Analysis of collagen expression during chondrogenic induction of human bone marrow mesenchymal stem...

7/27/2019 Analysis of collagen expression during chondrogenic induction of human bone marrow mesenchymal stem cells.pdf

1/11

O R I G I N A L R E S E A R C H P A P E R

Analysis of collagen expression during chondrogenic

induction of human bone marrow mesenchymal stem cellsEmeline Perrier Marie-Claire Ronziere

Reine Bareille Astrid Pinzano

Frederic Mallein-Gerin Anne-Marie Freyria

Received: 26 February 2011 / Accepted: 23 May 2011 / Published online: 10 June 2011

Springer Science+Business Media B.V. 2011

Abstract Adult mesenchymal stem cells (MSCs)

are currently being investigated as an alternative to

chondrocytes for repairing cartilage defects. As

several collagen types participate in the formation

of cartilage-specific extracellular matrix, we have

investigated their gene expression levels during MSC

chondrogenic induction. Bone marrow MSCs were

cultured in pellet in the presence of BMP-2 and TGF-

b3 for 24 days. After addition of FGF-2, at the fourth

passage during MSC expansion, there was an

enhancing effect on specific cartilage gene expression

when compared to that without FGF-2 at day 12 in

pellet culture. A switch in expression from the pre-

chondrogenic type IIA form to the cartilage-specific

type IIB form of the collagen type II gene was

observed at day 24. A short-term addition of FGF-2followed by a treatment with BMP-2/TGF-b3

appears sufficient to accelerate chondrogenesis with

a particular effect on the main cartilage collagens.

Keywords Bone morphogenetic protein-2,

chondrogenesis Collagen Fibroblast growth-factor-

2 Mesenchymal stem cells Transforming growth

factor-beta3

Introduction

Cartilage tissue engineering is currently exploring the

potential of adult mesenchymal stem cells (MSCs),

present in different tissues, as an alternative to the use

of autologous chondrocyte transplantation for carti-

lage repair (Khan et al. 2010; Freyria et al. 2008).

Prior to their use for tissue repair, there have been

extensive studies to develop methods to enhance

MSC proliferation and subsequent chondrogenic

Electronic supplementary material The online version ofthis article (doi:10.1007/s10529-011-0653-1) containssupplementary material, which is available to authorized users.

E. Perrier

M.-C. Ronziere

F. Mallein-GerinA.-M. Freyria (&)

Institut de Biologie et Chimie des Proteines, Universite

Lyon 1, Univ Lyon, CNRS FRE 3310, IFR128

BioSciences Gerland-Lyon Sud, 7 Passage du Vercors,

69367 Lyon Cedex 7, France

e-mail: [email protected]

E. Perrier


M.-C. Ronziere


F. Mallein-Gerin


R. Bareille

Inserm Unite 577, Universite Victor Segalen ,

Bordeaux 2, 33076 Bordeaux, France


A. Pinzano

Laboratoire de Physiopathologie, Pharmacologie et

Ingenierie Articulaires, UMR 7561 CNRS-Nancy

Universite, 9, avenue de la Foret de Haye,

54505 Vanduvre-Les-Nancy, France


123

Biotechnol Lett (2011) 33:20912101

DOI 10.1007/s10529-011-0653-1
http://dx.doi.org/10.1007/s10529-011-0653-1http://dx.doi.org/10.1007/s10529-011-0653-1


2/11

differentiation, using both animal and human models.

Some procedures have now been standardized but

before obtaining a sufficient cell reservoir for labo-

ratory and clinical purposes it is necessary to amplify

MSCs in vitro. These cells represent a minor fraction

of the total nucleated cell population in the bone

marrow (BM), the most common and best-character-ized MSC source, with an approx. frequency of 1

MSC per 5 9 103 mononuclear cells (Kastrinaki

et al. 2008). Fibroblast growth factor-2 (FGF-2) has

been most frequently used as it was known to

maintain the differentiation potential of MSCs after

several mitotic divisions (Karlsson et al. 2007;

Murdoch et al. 2007; Solchaga et al. 2005, 2010;

Varas et al. 2007). Interestingly, FGF-2 treatment of

MSCs during expansion has the potential to delay the

loss of chondrogenic potential (Solchaga et al. 2010).

In addition, to promote chondrogenic differentiation,the expanded MSCs need to be subsequently cultured

in a three-dimensional environment as micromasses

or in scaffold materials and this differentiation also

requires the presence of various compounds such as

vitamins, dexamethasone and members of the TGF-b

superfamily (Karlsson et al. 2007; Marsano et al.

2007; Mehlhorn et al. 2006; Merceron et al. 2009;

Miyanishi et al. 2006; Murdoch et al. 2007; Pelttari

et al. 2006; Solchaga et al. 2005; Varas et al. 2007).

Bone morphogenetic proteins (BMPs) have also been

added to the culture medium of BM-MSCs alone,such as BMP-2 or in various combinations with TGF-

b (Schmitt et al. 2003; Sekiya et al. 2005; Shen et al.

2009). Interestingly, all BMPs enhance the chondro-

genic effect of TGF-b.

These studies have mainly investigated the essen-

tial components of hyaline cartilage to assess and

characterize the chondrogenic induction of MSCs

such as type II collagen and sGAG (Tew et al. 2008).

