCE, Hisar
34. Dr. R.B. Singh President, NAAS
35. Dr. R.C. Agarwal, National Coordinator, National
Agriculture Innovation Project, New Delhi
36. Dr. Robert Norgren, Global Head, Biologics
Research & Development, Merial Ltd., USA
37. Dr. S.K. Dewedi, Ex-Director NRC Equine
38. Dr. S. Ayyappan, DG, ICAR and Secretary,
DARE, New Delhi.
39. Dr. S.K. Garg, Ex-VC, UPPDDUPCVV Evam
GAS, Mathura & Director CAE&HS, Meerut.
40. Dr. S.K. Sharma V.C., H.P.K.V., Palampur
41. Dr. S.N. Maurya, Ex-VC, UPPDDUPCVV Evam
GAS, Mathura
42. Dr. Shyam Kumar Sharma, Vice Chancellor ,
CSKHPKV, Palampur, Himachal Pradesh
43. Dr. Subhash Morzaria, Regional Manager,
FAO-Emergency Center for Transboundary
Animal Diseases (Asia and Pacific), Bangkok
44. Dr. Takeshi Onodera, Assistant Professor,
Ultra Biology Lab, Department of Electronics,
Kyushu University, Fukuoka, Japan.
45. Dr. Toby Heath Galigan, Conservation Scientist
(RSPB), Dr Ananya Mukherjee (RSPB), Ms
Janki Teli (BNHS) and Mr Mandar Kulkarni
(BNHS)
46. Dr. V.K. Taneja ,VC, GADVASU, Ludhina
47. Hon. Dr. Charandasji Mahant, MoS, Agriculture
& Food Processing Industries, Govt. of India
48. Prof. B.B. Mallick, Ex. VC, WBUAFS, Kolkata
49. Prof. Duncan Masken University of Cambridge,
UK
50. Prof. Fiona Tomley and Dr. Dave Blake, Royal
Veterinary College, London, UK
51. Prof. M.J. Modayil Member, ASRB, New Delhi
52. Shri P.G. Bhatol, Chairman, Gujarat State Milk
Marketing Federation, Anand.
53. Shri Raj Kumar, IPS D.I.G./S.S.P., Bareilly
161
15. IVRI PERSONNEL (2011-12)
ADMINISTRATION - IZATNAGAR CAMPUS
1. Prof. M.C. Sharma Director &
Vice-Chancellor
2. Dr. Triveni Dutt JD (Extension Edn.)
3. Dr. Rishendra Verma JD (CADRAD)
4. Dr. J.M. Kataria JD (Research)
5. Dr. V.P. Singh JD (Academic)
(w.e.f. 03.05.2011)
6. Dr. S.V.S. Malik Scientific Secretary
to Director
7. Dr. Rupasi Twari Scientific Secretary
to Director
(up to 05.01.12)
8. Dr. Uma Shankar Scientific
Coordinator,
Deemed University
(up to 31.07.2011)
9. Dr. S.K. Mendiratta Scientific
Coordinator,
Deemed University
(w.e.f. 01.08.2011)
10. Dr. K.N. Bhilegaonkar Principal Scientist
Joint Directorate of
Research
11. Shri Rakesh Kumar C A O
(up to 18.04.11)
12. Shri S. Saha C A O
(w.e.f. 18.04.11)
13. Shri U.C. Prasad CAO & Registrar
(w.e.f. 23.11.11)
14. Shri G.R. Deshbandhu JD (Admn.) &
Registrar
(on deputation)
15. Shri D.D. Verma Comptroller
(up to 18.04.11)
16. Shri Pankaj Kumar SAO
17. Shri Vampad Sharma A O
18. Shri G.C. Pant SF&AO
19. Shri Ravindra Kumar F&AO
(w.e.f. 30.04.11)
20. Shri Ashish Srivastava F&AO
(w.e.f. 31.05.11)
21. Shri R.B. Saxena AAO
(up to 08.04.11)
22. Shri S.K. Saxena AAO
(up to 31.01.12)
23. Shri S.P. Pandey AO (up to 29.02.12)
24. Smt. Usha Pandey AAO
25. Shri P.C. Karnatak AAO
26. Shri Z.A. Khan AAO
(up to 30.11.11)
27. Shri H.C. Pandey AAO
28. Smt. Sujatha Jethi Asstt. Director
(Official
Language)
29. Dr. (Smt.) Shashi Rani Asstt. Professor
Saxena (English)
30. Shri P.S. Jina AAO
31. Shri S.N. Singh AAO
32. Shri D.S. Negi AAO
33. Shri M.C. Nagoi AAO
34. Shri Anil Joshi AAO
35. Shri G.C. Tiwary AAO (w.e.f. 09.04.11)
36. Shri B.S. Jakhwal AAO (w.e.f. 26.07.11)
37. Shri B.S. Rana AAO (w.e.f. 26.07.11)
38. Shri A.D. Sunori AAO (w.e.f. 26.07.11)
39. Shri O.P. Saxena AAO (w.e.f. 26.07.11)
40. Shri Chandra Prakash AAO (w.e.f. 29.12.11)
41. Shri G.S. Bisht AAO (w.e.f. 13.02.12)
MUKTESWAR CAMPUS
1. Dr. A.B. Pandey Head, Virology &
Station In-charge
2. Shri J.D. Suntha AAO
3. Shri Amar Nath AAO
BANGALORE CAMPUS
1. Dr. R. Venkataramanan Joint Director
2. Shri B. Riyaz Ahmed AAO
3. Smt. G.S. Rajalaxmi Private Secretary
4. Dr. S. Srinivas Medical Officer
5. Mrs. B. Dakshyayini AAO
6. Shri K. Ravindranathan AAO (w.e.f. 02.01.12)
REGIONAL STATION, PALAMPUR
1. Dr. O.P. Sharma Principal Scientist &
In-charge
REGIONAL STATION, KOLKATA
1. Dr. S.C. Das Principal Scientist &
Station In-chargre
HSADL, BHOPAL
1. Dr. S.C. Dubey Joint Director
(up to 31.10.11)
2. Dr. D.D. Kulkarni Actg. Joint Director
(w.e.f. 01.11.11)
3. Shri S. K. Gupta A O
4. Shri M.K.M. Nair AAO
5. Shri B.K. Kanchan AF&AO
DIVISION OF BACTERIOLOGY & MYCOLOGY
1. Dr. R.K. Agarwal MVSc, PhD
Principal Scientist
Actg. Head
(w.e.f. 03.05.11)
2. Dr. P. Chaudhuri MVSc, PhD
Senior Scientist
3. Dr. Rajneesh Rana MVSc, PhD
Senior Scientist
4. Dr. K.N. Viswas MVSc, PhD
Senior Scientist
5. Dr. S. K. Gupta MVSc, PhD
Scientist
6. Dr. Sabrinath T. MVSc
Scientist
7. Dr. Abhishek MVSc
Scientist
8. Dr. Prasad Thomas MVSc
Scientist
162
DIVISION OF BIOLOGICAL PRODUCTS
1. Dr. V.K. Chaturvedi MVSc, PhD
Principal Scientist &
Head
2. Dr. P.C. Verma MVSc, PhD
Principal Scientist
(up to 29.02.12)
3. Dr. P. Das MVSc, PhD
Principal Scientist
4. Dr. R. P. Singh MVSc, PhD
Senior Scientist
5. Dr. Bina Mishra MVSc, PhD
Senior Scientist
6. Dr. R. Saravanan MVSc, PhD
Scientist
7. Dr. C.L. Patel MVSc, PhD
Scientist
8. Dr. S. Chakravarti MVSc
Scientist
(w.e.f. 21.06.11)
Technical Staff:
1. Er. Gopal Tandon M.Tech.
T-9
CENTRE FOR ANIMAL DISEASE RESEARCH AND
DIAGNOSIS
1. Dr. Rishendra Verma MVSc, PhD
Joint Director
2. Dr. Rajendra Singh MVSc, PhD
Principal Scientist
3. Dr. K.P. Singh MVSc, PhD
Principal Scientist
4. Dr. Dinesh Chandra MVSc, PhD
Principal Scientist
5. Dr. B.R. Singh MVSc, PhD
Principal Scientist
6. Dr. S. Nandi MVSc, PhD
Senior Scientist
7. Dr. A.G. Telang MVSc, PhD
Senior Scientist
8. Dr. Rajesh Rathore MVSc, PhD
Scientist (Sr. Scale)
9. Dr. Vishal Chander MVSc
Scientist
10. Dr. Chandan Prakash MVSc
Scientist
EPIDEMIOLOGY SECTION
1. Dr. D.K. Sinha MVSc, PhD
Senior Scientist &
Incharge
DIVISION OF MEDICINE
1. Dr. U. Dimri MVSc, PhD, MBA
Principal Scientist &
Head
(w.e.f. 06.06.2011)
2. Dr. S. Dey MVSc, PhD
Principal Scientist &
Actg. Head
(up to 05.06.2011)
3. Dr. Reena Mukherjee MVSc, PhD
Senior Scientist
4. Dr. D.B. Mondal MVSc, PhD
Senior Scientist
5. Dr. V.K. Gupta MVSc, PhD
Senior Scientist
6. Dr. Pankaj Kumar MVSc, PhD
Scientist
7. Dr. U.K. De MVSc, PhD
Scientist
8. Dr. K. Mahendran MVSc
Scientist
VETERINARY POLYCLINIC
1. Dr. S. Dey MVSc, PhD
Principal Scientist &
Coordinator
2. Dr. K.L. Khurana MVSc, PhD
Sr. Scientist
3. Dr. N.P. Kurade MVSc, PhD
Sr. Scientist
WILDLIFE SECTION
1. Dr. A.K. Sharma MVSc, PhD
Principal Scientist &
In-Charge
2. Dr. Mohini Saini MSc, PhD
Senior Scientist
3. Dr. Asit Das MVSc, PhD
Senior Scientist
DIVISION OF PARASITOLOGY
1. Dr. B.P. Singh MVSc, PhD
Principal Scientist &
Actg. Head
(upto 07.06.2011)
2. Dr. P.S. Banerjee MVSc, PhD
Principal Scientist &
Head
(w.e.f. 08.06.2011)
3. Shri S.C. Gupta MSc, MPhil
Principal Scientist
4. Dr. G.C. Bansal MVSc, PhD
Principal Scientist
5. Dr. D.D. Ray MVSc, PhD
Principal Scientist
6. Dr. A. Prasad MSc, DPhil
Principal Scientist
7. Dr. S. Ghosh MSc, PhD
Principal Scientist
8. Dr. S. Samanta MVSc, PhD
Senior Scientist
9. Dr. O.K. Raina MSc, PhD
Senior Scientist
10. Dr. A.K. Tewari MVSc, PhD
Senior Scientist
11. Dr. B.C. Saravanan MVSc, PhD
Senior Scientist
12. Dr. Rajat Garg MVSc, PhD
Senior Scientist
13. Dr. Hira Ram MVSc, PhD
Scientist
DIVISION OF PATHOLOGY
1. Dr. R. Somvanshi MVSc, PhD, FRVCS
(Sweden)
Principal Scientist &
Head
163
2. Dr. R.B. Rai MVSc, PhD
Principal Scientist
3. Dr. S.D. Singh MVSc, PhD
