An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An...
Transcript of An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An...
![Page 1: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/1.jpg)
Aninvestigationoffunctionaldiversityofendogenouscellulase
andexpressionofotherdigestiveenzymegenesinfreshwater
crayfish(Cherax)species
Dammannagoda Acharige Lalith Keerthiratne BSc (Agriculture) sp. Hons, MSc (Agriculture)
School of Earth, Environmental and Biological Sciences
Science and Engineering Faculty
Queensland University of Technology
Brisbane, Australia
A thesis submitted in fulfilment of requirements for the degree of Doctor of Philosophy
2014
![Page 2: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/2.jpg)
ii
Keywords
Cherax, freshwater crayfish, redclaw, yabby, marron, soluble cellulose, starch, endo‐
beta‐glucanase, endogenous cellulases, endo‐beta‐mannanase, digestive enzymes,
digestibility, transcriptome, transcripts, enzyme expression, gene expression,
hepatopancreas, midgut gland, next generation sequencing, ion torrent, ion proton
![Page 3: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/3.jpg)
iii
Statementoforiginalauthorship
QUT Verified Signature Lalith Dammannagoda Acharige August, 2014
![Page 4: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/4.jpg)
iv
Workspublishedorsubmittedforpublicationbytheauthorincorporatedintothethesis
Statement of contribution to jointly authored works in the thesis.
1. Dammannagoda L. K., Pavasovic A., Hurwood D. A. & Mather P. B. (2013). Effects
of soluble dietary cellulose on specific growth rate, survival and digestive enzyme
activities in three freshwater crayfish (Cherax) species. Aquaculture Research online
version doi:10.1111/are.12209
This manuscript is incorporated as Chapter 2 of this thesis. The first author was
responsible for conducting the research, analysis and interpretation of data, and
written work for this manuscript. The co‐authors were involved in refining the
experimental design and provided conceptual, logistical and editorial support.
2. Dammannagoda L. K., Pavasovic A., Prentis P. J., Hurwood D. A & Mather P. B.
(2014). Expression and characterisation of digestive enzyme genes from
hepatopancreatic transcripts from redclaw crayfish (Cherax quadricarinatus).
Aquaculture Nutrition (accepted).
This manuscript is incorporated as Chapter 3 of this thesis. The first author was
responsible for conducting the research, analysis and interpretation of data, and
written work for this manuscript. The co‐authors provided conceptual, logistical and
editorial support. In addition, the second and third co‐authors were involved in
refining the experimental design and data analysis.
3. Dammannagoda L. K., Prentis P. J., Amin S., Hurwood D. A, Mather P. B. &
Pavasovic A. Expression patterns of selected digestive enzyme genes in the
hepatopancreas of redclaw (Cherax quadricarinatus) fed two different carbohydrate
sources. (manuscript in preparation for submission to BMC Genomics)
This manuscript is incorporated as Chapter 4 of this thesis. The first author was
responsible for conducting the research, analysis and interpretation of data, and
![Page 5: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/5.jpg)
v
written work for this manuscript. The co‐authors provided conceptual, logistical and
editorial support. In addition, the second and last co‐authors were involved in
refining the experimental design and data analysis. The third co‐author helped with
tissue extraction and data analysis.
![Page 6: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/6.jpg)
vi
Acknowledgments
This Thesis is dedicated to my late father, my mother and all teachers who have
taught and enlightened me through giving knowledge.
First and foremost, my sincere thanks go to my supervisors, Prof. Peter Mather, Dr.
David Hurwood (School of Earth, Environmental and Biological Sciences, Science and
Engineering Faculty, Queensland University of Technology) and Dr. Ana Pavasovic
(School of Biomedical Sciences, Faculty of Health, Queensland University of
Technology) for all their help and support given to me to make my PhD journey a
successful one. Thanks to their excellent supervision, advice, guidance and
constructive comments during the project period and writing this thesis. In
particular, thanks to Peter for taking heed and guiding this project to the completion,
thanks to David for his eye for details during editing manuscripts and this thesis.
Special thanks to Ana who has been closely following me up from the beginning and
teaching me A, B, C of my project. Her encouragements and motivations “fuelled”
and kept me on the track. I was lucky to have such a great “class teacher” for my
PhD. I gratefully appreciate her friendly attitude and enormous support given to me
during my candidature.
I would also thank to Dr. Peter Prentis (School of Earth, Environmental and Biological
Sciences, Science and Engineering Faculty, Queensland University of Technology)
who opened my eyes to the new world of genetics, RNA and next generation
sequencing and for his significant contribution made for the second and third studies
of my PhD project. Thank you for your excellent teaching, a wide range of
information related to RNA extraction and next generation sequencing and for your
friendliness!
I am grateful for the time spent and generous help given by Associate Prof. Flavia
Hugens and Dr. Irani Ratnayake (School of Biomedical Sciences, Faculty of Health,
Queensland University of Technology) teaching me quantitative real‐time PCR
experiments and data analysis. I would also like to extend my gratitude to Dr. Patrick
Danoy (Roche, Australia) for demonstrating me conducting real‐time PCR
![Page 7: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/7.jpg)
vii
experiments using LightCycler96® and data analysis. You didn’t hesitate to make
several visits to QUT just for this purpose!
I would like to thank QUT for awarding me QUTPRA scholarship and providing me
necessary facilities to conduct my PhD project here. Thanks to all in QUT Molecular
Genetic Resource Facility (MGRF) and technical staff at Banyo Pilot Plant Precinct for
the help given to me during my project period. Specially, Vincent Chand who
facilitated arranged and organised everything for freshwater crayfish growth trial
conducted in Banyo and genetics works in MGRF laboratory. I would also thank to
Ms. Kylie Agnew‐Francis and Hamish Kelly for fast‐track sequencing my samples and
to Shane Russell for providing me some equipment for Banyo Aqualab. I also thank
to administration, technical, academic and research staff within the school of Earth,
Environmental and Biological Sciences for making a friendly environment with a
feeling of belonging to a community of people.
My sincere thanks go to Kristian Just (Technical Account Manager, Ridley Agri
Products Pty Ltd) for donating us shrimp meal and other feed ingredients to make
our experimental diets. I greatly acknowledge the support and cooperation given by
freshwater crayfish suppliers (Redclaw: Debbie White, Peter and Ethel Moore –
Cherax park, Theebine, Gympie, QLD; Marron: Peter McGinty – Aquatic Resources
Management Pty Ltd., Manjimup west, WA; Yabby: Peter and Margaret Burns – B
and B yabby farm, Mudgee, NSW) by supplying us good quality animals. Special
thanks to Cherax Park for donating us redclaw for the third study.
I would like to thank members of Physiology Genomics Lab (PGL) where our lab
group met regularly and discussed issues related to our project works, shared our
experiences and learnt new knowledge. Special thanks to Shorash Amin and Mohd
Yousuf Ali for helping me with my project work. Thanks to all my fellow postgrads
from past and present with special mention Dr. Eleanor Adamson, Dr. Matthew
Krosch, Dr. Litticia Bryant, Dr. Kumaran Nagalingam, Karma Wnagchuck, Coralie
Siegel, Amal Al Saadi, Feni Iranawati, Norainy Mohd Husin, Jobina Lopez, Melodina
Fabillo, Purnika Ranasinghe, Li Xin Eow, Yuvarin Boontop, Dania Aziz, Md. Lifat Rahi,
Sandya Nanayakkara, (School of Earth, Environmental, Biological Sciences),
![Page 8: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/8.jpg)
viii
Nadeesha Jayasundara, Imalka Tennakoon (School of Biomedical Sciences) Prasad
Neelawala, Suresh Shanaka (Business school), Dr. Isuru Wickramasinghe (School of
Chemistry, Physics and Mechanical Engineering), Dr. Lahiru Ratnayake, Dr. Chanaka
Abeysinghe for their valuable support given to me not only in university life but also
in my personal life.
I should thank Terrence (and his family, Shyama and little Nevi), my brother who
came to Australia ten years before me for his PhD and was always encouraging me to
come to QUT and do a PhD. As my elder brother, he always wants to see that I am
progressing in my higher education. Unless his continuous influence and
encouragement, I would not have got my mind motivated and decided to do a PhD.
Moreover, his presence in Brisbane made everything easy for me in settling down to
new destination which could be a rare opportunity for many new international
students.
Last but not least, my deepest thanks with love go to my wife, Kaumudi for taking
care of most of household matters and looking after our two sons, leaving me away
from those responsibilities while I am busy with my studies. I would like to recognise
the sacrifice she made and her patience to get me through this journey. My last
words, but above all, are for my little two sons, Anurag and Nethul for making our
lives happier with bringing new hopes day by day.
![Page 9: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/9.jpg)
ix
Abstract
Contribution of farmed crustacean species to global aquaculture production is
currently only 9.6 per cent and is mainly composed of farmed marine species. With
the ongoing decline in most commercial crustacean fisheries, freshwater crayfish
farming has gained significant attention over the last couple of decades as a viable
addition to the existing commercial fisheries of other types of marine crustaceans.
Current commercial farming practices however, are not fully developed and are
failing to meet the current growth in world market demand. Redclaw is the most
widely farmed Australian native species of freshwater crayfish followed by yabby
and marron; the three species in the genus (Cherax) that are farmed commercially.
Lack of appropriate information about specific nutrient requirements and
appropriate feeding practices for Cherax species has, to date, limited development
of their aquaculture. To address this significant knowledge gap, the current study
investigated growth and digestive enzyme activities of the three major Cherax
species fed soluble cellulose. In addition, redclaw hepatopancreas was profiled and
expressed sequence tags (ESTs) were characterised with reference to digestive
metabolism. Furthermore, deep sequencing was used to assess differentially
expressed digestive enzyme genes from the hepatopancreas in redclaw fed two
different carbohydrate sources.
Effects of soluble dietary cellulose on growth, survival and digestive enzyme
activities in three Australian freshwater crayfish species (redclaw: Cherax
quadricarinatus, marron: C. tenuimanus, yabby: C. destructor) were evaluated.
Separate individual feeding trials were conducted on late‐stage juveniles of each
species in an automated recirculating freshwater, culture system. Animals were fed
either a test diet (TD) that contained 20% soluble cellulose or a reference diet (RD)
substituted with the same amount of corn starch, over a 12 week period. Redclaw
fed with RD showed significantly higher (p<0.05) specific growth rates (SGR)
compared with animals fed the TD, while SGR of marron and yabby fed the two diets
were not significantly different. Marron and yabby showed significantly higher
cellulase activity when fed the RD (p<0.05) while expressed cellulase activity levels in
redclaw were not significantly different between diets. Amylase and protease
![Page 10: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/10.jpg)
x
activity in all three species were significantly higher in animals fed with RD (p<0.05).
Results indicate that test animals of all three species appear to utilise starch more
efficiently than soluble dietary cellulose in their diet. No significant difference in
cellulase activity observed between redclaw fed the two diets however, suggests a
better ability to utilise complex structural polysaccharides in their diets, compared
with the other two species.
Higher endogenous cellulase activities and molecular evidence for an endogenous
corresponding gene(s) that produce endo‐β‐1, 4 glucanase in redclaw have directed
recent research at assessing the characteristics of redclaw carbohydrase enzyme(s).
While a number of digestive enzymes and enzyme activity studies have been
conducted on this species, currently there is very little information available on
genes encoding digestive enzymes or their relative expression levels related to
digestive capacity. Here, the redclaw hepatopancreas was dissected from an animal
acclimated to the experimental conditions and normal shrimp feed.
Hepatopancreatic transcriptomes were profiled for ESTs using a next generation
sequencing (NGS) approach (Ion Personal Genome machine) and all resulting contigs
were assembled using Trinity software, referenced to the NR database at NCBI and
annotated using Blast2GO software. All contigs were then screened against protein
databases and the nucleotide database using BLASTx. Annotated contigs were
characterised in particular, paying special attention to the animal’s digestive
metabolism. While endoglucanases were the most abundant group of digestive
enzymes found, a number of novel transcripts were also detected. Here we provide
the first report for the presence and expression of an endo‐β‐mannanase in
freshwater crayfish hepatopancreas. This novel gene showed significant alignment
with a GH5 family protein reported from marine Limnoriids that are wood borers
and that do not possess symbiotic microbes in their gut system. Most expressed
digestive genes in redclaw were involved in carbohydrate metabolism demonstrating
that redclaw have an innate capacity to digest a wide range of carbohydrate
substrates.
Expression patterns of digestive enzyme genes in the hepatopancreas of redclaw fed
two different carbohydrate sources (soluble cellulose and corn starch), at 20 per cent
![Page 11: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/11.jpg)
xi
inclusion level were then explored to investigate differential expression patterns of
digestive enzyme genes in response to those two ingredients that have different
structural complexities. Pre‐adult redclaw were starved for 48 hours following which
they were fed with their respective diets. After 90 minutes of feeding time,
hepatopancreatic tissue was dissected for RNA extraction and transcriptome analysis
using the Ion Proton NGS platform. High quality mRNA samples from three animals
from each diet were then bar corded and sequenced on two separate chips (PI). All
contigs resulting from both chips were assembled (Trinity) and annotated using
Blast2GO software, referenced to the NR database at NCBI. All contigs were then
screened against protein databases using BLASTx. The transcripts we sequenced
showed a vast array of expressed genes in redclaw hepatopancreas and analysis of
ESTs from both test groups revealed that most redclaw digestive enzyme genes
expressed are involved in carbohydrate metabolism. Soluble cellulose in the diet
resulted in more genes being expressed and at higher expression levels, in particular,
genes that produced enzymes involved in hydrolysis of lignocellulosic material. In
contrast, dietary soluble cellulose resulted in lower expression of alpha amylase
compared with dietary starch in the redclaw hepatopancreas. A wide range of
redclaw digestive enzyme genes and presence of a number of isoforms, suggest that
this species has innate genetic capacity to utilise a wide range of carbohydrate
substrates of different structural complexity and a special ability to digest
lignocellulosic materials. Digestive enzyme gene expression patterns in the
hepatopancreas of redclaw reflect natural feeding behaviour.
The data generated here can contribute significantly to our current knowledge of
redclaw and other Australian freshwater crayfish nutrition and provide an important
resource for improving our understanding of their digestive physiology. The
transcriptome studies provide preliminary findings on digestive enzyme gene
expression in redclaw hepatopancreas and important information about the species’
genetic make‐up. As revealed here, there is a potential to incorporate complex plant
polysaccharides into their diets when formulating a specific diet in order to reduce
overall feed cost. Together, the data generated can help to identify low‐cost
potential feed ingredients that are well matched to the animal’s digestive enzyme
![Page 12: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/12.jpg)
xii
activities and genetic capacity and that can be utilised efficiently by them when
specific formulated diets are developed.
![Page 13: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/13.jpg)
xiii
Noteonthesispreparation
Chapter 2 to 4 of this thesis represent individual, independent studies that each have
a discrete set of specific objectives and introduction and discussion sections
particular to each study. As such, there is some necessary repetition of information
in the General Introduction (Chapter 1) and General Discussion and conclusions
sections (Chapter 5) when compared with the introductions and discussions sections
of chapter 2 to 4.