Regarding the collagens, those characteristic of car-

tilaginous tissues include type II collagen [a1(II)3]

representing about 9095%, as well as types IX[a1(IX) a2(IX) a3(IX)] and XI [a1(XI) a2(XI)

a3(XI)], representing less than 10% of the total

collagen content of the ECM in adult articular

cartilage (Petit et al. 1992). Type II collagen is

synthesized as a larger precursor procollagen mole-

cule under two forms, IIA and IIB, resulting from

alternative splicing of exon 2, which codes for a

cysteine-rich (CR) domain located in the N-propep-

tide region (Sandell et al. 1991). Type IIA procollagen

contains the CR domain and is produced by chondro-

progenitor cells, whereas type IIB procollagen does

not contain this domain and is synthesized only when

chondrocytes are fully differentiated (Aigner et al.

1999; Zhu et al. 1999). Thus, the switch from type IIA

to type IIB procollagen mRNA expression is a marker

of the chondrocyte phenotype. Besides, the fibril-associated collagens present in cartilage and forming

the primary core fibrillar network (types II, IX and XI

collagens), other collagen molecules, such as types VI

[a1(VI) a2(VI) a3(VI) a4(VI) a5(VI) a6(VI)], XII

[a1(XII)3] and XXVII [a1(XXVII)3], have a structural

role in cartilage organization or are temporally or

qualitatively associated with cartilage development

and thus their encoding genes represent potential

reference markers to monitor chondrogenesis in MSC

cultures (Alexopoulos et al. 2009; Gregory et al. 2001;

Hjorten et al. 2007).The aim of the present study was to seek a concise

system for analyzing the effects of the growth factors

on the chondrogenic ability of human BM-MSCs,

with special attention given to collagen expression.

We sought conditions that would produce expression

of the characteristic markers with the minimal and

effective content of growth factors. In order to treat

the cells similarly given by each donor, indepen-

dently of the time of harvest, we chose to expand

MSCs during three passages to obtain a sufficient cell

reservoir for our experimental purposes and to addFGF-2 at the fourth passage. The subsequent level of

cell differentiation in pellet cultures was investigated,

and especially the mRNA expression of spliced forms

of type II procollagen, as well as other collagens. The

occurrence of chondrogenesis was characterized by

the expression of marker genes for chondrocytes,

hypertrophic chondrocytes and by the synthesis of

extracellular matrix proteins.

Materials and methods

Isolation and cell culture of MSCs and human

chondrocytes

Adult bone marrows were obtained from iliac aspi-

rations of three donors (age range: 3766 years)

undergoing total hip replacement, after informed

consent and according to local ethical guidelines. The

BM-MSCs were separated from BM mononuclear

2092 Biotechnol Lett (2011) 33:20912101

123


3/11

cells by adherence on plastic (Cournil-Henrionnet

et al. 2008; Vilamitjana-Amedee et al. 1993). Cells

(0.5 9 106/cm2) were then expanded in monolayer

culture in Dubelccos modified Eagles Medium

(DMEM) supplemented with 10% (v/v) fetal calf

serum (FCS), 100 U penicillin/ml and 100 lg strep-

tomycin/ml in humidified incubators at 37C with 5%CO2. As surface markers on MSCs showed little

variation during the culture, the cell surface receptor

profile of the BM-MSCs was not reported in this

paper (Cournil-Henrionnet et al. 2008). Cells were

cultured until 80% confluence and harvested with

0.25% trypsin/1 mM EDTA for 34 min at 37C and

seeded in new flasks for expansion. After the third

subculture, cells were harvested and frozen in a

cryopreservation medium containing 50% FCS, 40%

DMEM and 10% dimethyl sulfoxide (DMSO).

Before the formation of pellets, a fourth passagewas carried out in the presence or absence of 5 ng/ml

of human recombinant FGF-2 (R&D Systems). After

each trypsination, cells were counted with a Cello-

meter Auto T4 (Nexcelom Bioscience) and the

proliferation rate was calculated between the differ-

ent culture conditions.

Articular chondrocytes were isolated from the

macroscopically healthy zone of cartilages obtained,

according to the local ethical guidelines and after

informed consent, from three donors undergoing total

knee replacement. The rationale to compare theinduced MSCs with cultured articular chondrocytes is

that both cells are in a nonmatrix environment, while

with fresh tissue the gene expression represents in

vivo levels. Cells were cultured in monolayer for

36 h (Ach), as previously described (Hautier et al.

2008). Total cell RNA obtained at this stage gave us a

chondrocytic gene expression reference to compare

with the induced MSCs.

Pellet cultures

Cells (0.25 9 106) were seeded in V-bottomed

96-well plates and pelleted for 5 min at 250 g. The

pellets were cultured in 250 ll high glucose DMEM

supplemented with 1% (w/v) insulin/transferring/

selenium/bovine serum albumin/linoleic acid

(ITS ? Premix; BD), 100 U penicillin/ml, 100 lg

streptomycin/ml, 40 lg L-proline/ml, 100 lg sodium

pyruvate/ml, 100 nM dexamethasone, 50 lg ascor-

bate-2-phosphate/ml (Asc-P) and BMP-2 (R&D Sys-

tems) and TGF-b3 (R&D Systems) in combination

[10 ng TGF-b3/ml ? 50 ng BMP-2/ml (BT)]. In a

preliminary experiment, we verified that the combi-

nation TGF-b3/BMP-2 was a better inducer of

chondrogenesis than each growth factor alone. Mediain both groups was changed every 3 days. Pellet sizes

were regularly measured on micrographs taken with a

bright-field Nikon TE300 microscope equipped with

a QICAM Fast 1394 camera (Qimaging).

Gene expression analysis

Four to six pellets for each culture condition and for

each donor were homogenized with TissueLyser

(Qiagen). Total RNA was isolated after 1, 12 and24 days of culture, using the RNeasy kit (Qiagen) and

reverse transcription of 50500 ng total RNA was

performed as previously described (Cortial et al.