Principal Scientist &
I/C A.D. Section
4. Dr. A.K. Sharma MVSc, PhD
Principal Scientist
5. Dr. G. Sai Kumar MVSc, PhD
Senior Scientist
6. Dr. K. Dhama MVSc, PhD
Senior Scientist
7. Dr. Monalisa Sahoo MVSc
Scientist
Technical Staff
1. Shri B.K. Das (Dip. Photography)
T-6
DIVISION OF PHARMACOLOGY & TOXICOLOGY
1. Dr. S.K. Mishra BVSc & AH, MSc, PhD
Principal Scientist &
Head
2. Dr. S.K. Tandan MVSc, PhD
Principal Scientist
3. Dr. S.N. Sarkar MVSc, PhD
Principal Scientist
4. Dr. Dinesh Kumar MVSc, PhD
Principal Scientist
5. Dr. Thakur Uttam Singh MVSc, PhD
Scientist
6. Dr. Dhirendra Kumar MVSc
Scientist
7. Dr. S. Kalpana MVSc, PhD
Scientist
8. Dr. Subhashree Parida MVSc
Scientist
9. Dr. P. Sankar MVSc
Scientist
DIVISION OF STANDARDISATION
1. Dr. Rishendra Verma MVSc, MSc,
(Immunol, U.K.), PhD
Principal Scientist &
Actg. Head
2. Dr. P. Dhar MVSc, PhD
Senior Scientist
3. Dr. Mayank Rawat MVSc, PhD
Senior Scientist
4. Dr. Haridas Karmakar MVSc, PhD
Senior Scientist
5. Dr. Lata Jain MVSc
Scientist
(On study leave)
6. Dr. Vikramaditya Upmanyu MVSc, PhD
Scientist
DIVISION OF SURGERY
1. Dr. M.M.S. Zama MVSc, PhD
Head
2. Dr. A.K. Sharma MVSc, PhD
Principal Scientist
3. Dr. M. Hoque MVSc, PhD
Principal Scientist
4. Dr. P. Kinjavdekar MVSc, PhD
Principal Scientist
5. Dr. Naveen Kumar MVSc, PhD
Principal Scientist
6. Dr. A.M. Pawde MVSc, PhD
Principal Scientist
7. Dr. Amarpal MVSc, PhD
Senior Scientist
8. Dr. H.P. Aithal MVSc, PhD
Senior Scientist
9. Dr. S.K. Maiti MVSc, PhD
Senior Scientist
10. Dr. Rekha Pathak MVSc, PhD
Senior Scientist
11. Dr. A.C. Saxena MVSc
Scientist
12. Dr. Aswathi Gopinathan MVSc, PhD
Scientist
DIVISION OF VETERINARY PUBLIC HEALTH
1. Dr. Ashok Kumar MVSc, PhD
Principal Scientist &
Head
2. Dr. S.V.S. Malik MVSc, PhD
Principal Scientist
3. Dr. D.K. Singh MVSc, PhD
Principal Scientist
4. Dr. K.N. Bhilegaonkar MVSc, PhD
Principal Scientist
5. Dr. R.S. Rathore MVPH, PhD
Senior Scientist
6. Dr. D.B. Rawool MVSc, PhD
Sr. Scientist
DIVISION OF VIROLOGY, MUKTESWAR
1. Dr. A.B. Pandey MVSc, PhD
Head &
Station Incharge
2. Dr. V. Bhanuprakash MVSc, PhD
Principal Scientist
(up to 12.08.11)
3. Dr. B. Mondal MVSc, PhD
Senior Scientist
4. Dr. Y.P.S. Malik MVSc, PhD
Senior Scientist
5. Dr. D. Muthuchelvan MVSc, PhD
Senior Scientist
6. Dr. S.B. Shivachandran MVSc, PhD
Senior Scientist
7. Dr. M.A. Ramakrishnan MVSc, PhD
Senior Scientist
8. Dr. S.K. Biswas MVSc
Scientist
9. Dr. S. Chakravarti MVSc
Scientist
(upto 07.06.11)
10. Dr. Gnanavel V. MVSc
Scientist
11. Dr. K.K. Rajak MVSc, PhD
Scientist
12. Dr. S.B. Sudhakar MVSc
Scientist
13. Dr. P.N. Gandhale MVSc
Scientist
14. Dr. K.C. Negi MVSc
Scientist
164
Technical Staff:
1. Shri D.C. Joshi Diploma (Elect. Engg.)
T-9 (TO)
2. Shri Hari Om Gangwar MSc (Agro.)
T-6 (TO)
3. Shri T.L. Banker MLib Sci, BEd &
Dip (Agri.), T-6 (TO)
DIVISION OF TEMPERATE ANIMAL HUSBANDRY,
MUKTESWAR
1. Dr. A.K. Sharma MVSc, PhD
Senior Scientist &
Incharge
2. Dr. P. Thirumurugan MVSc, PhD
Senior Scientist
3. Dr. B. Sahoo MVSc, PhD
Senior Scientist
4. Dr. K. Narayanan MVSc, PhD
Senior Scientist
5. Dr. Vikash Chandra MVSc, PhD
Scientist
6. Dr. M. Sankar MVSc, PhD
Scientist
EXTENSION EDUCATION SECTION, MUKTESWAR
1. Dr. Vikash Chandra MVSc, PhD
Actg. In-charge
DIVISION OF VETERINARY BIOTECHNOLOGY
1. Dr. B.P. Mishra MVSc, PhD
Principal Scientist &
Head
2. Dr. Satish Kumar MSc, PhD
Principal Scientist
3. Dr. P.P. Goswami MSc, PhD
Principal Scientist
4. Dr. A.K. Tiwari MVSc, PhD
Principal Scientist
5. Dr. P.K. Gupta MVSc, PhD
Senior Scientist
6. Dr. G.S. Desai MVSc, PhD
Senior Scientist
(w.e.f. 21.12.11)
7. Dr. G.V.P.P.S. Ravi Kumar MVSc, PhD
Senior Scientist
8. Dr. S.K. Dhara MVSc, PhD
Sr. Scientist
9. Dr. C. Madhan Mohan MVSc, PhD
Scientist (Sr. Scale)
10. Dr. Sohini Dey MVSc, PhD
Scientist (Sr. Scale)
11. Dr. Sameer Srivastava MVSc, PhD
Scientist
12. Dr. Deepak Kumar MVSc, PhD
Scientist
13. Dr. Sonal MVSc, PhD
Scientist
14. Dr. Ajay Kumar MVSc, PhD
Scientist
15. Dr. Aditya P. Sahoo MVSc
Scientist
16. Dr. Jowar Doley MVSc
Scientist
(up to 20.01.12)
Technical Staff:
1. Dr. P.K. Bhatnagar MSc, PhD, T-9
2. Shri Surendra Nath MSc, T-9
3. Shri Sudesh Kumar MSc, T-9
4. Shri Narsingh Prasad MSc, T (7-8)
IMMUNOLOGY SECTION
1. Dr. T.K. Goswami MVSc, PhD
Principal Scientist &
In-charge
2. Dr. Alka Tomar MVSc, PhD
Principal Scientist
3. Dr. S. Dandapat MVSc, PhD
Senior Scientist
4. Dr. Mithilesh Singh MVSc, PhD
Scientist
I.V.R.I. CAMPUS, BANGALORE
1. Dr. R. Venkataramanan MVSc, PhD
Joint Director
2. Dr. V.V.S.Suryanarayana MSc, PhD
Principal Scientist
3. Dr. Subodh Kishore MVSc, PhD
Principal Scientist
4. Dr. G.R. Reddy MSc, PhD
Principal Scientist
5. Dr. V. Bhanuprakash MVSc, PhD
Principal Scientist
(w.e.f. 16.08.11)
6. Dr. S.H. Basagoudanavar MVSc, PhD
Sr. Scientist
7. Dr. B.P. Sreenivasa MVSc, PhD
Senior Scientist
8. Dr. K. Ganesh MVSc, PhD
Senior Scientist
9. Dr. N. Banumathi MSc
Senior Scientist
10. Dr. H.J. Dechamma MVSc, PhD
Sr. Scientist
11. Dr. Madhusudan Hosmani MVSc, PhD
Sr. Scientist
12. Dr. P. Saravanan MVSc, PhD
Scientist (Sr. Scale)
13. Dr. S. Chandra Sekar MVSc, PhD
Scientist
14. Dr. R.P. Tamil Selvan MVSc, PhD
Scientist
Technical Staff:
1. Mr. A.M. Mathur PG Dip. (Ref.)
T-9
2. Shri A. Sadashivam PG Dip.(Med. Equip.)
T-9
3. Dr. Sakey Srinivas MBBS, MD
Medical Officer
T (7-8)
4. Shri B. Somasundaram Dip. (Elec. Engg.)
T (7-8)
5. Shri A. Rajendran MSc (Zool.)
T (7-8)
6. Shri S. Krisnamurthy BE (Instrumen.)
T-6
7. Shri H.R. Narayana BSc
T-6 (Lab.)
(up to 31.12.11)
165
8. Shri V.C. Hiremath BE (Civil)
T-6 (JE, Civil)
9. Shri Siddaraju BSc (Ag)
T-6 (Lab.)
I.V.R.I. REGIONAL STATION, KOLKATA
1. Dr. S.C. Das MVSc, PhD
Principal Scientist &
Station In-chargre
2. Dr. U.K. Bandyopadhyay MVSc,PhD
Principal Scientist
3. Dr. S. Bandyopadhaya MVSc, PhD
Senior Scientist
4. Dr. S. Naskar MVSc, PhD
Senior Scientist
5. Dr. R.N. Roy MVSc, PhD
Senior Scientist
6. Dr. D. Bhattacharya MVSc, PhD
Senior Scientist
(up to 12.05.11)
7. Dr. B.C. Das MVSc, PhD
Senior Scientist
(w.e.f. 16.11.11)
8. Dr. P. Dandapat MVSc, PhD
Senior Scientist
9. Dr. P.K. Nanda MFSc, PhD
Scientist (SG)
10. Dr. A.K. Bera MVSc, PhD
Scientist (Sr. Scale)
(up to 25.04.11)
11. Dr. S. Bandyopadhyay MVSc, PhD
Scientist (Sr. Scale)
(w.e.f. 29.10.11)
DIVISION OF ANIMAL GENETICS
1. Dr. Deepak Sharma MVSc, PhD
Principal Scientist &
Head (w.e.f. 25.01.12)
2. Dr. Bharat Bhushan MSc, PhD
Principal Scientist &
Actg. Head
(up to 24.01.12)
3. Dr. Pushpendra Kumar MSc, PhD
Principal Scientist
4. Dr. Ran Vir Singh MSc, PhD
Senior Scientist
5. Dr. Abhijit Mitra BVSc & AH
MSc, PhD
National fellow
(w.e.f. 06.06.11)
6. Dr. Subodh Kumar MSc, PhD
Senior Scientist
7. Dr. Amit Kumar BVSc & AH
MSc, PhD
Scientist
8. Dr. Sivamani B. MVSc
Scientist
9. Dr. Arvind Sonwane MVSc, PhD
Scientist
10. Dr. Anuj Chauhan MVSc
Scientist
(on study leave)
11. Dr. Manjit Panigrahi MVSc, PhD
Scientist
CENTRAL DATA CELL
1. Shri C.L. Suman MSc
Principal Scientist &
In-charge
(up to 19.08.11)
LIVESTOCK PRODUCTION & MANAGEMENT
SECTION
1. Dr. Uma Shankar MVSc, PhD
Principal Scientist &
Incharge
(up to 31.07.11)
2. Dr. Bharat Bhushan MSc, PhD
Principal Scientist &
Incharge (w.e.f.