![Page 14: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/14.jpg)
xiv
Tableofcontents
KEY WORDS .................................................................................................................................... II
STATEMENT OF ORGINAL AUTHORSHIP ......................................................................................... III
WORKS PUBLISHED OR SUBMITTED FOR PUBLICATION BY THE AUTHOR INCORPORATED INTO THE
THESIS ........................................................................................................................................... IV
ACKNOWLEDGMENTS .................................................................................................................... VI
ABSTRACT ..................................................................................................................................... IX
NOTE ON THESIS PREPARATION ................................................................................................... XIII
TABLE OF CONTENTS .................................................................................................................... XIV
LIST OF FIGURES .......................................................................................................................... XVI
LIST OF TABLES .......................................................................................................................... XVIII
CHAPTER1: GENERAL INTRODUCTION .......................................................................................... 1
1.1 THE CONTRIBUTION FROM AQUACULTURE TO WORLD FOOD SUPPLY ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 1
1.2 CRUSTACEAN AQUACULTURE ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 2
1.3 FRESHWATER CRAYFISH AND CRAYFISH AQUACULTURE ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 3
1.4 CHERAX SPECIES ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 4
1.5 REDCLAW (CHERAX QUADRICARINATUS) ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 6
1.6 OTHER ECONOMICALLY IMPORTANT CHERAX SPECIES ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 7
1.6.1 Yabby (Cherax destructor) ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 7
1.6.2 Marron (Cherax tenuimanus) ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 9
1.7 AQUA FEEDS AND FRESHWATER CRAYFISH NUTRITION ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 10
1.8 NUTRITION AND DIGESTIVE PHYSIOLOGY OF FRESHWATER CRAYFISH ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 13
1.8.1 Crayfish natural habitats and feeding behaviour ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 13
1.8.2 Nutritional requirements of redclaw ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 13
1.8.3 Digestive enzymes ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 17
1.8.4 Endogenous cellulase ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 19
1.8.5 Digestive enzyme gene expression and transcriptome analysis ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 20
1.9 CELLULOSE AND BIOLOGICAL DEGRADATION OF CELLULOSE ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 22
1.10 CELLULOSE PLANT MATERIAL AND CRAYFISH DIET FORMULATION: IMPORTANCE OF ENDOGENOUS CARBOHYDRASES‐
‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 22
1.11 CURRENT STUDY ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 24
CHAPTER2: EFFECTS OF SOLUBLE DIETARY CELLULOSE ON SPECIFIC GROWTH RATE, SURVIVAL
AND DIGESTIVE ENZYME ACTIVITIES IN THREE FRESHWATER CRAYFISH (CHERAX) SPECIES ............ 26
ABSTRACT ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 28
2.1 INTRODUCTION ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 29
2.2 MATERIALS AND METHODS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 31
2.2.1 Preparation of experimental diets ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 31
2.2.2 Experimental animals and culture conditions ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 33
2.2.3 Digestive enzyme analyses ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 34
2.2.4 Statistical analyses ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 36
2.3 RESULTS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 37
2.3.1 Feeding trial ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 37
2.3.2 Enzyme activity levels ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 39
![Page 15: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/15.jpg)
xv
2.4 DISCUSSION ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 39
2.5 ACKNOWLEDGMENTS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 45
CHAPTER3: EXPRESSION AND CHARACTERISATION OF DIGESTIVE ENZYME GENES FROM
HEPATOPANCREATIC TRANSCRIPTS FROM REDCLAW CRAYFISH (CHERAX QUADRICARINATUS) ..... 46
ABSTRACT ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 48
3.1 INTRODUCTION ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 49
3.2 MATERIALS AND METHODS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 51
3.2.1 Collection of tissues and RNA extraction ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 51
3.2.2 cDNA synthesis, library preparation and sequencing‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 52
3.2.3 Analysis ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 52
3.3 RESULTS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 54
3.3.1 Transcriptome sequencing and reads assembly ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 54
3.3.2 Functional annotation of transcripts and gene ontology (GO) assignment ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 54
3.3.3 Identification of candidate digestive genes in redclaw hepatopancreas ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 55
3.4 DISCUSSION ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 59
3.5 ACKNOWLEDGMENTS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 69
3.6 SUPPLEMENTARY MATERIAL ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 70
CHAPTER4: EXPRESSION PATTERNS OF SELECTED DIGESTIVE ENZYMES GENES IN THE
HEPATOPANCREAS OF REDCLAW (CHERAX QUADRICARINATUS) FED TWO DIFFERENT
CARBOHYDRATE SOURCES ............................................................................................................ 76
ABSTRACT ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 78
4.1 INTRODUCTION ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 79
4.2 MATERIALS AND METHODS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 82
4.2.1 Experimental animals and diets ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 82
4.2.2 Total RNA extraction ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 82
4.2.3 mRNA enrichment‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 83
4.2.4 cDNA synthesis, library preparation and sequencing‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 83
4.2.5 Analysis ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 83
4.2.6 Quantitative PCR validation ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 84
4.3 RESULTS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 84
4.3.1 Transcriptome sequencing and reads assembly ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 84
4.3.2 Functional annotation and gene ontology (GO) assignment ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 86
4.3.3 Candidate digestive enzyme genes and their expression ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 86
4.3.4 Real‐time PCR validation ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 88
4.4 DISCUSSION ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 88
4.5 SUPPLEMENTARY MATERIAL ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 93
CHAPTER5: GENERAL DISCUSSION AND CONCLUSIONS .............................................................102
REFERENCE ..................................................................................................................................113
APPENDICES ‐ PUBLICATIONS .......................................................................................................138
![Page 16: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/16.jpg)
xvi
ListofFigures FIGURE 1.1.NATURAL DISTRIBUTIONS OF YABBIES, MARRON, AND REDCLAW (WINGFIELD 2008) ................................. 5 FIGURE 1.2. REDCLAW CRAYFISH (C. QUADRICARINATUS VON MARTENS 1868) ©DAVE WILSON (SOURCE:
HTTP://WWW.ARKIVE.ORG) .................................................................................................................. 7 FIGURE 1.3. YABBY CRAYFISH (C. DESTRUCTOR CLARK 1936) ©R.B. MCCORMACK .................................................. 8 FIGURE 1.4. MARRON CRAYFISH (C. TENUIMANUS SMITH 1912) ©CHRIS LUKHAUP ................................................. 9 FIGURE 1.5. INTERNAL ANATOMY OF FEMALE CRAYFISH SHOWING THE MAIN ORGANS, EXCEPT THE MUSCULATURE AND
ENDOCRINE SYSTEM (AFTER HOLDICH & REEVE 1988) .............................................................................. 17 FIGURE 2.1. MEAN WET BODY WEIGHT MEASURED BI‐WEEKLY FOR THREE SPECIES FED TWO DIETS OVER THE 12 WEEKS
TRIAL PERIOD. DATA POINTS REPRESENT MEAN ±SE .................................................................................. 38 FIGURE 3.1. TRANSLATED AMINO ACID SEQUENCE ALIGNMENT OF REDCLAW ENDOGLUCANASE SEQUENCES (CQ|EG_1,
CQ|EG_2 AND CQ|EG_3) REFERENCED TO CHERAX QUADRICARINATUS COMPLETE Β‐1, 4 ENDOGLUCANASE PROTEIN (CQ COMPLETE EG: AAD38027.1). IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK AND GREY
RESPECTIVELY. ................................................................................................................................... 57 FIGURE 3.2. PARTIAL ALIGNMENT OF REDCLAW (C.Q|EM_1) ENDO‐Β‐MANNANASE TRANSLATEDAMINO ACID SEQUENCE
COMPARED WITH THREE GH5 FAMILY PROTEINS FROM L. QUADRIPUNCTATA (GH5A: ADE58567.1, GH5C: ADE58568.1, GH5E: ADE58569.1). IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK AND GREY
RESPECTIVELY. ................................................................................................................................... 58 FIGURE 3.3. NUCLEOTIDE SEQUENCE ALIGNMENT OF REDCLAW (CQ) ENDO‐Β‐MANNANASE SEQUENCES REFERENCE TO
LIMNORIA QUADRIPUNCTATA (LQ) GH5A (ADE58567.1). IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK
AND GREY RESPECTIVELY. ..................................................................................................................... 59 FIGURE 3.4. EVOLUTIONARY RELATIONSHIP (NEIGHBOUR‐JOINING CONSENSUS TREE) OF REDCLAW ENDO‐Β‐MANNANASE
(C.Q|EM_1) COMPARED WITH MANNANASE SEQUENCES FROM OTHER CRUSTACEAN, MOLLUSC AND INSECT
SPECIES. L. QUADRIPUNCTATA (GH5A: ADE58567.1, GH5C: ADE58568.1, GH5E: ADE58569.1), D. PULEX (EFX71597.1), BIOMPHALARIA GLABRATA (AAV91523.1), APLYSIA KURODAI (BAJ60954.1), HALIOTIS DISCUS DISCUS (BAI99559.1), CALLOSOBRUCHUS MACULATUS (ADU33271.1), GASTROPHYSA VIRIDULA (ADU33333.1). (SCALE BAR REPRESENTS MEAN SUBSTITUTIONS PER SITE) .................................................. 60
FIGURE 3.5. TRANSLATED AMINO ACID SEQUENCE ALIGNMENT OF REDCLAW (CQ) CHITINASE REFERENCE TO SCYLLA
SERRATA (SS) CHITINASE PROTEIN (ABY85409.1). IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK AND GREY
RESPECTIVELY. ................................................................................................................................... 61 FIGURE 3.6. TRANSLATED AMINO ACID SEQUENCE ALIGNMENT OF ALPHA AMYLASE OF REDCLAW (CQ|AA_1, CQ|AA_2,
CQ|AA_3, AND CQ|AA_4) REFERENCE TO D. PULEX ALPHA AMYLASE PROTEIN (D. PULEX_AA‐EFX66437.1). IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK AND GREY RESPECTIVELY. ............................................. 62
FIGURE 3.7. TRANSLATED AMINO ACID SEQUENCE ALIGNMENT OF REDCLAW TRYPSIN ESTS (CQ|TRYPSIN_1,
CQ|TRYPSIN_2 AND CQ|TRYPSIN_3) REFERENCE TO FOUR TYPES OF CARIBBEAN SPINY LOBSTER (PANULIRUS ARGUS) TRYPSINS (TRYPSIN 1A: ADB66711.1, TRYPSIN 1B: ADB66712.1, TRYPSIN 2: ADB66713.1, TRYPSIN 3: ADB66714.1). IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK AND GREY RESPECTIVELY. ...................... 63
FIGURE 4.1 PAIRWISE COMPARISONS OF TRANSCRIPT ABUNDANCE BETWEEN TWO DIET TREATMENT GROUPS. (A) MA PLOT
FOR DIFFERENTIAL EXPRESSION ANALYSIS. LOG (FOLD CHANGE OR RATIO) [LOG (TD/RD)] FOR EACH GENE BETWEEN
THE TWO SAMPLES AGAINST THE GENE’S LOG (AVERAGE EXPRESSION) [½LOG (RD*TD)] IN THE TWO SAMPLES. (B) VOLCANO PLOT FOR FALSE DISCOVERY RATE (‐LOG10FDR) AS A FUNCTION OF LOG (FOLD CHANGE) BETWEEN THE
SAMPLES. TRANSCRIPTS THAT WERE DIFFERENTIALLY EXPRESSED (UP REGULATED OR DOWN REGULATED ARE SHOWN
IN RED. ............................................................................................................................................ 85
![Page 17: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/17.jpg)
xvii
Supplementary sections FIGURE S 3.1 FUNCTIONAL ANNOTATION OF REDCLAW (C. QUADRICARINATUS) ACROSS DIFFERENT GO TERM CATEGORIES.
...................................................................................................................................................... 70 FIGURE S 3.2 ALIGNMENT OF TRANSLATED AMINO ACID SEQUENCE OF REDCLAW AMPLIFIED CHITINASE GENE FRAGMENT
(C_AMP) WITH TRANSLATED AMINO ACID SEQUENCES OF CHITINASE FRAGMENTS RESULTED FROM THE
TRANSCRIPTOME (C_SEQ1 AND C_SEQ2). IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK AND GREY
RESPECTIVELY (69.8% PAIRWISE IDENTITY AND 64.2% COLUMN WISE IDENTITY). .......................................... 71 FIGURE S 3.3 ALIGNMENT OF TRANSLATED AMINO ACID SEQUENCE OF REDCLAW AMPLIFIED ENDO‐Β‐MANNANASE GENE
FRAGMENT (MANN_AMP) WITH TRANSLATED AMINO ACID SEQUENCES OF ENDO‐Β‐MANNANASE RESULTED FROM
THE TRANSCRIPTOME (MANN_SEQ1 AND MANN_SEQ2). IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK AND
GREY RESPECTIVELY (ESTIMATED AT 85.2% AND 85.8% PAIR WISE AND COLUMN WISE IDENTITY, RESPECTIVELY). 71 FIGURE S 3.4 ALIGNMENT OF TRANSLATED AMINO ACID SEQUENCE OF REDCLAW AMPLIFIED LIPASE GENE FRAGMENT
(LIP_AMP) WITH TRANSLATED AMINO ACID SEQUENCES OF LIPASE (LIP_SEQ1) RESULTED FROM THE
TRANSCRIPTOME. IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK AND GREY RESPECTIVELY (ESTIMATED AT
100.0% PAIR WISE AND COLUMN WISE IDENTITY). ................................................................................... 72 FIGURE S 3.5 ALIGNMENT OF TRANSLATED AMINO ACID SEQUENCE OF REDCLAW AMPLIFIED TRYPSIN GENE FRAGMENTS
(T1_AMP AND T2_AMP) WITH TRANSLATED AMINO ACID SEQUENCES OF TRYPSIN RESULTED FROM THE
TRANSCRIPTOME (T_SEQ1 AND T_SEQ2). IDENTICAL AND SIMILAR RESIDUES ARE SHADED BLACK AND GREY
RESPECTIVELY (ESTIMATED AT 69.9% PAIR WISE AND 47.4% COLUMN WISE IDENTITY). .................................. 72 FIGURE S 4.1. RELATIVE CONCENTRATIONS OF SELECTED DIGESTIVE ENZYME AND OTHER GENES IN REFERENCE (RD) AND
TREATED (TD) SAMPLES EVALUATED BY RELATIVE QUANTITATIVE REAL‐TIME PCR (FOR GENE NAMES, SEE TABLE S 4.1) .............................................................................................................................................. 101
![Page 18: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/18.jpg)
xviii
ListofTables TABLE 2.1 COMPOSITION OF RD AND TD DIETS. ............................................................................................... 32 TABLE 2.2 CULTURE CONDITIONS MAINTAINED FOR EACH SPECIES DURING THE EXPERIMENT. ..................................... 33 TABLE 2.3 SPECIFIC GROWTH RATE (±SEM) AND SURVIVAL RATE (%) ESTIMATED FOR THREE SPECIES FED TWO DIETS OVER
12 WEEK TRIAL. DIFFERENT SUPERSCRIPTS INDICATE SIGNIFICANT DIFFERENCES (P<0.05) ................................ 37 TABLE 2.4 SPECIFIC ENZYME ACTIVITY LEVELS (±SEM) IN THE MIDGUT GLAND. SPECIFIC ACTIVITY IS EXPRESSED AS UNITS
PER MILLIGRAM OF PROTEIN. COLUMN FIGURES SHOWING DIFFERENT SUPERSCRIPTS ARE SIGNIFICANTLY DIFFERENT
(P<0.05) ......................................................................................................................................... 39 TABLE 3.1 ANNOTATION RESULTS ................................................................................................................... 55 TABLE 3.2 LIST OF SELECTED CANDIDATE GENES REPRESENTED REDCLAW DIGESTIVE ENZYMES ..................................... 56 TABLE 4.1 SUMMARY OF SEQUENCE AND ASSEMBLY DATA ................................................................................... 85 TABLE 4.2 SUMMARY OF BLAST AND ANNOTATION RESULTS................................................................................. 86 TABLE 4.3 SELECTED CANDIDATE DIGESTIVE ENZYME GENES AND STATISTICS ........................................................... 87
Supplementary sections TABLE S 3.1 TOP 10 BLASTX RESULTS FOR CHERAX QUADRICARINATUS ENDO‐Β‐GLUCANASE, ................................... 73 TABLE S 3.2 LIST OF PRIMERS DESIGNED FOR SELECTED CANDIDATE GENES ............................................................. 74 TABLE S 3.3 TOP 10 BLASTX RESULTS FOR SELECTED GENE FRAGMENTS SEQUENCED FOR PCR VALIDATION ................. 75 TABLE S 4.1. LIST OF SELECTED DIGESTIVE ENZYME AND OTHER GENE PRIMERS USED FOR QRT‐PCR VALIDATION IN
REDCLAW. ........................................................................................................................................ 93 TABLE S 4.2. BLASTX RESULTS FOR SELECTED CANDIDATE DIGESTIVE ENZYME GENES FROM THE RD TRANSCRIPTOME (FIRST
10 RESULTS) ..................................................................................................................................... 94 TABLE S 4.3. BLASTX RESULTS FOR SELECTED CANDIDATE DIGESTIVE ENZYME GENES FROM THE TD TRANSCRIPTOME (FIRST
10 RESULTS) ..................................................................................................................................... 97 TABLE S 4.4. KEGG PATHWAYS OF REDCLAW HEPATOPANCREATIC GENES (PATHWAYS THAT ONLY 100 OR MORE
SEQUENCES ARE INVOLVED, ARE SHOWN). ............................................................................................. 100
![Page 19: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/19.jpg)
1
CHAPTER1: GeneralIntroduction
1.1 Thecontributionfromaquaculturetoworldfoodsupply
Produce from fisheries play an important role in human diet and provide a good
source of high quality animal protein, lipids and other essential nutrients (Tacon et
al. 2010). The contribution from fisheries and aquaculture to world food supply and
economic growth has become a key factor for global food security and it is estimated
that total production from capture fisheries and aquaculture will exceed that of beef,
pork and poultry over the next decade (FAO 2012). Global per capita fish
consumption has increased significantly since the 1960s (9.9 kg) and had almost
doubled by 2010 (18.6 kg). This contributed 16.6 per cent on average to total animal
protein consumption by humans and accounted for 6.5 per cent of all protein
consumed (FAO 2012). According to the FAO (2010, 2012), production from world
capture fisheries has continued to remain stable at around 90 million tonnes per
annum over the last decade. In 2006, wild harvests actually declined by 2.2 million
tonnes in comparison with 2005, mostly as a result of environmentally‐driven effects
(e.g. El Nino) on anchoveta catches compared with previous years (FAO 2007, 2009).
In addition, many wild fisheries are currently threatened by rising organic pollution,
toxic contamination, coastal degradation, and climate change (Garcia & Rosenberg
2010).
Marine capture fisheries in particular, are now considered to have reached their
maximum sustainable yield in many countries (FAO 2010). FAO (2012) has reported
that most of the top ten harvested marine fish species that account for 30 per cent
of total marine capture fish production are now fully exploited and hence have little
potential for further expansion of production. Moreover, over time wild capture
fisheries have gradually shifted from targeting large and valuable carnivorous species
to smaller, less valuable species (Naylor et al. 2000). Under these circumstances,
with declining profitability and no apparent additional supply available from marine
capture fisheries, production from aquaculture will need to increase significantly to
meet rising global demand for seafood. FAO (2012) has estimated that aquaculture
![Page 20: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/20.jpg)
2
will have to provide at least an additional 23 million tonnes of aquatic food to
maintain the current level of per‐capita consumption, by 2030.