2006). Quantitative RT-PCR was performed with an

iCycler iQ (BioRad). Each analysis was carried out in

duplicate. PCR primers (Table 1) were obtained from

Invitrogen. We focused our interest on genes coding

for collagens (types I, II, VI, IX, X, XI, XII and

XXVII), proteoglycan (aggrecan: ACG1), transcrip-

tion factor (SOX9) and one MEC-degrading enzyme

(MMP13). For each cDNA sample the Ct value of thereference gene ribosomal protein L30 (RPL30) was

subtracted from the Ct value of the target gene to

obtain the DCt. The level of expression was then

calculated as 2-DCt and was expressed in relative

quantity.

In addition, the total amounts of type II collagen

transcripts and of procollagen IIA and IIB isoform

transcripts were assessed by conventional PCR after

12 and 24 days of culture, using previously

described parameters (Hautier et al. 2008). Glycer-

aldehyde-3-phosphate dehydrogenase (GAPDH)was used as the housekeeping gene. Photographs

of gels obtained using a Baby Imager (Appligene

Oncor, Illkirch, France) were scanned using an

Epson 1640 scanner (Epson France). The relative

ratios of the bands corresponding to type IIA

(475 bp) and type IIB (268 bp) procollagen tran-

scripts were quantified using Image Quant software

(GE Healthcare).

Biotechnol Lett (2011) 33:20912101 2093

123


4/11

Immunohistological analysis

Pellets collected after 12 and 24 days of culture were

fixed for 24 h in 4% neutral buffered formalin,

processed in paraffin wax, and then sectioned. Perox-

idase staining was performed, according to the

horseradish peroxidase conjugated Envision methodas previously described (Freyria et al. 2004). Before

their application, polyclonal antibodies to type I, type

II, or type VI collagen and aggrecan (Novotec) were

diluted 1:1000, 1:500, 1:1000 and 1:1000, respec-

tively, in PBS/3% BSA. Sections were lightly coun-

terstained using Harriss haematoxylin stain, washing

in PBS between each step of the procedure. Control

sections without the addition of primary antibodies

were processed in parallel to rule out nonspecific

labeling. Sections were observed with a Leica DMLB

microscope directly coupled to a JVC color camera

(Leica Microsystemes SAS).

For immunofluorescence staining of type II colla-

gen, pellets were rapidly frozen at -20C in Tissue

Tek OCT (Sakura Finetek Microm France). Frozen

sections (5 lm thick) were fixed with acetone,permeabilized with PBS/3% BSA/1% Tween20 and

incubated (45 min at 20C) with a polyclonal anti-

serum recognizing the CR domain in the type IIA

propeptide (Oganesian et al. 1997) and then diluted

1:300 in PBS/3% BSA. Following washes in PBS,

sections were incubated (45 min at 20C) with

secondary antibodies [Alexa-Fluor 488 goat anti-

rabbit IgG (H ? L): AF488, Invitrogen] diluted

1:500. Fluorescent nuclear staining was obtained

Table 1 Nucleotide sequences of primers used for real-time PCR

Genes Primers References

Extracellular matrix proteins

a1 chain of collagen I (COL1A1) Forward CAGCCGCTTCACCTACAGC Hautier et al. (2008)

Reverse TTTTGTATTCAATCACTGTCTTGCC

a1 chain of collagen II (COL2A1) Forward GCCTGGTGTCATGGGTTT NM 001844.4

Reverse GTCCCTTCTCACCAGCTTTG

a1 chain of collagen VI (COL6A1) Forward GAAGAGAAGGCCCCGTTG NM 001848.2

Reverse CGGTAGCCTTTAGGTCCGATA

a1 chain of collagen IX (COL9A1) Forward ACGGTTTGCCTGGAGCTAT NM 001851.4

Reverse ACCGTCTCGGCCATTTCT

a1 chain of collagen X (COL10A1) Forward CAAGGCACCATCTCCAGGAA NM 000493

Reverse AAAGGGTATTTGTGGCAGCATATT

a1 chain of collagen XI (COL11A1) Forward TCCTCTTCCAAGCTAGAGAGGTC NM 080629.2

Reverse GGAGAATTGTGAAAATCTAGTGCT

a2 chain of collagen XI (COL11A2) Forward CCTGAGCCACTGAGTATGTTCATT Khan et al. (2008)

Reverse TTGCAGGATCAGGGAAAGTGA

a1 chain of collagen XII (COL12A1) Forward TGGTCATCCAGCAGTCAGG NM 004370.5

Reverse TGGCAAGCTCATTGTAGTCG

a1 chain of collagen XVII (COL27A1) Forward GGTCTCCTGCAACTTCACTCAT Hjorten et al. (2007)

Reverse GCTTAGCAGGTGCAGGAAATTC

Aggrecan (AGC1) Forward TCGAGGACAGCGAGGCC Hautier et al. (2008)

Reverse TCGAGGGTGTAGCGTGTAGAGA

Transcription factor

SOX9 Forward ACGCCGAGCTCAGCAAGA Hautier et al. (2008)

Reverse CACGAACGGCCGCTTCT

Housekeeping geneRibosomal protein L30 (RPL30) Forward CCTAAGGCAGGAAGATGGTG NM 000989.2

Reverse AGTCTGCTTGTACCCCAGGA

2094 Biotechnol Lett (2011) 33:20912101

123


5/11

after incubation with propidium iodide diluted 1:100

in PBS, for 30 min at 20C. In some experiments, a

sequential double immunostaining was carried out

with, first, immunolabeling of type II collagen

(Novotec; antibodies diluted 1:300) detected with

AF488, then with immunolabeling of the type IIA

propeptide (Oganesian; antibodies diluted 1:300)detected by Cy3 conjugated sheep anti-rabbit IgG

(Sigma), diluted 1:100. Sections were observed with

a Zeiss Axioplan 2 Imaging or a Nikon E600 micro-

scope, equipped for epifluorescence.