01.08.11)
3. Dr. G.K. Gaur MSc, PhD
Principal Scientist
(w.e.f. 06.04.11)
4. Dr. A.K. Verma MSc(Ag), PhD
Principal Scientist
5. Dr. T.A. Khan MSc, PhD
Senior Scientist
6. Dr. A.K.S. Tomar MSc, PhD
Senior Scientist
7. Dr. Sanjeev Mehrotra MVSc, PhD
Senior Scientist
8. Dr. Mukesh Singh M. Tech, PhD
Senior Scientist
9. Dr. S.K. Singh MVSc, PhD
Senior Scientist
10. Dr. S.K. Mondal MSc (Dairy), PhD
Senior Scientist
11. Dr. Om Singh MSc (Agro.), PhD
Senior Scientist
12. Dr. B.H.M. Patel MVSc, PhD
Senior Scientist
13. Dr. H.O. Pandey MVSc
Scientist
Technical Staff:
1. Shri R.P. Verma MSc(Ag)
T-9
2. Shri Alok Mathur MSc, PGDCA
T-7/8
3. Shri S.B. Singh MSc
T-7/8
DIVISION OF ANIMAL REPRODUCTION
1. Dr. S.K. Agarwal MVSc, PhD
Principal Scientist &
Head
2. Dr. Uma Shanker MVSc, PhD
Principal Scientist
(Up to 31.07.11)
3. Dr. H. Kumar MVSc, PhD
Principal Scientist
4. Dr. S.K. Srivastava MVSc, PhD
Principal Scientist
5. Dr. S. Mahmood MVSc, PhD
Principal Scientist
6. Dr. S.K. Ghosh MVSc, PhD
Senior Scientist
7. Dr. G.K. Das MVSc, PhD
Senior Scientist
166
8. Dr. J.K. Prasad MVSc, PhD
Senior Scientist
Technical Staff:
1. Dr. R.P. Tripathi MSc(Ag), PhD
T(7-8)
DIVISION OF ANIMAL NUTRITION
1. Dr. D.N. Kamra MSc, PhD
Principal Scientist &
Head & Professor-
cum-Director, CAFT
2. Dr. R. S. Dass MSc, PhD
Principal Scientist
3. Dr. A.K. Garg MSc(AH), PhD
Principal Scientist
4. Dr. L.C. Chaudhary MSc(Ag), PhD
Principal Scientist
5. Dr. Putan Singh MSc(AN), PhD
Principal Scientist
6. Dr. A.K. Pattanaik MVSc, PhD
Senior Scientist
7. Dr. Narayan Dutta MSc(Ag), PhD
Senior Scientist
8. Dr. V.B. Chaturvedi MSc(Ag), PhD
Senior Scientist
9. Dr. S.K. Saha MVSc, PhD
Senior Scientist
Technical Staff:
1. Dr. Neeta Agarwal MSc, PhD
T-9
2. Dr. Avneesh Kumar MSc, PhD
T-9
3. Shri Ram Singh BSc (Ag), MA
T-7/8
4. Shri R.K. Mishra BSc(Ag &AH)
T-7/8
5. Shri Rajendra Singh MSc
T-6
DIVISION OF PHYSIOLOGY & CLIMATOLOGY
1. Dr. G. Taru Sharma MSc, PhD
Principal Scientist &
Head-cum-Director,
CAFT
2. Dr. Puneet Kumar MSc, PhD
Principal Scientist
3. Dr. V.P. Maurya MSc., PhD
Sr. Scientist
(w.e.f. 12.05.11)
4. Dr. Sadhan Bag MVSc, PhD
Senior Scientist
5. Dr. Gyanendra Singh MVSc, PhD
Senior Scientist
6. Dr. Mihir Sarkar MSc, PhD
Senior Scientist
7. Dr. B.C. Das MVSc, PhD
Senior Scientist
(up to 16.11.11)
8. Dr. N.H. Mohan PhD
Senior Scientist
(up to 30.01.12)
Technical Staff:
1. Shri M.C. Pathak MSc (Env. Sci.)
T (7-8)
BIOCHEMISTRY SECTION
1. Dr. Bhaskar Sharma MSc, PhD
National Professor
2. Dr. P. Joshi MSc, PhD
Principal Scientist &
In-charge
3. Dr. Meena Kataria MSc, PhD
Principal Scientist
4. Dr. Sanjeev Bhure MVSc, PhD
Senior Scientist
5. Dr. Sujata Sahoo MVSc, PhD
Scientist
6. Dr. Karuna MVSc
Scientist
JOINT DIRECTORATE OF EXTENSION EDUCATION
1. Dr. Triveni Dutt MSc, PhD
Joint Director
2. Dr. B.P. Singh MSc, PhD
Senior Scientist
3. Dr. Rupasi Tiwari MSc, PhD
Senior Scientist
Technical Staff:
1. Dr. M.S. Rathore MSc, PhD
T (8-9)
2. Dr. Neeraj Srivastava MVSc; T( 7-8)
3. Dr. K.K. Mishra MVSc; T-6
4. Shri Atul Sachan MSc(Ag.); T-6
DIVISION OF EXTENSION EDUCATION
1. Dr. Mahesh Chander MSc, PhD
Principal Scientist &
Head (w.e.f. 24.01.12)
2. Dr. H.R. Meena MSc, PhD
Senior Scientist
KRISHI VIGYAN KENDRA (KVK)
1. Dr. Hema Tripathi MSc, PhD
Principal Scientist &
Programme
Coordinator
Technical Staff:
1. Mrs. M. Gupta MSc (Ext. Edn.)
T-9
2. Dr. S.S. Tomar MSc, PhD (Agron)
T-9
3. Dr. V.K. Solanki MSc, PhD
T -8
4. Shri Ranjeet Singh MSc (Hort)
T (7-8)
5. Shri K.L. Meena MSc, PhD (Ag. Ext.)
T (7-8)
6. Dr. Ranjana Gupta MSc, PhD; T-6
7. Shri M. Tomar MSc (Ag. Ext.); T-6
DIVISION OF LIVESTOCK ECONOMICS,
STATISTICS & INFORMATION TECHNOLOGY
1. Dr. B. Singh M. Stat., PhD
Principal Scientist &
Head (w.e.f. 06.06.11)
2. Dr. Shiv Prasad MSc, PhD
Principal Scientist
3. Dr. Med Ram Verma PhD (Statistics)
Sr. Scientist
4. Shri Dinesh Kumar MSc
Scientist (Sr. Scale)
167
Technical Staff:
1. Shri Ajay Shukla MSc; T(7-8)
2. Shri Om Prakash MA; T(7-8)
BIOPHYSICS, ELECTRON MICROSCOPY &INSTRUMENTATION SECTION
1. Dr. Praveen Singh MSc, PhD
Senior Scientist &
In-charge
HIGH SECURITY ANIMAL DISEASE LAB (HSADL),BHOPAL
1. Dr. S.C. Dubey MVSc, PhD
Joint Director
(Up to 31.10.11)
2. Dr. D.D. Kulkarni MVSc, PhD
Principal Scientist
Actg. Joint Director
(w.e.f. 01.11.11)
3. Dr. H.V. Murugkar MVSc, PhD
Senior Scientist
4. Dr. C. Tosh MVSc, PhD
Senior Scientist
5. Dr. N. Mishra MVSc, PhD
Senior Scientist
6. Dr. Sandeep Bhatia M.V.Sc, PhD
National Fellow
(w.e.f. 08.04.11)
7. Dr. A.A. Raut MVSc, PhD
Senior Scientist
8. Dr. K. Rajukumar MVSc, PhD
Scientist (Sr. Scale)
9. Dr. Richa Sood MVSc
Scientist (Sr. Scale)
10. Dr. S. Nagarajan MVSc, PhD
Scientist (Sr. Scale)
11. Dr. G. Venkatesh MVSc, PhD
Scientist (Sr. Scale)
12. Dr. A. Mishra MVSc, PhD
Scientist
13. Dr. Atul K. Pateria MSc
Scientist
14. Dr. Manoj Kumar MVSc, PhD
Scientist
15. Dr. Kalaiyarasu S. MVSc
Scientist
16. Dr. Sridevi, R. MVSc, PhD
Scientist
17. Dr. Senthil Kumar, D. MVSc
Scientist
Technical Staff:
1. Shri K.K. Gupta AMIE, M.Tech
T-9 (Sr. Engineer)
2. Shri R.K. Kaushik AMIE (Electronics)
T-9 (Instrumn. &
Control)
3. Mr. T.K. Ghosh MTech, BE(Elect),
MBA, T-9
4. Shri R.B. Srivastava BE (Civil),
ME (Civil), T-9
I.V.R.I. REGIONAL STATION, PALAMPUR
1. Dr. O.P. Sharma MSc, PhD
Principal Scientist &
In-charge
2. Dr. T.K. Bhat MSc, PhD
Principal Scientist
3. Dr. R. Bhar MVSc, PhD
Principal Scientist
4. Dr. Birbal Singh MSc, PhD
Senior Scientist
5. Dr. U.S. Pati MVSc, PhD
Senior Scientist
6. Dr. V. Umapathi MVSc, PhD
Senior Scientist
7. Dr. A. Kannan MVSc, PhD
Senior Scientist
8. Dr. Rinku Sharma MVSc, PhD
Scientist
DIVISION OF LIVESTOCK PRODUCTS
TECHNOLOGY
1. Dr. B.D. Sharma MVSc, PhD
Principal Scientist &
Head
2. Dr. R.C. Keshri MVSc, PhD
Principal Scientist
(upto 31.07.11)
3. Dr. S.K. Mendiratta MVSc, PhD
Senior Scientist
4. Dr. Geeta Chauhan MSc, PhD
Senior Scientist
5. Dr. Rajiv R. Kumar MVSc
Scientist
6. Dr. G. Kandeepan MVSc, PhD
Scientist
7. Dr. Suman Talukder MVSc
Scientist
Technical Staff:
1. Shri R.L. Sagar MSc (Ag); T-9
AGRICULTURAL RESEARCH INFORMATION
SYSTEM (ARIS) CELL
1. Dr. Sanjay Kumar MSc, PhD
Senior Scientist &
In-charge
2. Shri Yash Pal Singh M C A
Scientist
JOINT DIRECTORATE OF RESEARCH
1. Dr. J.M. Kataria MVSc, PhD
Joint Director
2. Dr. K.N. Bhilegaonkar MVSc, PhD
Principal Scientis
3. Dr. H.P. Aithal MVSc, PhD
Senior Scientistt
4. Dr. Rajneesh Rana MVSc, PhD
Senior Scientist
Technical Staff:
1. Shri Ashutosh Soni MSc, PGDCA
T (7-8)
2. Dr. Beena Singh MSc (H.Sc.), PhD
T (7-8)
DEEMED UNIVERSITY
1. Dr. V.P. Singh MVSc, PhD
Joint Director
(Academic)
(w.e.f. 02.05.11)
168
2. Dr. Uma Shankar MVSc, PhD
Scientific Coordinator
(up to 31.07.2011)
3. Dr. S.K. Mendiratta MVSc, PhD
Scientific Coordinator
(w.e.f. 01.08.2011)
4. Dr. J.K. Prasad MVSc, PhD
Senior Scientist
(w.e.f. 16.08.11)
NATIONAL LIBRARY OF VETERINARY SCIENCES
(NLVS)
1. Dr. M. Hoque MVSc, PhD
Principal Scientist &
Coordinator
Technical Staff:
1. Shri S.S. Rawat MA, M Lib Sci
Officer-In-charge
T (7-8)
2. Shri Alok Kumar MSc, M Lib Sci
T (7-8)
3. Shri A.K. Saxena MA, M Lib Sci
T (7-8)
4. Shri K.N. Kandpal MSc (IT), M Lib Sci
MCA, T (7-8)
5. Shri U.E. Gaidhane M Lib Sci, T (7-8)
6. Shri G.C. Sharma MA, M Lib Sci., T6
7. Shri R.L. Bankar MA, M Lib Sci., T6
(w.e.f. 23.05.11)
COMMUNICATION CENTRE
1. Dr. Triveni Dutt MSc, PhD
Joint Director
(Extn. Edn.) &
Coordinator
Technical Staff:
1. Shri Kundan Singh DP. Tech., D. Photo
PGD, BM, MJ(C)
Officer-In-charge (T-9)
AGRICULTURAL TECHNOLOGY INFORMATION
CENTRE (ATIC)
1. Dr. Rupasi Tiwari MSc, PhD
Senior Scientist
& In-charge
Technical Staff:
1. Mrs. Madhurima MSc (Ext. Edn.)
Gupta T-9
2. Dr. K.K. Mishra MVSc
Vety. Officer (T-6)
ESTATE UNIT (Horticulture & Sanitation Sections)
1. Dr. Putan Singh MSc, PhD
Principal Scientist &
Coordinator
2. Shri Rakesh Pandey MSc (Agronomy) T-9
3. Shri Harkesh Meena MSc (Ag) T-6
FARM SECTION
1. Dr. Putan Singh MSc, PhD
Principal Scientist &
Coordinator
2. Shri Rakesh Pandey MSc (Agronomy)
Incharge, T-9
FARM WORKSHOP
1. Er. H.C. Joshi M Tech (FMP)
Principal Scientist
In-charge
FEED TECHNOLOGY UNIT
Technical Staff:
1. Er. S.S. Tripathi MSc (Ag. Engg.)
In-charge, T-9
(on study leave)
ENGINEERING SECTION
1. Dr. M. Hoque MVSc, PhD
Coordinator
(w.e.f. 07.05.11)
Technical Staff:
1. Shri G.N. Sharma Diploma (Elect)
In-Charge (T-9)
2. Shri S.K. Alekar G.D.Arch; Diploma
(Arch. Asstt.)