In contrast to wild fisheries production, output from aquaculture has shown
significant growth over recent decades and has increased 12 fold over the last three
decades with an annual rate of increase of 8.8 per cent (FAO 2012) while terrestrial
farmed meat, egg, and milk production have grown at only 3.0%, 3.4%, and 1.5%,
respectively (Tacon et al. 2010). World aquaculture production in 2010 in total,
accounted for 40.3 per cent of the world’s food fish supply and mean supply per
consumer had increased from 7.8 kg (2006) to 8.7 kg (2010) (FAO 2012).
Aquaculture provides an alternative source of fish and other aquatic organisms, and
as such can reduce pressures placed by overfishing on wild fisheries (Naylor et al.
2000). Production and markets for lower‐value farmed species have increased in
both developing and industrialised countries (Naylor et al. 2000). Recent data
suggests that while supply of fish from aquaculture continues to outstrip projections
for growth, a more focussed approach will be needed in the future to optimise
growth and supply from this industry. This is needed in order to offset the effects of
static production from capture fisheries and to meet growing protein requirements
of an increasing human population, worldwide (FAO 2009).
1.2 Crustaceanaquaculture
Global aquaculture is dominated by freshwater fishes with the contribution from
farmed crustacean species currently only 9.6 per cent (5.7 million tonnes) which is
composed nearly 30 per cent from freshwater and 70 per cent from marine waters
(FAO 2012). The main farmed decapod crustaceans used in aquaculture include
marine and brackish water shrimp and prawns, freshwater prawns, freshwater
crayfish, clawed and spiny lobsters, and crabs. The key farmed marine crustacean
species currently are white leg shrimp (Penaeus vannamei), (2.75 million tonnes)
followed by giant tiger prawn (Penaeus monodon) (FAO 2012). Production of tropical
freshwater prawns remains of significant interest since the farming system used is
regarded in general, to be more sustainable than marine shrimp culture, a system
![Page 21: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/21.jpg)
3
that employs higher stocking densities and that requires high value coastal culture
sites (Wickins & Lee 2002). Of all major taxa used in aquaculture, culture of
crustacean species has expanded most rapidly over the last few decades and on
average, this industry grew by more than 15% per year from 1970 to 2006 (FAO
2009). While total production of crustaceans is comparatively low in quantity relative
to finfish and mollusc culture, in value terms, it provides a very significant
contribution (i.e. 23% of total world production from aquaculture in 2006) (FAO
2009).
Currently the contribution from farming of freshwater crustaceans to total
freshwater aquaculture production is relatively low (6.4 per cent) and is mainly
characterised by freshwater shrimp, Chinese mitten crab and some freshwater
crayfish species (FAO 2012). Farming of freshwater crayfish is dominated worldwide
by production from Australia, Europe, China and the southern states (mainly
Louisiana) of USA (Holdich 1993; Wickins & Lee 2002). Approximately 1/3 of total
freshwater crayfish production is based on red swamp crayfish (Procambarus clarkii)
together with the white river crayfish (Procambarus zonangulus) (Ackefors 2000),
that are mainly cultured in the USA and China (Wickins & Lee 2002; Harlio lu & Harlio
lu 2006) but substantial production is now also coming from several other countries
in central (Mexico) and south America (Argentina).
1.3 Freshwatercrayfishandcrayfishaquaculture
Freshwater crayfish are decapod crustaceans that are members of three families.
Cambaridae, mainly represented in North America and eastern Asia; Astacidae that
occur mainly in Eurasia but also in the western USA (Holdich 1993) and a third family
(Parastacidae) that is confined to the southern hemisphere, primarily to Australia
and New Zealand (Holdich 1993; Huner 1995; Crandall & Buhay 2008).
North America and Australia have the highest diversity of freshwater crayfish species
(Rouse 1995; Lawrence & Jones 2002). Despite this high diversity of taxa, commercial
farming of freshwater crayfish is currently limited to approximately only 10 species.
Key commercially produced species include 3 astacids (the noble crayfish (Astacus
![Page 22: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/22.jpg)
4
astacus), the narrow‐clawed crayfish (A. leptodactylus) and the signal crayfish
(Pacifastacus leniusculus)), 4 cambarids (the calico crayfish (Orconectes immunis),
the white river crayfish (Procambarus acutus acutus), the red swamp crayfish (P.
clarkii), and the white river crayfish (P. zonangulus)) and 3 parastacid species (the
yabby (Cherax albidus/destructor), redclaw (C. quadricarinatus), and marron (C.
tenuimanus)) (Huner 1995).
Freshwater crayfish in general, have a number of excellent characteristics that make
them ideal for aquaculture production (Holdich 1993). Unlike shrimp and prawns,
they do not possess a free‐living (planktonic) larval stage that necessitates a
hatchery cycle and different dietary compositions, so juvenile crayfish tend to
resemble adult crayfish and have similar dietary requirements (Holdich 1993; Jones
1995a). This is highly advantageous as it diminishes the need for expensive and
sophisticated hatcheries typically required for most farmed crustacean species with
a planktonic larval phase in their development. Consequently, culture of crayfish is in
general considered easier than that of most marine shrimps and freshwater prawns,
which in general possess multiple larval stages (Curtis & Jones 1995; Holdich 1995;
Jones 1995a; Masser & Rouse 1997; Jones et al. 2000; Jones & Ruscoe 2000; Rodgers
et al. 2006). Furthermore, many freshwater crayfish species are opportunistic,
polytrophic and omnivorous/detritivorous feeders, hence they can be fed with
relatively inexpensive feeds that do not require high animal protein levels so that
low‐cost plant ingredients can often be substituted into their diets.
1.4 Cheraxspecies
Australia possesses a rich diversity of freshwater crayfishes all of which belong to the
family Parastacidae and consists of 9 genera (Rouse 1995; Crandall & Buhay 2008)
and more than 100 species (Holdich 1993). To date the aquaculture industry for
parastacids, however, has focused on only three species, all members of the genus
Cherax that have been identified as candidate commercial aquaculture species
(Rouse 1995; Lawrence & Jones 2002; Wingfield 2008). The three Cherax species
include redclaw (C. quadricarinatus, Von Martens), yabby (C. destructor, Clark) and
marron (C. tenuimanus, Smith).
![Page 23: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/23.jpg)
5
The three native Cherax species cultured in Australia occur naturally in disjunct
geographical regions. Yabby occur across southern and central Australia, marron
occur only in south‐western Australia while redclaw is found only across northern
Australia (Figure 1.1) (Lawrence & Jones 2002). All three species have been widely
translocated, however, for commercial aquaculture production (Wingfield 2008).
Yabby culture is practiced across the species’ natural distribution with production in
New South Wales (NSW), South Australia (SA) and Victoria (Vic). Western Australia
(WA) has a translocated yabby population that has been established successfully in
culture and now provides the highest share of national yabby production (Wingfield
2008). Marron farming is largely restricted to southern WA, where the species is
native but with also substantial production now coming from mainland SA and
Kangaroo Island where the species has been translocated for commercial culture
(Wingfield 2008). Redclaw, although native to the Northern Territory (NT) and
northern Queensland, is mostly produced in southern and eastern parts of
Queensland, areas outside of the species’ natural distribution (Wingfield 2008).
Figure 1.1.Natural distributions of yabbies, marron, and redclaw (Wingfield 2008)
Total annual production of freshwater crayfish in Australia has frequently been
dominated by yabby which is cultured extensively in farm dams (Holdich 1993) and is
harvested opportunistically (Wingfield 2008). In the recent past, however, much
attention has been focussed on the culture of redclaw as the physical, biological and
commercial attributes make this species an excellent candidate for commercial
aquaculture (Jones 1990; Holdich 1993; Webster et al. 2002a, 2002b).
![Page 24: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/24.jpg)
6
1.5 Redclaw(Cheraxquadricarinatus)
While redclaw (Figure 1.2) is a relatively new entrant into crustacean aquaculture,
global production of this species has grown rapidly (Saoud et al. 2013, 2012). Key
characteristics that have contributed to the success of redclaw as an aquaculture
species include relatively rapid growth rate, with individuals reaching commercial
size (40 – 200 g) within 6 – 9 months under optimum culture conditions (Wickins &
Lee 2002). They also show behavioural characteristics that are favourable for culture
including; gregariousness, non‐aggressiveness, non‐burrowing habit and so culture
technologies are straightforward and relatively simple to develop (Masser & Rouse
1997). Redclaw is also physiologically adaptable and can tolerate relatively high
stocking densities, low oxygen concentrations (>1 ppm), as well as wide range of
water quality conditions including variation in water hardness and alkalinity (20 to
300 ppm), and pH (6.5 to 9) (Masser & Rouse 1997). In addition, this species can also
survive in a wide range of temperatures and salinities, hence it is classified as a
eurythermal, mesohaline species (Meade et al. 2002; Austin 1995; Karplus et al.
1998; Nyström 2002). Both male and female redclaw can reach sexual maturity
within 7 to 9 months under optimal culture conditions and they are year‐around
breeders that spawn 3 to 5 times per annum with a fecundity rate ranging from 100
to 1000 eggs/spawn depending on size of the animal under controlled conditions
(Jones 1995a; Masser & Rouse 1997). Importantly, redclaw can also utilise a wide
range of feed resources efficiently (Jones 1995b; Masser & Rouse 1997).
Favourable ecological and physiological characteristics and potential economic
importance in both the aquaculture and the ornamental aquarium industry have
resulted in wide translocations of redclaw within Australia and more widely
internationally (Saoud et al. 2013). In Australia, redclaw has been translocated to
parts of Western Australia and New South Wales and more widely, it has been
introduced to and is now cultured successfully in many countries including; North
America (USA), Central America (Mexico, Costa Rica, Guatemala), South America
(Ecuador, Argentina, Uruguay), the Caribbean (Jamaica, Puerto Rico) Europe (Italy,
Greece, Spain), the Middle East (Israel), Africa (Zambia), South East Asia (Malaysia,
Thailand, Taiwan, Singapore, Indonesia, Vietnam), Japan and China (reviewed in
![Page 25: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/25.jpg)
7
Saoud et al. 2013; Ghanawi & Saoud 2012). Feral populations of this species (escapes
from farms) have also been recorded recently in several countries (South Africa,
Mexico, Jamaica, Singapore, and Puerto Rico) as production of redclaw is now, no
longer restricted to Oceania (Saoud et al. 2013).
Figure 1.2. Redclaw crayfish (C. quadricarinatus von Martens 1868) ©Dave Wilson
(Source: http://www.arkive.org)
Wide translocation and significant commercial interest in redclaw farming has
resulted in much attention being directed towards domestication of this species,
including various aspects of husbandry and production optimisation. Some key
questions that require immediate attention however, include establishing the
species’ specific nutritional requirements and understanding digestive capacity, as
the industry moves to developing specific formulated low‐cost diets for this species.
Unlike other farmed Cherax species, specific dietary requirements for redclaw have
been investigated in some detail, in a number of nutritional studies (see Sections 1.7
and 1.8).
1.6 OthereconomicallyimportantCheraxspecies
1.6.1 Yabby (Cherax destructor)
Yabby (Figure 1.3) are smaller in size than both redclaw and marron and only reach
140 to 280 g in size and grow at an average rate of 20 – 40 g per year (Rouse 1995).
Yabby production is only practiced in Australia and most comes from trapping wild
yabbies in farm dams, a practice that is extended to stocking existing dams built for
water retention. This approach has made yabby production very cost‐effective
![Page 26: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/26.jpg)
8
(Lawrence & Jones 2002). Yabbies show high fecundity (spawn 3 ‐ 4 times per
season) and reach sexual maturity early, at 20 grams in size before one year of age.
This can however, have negative impacts and potentially results in a large number of
undersized animals when juvenile survival rate is high. High rates of early
reproduction can also often result in overcrowding and hence retard growth leading
to poor returns for farmers (Lawrence & Jones 2002).
Figure 1.3. Yabby crayfish (C. destructor Clark 1936) ©R.B. McCormack
(Source: http://www.aabio.com.au)
Yabbies are considered to be the hardiest of the three aquacultured Cherax species
because they can tolerate relatively poor water quality and significant temperature
fluctuations. Tolerance range for temperature varies from 7 to 340C, however, their
optimum range is 22 to 300C (Rouse 1995). Yabbies do not grow well at winter
temperatures below 150C and growth ceases all together at temperatures above
340C (Lawrence & Jones 2002). They can also survive fluctuations in water salinity
(up to approximately one third that of seawater) and changes in water quality, such
as decreased oxygen levels (lower than 1 ppm) in stagnant water, and more so than
what is observed in other Cherax species (Lawrence & Jones 2002). Yabbies are also
deep burrowers, are considered to be territorial and can also remain dormant in
burrows for long periods during dry conditions (Rouse 1995; Lawrence & Jones
2002).
C. destructor cultured extensively in farm dams are usually provided only periodically
with cheap commercial pellets as a supplementary feed, hence underfeeding is a
major and widespread problem in yabby culture (Lawrence & Jones 2002).
![Page 27: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/27.jpg)
9
Development of a nutritionally complete diet for yabbies has not yet been achieved
while some progress is being made (Jones et al. 1996; Lawrence & Jones 2002).
1.6.2 Marron (Cherax tenuimanus)
Marron (Figure 1.4) is one of the largest freshwater crayfish species in the world and
achieves the highest farm gate prices for freshwater crayfish species currently
farmed in Australia (Lawrence 2007). They are highly regarded as a luxury product
(Wickins & Lee 2002). Although they can reach over 2 kg in size (Rouse 1995),
marron in general, are harvested at smaller sizes and most commonly are sold in the
100 ‐ 200 g size range (Wickins & Lee 2002). Marron can grow to between 60 to 150
g within 12 months, and between 100 to 300 g after 24 months (Lawrence & Jones
2002). They are, however, very susceptible to changes in water quality and do not
grow at temperatures below 12.50C, with best growth achieved at a temperature
range of 22 to 250C (Rouse 1995). Marron also require water of low salinity level (6 ‐
8 ppt) and a comparatively high dissolved oxygen level (above 6 ppm) (Lawrence &
Jones 2002). Therefore, design and management of grow‐out systems can affect
marron production significantly.
Figure 1.4. Marron crayfish (C. tenuimanus Smith 1912) ©Chris Lukhaup
(Source: Souty‐Grosset et al. 2006)
Marron take 2 to 3 years to reach sexual maturity and are seasonal spawners, usually
spawning in the spring as water temperature increases above 110C and when
photoperiod extends beyond 12 hours (Mills et al. 1994). They can also be difficult to
spawn under controlled conditions (Rouse 1995) and are considered to be a non‐
burrowing and territorial species (Rouse 1995).
![Page 28: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/28.jpg)
10
1.7 Aquafeedsandfreshwatercrayfishnutrition
Like other terrestrial farming sectors, efficient aquaculture relies on provision and
supply of essential nutrients in feeds (Tacon & Metian 2008) as this is the most
important factor that directly affects growth rate, health, and production costs
(Lopez‐Lopez et al. 2005). Intensification and global development of aquaculture is
increasing demand for nutritious, cheap formulated aqua feeds (Smith et al. 2001).
This is because, feed and feeding represent the largest operating cost in most fish
and crustacean farming ventures (Tacon & Metian 2008), in many cases contributing
between 50% (Martinez‐Cordova et al. 2003; Thompson et al. 2004; Thompson et al.
2006; Stickney 2009) and 80% of total production costs in intensive culture
(Thompson et al. 2010).
Protein is the most expensive and the most important feed component contributing
to growth of farmed aquatic animals (Cortes‐Jacinto et al. 2003), with fish meal
considered to be the most desirable animal protein ingredient for aquatic species
due to its high protein content, good digestibility, and high palatability (Thompson et
al. 2005a). Fish meal and fish oil have been used widely, particularly in formulated
diets for carnivorous species as they provide high quality essential amino acids
(lysine, methionine) and fatty acids (eicosapentanoic acid (EPA), docosahexanoic acid
(DHA) that are not found in plant proteins or vegetable oils (Naylor et al. 2000).
Many intensive and semi‐intensive aquaculture systems use 2 to 5 fold the amount
of fish protein in the form of fish meal in feed provided to cultured species than is
produced in harvested fish. In modern culture systems, herbivorous and omnivorous
species are also fed at high rates with commercial feeds due to high stocking
densities that cannot be supported from natural food sources (Naylor et al. 2000).
Aquaculture feeds currently utilise approximately one third of the worlds’ total fish
meal production and the proportion of fish meal used in aquaculture feed is much
higher than the protein provided in swine and poultry feeds (Naylor et al. 2000).
Rising fish meal and fish oil prices and declining availability of high quality fish meal
are a growing concern for aquafeed manufacturers worldwide (Naylor et al. 2000;
Saoud et al. 2008). Dependency of aquaculture as an industry on these major feed
![Page 29: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/29.jpg)
11
ingredients from capture fisheries is also not considered to be ecologically or
economically sustainable over the long‐term (Tacon & Metian 2008; Tacon et al.
2010) as the system cannot continue to rely on finite stocks of wild‐caught fish that
are already classified as fully exploited, overexploited or depleted (Naylor et al.