Statistical analysis

Changes in gene expression were given as fold

change of FGF-2 treated compared with untreated

MSCs. To determine the statistical significance of

induced gene expression (BT) compared with con-trols (CTL), the t-test was used. A value of P\ 0.05

was considered significant.

Results

Increases in cell proliferation and changes in BM-

MSC pellet morphology

BM-MSCs expanded during the fourth passage in the

presence of FGF-2 exhibited a shorter populationdoubling time than those expanded in the absence of

FGF-2 (2.1 vs. 11 days). Moreover in the presence of

the inducers, pellets from FGF-2-treated cells exhib-

ited a larger diameter at day 24 (1.6 mm) in compar-

ison to the pellets from untreated cells (1 mm).

Expansion with FGF-2 accelerates chondrogenic

induction and favors expression of the cartilage-

specific collagens

Since FGF-2 increases not only the growth rate butalso maintains the multidifferentiation potential of

human MSCs, we investigated whether the short-term

addition of FGF-2 during the expansion step, could

influence the effects of BMP-2/TGF-b3 observed in

our preliminary experiment, when cells were subse-

quently cultured in pellets. BM-MSCs were first

expanded in the presence or absence of 5 ng FGF-2/

ml during the fourth passage and then cultured in

pellets in the presence of the BT combination.

In order to evaluate the effect of this culture

condition on gene expression levels, the data are

presented as a ratio (FGF-2?/FGF-2-) for each gene

in Fig. 1. The data were pooled and presented as

means SEM as the gene expression profiles under

all the culture conditions were similar for the three

donors examined. First, we measured the expressionlevel variations for several collagen genes. With

FGF-2?/FGF-2- ratios close to 1, the same expres-

sion levels for COL6A1 and for COL27A1 mRNA

were recorded throughout the study under all culture

conditions (Fig. 1a). A similar pattern of expression

was observed for COL1A1 and COL12A1 mRNA

with an increase in the presence of FGF-2 only on

day 12 under both culture conditions (CTL and BT).

For the other collagen genes, their expression levels

were maximal on day 12 in those (?FGF-2) pellets

that received the inducers and levels decreasedslightly over time in culture. Statistically significant

increases were recorded only on day 12 for COL9A1

(885-fold; P = 0.07), COL11A2 (540-fold; P =

0.009). For COL2A1 (311-fold; P = 0.01 and

23-fold; P = 0.06), COL10A1 (575-fold; P\ 0.001

and 75-fold; P\0.001) and for COL11A1 (33-fold;

P = 0.02 and 12-fold; P = 0.006) increases were

significant both on day 12 and day 24. Second, we

investigated the variations in expression levels for

other components playing a role in ECM production

during chondrogenesis (Fig. 1b). For a gene such asMMP13 the presence of FGF-2 during expansion was

followed by a slight increase in the expression levels

under all the culture conditions. A similar expression

pattern was recorded for SOX9 and AGC1 mRNA

levels, with the highest levels on day 12 in (?FGF-2)

pellets receiving the inducers. When compared to the

control conditions, the largest increases (56-fold;

P\ 0.001) were recorded for the AGC1 mRNA

level. Finally, higher expression levels were observed

for all the genes in the pellets on day 24 compared to

human articular chondrocytes, whatever the cultureconditions (Electronic Supplementary Figs. 1 and 2).

The cartilage-characteristic gene expression levels

measured on day 24 in inducer-treated-pellets were

higher than those in articular chondrocytes (Ach),

strongly suggesting a chondrogenic conversion of

MSCs. Furthermore, the greatest difference was

noted for COL10A1 mRNA, certainly due to the

non-hypertrophic and non-osteoarthritic characteris-

tics of articular chondrocytes.

Biotechnol Lett (2011) 33:20912101 2095

123


6/11

Expansion with FGF-2 favors the expression

of the cartilage-specific collagen isoform of type

II procollagen

To examine the extent of this chondrogenic conver-

sion more closely, we analyzed the expression of the

pre-cartilaginous isoform (IIA) and cartilaginous

isoform (IIB) of type II procollagen. First, total type

II procollagen expression was detected, for the three

donors, in the presence of BT at high levels in

(?FGF-2) pellets, on days 12 and 24 (Fig. 2a, Elec-

tronic Supplementary Fig. 3), whereas in (-FGF-2)

pellets it could only be detected on day 24. Second,

both IIA and IIB transcriptswere expressed and a sharp

decrease in IIA expression occurred between days 12

and 24 (Fig. 2a). Indeed, quantitative analysis of the

A

B

0

1

10

100

1000

10000

CTL BT CTL BT CTL BT CTL BT CTL BT CTL BT CTL BT CTL BT CTL BT

COL1A1 COL2A1 COL6A1 COL9A1 COL10A1 COL11A1 COL11A2 COL12A1 COL27A1

0

1

10

100

CTL BT CTL BT CTL BT

AGC1 SOX9 MMP13

Fig. 1 a Effect of FGF-2 during MSC expansion on geneexpression during subsequent culture in pellet. The levels of

collagen genes associated with the chondrogenic phenotype

(COL1A1, COL2A1, COL6A1, COL9A1, COL10A1, COL11A1,

COL11A2, COL12A1, COL27A1) were analyzed by real-time

PCR on total RNA isolated on days 1, 12 and 24 from the

MSCs of three donors, amplified in the absence or presence of

FGF-2 (?) during the fourth passage and further induced

towards chondrogenesis in pellets in the absence (CTL) or

presence of BMP-2 and TGF-b3 (BT). The results are

presented as the ratio of the relative quantities corresponding

to expansion (?FGF-2/-FGF-2), obtained under each condi-

tion for each donor. Data are presented as means SE and

P values are given. b Effect of FGF-2 during expansion ofMSCs on gene expression during subsequent pellet culture.