T-9 (Int. Design
Deco.)
3. Shri Rajeev Saxena BE (Mech.)
T-9
4. Shri B.K. Pandey Diploma (Elect.)
T (7-8)
5. Shri A.K. Singh BE (Civil)
T (7-8)
6. Shri J.C. Nogai Dip. (Elect.)
T-6
IVRI HUMAN HOSPITAL
1. Dr. S. Dey MVSc, PhD
Co-ordinator
Technical Staff:
1. Dr. Neerav Koherwal BSc, MBBS, MHA
Medical Officer & I/C
2. Dr. Amitabh Mishra MBBS, D.Ortho
Medical Officer
3. Dr. Bharti Singh MBBS, MD
Medical Officer
4. Dr. A. Goel MBBS
Medical Officer
5. Shri M.K. Sharma Diploma Radiology
T -9
GAMES AND SPORTS CELL
1. Dr. Ashok Kumar MVSc, PhD
Head, VPH Div.
Chairman
2. Dr. M. Hoque MVSc, PhD
Principal Scientist
Secretary
CENTRAL INSTRUMENTATION FACILITY
1. Dr. Satish Kumar MSc, PhD
Principal Scientist &
In-charge, CIF
(Biotech.)
2. Dr. G. Sai Kumar MVSc, PhD
Principal Scientist &
In-charge, CIF (MLB)
169
SCIENTISTS/ OFFICERS APPOINTED
1. Dr. K. Narayanan Sr. Scientist
(01.04.2011)
2. Dr. Deepak B. Rawool Sr. Scientist
(15.04.2011)
3. Dr. B.R. Singh Principal Scientist
4. Dr. R.P. Tamil Selvan Sr. Scientist
(20.05.11)
5. Dr. Manish Mahawar Sr. Scientist
(06.09.2011)
6. Dr. Samiran Scientist (SS)
Bandyopadhyay (29.11.2011)
7. Dr. I. Karuna Devi Scientist
(26.12.2011)
8. Dr. A. Kannan Sr. Scientist
(25.03.2011)
9. Dr. Manjeet Panigrahi Scientist
(21.11.2011)
10. Dr. V.P. Singh JD (Academic)
(w.e.f. 03.05.2011)
11. Dr. B. Singh Head, LES
(06.06.2011)
12. Dr. Umesh Dimri Head, Medicine
(06.06.2011)
13. Dr. P.S. Banerjee Head, Parasitology
Division (08.06.2011)
14. Dr. Mahesh Chander Head, Ext. Ed. Div
( 24.01.2012)
15. Dr. Deepak Sharma Head, AGB
(25.01.2012)
SCIENTISTS/OFFICERS SUPERANNUATED
1. Shri B.P. Sati, AAO 31.05.2011
2. Dr. Uma Shankar Pr. Sci 31.07.2011
3. Dr. R.C. Keshri, Pr. Sci 31.07.2011
4. Shri N.L. Verma, Pvt. Sec. 30.07.2011
5. Dr. C.L. Suman, Pr. Sci. 19.08.2011
6. Shri Z.A. Khan, AAO 30.11.2011
7. Shri S.K. Saxena, AAO 31.01.2012
8. Dr. B.P. Singh, Prin. Sci 31.01.2012
9. Shri S.P. Pandey, A.O. 28.02.2012
10. Dr. P.C. Verma, Prin. Sci 28.02.2012
SCIENTIFIC/TECHNICAL OFFICERS DEPUTED
ABROAD
1. Dr. Richa Sood Senior Scientist
2. Dr. B.P. Srinivasa Senior Scientist
3. Dr. D.D. Kulkarni Principal Scientist
4. Dr. M. Hosamani Scientist (SS)
5. Dr. R.R. Kumar Scientist
6. Dr. K. Raju Kumar Scientist (SS)
7. Dr. L.C. Chaudhary Principal Scientist
8. Dr. Deepak Kumar Scientist
9. Dr. Gyanendra Singh Senior Scientist
10. Dr. D.D. Ray Principal Scientist
11. Dr. S. Ghosh Principal Scientist
12. Dr. A.K. Tiwari Principal Scientist
13. Dr. V.P. Singh Principal Scientist,
JD(Acad)
14. Dr. Mahesh Chandra Principal Scientist
15. Dr. K.N. Bhilegaonkar Principal Scientist
16. Dr. S.K. Maiti Senior Scientist
17. Dr. Puneet Kumar Principal Scientist
18. Dr. Mohan N.H. Senior Scientist
19. Dr. A.K. Sharma Principal Scientist
20. Dr. C. Madhan Mohan Scientist, S.S
21. Dr. S.K Gupta Scientist
22. Shri K.K. Gupta T-9
23. Shri R.B. Srivastava T-9
24. Dr. S. Nandi Senior Scientist
25. Dr. H.R. Murugkar Senior Scientist
26. Dr. S. Nagarajan Scientist
27. Dr. Pallav Chaudhary Senior Scientist
28. Dr. Praveen Singh Senior Scientist
29. Dr. K.K. Rajak Scientist
PERSONS PROMOTED
Scientific Staff
S. Name Post held Promoted to
No. the post of
1. Dr. B.C. Saravanan Scientist Scientist (SS)
2. Dr. Rajesh Rathore Scientist (SS) Senior Scientist
3. Dr. G. Desai Scientist (SS) Senior Scientist
4. Dr. H.D. Karmakar Scientist (SS) Senior Scientist
Administrative staff
1. Shri B.S. Jakhwal Assistant AAO
2. Shri B.S. Rana Assistant AAO
3. Shri A.D. Sunori Assistant AAO
4. Shri O.P. Saxena Assistant AAO
5. Shri G.S. Bisht Assistant AAO
6. Shri G.C. Tiwari Assistant AAO
7. Shri K.C. Chauhan PA Private Secretary
8. Shri B.N. Pal PA Private Secretary
9. Shri A.K. Saxena PA Private Secretary
10. Shri G.S. Danu PA Private Secretary
11. Shri Sushil Kumar PA Private Secretary
12. Shri K.K. Tiwari PA Private Secretary
170
16. ANY OTHER RELEVANT INFORMATION SUCH AS
INFRASTRUCTURE DEVELOPMENT
HUMAN HOSPITAL, IVRI
Human Hospital is an integral part of IVRI, it
extended optimum medical facilities to the staff of
IVRI and CARI with focus on health and preventive
care, treatment, awareness and education, which was
well supported by radiology, pathology, nursing care,
pharmacy, dressing room assistance, indoor facility
and emergency care. The hospital is well equipped
with nebuliser, biochemistry auto-analyzer, short-wave
diathermy, urine chemistry analyzer,
electrocardiogram, ambulance, etc.
The hospital has attended 37,402 cases,
besides 167 emergency and 209 indoor cases.
Vaccination coverage to 1191 subjects was extended,
which included tetanus (694), measles (4), DPT (19),
oral polio (20) and anti-rabies (454). The clinical
investigations including 347 ECG, 1,405 X-rays, 1,483
diathermy and 12,463 clinical pathological
investigations were done. A total of 6,275 dressing
cases including 140 plaster cases were attended.
The hospital organized camps for bone mineral
density (241 patients), nerve conduction camp (114)
and pulmonary function test camp (75 patients).
Medical hospital also extended checkup facility in
Pashu Mela -2011, wherein 750 diabetic cases were
tested and 456 blood group, blood pressure 700, BMD
250 and spirometer 115 tests were done.
MEDICAL SECTION, BANGALURU
Medical section, Bangaluru provided better
and comprehensive health care of the employees of
I.V.R.I. staff, ADMAS staff, NBAII staff, TOT staff
and retired ICAR staff and their dependent family
members through primary health care approach
(Preventive, primitive, curative and rehabilitative care)
ENGINEERING SECTION, IZATNAGAR
Engineering section (Unit-I) provides basic
services like electricity, generator supply and EPABX
etc. to whole campus including residential buildings.
The following major works were undertaken and
services were provided to whole campus through out
the year:
* Running maintenance and operation of (2500+
1000) KVA, 33/11 KV Sub-station 01 N0, 11/
0.433 KV Sub station -07 No.
* Maintenance of external services, overhead lines,
street lights and compound light of the campus.
* Maintenance of internal electrical installations and
fans in residential and non- residential buildings.
* Maintenance of electrical and electronic
appliances/equipments including P.A system of
all laboratories and offices.
* Running Maintenance and operation of D/G sets
(1250 KVA 11 KV-01 No. , 320 KVA 440 Volt -
01 No. , 250 KVA 440 Volt -01 No., 180 KVA-01
No, 125 KVA-02 Nos.)
* Running, maintenance and operation of 600 lines
EPABX of the campus
* Running, maintenance and operation of sewage
pump behind fish pond (KVK farm).
* Minor addition and alteration works in different
buildings.
This section also provided all the related
services and infrastructure for organisation of Pashu
Vigyan Mela, symposia, seminars, etc held from time
to time by different Divisions of the Institute.
The number of complaints attended by different
wings of this section were electrical: 3765,
instrumentation: 350, EPABX: 450 and sub-station:
746.
This section (Unit-II) is responsible for
providing basic services like water supply, air
conditioning, carpentry work and repair of laboratory
equipment. This section also undertakes minor civil
works. The section attended mechanical jobs,
mechanical fabrications, carpentry jobs and masonry
repairs and plumbing work. This section has also
taken up civil repairs/ renovation works. The
refrigeration unit repaired refrigerators and deep
freezers, water coolers and BOD incubators, some
imported refrigeration machines, air conditioners
serviced and minor complaints of refrigerated have
been attended. The section maintained the AC plant
at NRL, BP Division LAR and Pathology and looked
after the cold room and deep freezer room at BP
Division, LPT Division and chilling plant at Dairy
Technology Section. Made all the arrangements
pertaining to this section for the successful completion
of 'Kisan Mela'. Special assignment of preparing online
examination hall for managing an online examination
system for NET/ARS-Prelim examination for ASRB,
ICAR was completed successfully.
FARM SECTION, IZATNAGAR
The fodder farm of the Institute comprises 140
hectares of fertile land. The land is divided into 12
plots inter-connected with underground irrigation
channels and concrete roads. Most of the plots have
quick and efficient drainage system of run-off water.
The farm section produces quality green fodder of
HYVs released under different fodder crops time to
time. Sorghum (single & multi-cut crops), Maize,
Makchari, Bajra, Cowpea, Oat and Berseem fodder
crops are grown at the farm round the year. The farm
171
section supplies green fodder daily to the Institute's
Cattle & Buffalo farm (LPM) and more than 20
experimental animal sheds of various Divisions. The
surplus green fodder is also conserved at the farm in
the form of "Hay" & "Silage" for its utilization in the
lean period. The Farm Section of the Institute has
three underground concrete silo pits of about 15,000
quintals green fodder capacity. These silage pits are
permanently covered by tubular steel and G.I. sheet
structure to ensure availability of safe and secure
storage even during rainy season. Farm Section is
maintaining about 5000 teak plants along the farm
road sides and at Field No. 13. Plantation of poplar
trees in the 25 acres of farm land at Field No. 18 and
19 are being managed nicely by this section. This
Section is also managing 200 Kinno plants along the
farm road sides. Farm Section has also prepared and
maintained 1000 square meters of high quality lawns
at Field No.9 and Farm Office.