2000; FAO 2010, 2012). Therefore, price of fish meal and fish oil has risen with
increasing demand and long‐term availability of these two inputs in the future is in
doubt (Thompson et al. 2006). Development and use of alternative high‐protein feed
ingredients from agricultural by‐products and cheaper plant materials as feed
supplements is now recognized as an international research priority and imperative
for the industry (Smith et al. 2001; Tacon & Metian 2008).
A review by Naylor et al. (2000) suggested that reduction of fish meal and fish oil
inputs in aquafeeds is a major priority for the aquaculture feed industry and more
scientific research will need to be focused on identifying specific feed requirements
for farmed aquatic herbivores and omnivores. These species do not rely so heavily
on feeds containing a high animal protein content and in theory, therefore can
reduce dependency of the feed industry on fish meal and fish oil. Hardy & Tacon
(2002) have suggested that replacement of fish meal and fish oil with alternative
feed ingredients in aquafeeds, will be much easier for herbivorous and omnivorous
aquaculture species including carps, tilapia and freshwater crustaceans, than for the
more nutritionally‐demanding carnivorous species such as salmon, trout and eels.
There is evidence however, that cultured Atlantic salmon can be raised successfully
on an aquafeed that contains vegetable oils that replaced fish oil 100 per cent.
Moreover, 75 per cent of fish meal can easily be replaced by non‐animal proteins for
farmed salmon (Bell & Waagbo 2008). This outcome demonstrates that with
significant research attention it is possible to largely bypass the use of animal protein
and fish oil in some aqua feeds. Considerable advances in this field have been made
over recent years and potential novel protein sources including biomass derived
from bio‐ethanol production, cereal glutens, microbial proteins, oilseed and legume
meals have all been evaluated as potential aquafeed ingredients to replace fishmeal
and fish oil in aquafeeds (Bostock et al. 2010). Despite this, problems, with anti‐
nutritional factors, poor palatability (Saoud et al. 2008), inappropriate amino acid
![Page 30: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/30.jpg)
12
balances, insufficient levels of lysine and methionine and relatively poor digestibility
(Naylor et al. 2000) of plant origin ingredients (e.g. soybean meal, cotton seed meal,
alfa‐alfa) have often limited inclusion levels of many alternative feed ingredients in
aquafeeds.
Lack of appropriate information about specific nutrient requirements and
appropriate feeding practices for freshwater crayfish species have to date become a
major constraint to develop a species‐specific diet for their aquaculture (Jones &
Roscoe 1996c). Limited knowledge has resulted in manufacturers often over‐
formulating feeds, and sometimes exceeding minimum required levels of specific
nutrients (Naylor et al. 2000). Formulated feed currently available in the market
under the name of “crayfish pellets” is a modification of chicken pellets made by
replacing expensive fish meal with cheaper ingredients without having any scientific
base but is simply made cheaper as an alternative to expensive shrimp feed available
for farmers. Farmers therefore, often tend to simply choose these cheaper feed or
other existing formulated diets developed for other terrestrial animal species that
apparently do not meet freshwater crayfish specific nutrient requirements and
typically practice overfeeding. Such practices can lead to depressed dissolved oxygen
levels and increased water pollution (Lawrence & Jones 2002) in the culture
environment that ultimately may impact negatively on production capacity of the
system. With a shift from extensive to more intensive culture systems (Saoud et al.
2012), it will therefore, be necessary to develop species‐specific formulated diets for
freshwater crayfish species to promote their aquaculture development (Webster et
al. 1994, 2002; Curtis & Jones 1995). Formulated freshwater crayfish feeds also need
to be less expensive than traditional shrimp feeds while offering a complete nutrient
profile matched to each species’ individual nutritional requirements (Saoud et al.
2012). Thus, we need to develop a better understanding of the utilisation and
digestibility of feed ingredients by specific cultured species. This is necessary for a
number of reasons, in particular, in order to reduce the requirement for expensive
protein for energy in feeds, as well as to explore non‐protein alternative energy
sources including carbohydrates and lipids (Medale & Kaushik 2008).
![Page 31: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/31.jpg)
13
1.8 Nutritionanddigestivephysiologyoffreshwatercrayfish
1.8.1 Crayfish natural habitats and feeding behaviour
Crustaceans, including freshwater crayfish, have adapted to a wide range of habitats
within the aquatic environment (Linton et al. 2009) and hence in general, display
polytrophic feeding habits (Hill & Lodge 1994; Vogt 2002; Beatty 2006). Many
crustaceans are described as omnivores and/or detritivores (Momot et al. 1978;
D’Abramo & Robinson 1989; Jones 1990; Brown 1995a; Momot 1995; Nyström 2002;
Garza de Yta et al. 2012). This classification indicates that they rely on a broad range
of plant‐based ingredients and that they tend to consume relatively high amounts of
carbohydrates in their natural diets (Hill & Lodge 1994; Vogt 2002; Linton et al.
2009). Carbohydrates in general show better protein‐sparing ability than some other
nutritional components (Pavasovic et al. 2006). Juvenile crayfish appear to be less
selective in their choice of feed items at the beginning of their development but as
they grow, preferences often change toward consumption of more plant material
(Figueiredo & Anderson 2003). This would suggest that it is possible to incorporate a
variety of plant derived compounds into feed formulations for practical diets for
redclaw aquaculture (Jones 1990; Campaná‐Torres et al. 2005, 2006, 2008; Pavasovic
et al. 2007a), a practice that can reduce the cost of feed significantly.
Investigations into the nutritional and economic importance of natural food items is
useful because data gathered can be used to assess the overall nutritional budget of
pond‐raised crustaceans. A nutritional study of C. destructor by Duffy et al. (2011)
demonstrated that reasonable growth rates can be achieved using commercial
pelleted diets that contain a crude protein level as low as 19% when there are
sufficient levels of naturally occurring food items present in the pond. This finding
suggests an opportunity to reduce the cost of formulated feeds by including
relatively lower levels of expensive animal protein sources in formulated feeds.
1.8.2 Nutritional requirements of redclaw
Dietary requirements of crustaceans are affected by several factors including size,
age and relative digestibility of feed ingredients (Guillaume 1997). Research on
nutritional requirements of redclaw has increased rapidly with the establishment
![Page 32: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/32.jpg)
14
and expansion of the industry (Saoud et al. 2012). Dietary requirements for a
number of ingredients have been determined for juvenile redclaw but in general,
only limited information is available for adult animals. Corte´s‐Jacinto et al. (2004)
suggested that formulated diets with 20% – 30% crude protein and 5% – 10% lipids
can provide good growth rates with high survival for redclaw and can potentially be
made inexpensively by incorporating plant rather than animal feed ingredients.
A number of nutritional studies have investigated ways to reduce animal protein
levels in formulated feeds, in particular the percentage of fish meal for freshwater
crayfish while maintaining optimum growth rates including C. quadricarinatus
(Cortés‐Jacinto et al. 2003; Cortés‐Jacinto et al. 2004; Muzinic et al. 2004; Thompson
et al. 2004; Campana‐Torres et al. 2005; Cortés‐Jacinto et al. 2005; Thompson et al.
2005a; Thompson et al. 2006; Metts et al. 2007; Pavasovic et al. 2007a). C.
destructor (Jones et al. 1996a, 1996b, 1996c), C. tenuimanus (Morrissy 1989; Fotedar
2004), Astacus astacus (Ackefors et al. 1992) and P. clarkii (Hubbard et al. 1986;
Lochmann et al. 1992). For C. quadricarinatus, Cortes‐Jacinto et al. (2003) defined
31% to be the optimum dietary protein inclusion level for 1 g juvenile crayfish (20%
fish meal (FM)) while Webster et al. (1994) indicated that smaller juveniles required
33% dietary protein (28% FM) when grown communally in recirculating systems.
Manomaitis (2001) reported that hatchlings of 0.02 g required 40% dietary protein
while 30% protein was sufficient for larger (3.0 g) animals. Campana‐Torres (2006,
2008) found that digestibility values of nutrients (protein, carbohydrates and lipids)
were slightly higher in juveniles than in adults. This may reflect a faster metabolism
during the early stages of growth where juveniles require more protein than adults
for metabolism.
Jones & Ruscoe (1996a) argued that redclaw does not seem to have a specific
requirement for high levels of proteins and that they can be cultured successfully on
a diet composed primarily of material of plant origin. Likewise, Thompson et al.
(2005a) have shown that relative dietary protein requirement can be reduced if
other plant‐protein ingredients are included. Furthermore, in earthen pond culture,
it is not necessary to supply high protein diets because redclaw can obtain a
substantial proportion of their nutrient requirements from natural food sources
![Page 33: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/33.jpg)
15
(Jones 1990; Jones & Ruscoe 1996b) a behaviour that can spare proteins in
formulated diets (Metts et al. 2007). Saoud et al. (2012) suggested that diets with
25% or greater protein inclusion are suitable for redclaw that are cultured in earthen
ponds where natural feed materials are available while redclaw grown in
intensive/closed recirculation systems need diets with approximately 35% or greater
protein inclusion level.
Dietary lipids also play an important role as a source of energy and essential fatty
acids (Hernandez et al. 2002). Linoleic (18:2n‐6), linolenic (18:3n‐3),
eicosapentaenoic EPA (20:5n‐3) and docosahexaenoic DHA (22:6n‐3) acids are
considered as essential fatty acids (EFA) for crustaceans, since they are not
synthesised endogenously (Kanazawa & Koshio 1994). Linton et al. (2009) observed
high amounts of lipids in the midgut gland of C. destructor and Engaeus sericatus and
dominant fatty acids present were 16:0, 16:1n‐7, 18:1n‐9, 18:2n‐6 and 18:3n‐3,
respectively. Presence of this range of fatty acids is a good indication of the
consumption of terrestrial plant matter by crayfish as the latter two fatty acids can
only be synthesized by plants. Lipid used as an energy source can also spare dietary
proteins, but less effectively than do carbohydrates (Cortes‐Jacinto et al. 2005).
Lipids can also reduce nitrogenous waste production (D’Abramo & Robinson 1989;
Lim & Sessa 1995; Cho & Bureau 2001).
Carbohydrates are generally considered to be the most economical and inexpensive
source of energy in crustacean feeds (Sanchez‐Paz et al. 2006). Although,
carbohydrates are not considered to be essential nutrients as are proteins and lipids
(Ali 1996), they can contribute a considerable proportion to the total diet, so animal
feeds often tend to contain relatively high levels of carbohydrates (Stickney 2009).
The primary uses of carbohydrates in aquaculture diets are as an energy source to
spare protein, so protein can be directed primarily for growth (Stickney 2009).
The ability to utilise different forms of carbohydrate will vary with the individual
digestive physiology of each species (Johnston 2003) and it is generally less efficient
in aquatic organisms than in terrestrial, domesticated animals. Degree of utilisation
is usually determined by carbohydrate structure (monosaccharide, disaccharide,
![Page 34: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/34.jpg)
16
oligosaccharide or polysaccharide) and in general, crustaceans are better able to
utilise more complex carbohydrates (e.g. polysaccharides: starch, chitin etc.) than
simple sugars (e.g. monosaccharides: glucose) (Shiau 1997; Pavasovic et al. 2006).
Freshwater prawn, M. rosenbergii grow poorly when their formulated feed is
supplemented with glucose but show good growth on diets with high levels of starch
(a polysaccharide) (Stickney 2009). A similar result with a significant difference in
feed conversion ratio, protein efficiency ratio and survival rate was obtained for
Penaeus monodon fed with starch or dextrin (oligosaccharides) compared with
individuals fed with glucose (Shiau & Peng 1992). Such findings indicate that
crustaceans like P. monodon, may have a lower protein requirement if starch,
instead of glucose or dextrin, is used as the carbohydrate source (Shiau & Peng
1992). This reflects an apparent better protein‐sparing ability of starch than either
glucose or dextrin (Pavasovic et al. 2006). Consequently, much of the carbohydrate
included in prepared feeds for crustaceans is currently provided in the form of starch
(Sanchez‐Paz et al. 2006; Stickney 2009).
A number of studies have reported that addition of cellulose in the diet did not
improve growth in some marine prawn species (Ali 1993). The relatively recent
discovery however, of endogenous cellulase enzymes secreted in the
hepatopancreas of commercially important cultured decapod crustaceans including
prawns, lobsters, crabs and freshwater crayfish (Yokoe & Yasumasu 1964; Glass &
Stark 1995; Xue et al. 1999; Moss et al. 2001; Gonzalez‐Pena et al. 2002; Pavasovic et
al. 2004) has led to much interest in assessing the potential to incorporate plant‐
derived ingredients into crustacean formulated feeds. For example, C.
quadricarinatus are able to consume diets containing some plant‐derived ingredients
more efficiently than diets containing animal‐derived ingredients due to the
presence of endogenous cellulases in their gut. Other studies, that have investigated
digestive enzymes in C. quadricarinatus have also demonstrated the ability of these
crayfish to utilise nutrients from plant matter successfully, but, this ability appears to
be related to the type of cellulose etc. included (Campana‐Torres et al. 2006, 2008).
![Page 35: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/35.jpg)
17
1.8.3 Digestive enzymes
In the crustacean digestive system, the hepatopancreas (Figure 1.5) plays a major
role in digestion and has various functions including synthesis and secretion of
digestive enzymes, absorption and storage of nutrients, metabolism and release of
stored reserves during the intermoult period (Ceccaldi 1998; Vogt 2002).
Figure 1.5. Internal anatomy of female crayfish showing the main organs, except the
musculature and endocrine system (after Holdich & Reeve 1988)
Freshwater crayfish possess a variety of digestive enzymes that include; proteases,
lipases and carbohydrases in the midgut gland (hepatopancreas) and gastric fluid
(Zwilling & Neurath 1981; Brown 1995a; Hammer et al. 2000; Figueiredo et al. 2001).
This suggests that they can digest a variety of feed ingredients and may have a
diversity of feeding habits (Figueiredo et al. 2001; López‐López et al. 2003, 2005;
Pavasovic et al. 2007a). Activity of digestive enzymes in freshwater crayfish is
affected by different factors, including growth stage and life events such as ontogeny
(Figueiredo & Anderson 2003) moulting (Fernández et al. 1997; Vega‐Villasante et al.
1999; Perera et al. 2008) diet composition (López‐López et al. 2005; Pavasovic et al.
2007b), photoperiod and quality of light, water temperature, stage of larval
development (Ceccaldi 1997) and feeding habit and even habitat (Figueiredo &
Anderson 2009). Glass & Stark (1995), for example, showed that carnivorous species,
with diets composed mainly of protein, have high levels of proteases and low levels
of carbohydrases while herbivores, that utilise plant materials, show the opposite
![Page 36: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/36.jpg)
18
relationship. Omnivorous (and detritivorous) species lie in an intermediate position,
displaying a wide range of relative concentrations of proteases and carbohydrases
(Lee et al. 1984). Furthermore, the same class of enzyme may show different
substrate specificities (Figueiredo et al. 2001) and therefore, source of feed
ingredient will influence enzyme secretion and activity levels (Ong & Johnston 2006).
Crustacean proteases include trypsin, carboxypeptidase A, carboxypeptidase B and
leucine‐aminopeptidase (reviewed by Figueiredo et al. 2001). Crayfish trypsin differs
from mammalian trypsin because it lacks chymotrypsin and pepsin (Kleine 1967)
although certain decapods can synthesise chymotrypsin (Brown 1995b). The activity
and concentration of photolytic enzymes found in the gut of crayfish can also change
depending on an animal’s age and diet (Saoud et al. 2012). Crustacean trypsin can
digest undenatured protein while vertebrate trypsin does not (Dall & Moriarty 1983).
Figueiredo et al. (2001) observed maximum trypsin‐like activity in the midgut gland
and gastric fluid of redclaw at a pH of 7.0 while chymotrypsin‐like activity in the
gastric fluid was significantly higher than that found in the midgut gland at pH 7.5.
While lipase activity in crustaceans is thought to be limited, crayfish produce a
substantial quantity of fat emulsifiers that assist in lipid digestion (Vogt 2002) and
consequently they accumulate high amounts of lipids (fatty acids) in their
hepatopancreas (about 60% of dry mass) (Linton et al. 2009). The same study
reported that presence of two fatty acids (18:2n‐6 and 18:3n‐3) which have a plant
origin, suggesting an ability by crayfish to digest terrestrial plant material effectively.
Figueiredo et al. (2001) observed lipase activity only in the gastric fluid of adult
redclaw, while López‐López et al. (2003) had observed esterase–lipase activity in the
hepatopancreas of juveniles.
Carbohydrase activity has been documented widely in crustacean species (Gamboa‐
Delgado et al. 2003), a result that demonstrates the ability of these animals to utilise
a large range of plant‐based substrates (Figueiredo et al. 2001). Amylase is the most
common carbohydrase in marine and freshwater species of crustacean and in
addition, maltase, laminarinase, xylanase and cellulase activities have been surveyed
(Figueiredo et al. 2001; Figueiredo & Anderson 2009). Endogenous carbohydrase
![Page 37: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/37.jpg)
19
activity has been reported in a number of commercially important freshwater
crayfish species (reviewed in Crawford et al. 2005) including C. quadricarinatus (Xue
et al. 1999), C. destructor, and E. sericatus (Linton et al. 2009). C. quadricarinatus has
been reported to synthesize both endoglucanase and endoxylanase enzymes (Xue et
al. 1999) and endoglucanases are probably secreted from the hepatopancreas while
the source of endoxylanase remains to be confirmed (Crawford et al. 2005).