The levels of genes associated with the formation of

chondrogenic extracellular matrix components (AGC1, SOX9

and MMP13) were analyzed by real-time PCR on total RNA

isolated on days 1, 12 and 24 from MSCs of three donors,

amplified in the absence or presence of FGF-2 (?) during the

fourth passage and further induced towards chondrogenesis in

pellet culture in the absence (CTL) or presence of BMP-2 and

TGF-b3 (BT). The results are presented as the ratio of the

relative quantities corresponding to expansion (?FGF-2/-

FGF-2), obtained under each condition for each donor. Data are

presented as means SE and P values are given

2096 Biotechnol Lett (2011) 33:20912101

123


7/11

IIA and IIB amplicons showed that their relative values

switched from 36:64 on day 12 to 5:95 on day 24,

supporting the view that BM-MSCs had entered a

chondrogenic differentiation pathway. Furthermore,

these latter data differed from that measured (25:75)

for human Ach which rapidly and partially dediffer-

entiate in monolayer culture.Finally, immunohistological analysis was carried

out to visualize accumulation and localization of

cartilage matrix components synthesized by the cells

during the course of chondrogenic induction. As

shown on Fig. 2b, type II collagen, including the type

IIA isoform, was progressively synthesized and

deposited in the extracellular matrix of the pellets,

in a time and culture condition-dependent manner.

There was more intense immunofluorescent staining

at the periphery of the (?FGF-2) pellets induced with

BT (Fig. 2b). Immunostaining of type IIA procolla-gen was observed at the periphery of the pellets on

day 12, showing the early presence of chondropro-

genitor-like cells in the pellets, and this staining was

still observed on day 24 (Fig. 2b). When peroxidase

staining was used, both extracellular and intracellular

labeling of type II collagen could be clearly seen on

day 24 although with a non-homogenous deposition

(Electronic Supplementary Fig. 4), suggesting that

the cells were still metabolically active towards

chondrogenic differentiation. It is also interesting to

report that labeling for type VI collagen was presentin the (-FGF-2) pellet more at the periphery on day

24. In the BT-treated pellet this collagen was

deposited at similar locations than type II collagen

and aggrecan (Electronic Supplementary Fig. 4).

Altogether these immunohistological findings also

upheld the results from real-time PCR.

Discussion

BM-MSCs are capable of chondrogenic differentiationin vitro in the presence of various growth factors

provided during the expansion and induction steps. In

this study, we found that expanding the MSCs in the

presence of FGF-2 for a short-term addition during the

fourth passage stimulated the cell chondrogenic con-

version induced by the combination of BMP-2 and

TGF-b3. The switch in expression from the pre-

cartilaginous IIA isoform to the cartilaginous IIB

isoform of the type II procollagen gene and an increase

in gene expression of the main collagen types forming

the primary core fibrillar network of cartilage sup-

ported this conversion.

When we performed cell expansion with growth

medium supplemented with FGF-2, we obtained data

consistent with the findings of other groups concern-

ing the stimulatory effects of this growth factor onBM-MSC proliferation and differentiation (Solchaga

et al. 2005, 2010; Varas et al. 2007). Our data are of

interest as they report the effect of adding FGF-2 for

a short time, at the fourth passage, in comparison to

its presence during all passages in the other studies.

The cell proliferation that we observed, assessed by

the shortening of the population doubling time, is the

mark that the cells after 3 passages in culture were

still responsive to the mitogenic factor FGF-2. As in

many studies the chondrogenic differentiation was

induced in cells expanded with or without a cocktailof growth factors and at different passages (15) our

data are not surprising and they correspond to another

cell amplification condition (Ronziere et al. 2010). In

the presence of the inducers (BMP-2/TGF-b3) the

cells in pellets exhibited a higher chondrogenic

potential with larger pellet derived from FGF-2-

treated cells than those made from control cells

corresponding to a higher matrix synthesis as previ-

ously reported (Solchaga et al. 2005). There was an

enhancing effect of FGF-2-treatment on the gene

expressed in pellet cultures between days 1 and 12mainly for the genes coding for cartilage components.

Changes were about one hundred-fold for the major

cartilage collagens (COL2A1, COL9A1, COL11A2

and COL10A1 mRNA) and about ten-fold for the

genes coding for other cartilage specific components

(AGC1 and COL11A1 mRNA). Only the levels of

expression of 2 chondrogenic-specific genes COL2A1

and COL11A2 increased between days 12 and 24

attesting that it was sufficient to add FGF-2 at the

passage preceding the induction to observe its chon-

drogenic capacity.It is still not clear how FGF-2 plays a role in

chondrogenesis as several signal transduction path-

ways might be activated in addition to the MEK/ERK

(mitogen-activated protein kinase kinase/extracellu-

lar-signal regulated kinase) cascade and the Wnt

signaling by FGFs stimulation described in these cells

(Bobick et al. 2007; Solchaga et al. 2010). As FGFs

and their receptors play fundamental roles regulating

growth morphogenesis and cartilage formation in

Biotechnol Lett (2011) 33:20912101 2097

123


8/11

embryonic limbs further studies have to be conducted

to describe and understand the precise role of FGFs

on in vitro MSC chondrogenesis. The chondrogene-

sis, in our culture conditions, was not totally efficient

in the pellets as the ECM was not homogeneously

deposited around the cells in FGF-2 treated samples

contrary to previously reported data with FGF-2

present at all passages (Solchaga et al. 2005). Beside

the differences in cell harvesting, donor variability

and culture conditions in different laboratories these

data likely correspond to the heterogeneity of the cell

population after the expansion steps (Kastrinaki et al.