Farm Section is equipped with 10 tractors, 9
deep irrigation tube-wells and adequate agricultural
machineries. All the irrigation tube-wells are inter-
connected by underground irrigation channels (Hume
pipes) spread throughout the farm area for better
application and utilization of available irrigation
potential.
FEED TECHNOLOGY UNIT
The Feed Technology Unit prepares and
supplies about 16,000 quintals of animal feed required
for animals used for research experiments like cows
and buffaloes, sheep and goats, pigs and laboratory
animals of Izatnagar and Mukteshwar Campuses.
The unit has automatic feed ingredient loading and
lifting unit, grinding unit (Hammer mill), mixing unit,
conveyor elevator unit, dust separation and collection
unit, go-downs and office-cum-feed plant building.
This year, the Unit has fabricated 5 nos. machines
named "Pashu Chokolater" (UMM Block making
machine) to facilitate efficient mass production of
Pashu Chokolates and thereby popularizing their use
among animal farmers and dairy entrepreneurs.
ZONAL TECHNOLOGY MANAGEMENT-
BUSINESS PLANNING & DEVELOPMENT (ZTM-
BPD) MEETING-CUM-WORKSHOP (NORTH
ZONE-II)
The ZTM-BPD unit has successfully
commercialized three technologies, Area specific
Mineral Mixture (ASMM) to M/s Margdarshak Social
Projects and Consulting Pvt. Ltd., Lucknow, Urea
Molasses Mineral Block (UMMB) to M/s Margdarshak
Social Projects and Consulting Pvt. Ltd, Lucknow
and Peste des Petits Ruminants (PPR) Hybridoma
clone 4b11 to control the quality during PPR Vaccine
production to M/s Intervet India Pvt. Ltd., Pune. ZTM-
BPD Unit received prestigious best National
Agribusiness Incubator Award from Dr. A.P.J. Abdul
Kalam, Former President and Eminent Scientist
during an International Conference organized by the
Network of Indian Agri-Business Incubators (NIABI),
Mr. Sukhjinder Singh of All India Development Trust
(AIDT), a registered member of ZTM-BPD Unit, IVRI
has received the Best Incubatee award during NIABI
Conference 2012 and Award for Excellent
Achievements at 7th Food and Technology Expo
2011 at Pragati Maidan, New Delhi
NATIONAL LIBRARY OF VETERINARY
SCIENCES, IZATNAGAR
IVRI Library is one of the biggest in veterinary
sciences, houses about 57,832 books, 4,989 theses,
3,987 reports and 1,97,380 bound volumes along with
issues of journals and other serial publications as on
31.03.2012. This year 378 books, 158 theses, 127
books received free and 11 Hindi books were added
to the holding of the library. The library remained open
from 9.00 am to 9.00 pm daily and from 8.00 am to
1.00 pm on holidays except national holidays. There
are 255 Scientists 710 MVSc. and Ph.D Students
and 175 other staff members as library members.
Acquisition of publications
Library subscribed 100 foreign journals and 101
Indian journals during the year 2012. Four Titles were
received on exchange/gratis basis.
Library automation
Many functions of the library are automated.
Libsys automation software version 4.0 on Linux
based server and is being used on LAN. The books,
theses, bound volumes of journals, other publications
and member identity cards are being bar-coded. The
circulation work is also automated using laser bar-
code reader.
CD-ROM services
A CD-Mirror Hybrid Server is being used for
CD-ROM services and the service is being provided
on LAN. The various life sciences databases are
available on CD Mirror Server. About 216 users were
trained for using the CD-ROM services themselves
and about 382 users availed CD-ROM facilities. A
revenue of Rs. 2206/- was generated by providing
printouts of CD-ROM databases to the users.
Besides, some print outs were provided by post to
scientists and students on their requisition received
from various parts of the country and revenue in the
shape of bank drafts amounting to Rs. 3400/- was
earned during the year.
Resource management
In the current year 45400 users consulted the
library from various institutions including SAUs. About
37800 publications were issued on loan basis to the
members. The library provided inter-library loan
services and inter-library exchange services. Fine
172
system is applicable to defaulters and a fine of
Rs.33,264/- was collected from various users and
deposited in Institute account.
Reprography Services
During the period xerox services were provided
to the students & staff members at nominal charges
in the Reading Hall, 74,845 exposures were taken
for the purpose and Rs. 25,950/- only was received
from the users.
E-mail and internet facilities
This library is providing good E-mail & Internet
facilities on 24 terminals to its users.
Air Conditioning Facility
The Current Display Section, Computer
Section, Reading Hall (Ground Floor), Internet Room
and Book Section of the Library are air-conditioned
and cohesive atmosphere is being provided to the
readers/users of the library by maintaining air-
conditioners.
Auditorium services
The fully air-conditioned auditorium of the
library is being maintained and many functions/
programmes of the Institute as well as of other
government and private organizations have been
organized from time to time in the auditorium. A
revenue of Rs. 20,000/- only was generated for the
Institute by providing auditorium to outsiders.
Electronic surveillance
Digital Video Recording based Close Circuit
TV system with 22 cameras is being used in the
various sections of the library for electronic
surveillance.
Membership of e-CERA
This library is a member of CeRA, a
Consortium for e-Resources in Agriculture, set up
under NAIP, ICAR along with other Institute and SAU
libraries. Under e-CERA, Institute is getting access
to about 2000 full text online journals. Necessary
services are being exchanged with the member
libraries under the consortium.
e-Granth project
This library is a consortium partner of 12
libraries of various ICAR institutes and SAUs under
NAIP (Component I) on "Strengthening of Digital
Library and Information Management under NARS
(e-Granth)". Under this project a Union Catalogue of
all the partners "AGRICAT" has been created and
about 27477 records of this library are available in
Agricat. Further a Digital Library of Institute
Depositories of National Agricultural Research
System (NARS) is being created.
LIBRARY, BANGALORE
The Library, at IVRI Bangalore subscribed 14
Foreign journals (online version) and 6 Indian journals
during the year 2011-12 and also electronic version
of the backlog subscription from 1995 kept for future
reference. Reports, bulletins, newsletters, etc.,
published by different societies, institutes and
organisations were displayed in the library. Scientists,
research scholars, faculty members and students
consulted the library. Foreign journals were
downloaded in external hard disc format and kept for
ready reference.
COMMUNICATION CENTRE, IZATNAGAR
All the services in the area of institute
publication, printing, photography, art, xeroxing,
editing, typing, binding, press and media coverage,
etc were provided by this centre as a central facility.
The following jobs were rendered by the centre:
1. Information Bulletin & Application form (2011-
2012)
2. Newsletter (Vol.32, No.002)
3. Multicolour poster/exhibitions for ZTM-BPD
4. IVRI Vision-2030
5. IVRI Profile (At a Glance)
6. Brochure and envelops for 21 days Winter School
on Advances in Reproductive Technologies to
Augment Fertility in Farm Animals
7. IVRI Annual Report-2010-11
8. Announcement leaflet and envelops
9. Brochure of ZTM-BPD unit
10. Printing of preliminary announcement and
envelops for short course on Microbial and
Functional Feed Supplements to Improve
Livestock Productivity under CAFT, A.N.Division
11. Compendium, circular invitation cards etc. for
short course on In-vitro Toxicodynamics of P&T
Division
12. Compendium on Microbial and Functional Feed
Supplements to Improve Livestock Productivity
for CAFT, A.N.Division
13. Compendium for training course on Modern
Diagnostic Methods and Innovative Techniques
for Veterinary Officers (Joint Directorate of
Extension Education)
14. Labels for area. specific mineral mix.
15. Smarika (Kku nhfidk)16. Compendium of the optic and practical manual
17. Divisional profile of surgery
18. Invitation card and certificates
19. Invitation card and certificates for K.M.-2011
20. Hindi Smarika for K.M.-2011(i'kq/ku es m|ferk)21. Publication of News Letter January to June 2011
22. Compendium for short course for Vety. Officers
Govt. of Odisha under AN Division
173
23. Poster and leaflet for Dog Show 2012
24. Compendium for training course on Control of
Zoonotic Diseases and Emergency
Preparedness for Veterinary Officers (Joint
Directorate of EE)
25. Compendium for training course on Animal
Disease Control and Management for Veterinary
Officers (Joint Directorate of EE)
26. Compendium for training course on Diagnosis
Treatment Control and Eradication of Animal
Disease for Veterinary Officers (Joint Directorate
EE)
27. Multicolour folders and plastic folders for ZTM-
BPD
28. Brochures for CAFT course of P&C
29. Announcement with envelop and Compendium
for short course under CAFT, AN Division
30. ATIC Biannual Magazine (Pashu Chikitsa Vigyan)
31. Information Bulletin and Application Forms for
P.G. Programme (2012-2013)
32. Folder entitled Enhancing Livelihood of rural
women livestock technology under Network
Project (KVK)
33. Poster J.D./E.E. for Krishi Vigyan Mela 2012 at
IARI, New Delhi
34. Printing of folder highlighting progress of NAIP
35. Printing of Research Monograph of NAIP
36. Annual Report of Network Project (A.R. Division)
ARIS CELL, IZATNAGAR
Institute Website is being maintained and
updated regularly. Internet and E-mail facility was
provided to the scientists and students of the campus
through 1 Mbps VSAT along with newly acquired
IGbps leased line connectivity. This year the institute
has been connected with the National Knowledge
Network (NKN) with all the institutions and universities
of higher learning. Human resourse management
software was acquired and implemented with the self
service user portal. Salary of all the staff of Izatnagar,
Kolkata and Palampur are being processed through
this. In this the user can view his salary slip, GPF
statement, Loan statement etc. Personal information
related to the staff of the whole institute is being
updated on PERMISNET of ICAR. Video
conferencing facility was established in the institute
and being maintained. Online course registration,
faculty registration, student registration and marks
submission has been developed .Consultancy
services were provided to the central store and
purchase section in purchase related to computer
and its accessories. Statistical analysis of the
research data of scientist and students was carried
out. Four courses with theory and practical in
Computer was offered to Ph.D and M.V.Sc. students.
BIOINFORMATICS CENTRE, IZATNAGAR
The institute bioinformatics Centre has all
modern computer and communication facilities viz.,
Latest high speed workstation, Mbps broadband
connectivity, Wi-Fi system, laser & DMP printers and
photocopier and fax machine. The scientific software
packages available with the centre are Lasergene
(DNAStar), BioEdit, OpenBabel, Genocluster
Software (IGIB Jalaja), Autodock, Modeller, MEGA
4, ClustalW, PYMOL, Emboss, Gene Tool, Oligos
etc.
* Online/Off-line information was collected to help
the scientists / students for references.
* Molecular modeling and Insilco Drug designing
study for various pathogenic diseases like
Leishmaniasis and H1N1, H5N1 etc.
* Students and Scientists of IVRI and other
organizations were trained in handling
bioinformatics databases and tools for sequence
analysis, primer designing, probe searching,
micro-array analysis and phylogenetic analysis
etc.
* The centre has provided the bioinformatics
support to students for their PhD and MVSc
research work
* 3-D models were developed for 2 proteins and
submitted to Protein Model Database
(Accession: PM0077653, PM0077654).
* Development of bioinformatics tools for DNA
sequence analysis.
* A livestock disease database developed earlier
was updated. So far 80 bacterial, parasitic, fungal
and viral diseases data have been entered in the
database. It is being made available for users.
* One student carried out research work at the
centre for partial fulfillment for the award of MSc
in Bioinformatics during the session 2011-12.
* Centres website www.bicivri.co.in is being
maintained and updated regularly.