1.8.4 Endogenous cellulase
The notion that cellulose digestion in higher animals occurs exclusively via a
symbiotic relationship with microbes has been challenged by the discovery of the
presence of endogenous cellulase enzymes in the digestive tracts of wide range of
invertebrates including annelids, nematodes, arthropods and molluscs (Reviewed in
Crawford 2006). Gonzalez‐Pena et al. (2002) observed higher activity of endogenous
cellulase enzymes in the hepatopancreas of cultured crustacean species in response
to higher levels of soluble cellulose in their formulated diets while Crawford et al.
(2005) observed that cellulase activity levels in freshwater crayfish (Cherax) were
higher than that in marine prawns. Figueiredo & Anderson (2003) observed cellulase
activity in very small crayfish even before first feeding. Of interest, C. tenuimanus
showed four times higher cellulase activity than did other cultured Cherax species, so
this could potentially indicate specific adaptations for utilising large amounts of plant
material in their diet (Crawford et al. 2005).
The gene responsible for producing endo‐β‐1,4‐glucanase has been characterised in
several freshwater crayfish species notably, Cherax quadricarinatus (Byrne et al.
1999; Xue et al. 1999), C. destructor, Euastacus spp., (Linton et al. 2006) and it is
clear that crustaceans generally possess cellulolytic capacity via synthesis of endo‐β‐
1,4‐glucanase (Linton & Greenway 2007). In addition to endo‐β‐1, 4‐glucanase, β‐
glucosidase has also been detected in the hepatopancreas of C. destructor and
Engaeus sericatus (Linton et al. 2009). Studies have revealed the presence of at least
two forms of endoglucanases with different molecular weights, 30 and 40 kD present
in C. quadricarinatus (Xue et al. 1999) and Figueiredo et al. (2001) observed two pH
peaks (4.0 and 7.0) for the same enzyme. Later, Crawford et al. (2004) verified this
![Page 38: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/38.jpg)
20
by purifying two proteins from gastric fluid from C. quadricarinatus. Similar studies in
C. destructor have also shown presence of two endo‐β‐1, 4‐glucanases (termed 1 and
2) with molecular weights of 53±3 and 52 kD, respectively (Allardyce & Linton 2008).
Enzyme 1 showed the capacity for hydrolysing only β‐1, 4‐glucosidic bonds (Allardyce
& Linton, 2008) while endo‐β‐1, 4‐glucanases from C. quadricarinatus were capable
of hydrolysing both β‐1, 4 and β‐1, 3‐glucosidic bonds (Xue et al. 1999). Phylogenetic
analyses confirmed the presence of two corresponding genes, termed EG‐1 and EG‐2
more widely within the family Parastacidae (Crawford 2006).
Linton et al. (2006) amplified a 900 bp cDNA fragment encoding a portion of the
endo‐β‐1, 4‐glucanase amino acid sequence in C. destructor and Euastacus spp., that
provided direct evidence for endogenous production of endo‐β‐1, 4‐glucanases in
other parastacid species but they also commented that molecular evidence was still
required to determine if other cellulase enzymes, (cellobiohydrolase and β‐1, 4‐
glucosidase) were produced endogenously. Of interest, Pavasovic et al. (2006) have
demonstrated that redclaw can liberate glucose from carboxymethyl cellulose
(derivative of soluble cellulose) that suggests that soluble cellulose can be an energy
source for them. In a very recent study of the land crab Gecarcoidea natalis, a β‐
glucosidase enzyme of 160 kD that is capable of releasing glucose from small
oligomers that result from action of endo‐β‐1, 4‐glucanases hydrolysis of native
cellulose, has been purified and characterised (Allardyce et al. 2010). Taken
together, these findings provide a possible complete enzymatic model for
endogenous hydrolysis of cellulose to glucose in a crustacean species.
1.8.5 Digestive enzyme gene expression and transcriptome analysis
The synthesis of digestive enzymes is regulated by various genes, hormones, and diet
(Péres et al. 1998). Gene expression is regulated at multiple levels (protein synthesis)
and is species’ and age‐specific (Wang et al. 2006). Regulation of digestive enzyme
expression is important therefore, for understanding digestive physiology in any
crustacean species (Wang et al. 2006).
Applying modern molecular biology techniques to examine animal development,
growth and nutrition can help to determine if changes in expressed levels of
![Page 39: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/39.jpg)
21
digestive enzymes reflect control at the level of transcription and also can identify
major genes involved in regulation of enzyme production (Zambonino et al. 2001).
Molecular genetic and genomic information can also be used to describe the
complexity/diversity of different digestive enzymes and document their individual
expression patterns.
To date, the gene responsible for producing endo‐β‐1, 4‐glucanase has only been
examined in a relatively few freshwater crayfish species namely; Cherax
quadricarinatus (Byrne et al. 1999; Xue et al. 1999), C. destructor and Euastacus spp.,
(Linton et al. 2006). Several studies have also analysed gene expression patterns in
the hepatopancreas in some crustaceans under different environmental
conditions/exposures: response to diseases (Pacific White shrimp, Litopenaeus
vannamei – Zeng et al. 2013), across the moult cycle (Redclaw Cherax
quadricarinatus – Yudkovski et al. 2007) and their relationship with immune
responses (Mitten crab, Eriocheir sinensis – Jiang et al. 2009b). Analysis and
identification of expressed genes that regulate secretion of various digestive
enzymes in freshwater crayfish hepatopancreas will therefore be informative for
developing a better understanding of each species’ nutritional requirements and
digestive capabilities.
The rapid development of high through‐put, and significant decrease in time and
cost of, next generation sequencing (NGS) have moved genomics research from
simply sequencing pieces of DNA to annotation and in depth analysis and the
approach is now widely accessible (Zend & Extavour 2012). Analysis of expressed
sequence tags (ESTs) provides a comprehensive and widely used method for
discovery of novel, uniquely expressed genes and a way to characterize their
individual expression patterns in various tissues (Jiang et al. 2009a). The approach
can provide very large data sets for species of interest, in particular on the expressed
portion of an organism's genome and these data are invaluable in comparative
studies (reviewed in Bai et al. 2009). This novel method is now being used widely to
discover genes that regulate economically significant traits and to explore their
expression patterns in aquaculture species, including commercially important
farmed crustaceans at different life history stages and that have been exposed to
![Page 40: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/40.jpg)
22
different culture conditions (Jiang et al. 2009a, 2009b; Robalino et al. 2009; Wu et al.
2009; Ma et al. 2012). Despite the relatively high number of feeding and digestive
enzyme activity studies that have already been conducted on crustacean species, to
date very little work has focussed on freshwater crayfish at least at the transcript
level, particularly in regard to identifying and describing the expression patterns of
each species’ digestive enzyme genes.
1.9 Celluloseandbiologicaldegradationofcellulose
Cellulose is the most abundant biomass on the earth and is produced by plants and
consists of polymerized forms of glucose molecules with β‐1, 4‐ linkages. These
polymers bond together to form highly ordered (crystalline) structures and less
ordered (amorphous) regions that are more prone to enzyme degradation (Beguin &
Aubert 1994; Tomme et al. 1995).
Hydrolysis of cellulose to glucose occurs by action of three different classes of
cellulase enzymes with different activities and specificities; endoglucanases (endo‐β‐
1, 4‐glucanases or endo‐β‐1, 4‐D‐ glucan‐4‐glucanohydrolases) cleave amorphous
sites in the cellulose chain at random points (Beguin & Aubert 1994; Watanabe &
Tokuda 2010). Exoglucanases (1, 4‐β‐D‐glucan cellobiohydrolases or 1, 4‐β‐D‐glucan
glucohydrolases) act on the non‐reducing or reducing ends of cellulose fibres and
release either cellobiose (cellobiohydrolases) or glucose (glucohydrolases). Β‐
glucosidases (1, 4‐β‐D‐glucosidases or cellobioses) hydrolyse cellobiose or cello‐
oligomers to glucose from the non‐reducing ends (Watanabe & Tokuda 2010).
Exoglucanases produce cellobiose, while most endoglucanases produce cellobiose
and smaller quantities of glucose and cellotriose (Watanabe & Tokuda 2010). All
three enzyme classes must be present in the system in order to directly digest
cellulose to glucose (Allardyce et al. 2010).
1.10 Celluloseplantmaterialandcrayfishdietformulation:importanceof
endogenouscarbohydrases
Plant tissues consist mainly of cellulose which accounts for 20‐40% of the primary
cell wall and up to 50% of the secondary cell wall on a dry weight basis (Watanabe &
![Page 41: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/41.jpg)
23
Tokuda 2010). In addition, hemicelluloses and lignin are present in the secondary
plant cell walls, mainly in the xylem of woody plants. Cellulose microfibrils are
covered with hemicellulose and spaces between the microlamella are filled with
lignin. This complex is called lignocellulose (Demura & Fukuda 2007).
Incorporating plant ingredients into aquafeeds can often result in poor growth
outcomes because of presence of anti‐nutritional factors and/or poor palatability
(Saoud et al. 2008), inappropriate amino acid balance (e.g. insufficient levels of
lysine and methionine), poor digestibility (Naylor et al. 2000) of plant origin
ingredients (e.g. soybean meal, cotton seed meal, alfa‐alfa) and anti‐nutritional
effects of non‐starch polysaccharides (NSP) (Francis et al. 2001). Effective utilisation
of plant based feeds can be improved however, by inclusion of exogenous enzymes
as feed additives (Bedford 2000). Endoglucanase and endoxylanase are common
enzymes that commercial enzyme blends contain and they can hydrolyse cellulose
and xylan polymers, respectively (Crawford et al. 2005). Studies have shown that
endoglucanase and endoxylanase enzymes could play an important role in utilisation
of plant ingredients in crustacean diets (Crawford et al. 2005).
Freshwater crayfish are able to utilise plant material efficiently as they appear to
produce cellulase enzymes endogenously to digest plant materials and appear to be
able to meet most of their nitrogen requirements using such enzymes (Linton &
Greenway 2007). A number of recent studies have reported both presence and
relatively high activities of endocellulases including β‐1, 4‐glucanase, laminarinase,
xylanase, β‐glucosidase in freshwater crayfish that together enable complex
carbohydrates to be hydrolysed to simple molecules (Figueiredo & Anderson 2003;
Crawford et al. 2005; Linton et al. 2009). This indicates the potential to use plant
materials as forage in ponds, in particular protein rich legumes such as lupin as a
low‐cost feed ingredient (Metts et al. 2007) and incorporation of plant based
ingredients into supplemental formulated diets can provide good nutrition while
reducing diet formulation costs.
![Page 42: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/42.jpg)
24
1.11 Currentstudy
Following the discovery of an endogenous endo‐β‐glucanase gene in Cherax
quadricarinatus (Byrne et al. 1999, Xue et al. 1999), studies on freshwater crayfish
nutrition have investigated digestive enzyme activities giving particular attention to
enzymes that are involved in hydrolysing complex polysaccharides (e.g. cellulase and
xylanase) that are principal constituents of plant cell walls. Accordingly, a number of
studies have demonstrated the activity of cellulases and other target enzymes
produced in the hepatopancreas of freshwater crayfish (Figueiredo et al. 2001;
Figueiredo & Anderson 2003). Crawford et al. (2005) also reported that
endocellulase and endoxylanase activity in several Cherax species were higher than
in marine prawns. Of interest, marron showed approximately four times higher
cellulase activity compared with other Cherax species in the same study. This
endocellulase activity suggested that dietary cellulose is digestible and can be a
source of energy for freshwater crayfish. In a study conducted by Pavasovic et al.
(2006), it was however, reported that dietary insoluble cellulose (α‐cellulose) has no
detectable nutritive benefit on freshwater crayfish growth. Meanwhile, in the same
study and some other studies (e.g. Crawford et al. 2005), it was demonstrated that
enzymes from the hepatopancreas of freshwater crayfish can liberate glucose from
soluble cellulose (carboxy methyl cellulose). In these in vitro studies,
hepatopancreatic extracts from marron showed the highest activity (approximately
two times higher than that of other crayfish species) (Crawford et al. 2005). These
observations provide strong evidence that unlike insoluble cellulose, soluble
cellulose is better able to be digested by freshwater crayfish and can be a source of
energy for them.
Most digestive enzyme studies in freshwater crayfish have been limited to only a few
types of major enzymes and are based on enzyme‐substrate assays. Molecular
studies on expression of these enzymes can give a broader picture of production,
activity and the biochemical pathways that the enzymes are involved in and can
provide information about the innate genetic capacity of freshwater crayfish to
produce them. It can also be used to characterise the full spectrum of digestive
enzyme genes produced in the hepatopancreas of freshwater crayfish, including
![Page 43: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/43.jpg)
25
finding candidate genes associated with digestive metabolism rather than confined
to assays of only a few major target enzymes. Despite recent development of
technologies used in gene expression studies, recent molecular studies of digestive
enzyme gene expression patterns in crayfish has been limited to characterising only
the endo‐β‐glucanase gene. It is therefore, important to investigate expression and
expression patterns of all major digestive enzyme genes and to identify the full
spectrum of digestive enzyme genes produced in the hepatopancreas of freshwater
crayfish. This information will be vital to fully understanding and utilising freshwater
crayfish digestive capacity in order to formulate specific formulated diets that suit
their nutritional requirements and innate genetic make‐up.
The overall aim of the current study therefore, was to undertake a comparative
study of the effects of two main carbohydrate sources, particularly with a focus on
the impacts of soluble cellulose on growth, relative survival and digestive enzyme
activities in three Cherax species and to profile digestive enzyme gene expression
patterns in the hepatopancreas of C. quadricarinatus.
The project was divided into three studies represented here in Chapters 2, 3 and 4 as
either published papers or accepted manuscripts (the third manuscript is in
preparation), respectively. Each sub study has a set of specific objectives as
described in the introduction section of each chapter.
![Page 44: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/44.jpg)
26
CHAPTER2: Effectsofsolubledietarycelluloseonspecificgrowthrate,survivalanddigestiveenzymeactivitiesinthreefreshwatercrayfish(Cherax)species
Presented at the “AQUACULTURE 2013” conference. 21 – 25 February 2013 Nashville, Tennessee, USA (oral presentation).
Published in Aquaculture Research (2013) online library. doi:10.1111/are.12209
![Page 45: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/45.jpg)
27
Effects of soluble dietary cellulose on specific growth rate, survival and
digestive enzyme activities in three freshwater crayfish (Cherax) species
Authors and their affiliations
Lalith K. Dammannagoda*, Ana Pavasovic#, David A. Hurwood* & Peter B. Mather*
*School of Earth, Environmental and Biological Sciences, Science and Engineering
Faculty, Queensland University of Technology, GPO Box 2434, Brisbane Qld 4001,
Australia.
#School of Biomedical Sciences, Faculty of Health, Queensland University of
Technology, GPO Box 2434, Brisbane Qld 4001, Australia.
![Page 46: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/46.jpg)
28
Abstract
The current study evaluated the effect of soluble dietary cellulose on growth,
survival and digestive enzyme activity in three endemic, Australian freshwater
crayfish species (redclaw: Cherax quadricarinatus, marron: C. tenuimanus, yabby: C.
destructor). Separate individual feeding trials were conducted for late‐stage juveniles
from each species in an automated recirculating freshwater, culture system. Animals
were fed either a test diet (TD) that contained 20% soluble cellulose or a reference
diet (RD) substituted with the same amount of corn starch, over a 12 week period.
Redclaw fed with RD showed significantly higher (p<0.05) specific growth rates (SGR)
compared with animals fed the TD, while SGR of marron and yabby fed the two diets
were not significantly different. Expressed cellulase activity levels in redclaw were
not significantly different between diets. Marron and yabby showed significantly
higher cellulase activity when fed the RD (p<0.05). Amylase and protease activity in
all three species were significantly higher in the animals fed with RD (p<0.05). These
results indicate that test animals of all three species appear to utilise starch more
efficiently than soluble dietary cellulose in their diet. The inclusion of 20% soluble
cellulose in diets did not appear, however, to have a significant negative effect on
growth rates of yabby or marron.
Key words:
redclaw, yabby, marron, Cherax, soluble cellulose, cellulase,
![Page 47: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/47.jpg)
29
2.1 Introduction
Farming of freshwater crayfish is well‐established worldwide, with major production
contributions coming from the USA, China, Europe, and Australia (Wickins & Lee
2002; Harlio lu & Harlio lu 2006). Despite this, currently only a limited number of
freshwater crayfish species are farmed, with redclaw being the most widely farmed
of the Australian native species. With ongoing decline in most commercial
crustacean fisheries (Ghanawi & Saoud 2012), there is insufficient freshwater
crayfish production to meet current growth in world market demand (Lawrence &
Jones 2002). Further expansion of freshwater crayfish aquaculture is needed,
therefore, to meet a growing demand for product. Three Cherax species (redclaw, C.
quadricarinatus; yabby, C. destructor, and marron, C. tenuimanus) have been
identified as excellent candidate species for commercial culture (Lawrence & Jones
2002; Qin & Mair 2008; Wingfield 2008; Meakin), and farming systems have been
developed for each species over the past two decades (Wingfield 2008).