2008).

Chondrogenic conversion was also clearly shown

on day 12 by the expression of both the IIA and IIB

forms of procollagen type II and on day 24 by the

Fig. 2 a Expression of the type II procollagen gene, COL2A1

(total) and isoforms IIA and IIB in pellet culture. MSCs were

first expanded in the absence or presence of FGF-2 (?) and

further induced towards chondrogenesis in pellet culture in the

absence or presence of BMP-2 and TGF-b3 (BT). Total RNA

were extracted from the pellets after 12 and 24 days of culture

and measured by conventional PCR, using specific primers.

GAPDHwas used as the housekeeping gene. Data are obtained

from one donor representative of all three. b Collagen type II

deposition by MSCs in pellet culture. The pellets were obtained

as described in Fig. 2a. The pellets were fixed and immuno-

stained for type II collagen using a polyclonal antibody against

the triple helical domain (total type II collagen) and a

polyclonal antibody against the CR domain (propeptide of

type IIA collagen) (green collagen, red nucleus). Bar 250 lm.

Inset double-stained immunofluorescence for type II collagen

(triple helix staining, Alexa Fluor 488) and type IIA collagen

(propeptide IIA staining, Cy3 labeled antibodies) under 24-day

culture (green collagen). Bar 500 lm. Results are obtained

from one representative of three independent experiments

2098 Biotechnol Lett (2011) 33:20912101

123


9/11

switch in expression from type IIA to type IIB. In

addition, type II collagen synthesis (including the

type IIA form) was only detected in (?FGF-2) pellets

treated with BT. Importantly, the switch was

observed under these culture conditions with cells

obtained from three donors. Indeed, this combination

overtook donor-to-donor phenotypic differences thatwere observed in the other culture conditions (Elec-

tronic Fig. 3). Thus, our data show that measuring the

procollagen IIA: procollagen IIB ratio gives a useful

index of chondrogenic induction during the culture of

MSCs. Moreover, Murdoch demonstrated that only

4 days were necessary for a complete switch of

phenotype in Transwell culture, while more than

12 days were required in pellet culture, implying that

the microenvironment of the MSCs played a role

together with the addition of growth factors (Mur-

doch et al. 2007). Our data also showed that theincrease in gene expression was correlated with an

increase in ECM synthesis, as attested by immuno-

staining of type II collagen and aggrecan in the

pellets. The fact that type IIA procollagen, the non-

chondrogenic form of type II collagen, was still

present at day 24 in the pellet is likely an indicator of

an incomplete or slow chondrogenesis in our culture

model in comparison with, for example, the Trans-

well culture. However, our model may be used to

study the mechanisms involved in the synthesis of

type II collagen and it organization in the ECMduring MSC chondrogenesis.

We also paid particular attention to the expression

of collagens rarely studied in the context of MSCs

and not investigated in an in vitro model of

chondrogenesis. We found that BM-MSC cultures

expressed COL6A1, COL12A1 and COL27A1, three

genes coding for proteins previously described as

playing a structural role in the perichondrocytic

matrix and at the bone cartilage interface (Alexopo-

ulos et al. 2009; Gregory et al. 2001; Hjorten et al.

2007). Interestingly, these three genes appeared not toresponse, contrary to the other collagen genes, to the

addition of FGF-2 during cell expansion. Further-

more, COL12A1 and COL27A1 genes appeared to be

up-regulated by the combination of inducers but not

COL6A1 gene, which was unresponsive to the culture

conditions of the study. Along this study we were

able to visualize type VI collagen which, in normal

articular cartilage, has an exclusive location in the

pericellular matrix together with proteoglycan,

fibronectin and type II and IX collagens (Poole

et al. 1997). Type VI was recently reported as an

integrating molecule in a Col6a1-knockout mice as

its deficiency led to an alteration in the biologic and

mechanical environment of the chondrocyte (Alexo-

poulos et al. 2009). Thus our finding of the presence

of type VI collagen together with type II collagen andaggrecan in the pellets indicates that the cells

accumulate a cartilage-like matrix with an organiza-

tion of the molecules not yet characteristic of native

articular chondrocytes. Chondrogenesis is a dynamic

process where ECM production is constantly chang-

ing. Thus the presence of different type of collagens

described to play a role in the alignment of the fibrils

(type XII collagen) or in the later stages of the

cartilage to bone formation to likely offer a transient

scaffold for cartilage mineralization (type XXVII

collagen) may be required to produce different cellmatrix interactions corresponding to a specific stage

of the chondrogenic program (Gregory et al. 2001;

Hjorten et al. 2007; Plumb et al. 2007). Additional

studies will be required to more completely describe

and understand the role of these collagens in

chondrogenesis.

Conclusion

The competency of MSCs for chondrogenesis, under

treatment with BMP-2 and TGF-b3, is accelerated

and enhanced by the presence of FGF-2, during cell

amplification at the passage preceding the induction.

This was particularly demonstrated by the induction

of a subset of genes coding for collagens forming the

primary core of the fibrillar cartilage network.

However, the persistent expression of COL1A1, a

marker gene for mesenchymal cells, and the induc-

tion of COL10A1 expression observed in our cell

model and in other studies indicate that turning offthese expressions, and thus the deposition of non

cartilage-characteristic proteins, should be one of the

main future aims in cartilage therapy strategies that

use MSCs as a cell source. For instance, the use of

decoy or siRNA strategies targeting transactivators of

the genes could be considered in further studies.