174
* Facilities were also extended for conducting
practical of the course 'Bioinformatics in
Biotechnology'. More than 40 students of
Biotechnology and other disciplines registered
the course and used Bioinformatics facility.
* One student trainee and one trainee for six
months were trained in Bioinformatics at the
centre during 2011-12.
Databases/Software packages developed/Updated
* Livestock Disease Database: The database is
being maintained and updated. So far 80
important bacterial, parasitic, fungal and viral
diseases have been entered into the database.
* DNA manipulation suite: A complete tool for
analysis of nucleotide sequences has been
developed and is being tested on various
sequences.
Trainings/Workshop organized
* The center has organized a National workshop
cum training programme on "In-silico Approach
for Genome Analysis" from March 22-24, 2012.
A total 25 participants from different Institutes
such as NDRI Karnal, SKUAST Jammu,
Mangalayatan University Aligarh, GADVASU
Ludhiana and IVRI Bareilly attended the training.
The participants were trained in various
bioinformatics techniques like as primer
designing, sequence analysis, sequence
submission, phylogenetic analysis, gene
prediction etc. Different software and tools mainly
DNAStar, MEGA 4.0, Oligo Analyzer, BioEdit,
GenScan, GenMark, etc were used by
participants in this National workshop. The guest
lectures were also arranged from eminent
speakers including Dr. Peyush Goyal from
Department of Biotechnology, New Delhi. The
Certificates were given to successful participants
on completion of the training.
* Two trainees (Under DBT Studentship and
Traineeship programme) for six months
completed project on Protein Modeling and In
silico Drug Designing at the Centre during 2011-
12. Homology modeling and molecular docking
studies of different proteins of pathogenic
diseases for designing new candidate drugs were
carried out against Influenza and Leishmaniasis.
ISOLATION UNIT, YELAHANKA CAMPUS,BANGALORE
Animal experimentation and potency testing
of the FMD vaccine is carried out in the isolation unit
at Yelahanka Campus of IVRI.
SALE AND DISPOSAL OF LIVESTOCKPRODUCTS BY LPT DIVISION
A. Handling, processing and sale of Milk & Milkproducts
This is one of the core functions of the LPT.
Milk received from LPM was pasteurized, evaluated,
packed and sold to employees or further processed
into different value added products. The details of
supply and disposal of milk and milk products and
the revenue realized during the period from 01.04.2011
to 31.03.2012 are as follows:
Description Milk/Products Amount
(kg) (Rs)
A Milk Received
Previous balance 2,992
LPM.(C&B) 6,45,639
TOTAL (A) 6,48,631
B Milk issue for sale
i) Normal Milk Sale 5,89,452 1,29,67,944
@ Rs. 22/ kg
ii) Milk Sale @ 6,432 1,80,096
Rs. 17/ kg
C Milk issue for
i) Separation 400 0
ii) Paneer 4,207 0
iii) Softy 112 0
iv) Lassi 412 0
v) Yoghurt/ meetha 345 0
dahi
vi) Matha 281 0
vii) Issue to divisions 43,100.5* 0
(on indent)
viii) Handling loss 1,818.5 0
Balance 2,071 0
TOTAL 6,48,631 0
D Skimmed Milk
i) Sale @ Rs. 14/kg 322 45,085
ii) Issue on indent 40* 0
iii) Handling loss 06 0
Total 368 0
E Milk Products
i) Cream (kg) 35.2 0
F Ghee PB-23, CY-20=43 0
i) sale @ Rs.300/kg 13.5 4,050
ii) ATIC (on Indent) 13.0* 0
iii) Balance 16.5 0
G Paneer
i) @ Rs. 130/kg 378 49,140
ii) @ Rs. 150/kg 358 53,700
iii) ATIC (on Indent)* 95* 0
H Milk products issue
I Milk product issue for
Yoghurt 1,951 Nos. 19,510
Whey beverage 170 Nos. 340
Matha 1,675 Nos. 8,375
Lassi 1,868 Nos. 18,680
Softy 1,215 Nos. 12,150
Lassi (on indent) 116 Nos.* 0
Matha (on indent) 25 Nos.* 0
Yoghurt (on indent) 95 Nos.* 0
175
J. Others
(Delivery charges) 92,063
Grand Total = 1,34,10,556
* Issued to ATIC on indent basis
B. Slaughtering, processing and disposal of meat
The experimental animals received from
different divisions/sections and pigs from AICRP were
slaughtered and quality characteristics of carcasses
and meat were evaluated. After fulfilling the research
requirements, surplus meat was sold. Number of
animals slaughtered and revenue generated is as
under:
Animals No. of animals Revenue
slaughtered generated/
Amount deposited
with Cash Section
Sheep 32 27,364
Goats 54 34,187
Pigs 01 6,304
Poultry 180 3,003
Chicken liver & bones 1,889
Total 72,747
C. Processing and quality evaluation of meatproducts
For experimentation, meat was processed to
different value added products on pilot scale basis.
After quality evaluation, surplus experimental products
were sold to staff and students of Institute. Consumer
evaluation of the products was carried out during
Institute IRC meetings. Feed back about quality of
products was obtained for further improvement. The
type of products and revenue generated is given
below:
Products Sold Amount(Rupees)
Chicken sSoup 5.2 lit 520
Chicken nuggets 199.56 Kg 49,450
Chicken patties 52 pieces 650
Chicken meat balls 103 packs 5,150
Mutton nuggets 94.52 Kg 25,200
Mutton patties 58 Pieces 725
Mutton meat balls 33 packs 1,650
Chicken mutton nuggets 13.79 kg 3,450
Chicken drumstick 108 pieces 1,080
Total 87,875
D. Handling and disposal of Hides & Skins (Hide& Skin Section)
Dead and fallen animals hides and skins of
the institute were processed and disposed at regular
intervals. The number of hides and skins processed
and revenue generated is given below:
Species Qty.
Lamb/kid 28
Buffalo(M/F) 02
Buffalo calf 09
Goat 71
Sheep 46
Cow (M/F) 06
Cow calf 18
Horse 01
Total 181
Amount (Rs.) 5,647.90
S.T./VAT 4% (Rs.) 282.39
Store Charges (Rs.) 3,422.25
Total (Rs.) 9,352.54
AGRICULTURAL TECHNOLOGY INFORMATION
CENTRE (ATIC), IZATNAGAR
ATIC is effectively involved in providing
technical information to farmers and livestock owners
as a "single window delivery system". The centre
has provided farm literature, various vaccines,
semen, vermi-compost, milk/milk products, meat and
meat products, sapling of various vegetables and
fruits, mushroom, and other farm produce and
generated revenue of Rs. 43,42,374.00. This centre
is also involved in conducting educational tours of
farmers, students, extension workers and other
officials to various divisions and sections of this
institute. During the year a total of 20,263 visitors
viz., livestock owners/ farmers, students, and
entrepreneurs and distinguished visitors visited the
Institute. The Kisan Call Centre, Help Line, visits and
training and consultancy services are the major
activities of ATIC. An interaction meet with the ATIC
Kisan Club members was organized, wherein 41 Club
members and officials from banking and insurance
sectors participated. A media meet and showcasing
of technologies of IVRI was organized, wherein 50
media personnel of newspaper and electronic media
and 50 progressive farmers of Bareilly District
participated.
Mobile ATIC Van Services
Mobile ATIC van made 312 field visits to 92
villages for popularization of technologies of the
Institute. A total of Rs. 23,220.00 was generated as
revenue by sale of research /farm products of IVRI
KISAN CALL CENTRE AND HELP LINE,IZATNAGAR
A total of 463 calls were received through
Kisan Call Centre and 489 calls through Institute Help
Line regarding livestock management, extension
programmes, livestock feeding and nutrition, livestock
diseases, goattery, dog, poultry, fisheries, bee
keeping, horticulture and other allied subjects of
agriculture
An interaction meet with the ATIC kisan club
members was organized on 09.04.12 wherein a
total of 41 ATIC Kisan Club members and the officials
from banking and insurance sectors participated.
Further, media meet and show casing of technologies
176
was organized at IVRI Campus on 10.2.2012, wherein
a total of 50 media personnel of daily news papers
and electronic media and 50 progressive farmers of
Bareilly district participated.
jktHkk"kk vuqHkkx
jktHkk"kk vuqHkkx Hkkjr ljdkj dh jktHkk"kk uhfr dsfdz;kUo;u lEcU/kh le;≤ ij tkjh fofo/k vkns"kksa@funsZ"kksa dkvuqikyu djrs gq, vius lHkh nkf;Roksa dks iwjk djus ds fy, lrriz;Ru'khy gSA blh dze esa o'kZ 2011&12 ds nkSjku fd;s x;s dk;ksZadk laf{kIr C;kSjk fuEukuqlkj gS%&
Hkkjr ljdkj ds jktHkk"kk okf"kZd dk;Zdze dk vuqikyu
x`g ea=ky;] jktHkk"kk foHkkx ls izkIr okf"kZd dk;Zdze }kjkfu/kZkfjr y{;ks dh izkfIr gsrq okf"kZd dk;Zdze esa fn;s x;s funsZ"kksa dsvuqlkj dkjZokbZ dh xbZ rFkk lHkh foHkkxksa~@vuqHkkxksa dks bu funsZ"kksals voxr djk;k x;kA
laLFkku jktHkk"kk dk;kZUo;u lfefr dh cSBdksa dkvk;kstu
vuqHkkx }kjk Hkkjr ljdkj rFkk Hkkjrh; d`f"k vuqla/kkuifj"kn ls le;≤ ij izkIr funsZ"kksa ds vuqlkj izR;sd frekgh dhlekfIr ij jktHkk'kk lEcU/kh =Sekfld cSBdksa dk vk;kstu fd;kx;kA bu lHkh cSBdksa dh v/;{krk funs"kd ,oa v/;{k] laLFkkujktHkk'kk dk;kZUo;u lfefr }kjk dh xbZ rFkk laLFkku ds fofHkUufoHkkxksa ds foHkkxk/;{k ,oa ofj'B vf/kdkfj;ksa us lfefr ds lnL; ds:i es lgHkkfxrk dhA bu cSBdksa esa laLFkku ds dkedkt esajktHkk"kk dk;ZUo;u gsrq fofHkUu enksa ij ppkZ dh xbZA
jktHkk"kk fdz;kUo;u lacaa/kh =Sekfld fjiksVZ dkladyu
laLFkku ds fofHkUu foHkkxksa@vuqHkkxksa }kjk fgUnh esa fd;s tkjgs dk;ksaZ dh izxfr fjiksVZ fu/kZkfjr izksQkekZ esa gj =Sekl ij ekWxhxbZA lHkh foHkkxksa@vuqHkkxksa ls izkIr fjiksVZ dks ladfyr dj lesfdrfjiksVZ rS;kj dh xbZ rRi"pkr lesfdr fjiksVZ Hkkjrh; d̀f"k vuqla/kkuifj"kn] Hkkjr ljdkj ds jktHkk"kk foHkkx rFkk uxj jktHkk"kk dk;kZUo;ulfefr dks vfxze dkjZokbZ gsrq Hkstk x;kA
fofHkUu fgUnh izksRlkgu ;kstukvksa dks ykxw djuk
jktHkk"kk foHkkx }kjk tkjh funsZ"kksa ,oa jktHkk"kk okf"kZd dk;Zdzeds vuq:i fofHkUu fgUnh izksRlkgu ;kstuk,a tSls%& ljdkjh dkedktewy:i ls fgUnh esa djus dh ;kstuk] vf/kdkfj;ksa ds fy, fgUnhfMDVs'ku ;kstuk] vaxzsth VkbfiLVksa@vk'kqfyfidksa ds fy, fgUnh esaVkbfiax rFkk fgUnh vk'kqys[ku ;kstuk pykbZ xbZA bu lHkh ;kstukvksaesa lgHkkfxrk djus okys lgHkkfx;ksa ds dk;ZewY;kadu ds i'pkr