The three Cherax species developed for culture have disjunct natural distributions in
Australia where they are exposed to very different climatic and ecological
conditions. Across northern Australia where redclaw occur naturally, the climate
shows a distinct wet/dry seasonality, characterised by fast flowing rivers in the wet
season and smaller water bodies that are often eutrophic during the dry season (DPI
2006). Yabbies are found in a range of freshwater environments and have an
extremely extensive natural distribution across central and eastern Australia that
includes a number of climatic zones (Sokol 1988; Austin et al. 1997). In contrast,
Marron are restricted to permanent rivers in forested, high rainfall areas in the
south west corner of Western Australia (Lawrence & Jones 2002). Consequently,
these different climatic and ecological conditions influence the types, and availability
of natural foods consumed by each of the species (Momot 1984).
Freshwater crayfish are known to consume relatively high amounts of plant and
other detrital material containing a relatively high proportion of carbohydrates in
their natural diets (Hill & Lodge 1994; Verhoef et al. 1998; Vogt 2002; Linton et al.
2009). Carbohydrates in general, provide the major energy source assimilated by
![Page 48: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/48.jpg)
30
freshwater macro‐invertebrates (Reid et al. 2008). While they are not considered to
be essential nutrients for freshwater crayfish, carbohydrates are often incorporated
into formulated feeds to reduce cost and also to spare animal protein (D’Abramo &
Robinson 1989; Guillaume & Choubert 2001; Pillay & Kutty 2005).
The presence of carbohydrase enzymes in crustacean species has been widely
documented (Yokoe & Yasumasu, 1964; Glass & Stark 1995; Xue et al. 1999;
Figueiredo et al. 2001; Moss, Divakaran & Kim 2001; González‐Peña et al. 2002;
Figueiredo & Anderson 2003; Pavasovic et al. 2004), and studies have demonstrated
the ability of many crustacean taxa to utilise a large range of plant‐based substrates
including cellulose and hemicelluloses as food items (Figueiredo et al. 2001). This is
of particular significance in commercially important farmed crustacean species,
where production cost may be reduced significantly by developing low cost feeds.
Presence of endogenous carbohydrase activity has also been reported in a number
of freshwater crayfish species including; redclaw (Xue et al. 1999), yabby, and the
hairy burrowing crayfish (Engaeus sericatus) (Linton et al. 2009) suggesting potential
for exploitation of carbohydrates in their diet. Moreover, the presence of a
functional gene(s) that encodes production of an endo‐β‐1, 4‐glucanase has
confirmed that most crustaceans in general, probably possess cellulolytic capacity
via synthesis of endogenous endo‐β‐1, 4‐glucanase enzymes (Linton & Greenway
2007). In a recent study of the land crab Gecarcoidea natalis, a β‐glucosidase
enzyme capable of releasing glucose from small oligomers and producing endo‐β‐1,
4‐glucanase hydrolysis of native cellulose was also identified, purified and
characterised (Allardyce et al. 2010). In combination, this provides good evidence
for a complete enzymatic cascade for cellulose digestion in crustaceans based on the
endogenous secretion of a suite of cellulose degrading enzymes (Allardyce et al.
2010).
A number of growth and digestive enzyme studies have been conducted on redclaw
to examine this species’ specific nutritional requirements. Very few studies,
however, have investigated the same attributes in the other two farmed Cherax
species. Moreover, the majority of nutritional studies of Cherax species to date have
been limited mostly to assessing lipid and protein digestibility (Cortés‐Jacinto et al.
![Page 49: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/49.jpg)
31
2005, 2004; Thompson et al. 2006, 2005b, 2004), despite recognition that some
freshwater crustaceans secrete endogenous carbohydrases to degrade plant
material in their natural diets. Campana‐Torres et al. (2006, 2008) have compared
the digestibility of different plant ingredients compared with animal ingredients
while Pavasovic et al. (2006) investigated the effect of insoluble cellulose on
digestive enzyme activity in redclaw. Additional studies on the relative ability of
freshwater crayfish species to utilise different carbohydrate sources and assessment
of their potential levels of inclusion in formulated diets therefore, can provide
important data that will be required to formulate species‐specific and cost‐effective
formulated feeds for farmed freshwater Cherax species.
The focus of the present study therefore, was to compare the effects of the inclusion
of soluble dietary cellulose on growth and digestive enzyme activity in three farmed
Cherax species and to document the relative ability of each species to utilise soluble
cellulose in experimental formulated diets.
2.2 MaterialsandMethods
2.2.1 Preparation of experimental diets
Two isocaloric and isonitrogenous diets, a reference diet (RD) and a test diet (TD),
were prepared for the study that incorporated shrimp / fish meal (Ridley Agri
Products, Narangba QLD, Australia) as the base ingredient and as the primary source
of protein. The TD was prepared by incorporating 20% of soluble cellulose (Sodium
Carboxymethyl Cellulose (Na CMC) – IMCD Australia Limited, product code‐4336712)
as the carbohydrate component while the RD was prepared by substituting the same
amount of soluble cellulose with corn starch. A complete list of ingredients and their
proximate analysis is presented in Table 1.
Diets were prepared by first grinding fish meal and sieving through a 500 µm mesh,
then thoroughly mixing all dry ingredients using a kitchen bench top mixer. After fish
oil was added, mixing was continued by adding water as required until a crumbly
dough consistency was achieved. This mixture was used to produce pellets 3 mm in
![Page 50: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/50.jpg)
32
Table 2.1 Composition of RD and TD diets.
*44.2% crude protein, 7.9 % crude fat, 1.7% crude fibre, 8.3% ash on dry matter basis and 20.4 MJ/kg gross energy ‡ Energy‐733 kJ, protein‐0, total fat‐0, total carbohydrate‐13 g, dietary fibre‐64 g, ash‐13g, Sodium‐9.5 g per 100 g, viscosity‐1400‐2000 mPa.s, pH‐6.5‐7.5 φ Energy‐1490 kJ, protein <1 g, total fat‐<1 g, total carbohydrate‐87.5 g, Sodium‐25 mg per 100 g †Sigma‐Aldrich Pty. Ltd. Castle Hill NSW, Australia ☼Protein 75% min. Ø Energy‐1450 kJ, protein 84.4 g, total fat‐0.4 g, total carbohydrate‐0 g, Sodium‐330 mg per 100 g § Ridley Agri Products, Narangba QLD, Australia Ψ Ridley Agri Products, Narangba QLD, Australia # Calculated values
diameter and 5‐10 mm in length using a mechanical mincer. Pellets were steamed in
a microwave oven for 60 seconds, after which they were air dried for two hours and
then dried in an oven at 500C for 18 hours. All diets were stored at ‐200C until used
for experimental growth trials.
Ingredient
(gkg‐1)
RD TD
Fish meal* 581 581
Carboxymethyl cellulose‡ (CMC) ‐ 200
Corn starchφ 200 ‐
Fuller’s earth† 79 79
Gluten☼ 40 40
GelatineØ 50 50
Vitamin/mineral pre‐mix§ 25 25
Fish oilΨ 25 25
Proximate composition# % %
Dry matter 92.6 92.6
Crude protein 32.9 32.8
Ash 5.0 4.9
Gross energy 17.3 15.8
![Page 51: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/51.jpg)
33
2.2.2 Experimental animals and culture conditions
Late‐stage juveniles of three Cherax species used in this study, were obtained from
commercial crayfish farms across Australia,: redclaw – C. quadricarinatus (Cherax
Park, Theebine, Queensland); marron – C. tenuimanus (Aquatic Resource
Management Pty Ltd, Manjimup, Western Australia), and yabbies – C. destructor
(Burns' B & B & Yabby Farm, Mudgee, New South Wales). Experimental animals
(redclaw: 24.37±0.42 g; marron: 9.92±0.26 g; yabby: 18.93±0.18 g) were housed in
an automated recirculating, freshwater aquaculture system (XenopLus Aqua System,
Techniplast, Italy) and experimental growth trials were conducted for each species
over a 12 week cycle. Water temperature, conductivity, and pH were controlled at
constant and optimum levels for each species across the experimental period (Table
2). A single female and male were housed in each tank held separately in individual
plastic mesh cages (160 X 160 X 220 mm) to eliminate the potential for cannibalism
and to minimize individual interactions to ensure uniform feed consumption. At the
start of the experiments, all animals were weighed individually and distributed
among tanks randomly and diets and replicates (n=34 per treatment, both sexes)
were also assigned randomly. Test animals were then acclimated to the
experimental conditions and diets over a 1 week period prior to the experiment. All
individuals were fed with experimental diets at a rate of 3% of wet body weight,
twice a day and any uneaten feed and faeces were removed by siphoning as
required. The wet body weight (g) of each animal was measured and recorded bi‐
weekly. Moults resulting after ecdysis were left in the cages to allow for ingestion of
exoskeleton by animals. Water temperature, pH, conductivity, and dissolved oxygen
(DO) in the system were recorded daily. Ammonia level was recorded twice weekly
while nitrite, nitrate, general water hardness (GH), and carbonate hardness (KH)
were recorded once a week. A 12 hour light/dark cycle was maintained across the
experimental period.
Table 2.2 Culture conditions maintained for each species during the experiment.
Species Temp. / oC Conductivity pH DO / ppm
Redclaw 26.0±0.01 517±4.0 7.9±0.01 7.42±0.05
Marron 20.4±0.03 499±1.0 7.9±0.01 8.67±0.02
Yabby 26.2±0.02 536±5.0 7.9±0.01 7.60±0.02
![Page 52: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/52.jpg)
34
Individual growth performance was determined by measuring two parameters;
survival rate and specific growth rate (SGR). SGR was calculated based on weight
gain of individual animals during the trial period. The two parameters were
calculated as follows:
100
100 / – /
2.2.3 Digestive enzyme analyses
All test individuals were harvested at the end of the 12 week experimental period
and digestive enzyme activity assessed in the midgut gland (MG). Animals were fed
for the final time three hours before harvest as recommended by Gonzalez‐Pena et
al. (2002). Following this, individuals were anaesthetised in ice water for 5 minutes
and then final wet body weight was recorded. Preparation of MG extracts and all
enzyme assays were conducted as described by Pavasovic et al. (2004). Enzyme
assays were performed in duplicates for protease, α‐amylase and cellulase extracted
from the MG. For all assays, one enzyme unit (U) was defined as the quantity of
enzyme that catalysed the release of 1 µmol of product per minute under the assay
conditions used. Specific enzyme activity was defined as enzyme units (U) per
milligram of protein. Protein concentration in MG extracts was determined using a
BioRad protein assay kit (BioRad, Hercules, CA, USA) according to the manufacturer’s
instructions. MG extract was diluted 1/14 in distilled water and the mixture
incubated for 20 minutes at room temperature. Absorbance of the solution was
measured at 595 nm using a Beckman Coulter spectrophotometer (Beckman Coulter
Inc. CA, USA), with Bovine Plasma Globulin (BioRad) used as the standard. Protease
assays were performed using two methods, one utilising soluble AZO‐Casein and
another insoluble AZCL‐Casein, as substrates (Megazyme International, Ireland).
Assays were performed as per the manufacturer’s instructions with the following
minor modifications; for the AZO‐Casein method, 0.5% substrate solution (dissolved
in 100 mM sodium phosphate; pH 7.0 buffer) was used and assay solutions were
decreased proportionately to half volumes. First, 0.5 mL of enzyme solution (20 μL
![Page 53: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/53.jpg)
35
MG extract and 480 μL buffer) was added to 0.5% substrate solution, the mixture
was stirred and incubated at 40°C for 10 minutes. The reaction was terminated and
non‐hydrolysed AZO‐Casein was precipitated by the addition of 3.0 mL of 5%
trichloroacetic acid followed by vigorous stirring for 5 seconds. After reaction tubes
had equilibrated to room temperature, the suspension was centrifuged at 1000 g for
10 minutes and following this absorbance of the supernatant was read at 440 nm.
For the AZCL‐Casein method, 250 µL of a 0.75% AZCL‐Casein solution was adjusted
to pH 7.0 using 90 µL of substrate buffer solution (0.1 M Citric acid/0.2 M Na2HPO4;
adjusted to pH 7.0 with 1 M NaOH). A 10 µL volume of MG extract was then added
and the mixture incubated at 40 oC for 60 minutes in a water bath. The reaction was
stopped by placing the tubes in ice for 10 minutes. Following this, 700 µL of distilled
water was added to the reaction mixture and the mixture centrifuged at 10,000 g for
10 minutes at room temperature. Absorbance of the supernatant was read at 590
nm. For both methods, protease (Subtilisin A; Bacillus licheniformis) (Megazyme)
was used as the enzyme standard.
Total α‐amylase activity was determined using a Ceralpha (α‐amylase) assay kit
(Megazyme) according to the manufacturer’s instructions. For this assay, MG
extracts for redclaw and yabby were diluted (1:24), while marron MG extracts were
used without dilution. 6.6 μL of MG extracts was added to 600 μL of substrate buffer
(0.1 M Malic acid/0.1 M NaCl/2 mM CaCl2.2H2O/0.01% sodium azide; pH 7.0). The
mixture was incubated at 40°C for 20 minutes following which, 133 μL of substrate
(BPNPG‐7, 54 mg+10 mL distilled water) was added and incubation continued for a
further 10 minutes. 1.9 mL of stopping reagent [20% (w/v) Trisodium phosphate
solution] was then added to the mixture and absorbance was measured at 400 nm.
Enzyme activity was calculated according to the following formula:
118.1
X
Cellulase activity was determined with two substrates, an insoluble substrate, AZCL‐
HE‐Cellulose (azurine cross‐linked hydroxyethylcellulose ‐ Megazyme, Ireland) as
described by Pavasovic et al. (2004), and a soluble substrate AZO‐CM‐Cellulose
![Page 54: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/54.jpg)
36
(Megazyme,) according to the manufacturer’s instructions. For AZCL‐HE‐Cellulose,
the assay was performed by first combining 250 μL of 0.75% AZCL‐HE‐Cellulose
solution with 70 μL of substrate buffer solution (200 mM Sodium citrate, adjusted to
pH 5.5 with 1M HCl). 30 μL of MG extract diluted in distilled water (redclaw: 1:499,
marron: 1:249, yabby: 1:199) was added to the reaction mixture and incubated at
50°C for 2 hours in a water bath. Next, the reaction was stopped by placing the
tubes in ice for 10 minutes followed by the addition of 700 μL of distilled water to
the mixture. All samples were then centrifuged at 10,000 g at room temperature for
10 minutes and the absorbance of supernatant was read at 590 nm.
For the AZO‐CM‐cellulose method, the concentration of substrate solution was
modified to 0.5% and pH adjusted to 4.5. Equal amounts (0.5 mL) of substrate
solution and MG extract diluted in distilled water (1:199 for each species) were
mixed together and the mixture was then incubated at 40 oC for exactly 10 minutes.
The reaction was terminated by the addition of 2.5 mL of precipitant solution
combined with vigorous stirring for 10 seconds. Tubes were then allowed to
equilibrate to room temperature (10 minutes) and stirred again before they were
centrifuged at 1000 g for 10 minutes. Absorbance of the supernatant was measured
at 590 nm. Endo‐cellulase from Aspergillus niger (Megazyme) was used as the
standard to determine activity with both methods.
2.2.4 Statistical analyses
Two‐way ANOVA was used to test for significant differences (α=0.05) in SGR
between treatments (RD vs TD) for each species. An independent t‐test was used to
compare significant differences (α=0.05) in digestive enzyme activities among the
three species. Chi‐squared test was used to test significant difference in survival
rates between the two diet groups. Tukey’s post hoc test was used to determine
significant differences among treatment groups. All statistical analyses were
performed using the IBM SPSS statistics 19 package.
![Page 55: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/55.jpg)
37
2.3 Results
2.3.1 Feeding trial
Survival rates and mean growth performances for each species, expressed as SGR,
are presented in Table 2.3. Survival rates of all species and both sexes were
consistently above 80%, with females overall showing higher survival rates. For SGR,
redclaw fed the RD diet showed significantly higher values (p<0.05) than did
individuals fed the TD diet. In contrast, the SGRs for both marron and yabby fed RD
and TD were not significantly different (p>0.05) and SGR by sex (diet*sex
interaction) were not significantly different (p>0.05) for any species (data not
shown).
Table 2.3 Specific growth rate (±SEM) and survival rate (%) estimated for three
species fed two diets over 12 week trial. Different superscripts indicate significant
differences (p<0.05)
Species Diet Mean wt gain (g)
SGR
Survival rate (%)
Female Male Total
Redclaw RD 3.99 0.193±0.019a 100.0a 88.2a 94.1a
TD 1.74 0.093±0.019b 94.1a 64.7a 79.4a
Marron RD 1.40 0.146±0.019a 100.0a 94.1a 97.1a
TD 0.88 0.107±0.017a 88.2a 94.1a 91.2a
Yabby RD 1.91 0.105±0.018a 82.4a 100.0a 91.2a
TD 1.50 0.086±0.017a 100.0a 64.7b 82.4a
A comparison of mean wet body weight (wbw) over time shows that redclaw
performed better on the RD diet (Figure 2.1a) after week 4 in the trial, and this was
also the case for marron (Figure 2.1b) after week 2 and yabby (Figure 2.1c) for the
whole trial period, but differences between performance on the RD and TD diets
were not significant for either marron or yabby.