Acknowledgments This work was supported by Cluster

Handicap Vieillissement NeuroSciences (HVN) (Decryp-

tage des interactions des cellules souches avec la matrice

Biotechnol Lett (2011) 33:20912101 2099

123


10/11

extracellulaire necessaires a leur conversion en chondrocytes)

from the Region Rhone-Alpes. The authors would like to thank

Dr L J Sandell (Washington University School of Medicine,

St Louis, MO, USA) for rabbit antiserum against recombinant

human type IIA and Sylviane Guerret (Novotec, Lyon, France) for

her expertise in histological analysis. The Analyse Genetique and

Platim platforms of IFR 128 are gratefully acknowledged for the

use of the iCycler iQ (BioRad) and the Nikon E600 microscope.

References

Aigner T, Zhu Y, Chansky HH, Matsen FA 3rd, Maloney WJ,

Sandell LJ (1999) Reexpression of type IIA procollagen

by adult articular chondrocytes in osteoarthritic cartilage.

Arthritis Rheum 42:14431450

Alexopoulos LG, Youn I, Bonaldo P, Guilak F (2009) Devel-

opmental and osteoarthritic changes in Col6a1-knockout

mice: biomechanics of type VI collagen in the cartilage

pericellular matrix. Arthritis Rheum 60:771779Bobick BE, Thornhill TM, Kulyk WM (2007) Fibroblast

growth factors 2, 4, and 8 exert both negative and positive

effects on limb, frontonasal, and mandibular chondro-

genesis via MEK-ERK activation. J Cell Physiol 211:

233243

Cortial D, Gouttenoire J, Rousseau CF, Ronziere MC, Piccardi

N, Msika P, Herbage D, Mallein-Gerin F, Freyria AM

(2006) Activation by IL-1 of bovine articular chondro-

cytes in culture within a 3D collagen-based scaffold. An

in vitro model to address the effect of compounds with

therapeutic potential in osteoarthritis. Osteoarthr Cartil 14:

631640

Cournil-Henrionnet C, Huselstein C, Wang Y, Galois L,

Mainard D, Decot V, Netter P, Stoltz JF, Muller S, GilletP, Watrin-Pinzano A (2008) Phenotypic analysis of cell

surface markers and gene expression of human mesen-

chymal stem cells and chondrocytes during monolayer

expansion. Biorheology 45:513526

Freyria AM, Cortial D, Ronziere MC, Guerret S, Herbage D

(2004) Influence of medium composition, static and stir-

red conditions on the proliferation of and matrix protein

expression of bovine articular chondrocytes cultured in a

3-D collagen scaffold. Biomaterials 25:687697

Freyria AM, Courtes S, Mallein-Gerin F (2008) [Differentia-

tion of adult human mesenchymal stem cells: chondro-

genic effect of BMP-2]. Pathol Biol (Paris) 56:326333 in

French

Gregory KE, Keene DR, Tufa SF, Lunstrum GP, Morris NP

(2001) Developmental distribution of collagen type XII in

cartilage: association with articular cartilage and the

growth plate. J Bone Miner Res 16:20052016

Hautier A, Salentey V, Aubert-Foucher E, Bougault C, Beau-

chef G, Ronziere MC, De Sobarnitsky S, Paumier A,

Galera P, Piperno M, Damour O, Mallein-Gerin F (2008)

Bone morphogenetic protein-2 stimulates chondrogenic

expression in human nasal chondrocytes expanded in

vitro. Growth Factors 26:201211

Hjorten R, Hansen U, Underwood RA, Telfer HE, Fernandes

RJ, Krakow D, Sebald E, Wachsmann-Hogiu S, Bruckner

P, Jacquet R, Landis WJ, Byers PH, Pace JM (2007) Type

XXVII collagen at the transition of cartilage to bone

during skeletogenesis. Bone 41:535542

Karlsson C, Brantsing C, Svensson T, Brisby H, Asp J, Tall-

heden T, Lindahl A (2007) Differentiation of human

mesenchymal stem cells and articular chondrocytes:

analysis of chondrogenic potential and expression pattern

of differentiation-related transcription factors. J Orthop

Res 25:152163

Kastrinaki MC, Andreakou I, Charbord P, Papadaki HA (2008)

Isolation of human bone marrow mesenchymal stem cells

using different membrane markers: comparison of colony/

cloning efficiency, differentiation potential, and molecular

profile. Tissue Eng C Methods 14:333339

Khan WS, Tew SR, Adesida AB, Hardingham TE (2008)

Human infrapatellar fat pad-derived stem cells express the

pericyte marker 3G5 and show enhanced chondrogenesis

after expansion in fibroblast growth factor-2. Arthritis Res

Ther 10(4):R74

Khan WS, Johnson DS, Hardingham TE (2010) The potential

of stem cells in the treatment of knee cartilage defects.

Knee 17(6):369374Marsano A, Millward-Sadler SJ, Salter DM, Adesida A,

Hardingham T, Tognana E, Kon E, Chiari-Grisar C,

Nehrer S, Jakob M, Martin I (2007) Differential carti-

laginous tissue formation by human synovial membrane,

fat pad, meniscus cells and articular chondrocytes. Os-

teoarthr Cartil 15:4858

Mehlhorn AT, Schmal H, Kaiser S, Lepski G, Finkenzeller G,

Stark GB, Sudkamp NP (2006) Mesenchymal stem cells

maintain TGF-beta-mediated chondrogenic phenotype in

alginate bead culture. Tissue Eng 12:13931403

Merceron C, Vinatier C, Portron S, Masson M, Amiaud J,

Guigand L, Cherel Y, Weiss P, Guicheux J (2009) Dif-

ferential effects of hypoxia on osteochondrogenic poten-

tial of human adipose-derived stem cells. Am J PhysiolCell Physiol 298:C355C364

Miyanishi K, Trindade MC, Lindsey DP, Beaupre GS, Carter

DR, Goodman SB, Schurman DJ, Smith RL (2006) Dose-

and time-dependent effects of cyclic hydrostatic pressure

on transforming growth factor-beta3-induced chondro-

genesis by adult human mesenchymal stem cells in vitro.