budks fu/Zkkfjr iqjLdkjksa ls iqjLd`r djok;k x;kA blh ds lkFkfoHkkxksa@vuqHkkxksa dks vf/kdkf/kd fgUnh esa dk;Z djus ds fy, fgUnh'khYM ;kstuk Hkh pykbZ xbZA
vfgUnh Hkk"kh oSKkfudksa dks fgUnh izf'k{k.k dh dkjZokbZ
laLFkku esa u;k inHkkj xzg.k djus okys vfgUnh Hkk"khoSKkfudksa dks dsUnzh; fgUnh izf'k{k.k laLFkku] ubZ fnYyh ls fgUnhizf'k{k.k fnyokus dh dkjZokbZ dh xbZA blds vUrxZr d̀qy 3 oSKkfudksadks fgUnh izf'k{k.k dh dkjZokbZ dh xbZA
vaxzsth fo"k; oLrq dk fgUnh vuqokn
laLFkku ds fofHkUu foHkkxksa@vuqHkkxksa ls izkIr fofHkUu izdkjdh oSKkfud ,oa iz'kklfud fo"k;&oLrq dk vuqokn fd;k x;kAblesa fofHkUu izdkj ds QkeZ vkfn Hkh 'kkfey gSA fofHkUu izdkj dsxksiuh; dkxtkrkas dk izkFkfedrk ds vk/kkj ij vuqokn dj miyC/kdjok;k x;kA
jktHkk'kk Lekfjdk if=dk dk izdk'ku
o"kZ 2011 esa vuqHkkx }kjk jktHkk"kk Lekfjdk dk izdk'ku Hkhdjok;k x;kA jktHkk"kk Lekfjdk dk izdk'ku fgUnh i[kokM+k&2011ds volj gqvk ftlesa laLFkku ds oSKkfudksa@vf/kdkfj;ksa ,oa deZpkfj;ksa}kjk fyf[kr oSKkfud ys[k] lkekU; ys[k izdkf'kr fd;s x;sA blesavf/kdkfj;ksa@deZpkfj;ksa }kjk Lojfpr dforkvksa dk Hkh lekos'k fd;kx;kA
fgUnh i[kokM+k&2011 dk vk;kstu
laLFkku esa fnukad 13-9-2011 ls 3-10-2011 dh vof/k esafgUnh i[kokM+k lekjksg dk lQy ,oa HkO; vk;kstu fd;k x;kAfnukad 13-9-2010 dks vk;ksftr mn~?kkVu volj ij eq[; vfrfFkds :i esa vkeaf=r cjsyh dkyst cjsyh ds izkpk;Z Mk- vkj- ih- flagus cksyrs gq, dgk fd fgUnh ifjos'k vkSj izd`fr dh Hkk"kk gSA blesaipkl izfr'kr 'kCn laLd̀r ds gSa] rFkk 'ks"k vU; Hkk"kkvksa ls fy, x,gSaA mUgksaus fgUnh esa 'kks/k dk;Z fd;s tkus ij Hkh cy fn;k ftllsfdlkuksa vkSj Ik'kqikydksa dks tkudkjh gkfly djus esa enn feyldsA
bl volj ij laLFkku ds funs'kd izks- egs'k pUnz 'kekZ usdgk fd fgUnh ds izpkj izlkj esa lekpkj i=ksa dh egRoiw.kZ HkwfedkgSA mUgksaus oSKkfudksa dk Hkh vkokg~u fd;k fd fgUnh esa 'kks/k dk;Zfd, tk,a ftlls vf/kd ls vf/kd yksx ykHkkfUor gksaA izks- 'kekZ uscrk;k fd laLFkku ds oSKkfudksa us 150 lkfgR; fgUnh izdkf'kr fd;sgSa] ftudk ykHk fdlkuksa dks feyk gSA
lekjksg dh vof/k esa laLFkku ds oSKkfudksa] vf/kdkfj;ksa]deZpkfj;ksa ds fy, vyx&vyx fgUnh fucU/k izfr;ksfxrk] fgUnh
177
okn&fookn izfr;ksfxrk] fgUnh lqys[k izfr;ksfxrk] fgUnh Vad.kizfr;ksfxrk] 'kq) fgUnh Hkk"k.k izfr;ksfxrk vkfn dk lQyrkiwoZdvk;kstu fd;k x;k A bu lHkh izfr;ksfxrkvks esa Hkkjh la[;k esaizfrHkkfx;ksa us lgHkkfxrk dhA dk;Zdzeksa dh J̀a[kyk esa oSKkfudksa@vf/kdkfj;ksa,oa deZpkfj;ksa ds d{kk 12 rd ds cPpksa ds fy, cky dkO; ikB ,oaok| ;a= oknu izfr;ksfxrk vk;ksftr dh xbZ ftuesa cPpks usc<+&p<+dj lgHkkfxrk dhA fnukad 25-9-2011 dks ,d vf[kyHkkjrh; dfo lEesyu dk vk;kstu fd;k x;kA dfo lEesyu esadfo;ksa us viuh dforkvksa ls Jksrkvksa dks Hkko&foHkksj dj fn;kAdfo;ksa us gkL;&O;aX; ,oa ns'k&HkfDr ls vksr&izksr dfork,a lqukdjmifLFkr tu leqnk; dks jksekafpr dj fn;kA
fnukad 3-10--2011 dks lekjksg dk lekiu gqvkA lekiulekjksg ds volj laLFkku ds funs'kd] izks- egs'k pUnz 'kekZ us lHkhizfr;ksfxrkvksa ds fot;h izfrHkkfx;ksa dks izFke] f}rh;] r`rh; ,oa
lkaRouk iqjLdkj ,oa izek.k i= iznku fd;sA o"kZ ds nkSjku fgUnh esaloksZRd`"V dk;ksZa ds fy, laLFkku ds mu foHkkxksa@vuqHkkxkas dks Hkhfuns'kd egksn; }kjk 'khYM iznku dh ftUgksaus o"kZ ds nkSjku fgUnh esaloksZRd̀"V dk;Z fd;kA lekiu lekjksg esa Jh nsoewfr v/;{k ,l-vkj-,e-,l- eq[; vfrfFk ds :i esa mifLFkr FksA
laLFkku dks feys izfrf"Br *jktf"kZ VaMu jktHkk"kkiqjLdkj* rFkk x.ks'k 'kadj fo|kFkhZ iqjLdkj
laLFkku }kjk vius nSfud dke dkt esa jktHkk"kk dk vf/kdkf/kd iz;ksx fd;k tk jgk gSA iz'kklfud dk;ksaZ ds lkFk ghlaLFkku ds oSKkfud fgUnh esa vius ys[k fy[k jgsa rFkk vius nSfuddkedkt esa fgUnh dk iz;ksx djrs gSsA blds QyLo:i o"kZ 2011 esalaLFkku dks ifj"kn }kjk *jktf"kZ VaMu jktHkk"kk iqjLdkj* iznku fd;kx;kA bl o"kZ laLFkku dks fgUnh es mRd`"V 'kks/k ys[k dh foKkuif=dk ds fy, x.ks'k 'kadj fo|kFkhZ iqjLdkj Hkh izkIr gqvkA
178
17. EMPOWERMENT OF WOMEN AND MAINSTREAMING THE
GENDER ISSUES
Gender equality and the empowerment of
women are gaining ground worldwide. There are more
women Heads of State or Government than ever,
and the highest proportion of women serving as
Government ministers. Women are exercising ever
greater influence in business. More girls are going to
school, and are growing up healthier and better
equipped to realize their potential. Despite this
momentum, there is a long way to go before women
and girls can be said to enjoy the fundamental rights,
freedom and dignity that are their birthright and that
will guarantee their well-being. Nowhere is this more
apparent than in the world's rural areas. Rural women
and girls - to whom this year's International Women's
Day is devoted - make up one quarter of the global
population, yet routinely figure at the bottom of every
economic, social and political indicator, from income
and education to health to participation in decision-
making.
-Message from UN Secretary General Baan Ki-Moon,
on the occasion of International Women's Day
Women Empowerment refers to increasing the
spiritual, political, social or economic strength of
women. The word women empowerment essentially
means that the women have the power or capacity
to regulate their day- to- day lives in the social,
political and economic terms -a power which enables
them to move from the periphery to the centre stage.
The principle of gender equality is enshrined
in the Indian Constitution in its preamble, fundamental
rights, fundamental duties and directive principles.
The Constitution not only grants equality to women
but also empowers the State to adopt measures of
positive discrimination in favour of women. Within
the framework of a democratic polity, our laws,
developmental policies, plans and programmes have
aimed at women's advancement in different spheres.
India has also ratified various international
conventions to secure rights of women. The women's
movement and a widespread network of Non-
Government Organisations (NGOs) having strong
grass-root presence and deep insight into women's
concerns have contributed in inspiring initiatives for
the empowerment of women. Women today are trying
to understand their position in the society. Women
have become increasingly aware of sexual inequalities
in every sphere of life and are seeking ways to fight
them. The Indian women have cast of their age-old
shackles of serfdom and male domination. She has
come to her own and started scaling the ladders of
social advance with proud and dignity. Women of India
are now uplifted and emancipated and granted equal
status with men in all walks of life-political, social,
domestic and educational. They have a franchise,
they are free to join any service or follow any
profession. Free India has, besides her woman prime
minister, women ambassadors, women cabinet
ministers, women legislators, women governors,
women scientists, engineers-doctors-space
researchers-giant IT specialists, women Generals,
women public officers, judiciary officers and in many
more responsible positions. No distinction is now
made in matters of education between boys and girls.
Their voice is now as forceful and important as that
of men. They are becoming equal partners in making
or dismissing of a government.
Gender mainstreaming
The concept of bringing gender issues into the
mainstream of society was clearly established as a
global strategy for promoting gender equality in the
Platform for Action adopted at the United Nations
Fourth World Conference on Women, held in Beijing
(China) in 1995. It highlighted the necessity to ensure
that gender equality is a primary goal in all area(s) of
social and economic development.
Definition of the concept of gender mainstreaming
"Mainstreaming a gender perspective is the
process of assessing the implications for women and
men of any planned action, including legislation,
policies or programmes, in all areas and at all levels.
It is a strategy for making women's as well as men's
concerns and experiences an integral dimension of
the design, implementation, monitoring and evaluation
of policies and programmes in all political, economic
and societal spheres so that women and men benefit
equally and inequality is not perpetuated. The
ultimate goal is to achieve gender equality. (Gendermainstreaming extract from report of the UnitedNations economic and social council, 1997)
Mainstreaming includes gender-specific
activities and affirmative action, whenever women
or men are in a particularly disadvantageous position.
Gender-specific interventions can target women
exclusively, men and women together, or only men,
to enable them to participate in and benefit equally
from development efforts. These are necessary
temporary measures designed to combat the direct
and indirect consequences of past discrimination.
Women in agriculture
"Women play a significant role in agriculture,
the world over. About 70% of the agricultural workers,
80% of food producers, and 10% of those who process
basic foodstuffs are women and they also undertake
60 to 90% of the rural marketing; thus making up
more than two-third of the workforce in agricultural
production (FAO, 1985). In West Africa, up to 80%
179
of the labour force in all trade is female. Yet, the role
of women in these activities, so important
economically, has remained obscure for long because
women seldom played any major roles in political
activities or decision making processes. Despite the
fact that women produce much of the food in the
developing world, they also remain more
malnourished than most men are. In many rural
societies, women eat less food than men do,
especially when the food is scarce, such as just
before the harvest, or when the workload increases
without a corresponding increase in the food intake."
(Roodkowsky, 1979)
Despite women's lower overall employment
rates, among employed women the proportion
working in agriculture as opposed to other sectors is
usually equal to or higher than the male equivalent.