![Page 56: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/56.jpg)
38
a).
b).
c).
Figure 2.1. Mean wet body weight measured bi‐weekly for three species fed two
diets over the 12 weeks trial period. Data points represent mean ±SE
20.00
22.00
24.00
26.00
28.00
30.00
00 02 04 06 08 10 12
wt (g)
Time in weeks
Redclaw (wbw)
RD
TD
Diet
8.00
8.50
9.00
9.50
10.00
10.50
11.00
11.50
12.00
00 02 04 06 08 10 12
wt (g)
Time in weeks
Marron (wbw)
RD
TD
Diet
17.00
18.00
19.00
20.00
21.00
22.00
23.00
24.00
0 2 4 6 8 10 12
wt (g)
Time in weeks
Yabby (wbw)
RD
TD
Diet
![Page 57: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/57.jpg)
39
2.3.2 Enzyme activity levels
Data on digestive enzyme profiles from the midgut gland in each species are
summarized in Table 2.4. In marron, protease activity on insoluble AZCL‐Casein
substrate could not be detected and activity was also much lower on soluble AZO‐
Casein substrate than for the other two species. Cellulase activity in redclaw was not
significantly different (p>0.05) between the two diets (RD and TD), while for marron
and yabby, significant differences in cellulase activity were evident between the diet
treatments. Amylase and protease activities in all three species were significantly
different between the RD and TD treatments, with individuals fed the RD diet
showing significantly higher average enzyme expression levels.
Table 2.4 Specific enzyme activity levels (±SEM) in the midgut gland. Specific activity
is expressed as units per milligram of protein. Column figures showing different
superscripts are significantly different (p<0.05)
2.4 Discussion
Freshwater crayfish are generally considered to be opportunistic and polytrophic
feeders that utilise the most abundant and easily accessible foods available in their
natural environments (Lawrence & Jones 2002; Beatty 2006; Linton et al. 2009). The
three Cherax species examined here have very different natural geographical
distributions across Australia and hence, possess unique adaptations to their
different environments, in most aspects of their ecology, including for feeding and
Species Diet
Average specific enzyme activity (U/mg of protein)
Protease Amylase Cellulase
AZCL‐Casein AZO‐Casein(X 10‐3)
AZCL‐HE‐Cellulose
AZO‐CM‐Cellulose
Redclaw RD 0.074±0.005a 2.469±0.18a 3.731±0.31a 3.408±0.20a 9.690±0.62a
TD 0.059±0.006b 1.718±0.23b 2.257±0.30b 2.985±0.33a 7.338±1.12a
Marron RD Not detected 0.622±0.07a 0.168±0.02a 2.492±0.24a 5.535±0.54a
TD Not detected 0.315±0.04b 0.079±0.01b 1.540±0.16b 2.203±0.27b
Yabby RD 0.034±0.003a 1.409±0.11a 2.753±0.21a 1.151±0.08a 4.372±0.38a
TD 0.026±0.002b 0.930±0.13b 2.025±0.24b 0.861±0.09b 2.435±0.29b
![Page 58: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/58.jpg)
40
digestion. Consequently, levels of digestive enzyme activity are often strongly
correlated with an animal’s dietary preference as individuals will have adapted to
optimise their nutritional intake from their wild food sources over evolutionary time
(Lundsted et al. 2004). In redclaw, Figueiredo et al. (2001) reported a range of
digestive enzymes that enable them to degrade a broad range of food types. In
support of these findings in the current study, they also detected higher levels of
cellulase and amylase than protease in gastric fluid and MG extracts in redclaw.
Pavasovic et al. (2007) reported significant changes in the activity of these enzymes
when the nutrient content of formulated diets was altered. Furthermore, Figueiredo
& Anderson (2003) reported the presence of cellulase activity in all stages of growth
in redclaw and Xue et al. (1999) demonstrated that redclaw cellulase enzymes show
broad substrate specificity. The ability of a number of crustacean species including
mud crabs and both marine and freshwater crayfish to digest and release glucose
from soluble cellulose (CMC) (Pavasovic et al. 2004; Crawford et al. 2005; Pavasovic
et al. 2006), indicates that cellulose substrates can be a potential source of energy
for crayfish.
In the current study, all three Cherax species showed significantly higher protease
and amylase activities when fed the RD diet. Evidence has supported the suggestion
that soluble non‐starch polysaccharides (NSP, e.g. cellulose) potentially can increase
the viscosity of the intestinal contents and can obstruct activity of other digestive
enzymes (reviewed in Crawford et al. 2005; Pavasovic et al. 2006). This may be the
reason why all three species tested here showed significantly lower protease and
amylase activities when fed a diet containing soluble cellulose. In addition, protease
activity in marron fed the two diets could not be detected with the insoluble
substrate (AZCL‐HE‐Cellulose) and showed relatively low activity on the soluble
substrate (AZO‐Casein) compared with results for the other two species.
Although it is generally accepted that aquatic animals are less efficient at utilising
carbohydrates than some terrestrial species (Saoud et al. 2012) because they are
less important as an energy source, several major carbohydrases have been found in
redclaw (Figueiredo et al. 2001, Crawford et al. 2005). This suggests that redclaw
should be able to rely on and assimilate carbohydrates for their energy needs, but
![Page 59: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/59.jpg)
41
further studies are needed to confirm this suggestion (Saoud et al. 2012). Moreover,
the presence of cellulase activity in redclaw (Figueiredo & Anderson (2003) does not
provide definitive proof that redclaw can utilise cellulose for their nutrition (Saoud
et al. 2012). Our study investigated the capacity of three Cherax crayfish species to
utilise soluble cellulose and results in general, did not show significant negative
effects on growth rate in yabby or marron. In addition, cellulase activity in redclaw
individuals fed both diets were not significantly different and so in combination, this
suggests that soluble cellulose could potentially be used as a source of energy in
freshwater crayfish formulated diets.
In contrast to an earlier observation that cellulase activity was significantly higher in
marron compared with the other two Cherax species (Crawford et al. 2005), our
study showed significantly lower cellulase activity in marron fed a diet containing
soluble cellulose. Animals used in the earlier study however, were not reared under
experimental conditions and had not been fed a specific diet containing known
ingredients. Also, average weight of marron used by Crawford et al. (2005) was
more than 20 times higher (219.6±62.2) than the late‐juvenile animals we tested
here. Several studies have reported that different dietary formulations can produce
changes in digestive enzyme profiles in freshwater crayfish (Lopez‐Lopez et al. 2005;
Pavasovic et al. 2007) and pond‐raised animals are also able to access natural food
items from the pond in addition to the formulated feed provided to them. In a study
by Morrissy (1989), marron reared in battery cages and fed a formulated diet
showed lower ecdysial frequency (moulting) and lowered ecdysial weight
increments compared with individuals raised in ponds. Furthermore, feeding
preferences of freshwater crayfish can change with age (D’Abramo & Robinson
1989; Mitchell et al. 1995; Momot 1995). For example, adult crayfish consume a
higher proportion of vegetable matter and detritus in their diets compared with
juvenile crayfish, and this is probably related to a differential need for amino acids.
Figueiredo et al. (2003) also observed distinct changes in digestive enzyme activities
in crayfish with age; in particular protease activity decreased, and carbohydrase
activity increased. In contrast, in our study both marron and yabby did not show any
significant difference in SGR between animals fed the two diets. Potentially, this may
![Page 60: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/60.jpg)
42
reflect an overall better ability of them to utilise cellulose in their diet compared
with redclaw.
Several studies have reported that juvenile yabbies achieve the best growth rates
and survival when they are fed animal protein‐based diets including freshwater
zooplankton (Austin et al. 1997; Verhoef et al. 1998). Linton et al. (2009) also
suggested that the morphology of the gastric mill and higher total protease activity
in the midgut gland of C. destructor indicates that yabbies are better able to digest
animal rather than plant matter. In the current study, however, yabbies fed the two
diets showed only relatively moderate protease activity compared with marron and
redclaw. Many crustaceans lack protease activity (Guillaume 1997; Navarrete del
Toro et al. 2006), and in our study test animals also all showed relatively low levels
of total protease activity. The protease activity recorded for redclaw however, was
slightly higher than those reported in previous studies. For example, protease
activity reported by Pavasovic et al. (2006) was about ten times lower than the
activity levels recorded here. There are no previous reports available on protease
activity in marron and our results showed that protease activity was very low
compared with redclaw and yabby. In particular, it was not detectable with the
insoluble substrate and was much lower with the soluble substrate. Very low
protease activity in marron may indicate their dietary preference and specific
genetic adaptation to natural diets high in plant material.
Amylase activity followed a similar pattern as for the other two enzymes screened.
López‐López et al. (2005) observed higher amylase activity in redclaw fed diets
containing a high percentage of starch and activity levels obtained here compare
well with their results and the results reported by Pavasovic et al. (2006). Given the
observations that marron appear to be well adapted to diets rich in plant material,
the relatively lower amylase activity levels recorded for them will require further
investigation. Cellulase activity levels obtained here also vary from levels obtained in
previous studies. For example, activity levels were much higher than those reported
in some other decapod crustaceans (e.g. Figueiredo & Anderson 2009). In contrast,
Crawford et al. (2005) reported higher cellulase activities in all three Cherax species
than the activity levels recorded here. Pavasovic et al. (2006) reported
![Page 61: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/61.jpg)
43
approximately 15 times higher cellulase activity in redclaw. Several studies have
demonstrated, that differences in culture conditions (in‐house tank system/earthen
ponds), size of animals, diet composition all potentially could have contributed to
these differences. In the presence of soluble substrate, which is specific for endo1,
4‐ β glucanase, all species showed significantly higher activity levels compared with
insoluble substrate. Figueiredo & Anderson (2009) observed however, lower (in
Macrobrachium australiense, Scylla serrata, Penaeus plebejus) and higher (in
Portunus pelagicus, P. esculentus, Metapenaeus bennettae) activity levels, for
soluble cellulose included in diets for tested decapod crustaceans species.
Ability to use carbohydrates in diets will vary with the complexity of the
carbohydrate source (Pillay & Kutty 2005). In order to provide energy, an ingredient
must be digested by the animal and differences in relative digestibility are influenced
by the composition and chemical bonds in different types of carbohydrates (Stone
2010). Poor digestibility of complex polysaccharides by crustacean species has been
demonstrated in several studies (M. rosenbergii – González‐Peňa et al. 2002; P.
monodon – Catacutan 1991; Scylla serrata – Pavasovic et al. 2004; Procambarus
clarkii – Reigh, Braden & Craig 1990). This strong evidence suggests that despite an
ability for freshwater crayfish to secrete endogenous cellulases, crayfish are unlikely
to obtain nutrients directly from highly fibrous material (Pavasovic et al. 2006). In
contrast, carbohydrates of starch origin are often referred to as digestible (Stone
2003) and have better protein‐sparing ability (Pavasovic et al. 2006). As a
consequence, much of the carbohydrate in prepared crustacean feeds is usually
provided in the form of starch (Sanchez‐Paz et al. 2006; Stickney 2009). In the
absence of digestibility data for starch and soluble cellulose here, variations in
survival rates and SGRs cannot be explained in isolation by differences in enzyme
activity in the test animals.
At the end of the feeding trial, a significantly higher SGR was observed only for
redclaw fed the RD but no significant differences were observed for the other two
Cherax species. SGR in all three species were relatively low compared with data
reported in previous studies and this may be because of different diet ingredients
and their relative inclusion levels, differences in experimental designs and/or culture
![Page 62: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/62.jpg)
44
type/conditions used in the various experiments. For example, Pavasovic et al.
(2006) used insoluble α‐cellulose at three different inclusions levels (12, 20 and 29%)
in their redclaw diets. They observed a high mortality rate however, with increasing
levels of inclusion (70% mortality for 29% α‐cellulose diet). Thompson et al. (2004,
2005, 2006) have conducted several experiments on redclaw, and varied protein
levels, some with or without fish meal and observed higher weight gain or SGR. In
these experiments however, animals were reared in earthen ponds where animals
also have access to natural feed sources. Cortés‐Jacinto et al. (2003, 2005)
investigated different Crude Protein (CP) levels and Protein (P): Lipid(L) ratios in
redclaw diets and recorded a mean SGR of 3.65% per day approximately for the
diets that contained 31% CP level and diets with P:L ratio of 310:80. They used a
static experimental tank system for these studies. Fotedar (2004) recorded higher
SGRs for marron reared in earthen ponds supplemented with animal/plant based
protein and lipids ingredients but observed relatively low survival rates (13.82 –
34.66%). Here, we used soluble cellulose at a 20% inclusion level and observed
higher survival rates (>80%) in all three species. We used an in‐house recirculating
water system to investigate only the effects of dietary soluble cellulose versus starch
in the test animals’ diets. As individual animals were treated as a single replicate,
measurements of feed waste were not practical hence feed intake was not
considered further. Total survival rates however, were not significantly different
between the two diets in all three species and were above 80%, a level that is
considered good in crustacean studies (Cuzon & Guillaume 1997).
As our results show, enzyme activity levels and individual growth rates varied among
the three Cherax species fed diets containing starch as opposed to soluble cellulose.
Given that all three Cherax species responded in similar ways to the two ingredients,
this suggests that they should show different abilities to digest and utilise different
carbohydrate sources that are present in their diets, and it indicates that in nature
they have adapted to different natural habitats and diets.
In conclusion, results here show that the test animals of all three species appear to
utilise starch more efficiently than soluble dietary cellulose in their diets and that
inclusion of 20% soluble cellulose in diets for yabby and marron did not appear to
![Page 63: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/63.jpg)
45
have a significant negative impact on individual growth rate. Survival rate and SGR
however, were impacted in redclaw. Future studies should test the effect of lower
inclusion levels of soluble cellulose in diets in each species to further evaluate the
potential for soluble cellulose to be used as a low‐cost feed additive in commercial
formulated diets for each of the three Cherax species.
2.5 Acknowledgments
The authors would like to thank Kristian Just (Ridley Agri Products) for donation of
fishmeal and other feed ingredients. We are also grateful to Debbie White (Cherax
Park, Theebine, QLD), Peter McGinty (Aquatic Resource Management Pty Ltd,
Manjimup west, WA), Margaret and Peter Burns (B and B and Yabby Farm, Mudgee,
NSW) and Gerard Abrams (Reedy Creek Crays, Karuah, NSW) for their kind
cooperation and supplying of crayfish for this project.
![Page 64: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/64.jpg)
46
CHAPTER3: Expression and characterisation of digestiveenzymegenes fromhepatopancreatic transcripts fromredclawcrayfish(Cheraxquadricarinatus)
Accepted for publication in Aquaculture Nutrition on 6th May 2014
Accepted for an oral presentation in world aquaculture Adelaide conference held from 7 to 11 June 2014 in Adelaide, Australia.
Presented at the Systems Biology and Bioinformatics Symposium, 25–26 November, Queensland University of Technology, Brisbane, Australia (poster presentation).
![Page 65: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/65.jpg)
47
Expression and characterisation of digestive enzyme genes from
hepatopancreatic transcripts of redclaw crayfish (Cherax quadricarinatus)
Authors and their affiliations
Dammannagoda L. K.*, Pavasovic A. #, Prentis P. J.*, Hurwood D. A.* & Mather P. B.*
*School of Earth, Environmental and Biological Sciences, Science and Engineering
Faculty, Queensland University of Technology, GPO Box 2434, Brisbane, Australia.
#School of Biomedical Science, Faculty of Health, Queensland University of
Technology, GPO Box 2434, Brisbane, Australia.
![Page 66: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/66.jpg)
48
Abstract
Redclaw crayfish, (Cherax quadricarinatus), possess a number of biological and
commercial attributes that make them ideal for commercial aquaculture. While
some studies have investigated digestive enzyme activity and nutritional
requirements of this species, little information exists about the expression of
digestive enzyme genes and their role in regulating digestive capacity. The current
study therefore, sequenced and annotated an RNASeq library constructed from a
redclaw hepatopancreas to identify genes involved in digestive enzyme production.
We observed that most of the transcripts that were annotated as digestive enzyme
genes are associated with carbohydrate metabolism, confirming that redclaw have
an innate capacity to digest a range of carbohydrate substrates. While
endoglucanases were the most abundant group of digestive enzymes found, a
number of novel transcripts were also detected. Here we provide the first report for
presence and expression of endo‐β‐mannanase in freshwater crayfish. This novel
gene showed significant alignment with a GH5 family protein from marine
Limnoriids, wood borers that do not possess symbiotic microbes in their gut system.
Overall, the data generated here provide an important resource to better
understand the suite of digestive enzymes in redclaw that are essential to fully utilise
the species’ digestive capacity and can assist development of specific formulated
feeds.
Key words:
redclaw, Cherax, hepatopancreas, transcriptome, digestive enzymes
![Page 67: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/67.jpg)
49
3.1Introduction
Redclaw crayfish, (Cherax quadricarinatus), is one of a number of endemic
freshwater crayfish species native to north and north‐western Australia. Key
physiological traits including rapid growth rate, simple life‐cycle, and ability to
withstand wide variations in temperature, pH, and dissolved oxygen levels (Rouse
1995; Masser & Rouse 1997; Karplus et al. 1998; Lawrence & Jones 2002) have
contributed to recognition of this species as an excellent aquaculture candidate.