Tissue Eng 12:22532262

Murdoch AD, Grady LM, Ablett MP, Katopodi T, Meadows RS,

Hardingham TE (2007) Chondrogenic differentiation of

human bone marrow stem cells in transwell cultures: gen-

eration of scaffold-free cartilage. Stem Cells 25:27862796

Oganesian A, Zhu Y, Sandell LJ (1997) Type IIA procollagen

amino propeptide is localized in human embryonic tis-

sues. J Histochem Cytochem 45:14691480

Pelttari K, Winter A, Steck E, Goetzke K, Hennig T, Ochs BG,

Aigner T, Richter W (2006) Premature induction of

hypertrophy during in vitro chondrogenesis of human

mesenchymal stem cells correlates with calcification and

vascular invasion after ectopic transplantation in SCID

mice. Arthritis Rheum 54:32543266

Petit B, Freyria AM, van der Rest M, Herbage D (1992) Car-

tilage collagens. In: Adolphe M (ed) Biological regulation

of the chondrocytes. CRC, Boca Raton, pp 3384

Plumb DA, Dhir V, Mironov A, Ferrara L, Poulsom R, Kadler

KE, Thornton DJ, Briggs MD, Boot-Handford RP (2007)

2100 Biotechnol Lett (2011) 33:20912101

123


11/11

Collagen XXVII is developmentally regulated and forms

thin fibrillar structures distinct from those of classical ver-

tebrate fibrillar collagens. J Biol Chem 282:1279112795

Poole CA, Gilbert RT, Herbage D, Hartmann DJ (1997)

Immunolocalization of type IX collagen in normal and

spontaneously osteoarthritic canine tibial cartilage and

isolated chondrons. Osteoarthr Cartil 5:191204

Ronziere MC, Perrier E, Mallein-Gerin F, Freyria AM (2010)

Chondrogenic potential of bone marrow- and adipose

tissue-derived adult human mesenchymal stem cells.

Biomed Mater Eng 20:145158

Sandell LJ, Morris N, Robbins JR, Goldring MB (1991)

Alternatively spliced type II procollagen mRNAs define

distinct populations of cells during vertebral development:

differential expression of the amino-propeptide. J Cell

Biol 114:13071319

Schmitt B, Ringe J, Haupl T, Notter M, Manz R, Burmester

GR, Sittinger M, Kaps C (2003) BMP2 initiates chon-

drogenic lineage development of adult human mesen-

chymal stem cells in high-density culture. Differentiation

71:567577

Sekiya I, Larson BL, Vuoristo JT, Reger RL, Prockop DJ(2005) Comparison of effect of BMP-2, -4, and -6 on in

vitro cartilage formation of human adult stem cells from

bone marrow stroma. Cell Tissue Res 320:269276

Shen B, Wei A, Tao H, Diwan AD, Ma DD (2009) BMP-2

enhances TGF-beta3-mediated chondrogenic differentia-

tion of human bone marrow multipotent mesenchymal

stromal cells in alginate bead culture. Tissue Eng A 15:

13111320

Solchaga LA, Penick K, Porter JD, Goldberg VM, Caplan AI,

Welter JF (2005) FGF-2 enhances the mitotic and chon-

drogenic potentials of human adult bone marrow-derived

mesenchymal stem cells. J Cell Physiol 203:398409

Solchaga LA, Penick K, Goldberg VM, Caplan AI, Welter JF

(2010) Fibroblast growth factor-2 enhances proliferation

and delays loss of chondrogenic potential in human adult

bone-marrow-derived mesenchymal stem cells. Tissue

Eng A 16:10091019

Tew SR, Murdoch AD, Rauchenberg RP, Hardingham TE

(2008) Cellular methods in cartilage research: primary

human chondrocytes in culture and chondrogenesis in

human bone marrow stem cells. Methods 45:29

Varas L, Ohlsson LB, Honeth G, Olsson A, Bengtsson T,

Wiberg C, Bockermann R, Jarnum S, Richter J, Pen-

nington D, Johnstone B, Lundgren-Akerlund E, Kjellman

C (2007) Alpha10 integrin expression is up-regulated on

fibroblast growth factor-2-treated mesenchymal stem cells

with improved chondrogenic differentiation potential.

Stem Cells Dev 16:965978

Vilamitjana-Amedee J, Bareille R, Rouais F, Caplan AI, Har-

mand MF (1993) Human bone marrow stromal cellsexpress an osteoblastic phenotype in culture. In Vitro Cell

Dev Biol Anim 29A:699707

Zhu Y, Oganesian A, Keene DR, Sandell LJ (1999) Type IIA

procollagen containing the cysteine-rich amino propeptide

is deposited in the extracellular matrix of prechondrogenic

tissue and binds to TGF-beta1 and BMP-2. J Cell Biol

144:10691080

Biotechnol Lett (2011) 33:20912101 2101

123

Analysis of collagen expression during chondrogenic induction of human bone marrow mesenchymal stem...

Documents

Transcript of Analysis of collagen expression during chondrogenic induction of human bone marrow mesenchymal stem...