Almost 70 per cent of employed women in South
Asia and more than 60 per cent of employed women
in Sub-Saharan Africa work in agriculture. The
substantial involvement of rural women in agriculture,
primarily as unpaid or contributing family workers,
highlights the importance of developing policies and
programmes that address the needs, interests and
constraints of women as well as men in the agriculture
sector (http://www.un.org). Although women do the
majority of work in agriculture at the global level, elder
men, for the most part, still own the land, control
women's labor, and make agricultural decisions in
patriarcheal social systems. In the EU, agriculture is
the seventh largest employer of women (3%).
However, in Greece about 38% women (of all family
workers in agriculture) are employed in agriculture.
In Portugal, over 50% of the agricultural workforce is
female. Throughout the South Asian region, women
account for about 39 per cent of the agricultural
workforce, working as managers of land to agricultural
labourers. In India, in over all farm production,
women's average contribution is estimated at 55%
to 66% ...In the Indian Himalayas a pair of bullocks
works 1064 hours, a man 1212 hours and a woman
3485 hours in a year on a one hectare farm, a figure
that illustrates women's significant contribution to
agricultural production. (Shiva FAO, 1991)
Rural women play a key role in supporting their
households and communities in achieving food and
nutrition security, generating income, and improving
rural livelihoods and overall well-being. They
contribute to agriculture and rural enterprises and fuel
local and global economies. As such, they are active
players in achieving the Millennium Development
Goals (MDGs). Yet, every day, around the world, rural
women and girls face persistent structural constraints
that prevent them from fully enjoying their human
rights and hamper their efforts to improve their lives
as well as those of others around them. In this sense,
they are also an important target group for the MDGs.
The women in India, like in many developing
countries are silent workers. Although, there are a
growing number of available technologies which can
enhance women's productivity and income in animal
husbandry sector, these technologies have not
reached them. A number of research studies have
been conducted in the past to identify the animal
husbandry activities in which rural women are
generally involved. Results show that women are
involved at various levels in almost all animal
husbandry operations right from collecting fodder for
animals to marketing of dairy products. Taking animal
for grazing, preparing balanced ration, preparation of
home-made concentrate mixture, feeding the cattle,
management of livestock, taking care of young
calves, sick and pregnant animals, preparing
livestock products, storage and marketing of dairy
products and making cow dung cakes are mostly
carried out by rural women. In fact most of this work
and other household activities that the women perform
constitute a significant proportion of unpaid family
labour. According to UNIFEM (2005) unpaid work on
family agricultural enterprises accounts for 34 per
cent of women's informal employment in India
(compared with 11 per cent of men's informal
employment )
An important step towards women
empowerment over the world is the celebration of
International women's day. International Women's Day
(8 March) is an occasion marked by women's groups
around the world. This date is also commemorated
at the United Nations and is designated in many
countries as a national holiday. When women on all
continents, often divided by national boundaries and
by ethnic, linguistic, cultural, economic and political
differences, come together to celebrate their Day,
they can look back to a tradition that represents at
least nine decades of struggle for equality, justice,
peace and development. International Women's Day
is the story of ordinary women as makers of history;
it is rooted in the centuries-old struggle of women to
participate in society on an equal footing with men.
In 1975, during International Women's Year, the
United Nations began celebrating 8 March as
International Women's Day. Two years later, in
December 1977, the General Assembly adopted a
resolution proclaiming a United Nations Day for
Women's Rights and International Peace to be
observed on any day of the year by Member States,
in accordance with their historical and national
traditions. For the United Nations, International
Women's Day has been observed on 8 March since
1975 . Each year around the world, International
Women's Day (IWD) is celebrated on March 8.
Thousands of events occur not just on this day but
throughout March to mark the economic, political and
social achievements of women. Organisations,
governments, charities and women's groups around
the world choose different themes each year that
reflect global and local gender issues. The official
United Nations theme for International Women's Day
180
2012 is "Empower Rural Women - End Hunger and
Poverty." Below is a summary of UN system
observances, news and related links for IWD 2012
Institute Initiatives for women empowerment
The Indian Veterinary research Institute has
also taken a lead in organizing various activities for
women empowerment.
A total of 144 skill oriented trainings were
organized by the Krishi Vigyan Kendra of the institute
benefiting 2999 participants, On campus, Off campus,
In-service, Sponsored for farmers, rural youths, rural
women and Extension functionaries for disseminating
the latest and advance technical knowhow in their
area of work. Out of total trainings, 570 rural women
have been empowered technically in Home Science.
Besides the above, 03 scientist- farm women
interactions were conducted at the institute to create
awareness about the scientific livestock rearing and
to resolve various issues related to animal husbandry
and family matters. One day kisan mela was
organized in village Pitamberpur on 22 March, 2012
wherein farmer goshti, technology exhibition, animal
health camp, animal competitions were organized.
About 265 farmers/ women were benefited.
One research project on Enhancing Livelihood
of Rural Women through Livestock Production is
going on under the lead centre of Directorate of
research on women in Agriculture at KVK. IVRI, is
acting as Collaborating centre with the major
objectives of assessment of socio-economic
conditions, women's role, gender issues, policies and
programmes in livestock production, identification and
refinement of appropriate technologies to address the
gender needs and facilitation of appropriate
institutional mechanism and capacity building for up
scaling of appropriate technologies.
Livestock was found the primary and
subsistence activity to meet the household food
needs as well as supplementing the farm incomes.
After collecting the primary data from randomly
selected 720 respondents, through survey techniques
using specially designed questionnaire, were then
analyzed by using simple statistical tools. This
analysis helped in identifying the technical
interventions for enhancing the livelihood of rural
families especially women through various livestock
production system and capacity building programs.
The study revealed that majority of the families were
using the traditional method of herding the animals.
Besides cattle and buffaloes, goats were dominated
among the landless and marginal farming families.
Poultry was mainly used for domestic purpose
wherein eggs were used for family consumption and
for sale purpose, whenever in need of money to meet
day to day expenses. None of the families was rearing
poultry for commercial use. Pigs were reared by few
socially backward families for breeding purpose and
generating income through sale of meat and animals.
Cattle and buffaloes were reared for domestic use
and sale of milk. The scale of production and
productivity of livestock was low and were following
low input and low output production system.
Role of women was found predominant in most
of livestock production activities, with low adoption
of scientific animal husbandry practices. The results
of 't' test showed significant differences between the
husband and wives with respect to breeding, health
care and marketing related activities. Women were
taking decisions approximately 14% independently
and 10% jointly against 75% of the males.
About 30% of the males accessed to
extension agencies like village level extension worker
(30.83%), veterinary assistant surgeon (30.83%),
paravets (25.86%) and agricultural extension officer
(26.39%), 5% to NGO's against only 18% women,
who could access to village level extension worker,
14% to veterinary assistant surgeon and 11% women
to agricultural extension officer and NGO personnel.
The major reasons for not availing extension services
revealed by the respondents were; non availability of
timely extension services (91.67%) at door step and
sometimes without prior notice (81.95%) and the
contact of extension workers to selected farmers only
(77.77%). Majority of the respondents rely on their
neighbours (75.83% females and 78.33% males) as
interpersonal source of information followed by
Research Institute / University personnel (52.50%
females and 67.78% males) and friends & relatives
(41.67% females and 40.28% males). Radio was the
major source of information (47.78% females &
46.94% males) in the category of mass media. Group
discussions / gosthies (45.56% females and 47.50%
males) were also found to be the important source of
information in the studied area.
Appropriate interventions were selected and
refined based on their socio-economic profile of
household, herd structure, major crops grown, interest
and awareness about extension programs, access
and control on resources, role in dairy husbandry
practices, decision making pattern, perception and
adoption of improved technologies, problems faced
in adoption of improved technologies, etc and other
181
technological constraints revealed by the
respondents. Feeding area specific mineral mixture,
urea molasses mineral lick block, conservation of
fodder in silage pit for lean season, distribution of
crystoscope for timely insemination (09), animal
health camps (02) for timely vaccination (350 animals)
against contagious diseases, deworming of animals
and dealing the problem of infertility in dairy animals,
popularization of vrindavani breed (cross bred cattle
developed at IVRI) (1000 doses) through distribution
of semen straws to paravets, distribution of revolving
stool (10) for milking (a drudgery reduction tool) to
rural women, face mask for reducing the occupational
health hazards. Seven goat demonstration units, four
pig units and 33 backyard poultry units were
established in villages for improving their livelihood.
Three exposure visits to CIRG, Makhdoom,
GBPUA&T, Pantnagar and IVRI, Izatnagar were
organized for 60 rural women to make them aware
about the improved technologies of livestock farming.
Under fodder interventions napier grass (CO3) was
promoted through demonstration. Besides, 10
revolving stools for milking buffalo were distributed
among 10 farm women. Under capacity building
programs, seven trainings on scientific backyard
poultry, goat rearing, pig farming, dairy farming and
value addition of milk were organized for 130 farm
women, the impact of which were studied in terms of
gain in knowledge and increase in adoption. Extension
literature in Hindi was developed on 12 different topics
for women empowerment in livestock and related
enterprises.
To overcome the problem of repeat breeding
and infertility area specific mineral mixture in
concentrate feed was demonstrated to the farm
women. Feeding area specific mineral mixture and
vitamin supplementation to buffalo from calving to 6
months lactation observed an increase of 12-15%
milk yield per animal per day, 20-25% body weight in
calves and 23-30% economic returns with BC ratio
2.06 over the existing practice 1.82:1 ie feeding dry
fodder. Supplementation of UMMB licks significantly
increased feed intake, milk yield, weight gain and
general body condition of the cows with enhanced
cash benefit of over Rs. 7-8/day/cow in mixed farming
system. The cost benefit ratio calculated from the
economic returns was found 1:2.36. Results of goat
demonstration units each comprising 5 adult females
and 1 male yielded an average gain of Rs 3500/- to
4000/- per unit @ Rs 500/- per kid after six months.
After one year, a family could fetch Rs 10,000/- to
12,000/- per unit from the sale of the available young
stock (if not sold earlier) and kids of second lactation.
The success rate of poultry demonstration units
comprising 20-25 day old chicks suitable for backyard
poultry - Shyama and Nirbheek also found impressive
in most of the villages. A family could earn an average
of Rs 3500/- to 4000/- @ Rs 4/- to 5/- per egg from
the sale of eggs in a year. The results of economic
impact of the pig demonstration units each
comprising 4 females and 1 male piglets of landrace
breed revealed an average gain of Rs 6000/- to 8000/
- per animal by selling piglets at two months of age
@ Rs 1000/- to 1200/- each in a year.
OFT on problem of nutritional insecurity
among the rural women leading to various nutritional
disorders was conducted in 05 households
throughout the year by establishing 05 nutrition
garden (each in 150 mt.sq ) to enhance household
food security. The results on season wise availability
of fruits and vegetables and saving in, money were
calculated. It was found that farm families increased
the intake of seasonal fruits and vegetables
throughout the year from their kitchen garden. The
saving in monthly household expenditure on fruits
and vegetables was quite high in Rabi season followed
by zayed and Kharif. The annual average saving was
Rs. Rs. 711.22/= with BC ratio of 1.23:1.0
Further a total of 11 radio talks were delivered
for the benefit of rural women. Two training for 33
women functionaries was also conducted during the
year. Apart from this one women health camp and
four field days for farm women were organized by
the Krishi vigyan Kendra of the institute.
IVRI, ERS Kolkata is also making concerted
efforts for empowerment of tribal and non-tribal farm
women through various extension interventions such
as training, interface meeting, animal health camps
in order to create awareness about scientific animal
husbandry practices at Hooghly and South 24
Parganas districts of West Bengal including remote
villages of Sunderbans area. The resource poor
women, participating in large numbers, are found to
be highly motivated through these programmes.
The Indian Veterinary Research Institute is
continuously determined towards women
empowerment and is paving its way ahead to bring
the farm women in the agriculture mainstream through
continuous information dissemination and training
programmes.
Farm women participating in animal health
camp-cum- training programme organised by IVRI,
ERS, Kolkata at Hooghly district, West Bengal.