Over the past two decades, redclaw farming has seen significant growth in
production in a number of countries worldwide (USA ‐ Wickins & Lee 2002; Mexico ‐
Ponce‐Palafox et al. 1999 in Saoud et al. 2012; China ‐ Xiaoxuan & Edgerton 2001; He
et al. 2012; Israel ‐ Karplus et al. 1995; Argentina ‐ Vazquez & López Greco 2007;
Indonesia and Vietnam ‐ Edgerton 2005; Yuniarti et al. 2011) that has led to
significant emphasis being directed to research aimed at optimising husbandry
practices and diet development (Saoud et al. 2012).
A number of growth and digestive enzyme studies have investigated specific
nutritional requirements in redclaw and have explored development of formulated
diets specific for this species (e.g. Cortés‐Jacinto et al. 2003, 2004; Thompson et al.
2003a, 2003b, 2005a, 2010; Campana‐Torres et al. 2005; Pavasovic et al. 2006,
2007a, 2007b; Dammannagoda et al. 2013). Results from these studies suggest that,
in general, diets with 250 g kg‐1 or greater protein levels are suitable for redclaw
grow‐out in ponds where individuals have access to natural feeds (Saoud et al.
2012), while it is also widely recognised that 80 g kg‐1 dietary lipid level with
approximately 300 g kg‐1 protein is suitable for good growth of juvenile redclaw.
While specific feed formulations are currently based largely on data obtained from
standardised dose‐response growth trials, often performed in combination with feed
and ingredient digestibility trials, there has been only limited examination of the
specific molecular basis for feed utilisation by this species. Therefore, as feed
continues to be the most expensive component of semi‐intensive and intensive
types of commercial aquaculture systems information about the suite of digestive
enzymes and the underlying genetic makeup of target species is essential if we are to
![Page 68: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/68.jpg)
50
fully utilise the digestive capacity of an organism and further reduce feed costs while
providing adequate nutrition to support optimum growth.
In the crustacean digestive system, the hepatopancreas plays a variety of functional
roles including synthesis and secretion of digestive enzymes, absorption and storage
of nutrients, metabolism and release of stored reserves during the intermoult period
(Ceccaldi 1997; Vogt 2002). Studies that have investigated hepatopancreatic
secretions have demonstrated that redclaw produce enzymes belonging to the three
main classes of digestive enzymes, namely proteases, lipases and carbohydrases
(Brown 1995b; Hammer et al. 2000; Figueiredo et al. 2001). As with many other
aquatic species, activity levels of digestive enzymes in redclaw appear to be affected
by an array of factors including developmental stage (Figueiredo & Anderson 2003),
moult stage (Fernández et al. 1997; Vega‐Villasante et al. 1999; Perera et al. 2008),
photoperiod, water temperature (Ceccaldi 1997), feeding habit and diet composition
(López‐López et al. 2005; Pavasovic et al. 2007a; Figueiredo & Anderson 2009).
Despite this information, molecular genetic and genomic information that describes
the complexity and diversity of different digestive enzymes in redclaw, is still not
well investigated, with only a few studies providing detailed molecular information
about digestive enzyme genes. For example, the gene responsible for producing
endo‐β‐1, 4‐glucanase has only been examined in a few freshwater crayfish species
including; Cherax quadricarinatus (Byrne et al. 1999; Xue et al. 1999), C. destructor
and Euastacus spp. (Linton et al. 2006). Discovery of this endogenous cellulase gene
provided significant insights into redclaw’s ability to breakdown complex
carbohydrates in its diet and ultimately its ability to utilise low‐cost feed ingredients.
While this information is important, further analysis and identification of expressed
genes that regulate secretion of the complete range of digestive enzymes will be
essential in order to identify other novel and potentially useful digestive enzymes.
Analysis of expressed sequence tags (ESTs) provides a comprehensive and widely
adopted method for discovery of novel, uniquely expressed genes and allows
characterisation of their expression profiles in a variety of tissues and developmental
stages (Jiang et al. 2009b). This method is now used widely to discover genes that
influence economically important traits and to characterise their expression patterns
![Page 69: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/69.jpg)
51
in many aquaculture species, including farmed crustaceans at different life stages
and that are exposed to different culture conditions (e.g. Jiang et al. 2009a, 2009b;
Robalino et al. 2009; Wu et al. 2009; Ma et al. 2012). While a few transcriptome
studies have been conducted on redclaw (e.g. Yudkovski et al. 2007, 2010; Hai‐peng
2011), currently little data are available on expression patterns of specific digestive
enzyme genes in this species.
In the current study therefore, we sequenced the transcriptome of redclaw
hepatopancreas using the Ion Torrent sequencing platform, to investigate the range
of transcripts associated with digestive capacity in redclaw.
3.2Materialsandmethods
3.2.1 Collection of tissues and RNA extraction
Redclaw crayfish (C. quadricarinatus) were obtained from a commercial crayfish
farm (Cherax Park, Theebine, Queensland) and individuals were housed in an
automated recirculating, freshwater aquaculture system (XenopLus Aqua System,
Techniplast, Italy). Animals were acclimated to experimental conditions
(temperature – 26.0±0.03 0C; pH – 7.8±0.02; conductivity ‐ 489±8 μS/cm‐1) and to a
commercial shrimp feed (proximate composition: dry matter – 92.6%, crude protein
– 44.2%, crude fibre – 7.9%, ash – 8.3% and gross energy 20.4 MJ/kg) for a period of
one week. After acclimation, animals were euthanized by immersion in ice water for
10 minutes. Following this, the hepatopancreas was dissected from three
experimental animals and tissues washed with DNase/RNase free water after which
samples were frozen immediately in liquid nitrogen. Samples were stored at ‐80oC
for later RNA extraction.
Frozen samples were homogenised in liquid nitrogen and total RNA was extracted
using a Trizol/chloroform protocol followed by a column clean up. Briefly,
homogenised samples were added to 1 mL of Trizol and incubated for 5 minutes at
room temperature. 200 μL of chloroform was then added and the mixture was
centrifuged at 15,000 rpm for 10 minutes. 200 μL of supernatant was then added to
the mixture of 700 μL of RLT buffer (Qiagen, Limburg, Netherlands) and 500 μL of
![Page 70: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/70.jpg)
52
absolute ethanol. Samples were then purified using a RNEASY MINI KIT
(Qiagen, Limburg, Netherlands) and eluted into two aliquots of 52 μL RNase free
water. Quality of total RNA was tested by running 5 μL of purified samples in a 1.5%
agarose gel, followed by analysis on the BIOANALYZER 2100 using an RNA nano chip
(Agilent Technologies, Santa Clara, CA, USA). Total RNA extractions were treated
using AMBION TURBO DNASE (Life Technologies, Carlsbad, CA, USA) kit as per the
manufacturer’s protocol. mRNA enrichment was performed using a DYNABEAD
mRNA purification kit (Life Technologies, Carlsbad, CA, USA). Quality and quantity of
isolated mRNA were determined using a BIOANALYZER 2100 pico chip (Agilent
Technologies, Santa Clara, CA, USA).
3.2.2 cDNA synthesis, library preparation and sequencing
High quality (100‐500 ng) mRNA was fragmented into 200‐700 bp templates using
RNase III (Life Technologies, Carlsbad, CA, USA) for cDNA synthesis. Fragmented RNA
was then evaluated for yield and size distribution on a BIOANALYZER 2100 using an
RNA Pico chip (Agilent Technologies, Santa Clara, CA, USA). cDNA library synthesis
for the whole transcriptome was conducted using an ION Total RNA‐Seq Kit (Life
technologies, Carlsbad, CA, USA). Preparation of templates using emulsion PCR for
sequencing and purification were performed using ONETOUCH IONTM Template kit
(Life Technologies, Carlsbad, CA, USA) as per the manufacturer’s instructions.
Sequencing was conducted using the ION TORRENT PERSONAL GENOME MACHINE
(PGMTM, Life Technologies, Carlsbad, CA, USA) and the ION PGMTM 200 Sequencing Kit
(Life Technologies, Carlsbad, CA, USA). Sequencing was performed as per the
manufacturer’s protocol and 130 cycles of sequencing were run using a 316‐chip
(ION 316TM chip, Life Technologies, Carlsbad, CA, USA).
3.2.3 Analysis
Raw reads underwent strict quality filtering with removal of adapters and sequences
with greater than 5% N bases or greater than 10% of bases with Q<20, prior to
downstream analyses. Following quality filtering, high quality reads were assembled
using Trinity short read de novo assembler, applying default settings (Grabherr et al.
2011). The assembled transcriptome was referenced to the NR database at NCBI and
![Page 71: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/71.jpg)
53
annotated using Blast2GO software (Conesa et al. 2005). All contigs were screened
against protein databases and the nucleotide database using BLASTx (e‐value<10‐5)
and BLASTn (e‐value<10‐5), respectively. Blast2GO software was also used to
determine the functions of contigs and to assign Gene Ontology (GO) terms to
sequences.
All contigs related to major digestive enzymes were selected from annotated
fragments for further analysis. Selected contigs were queried against BLASTn and
BLASTx databases in NCBI. Protein and nucleotide alignments were carried out using
Geneious software (version 6.1.6: Biomatters, http://www.geneious.com) applying
the following parameters: gap open penalty = 12, gap extension penalty = 3,
alignment type = global alignment with free end gaps). Blosum62 and 65% similarity
(5.0/4.0) cost matrices were used for protein and nucleotide alignments,
respectively. A Neighbour‐Joining tree method (Saitou & Nei 1987) and Jukes‐Cantor
distance model (Jukes & Cantor, 1969) were used to resolve the evolutionary
relationships among different species for each gene target. A Bootstrap resampling
method was used (Geneious tree builder) with 10,000 replicates to produce a
consensus tree with a 50% support threshold.
Validation of transcriptome data was performed via PCR amplification and
sequencing of six major digestive enzyme genes with primers designed from the
longest fragments of each respective gene with Primer3 software (Rozen & Skaletsky
2000) using the settings as described in Prentis et al. (2010). Total RNA samples from
redclaw hepatopancreas were first converted to cDNA using a TETRO cDNA synthesis
kit (Bioline, London, UK) as per the manufacturer’s instructions. cDNA was then used
as a template and PCRs were run in 25 μL volume reactions under the following
cycling conditions; for mannanase and lipase; 94 oC for 3 minutes, 30 cycles at 94, 57
and 72 oC for 30 seconds each, followed by 5 minutes at 72 oC. Annealing
temperature for trypsin and chitinase was 59 oC. A 1.5% agarose gel electrophoresis
was used to verify amplification of a single, PCR product from the correct gene
fragment. PCR products were purified using an ISOLATE II PCR and Gel Kit (Bioline,
London, UK). Following purification, cycle sequencing was carried out with the
BIGDYE™ Terminator Cycle Sequencing Ready Reaction kit version 3.1 (Life
![Page 72: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/72.jpg)
54
Technologies, Carlsbad, CA, USA). Excess primer and nucleotides were removed from
sequence reactions using a MgSO4 clean‐up. Cleaned fragments were then run on an
3500 GENETIC ANALYSER (Life Technologies, Carlsbad, CA, USA). Sequences for all
loci were visualized and edited manually with Geneious (version 6.1.1: Biomatters,
http://www.geneious.com). Sequenced fragments were analysed and queried
against the BLASTx database. Nucleotide and translated amino acid sequences of
amplified sequences were aligned and compared with contigs obtained from the
transcriptome, using Geneious (version 6.1.1: Biomatters,
http://www.geneious.com) software.
3.3Results
3.3.1 Transcriptome sequencing and reads assembly
Tissue specific transcriptome sequencing of the hepatopancreas from redclaw
crayfish using the ION TORRENT PGM produced approximately 1,597,128 raw reads
resulting in 154.56 Mbp of clean sequence data, of which 129.74 Mbp met our
stringent quality criteria described above. Average length of raw reads was 97 bp,
with a longest read of 397 bp. A total of 10,585 contigs were generated from the
Trinity assembly. Lengths of contigs ranged from 201 bp to 3,771 bp, with an average
length of 378 bp and a N50 length of 385 bp.
3.3.2 Functional annotation of transcripts and gene ontology (GO) assignment
We queried our contigs against the NR and NT databases using Blast2GO (Conesa et
al. 2005) and a summary of annotated data distribution is shown in Table 3.1.
Second level GO terms were assigned to the annotated contigs with biological
processes having the greatest amount of GO terms assigned (9,471) followed by the
cellular component category (5,657) and the molecular function category (5,150).
The most commonly assigned GO terms from the molecular function GO category
were “catalytic activity” and “binding” that accounted for 84.27% of the total GO
terms assigned in this category. GO term assignment to the cellular component
category indicated that many sequences were involved with “cell” (2,250),
“organelle” (1,628), “macromolecular complex” (991) and “membrane” (338)
functions. The five most common GO terms assigned to biological processes were
![Page 73: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/73.jpg)
55
“metabolic process” (2,207), “cellular process” (1,674), “biological regulation” (903),
“localisation” (768) and “response to stimulus” (733) (Figure S3.1). The large variety
of GO terms assigned to the contigs, indicates that we had captured a wide range of
different types of genes involved in a number of different processes in the redclaw
hepatopancreas transcriptome.
Table 3.1 Annotation results
Data Distribution
Type Number of Sequences
Without Blast Results 26
Without Blast Hits 173
With Blast Results 269
With Mapping Results 627
Annotated Sequences 3490
Total Sequences 10585
3.3.3 Identification of candidate digestive genes in redclaw hepatopancreas
We identified a number of contigs that were annotated as digestive enzymes from
redclaw hepatopancreas (Table 3.2; NCBI SRA Accession No. SRX390042). Among the
most commonly encountered contigs were endoglucanases (having a cellulase
activity function involved in hydrolysing glycosyl bonds). Endoglucanases accounted
for 48 different ESTs, ranging in length from 202 to 1,961 bp. BLASTx comparisons of
the 10 longest contigs resulted in the highest similarity with published redclaw β‐1,
4‐endoglucanase (Accession number: AAD38027.1) and cellulase GHF9
(AAO61672.2) proteins. The other closest hits for these contigs in redclaw were from
several termite species (Nasutitermes walkeri, Coptotermes formosanus,
Macrotermes barneyi, Reticulitermes speratus, Reticulitermes speratus) for the same
enzyme (Table S3.1). Translated amino acid sequences of the three longest
endoglucanase fragments showed the best alignment with the β‐1, 4 endoglucanase
protein sequence from C. quadricarinatus (AAD38027.1) with 69% pairwise identity
and 50.3% of tested sequences being identical (Figure 3.1).
Endo‐β‐mannanase was represented by eight ESTs that showed significant similarity
with Limnoria quadripunctata (marine isopod) GH5 family proteins (GH5A:
ADE58567.1, GH5C: ADE58568.1, GH5E: ADE58569.1) followed by Daphnia pulex and
![Page 74: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/74.jpg)
56
Haliotis discus discus (Table S3.1). Alignment with three GH5 family proteins from L.
quadripunctata were estimated at 64.6% and 46.9% pairwise and column wise
identity, respectively (Figure 3.2). The three longest nucleotide fragments (890, 823,
and 752 bp) showed 63.2% and 44.0% pairwise and column wise identity,
respectively to L. quadripunctata GH5A mRNA, complete cds (ADE58567.1) (Figure
3.3). We constructed a phylogenetic tree of translated amino acid sequence for the
redclaw endo‐β‐mannanase against other most hit mannanase proteins from other
species (Figure 3.4).
Table 3.2 List of selected candidate genes represented redclaw digestive enzymes
Gene name Shortest
contig/bp
Longest
contig/bp
Total number of
contigs
Endoglucanase 202 1961 48 Alpha amylase 224 2830 8 Chitinase 212 1973 20 Endo‐β‐ 274 890 8 Maltase ‐ 439 1 Trypsin 342 925 6 Lipase 207 1677 16 Aminopeptidase 231 2560 17 Carboxypeptidase 246 1572 15
In addition, Blast2GO annotation identified 20 chitinase ESTs in redclaw, the second
highest number for any digestive enzyme and chitinase ESTs ranged in size from 212
to 1973 bp. Sequence identity of these fragments was explored with BLASTx and
redclaw sequences showed highest similarity with reported chitinase sequences in
mud crab (Scylla serrata) and several marine prawn species (Table S3.1). Translated
amino acid sequences aligned to S. serrata chitinase protein (accession no:
ABY85409.1) with an estimated 61.4% pairwise identity. Nucleotide sequence
similarities of the six longest ESTs referenced to the complete S. serrata mRNA
sequence (Accession no: EU402970.1) were also performed (Figure 3.5).
BLASTx annotation also identified eight alpha‐amylase transcripts including three
pancreatic alpha‐amylase like proteins. Peptide sequences of the longest alpha
amylase contigs aligned (75.9% pairwise and 51.9% column wise) to a hypothetical
protein (DAPPUDRAFT_64687) in D. pulex (EFX66437.1) with the highest BLASTx
score (Figure 3.6).
![Page 75: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/75.jpg)
57
Figure 3.1. Translated amino acid sequence alignment of redclaw endoglucanase
sequences (Cq|EG_1, Cq|EG_2 and Cq|EG_3) referenced to Cherax quadricarinatus
complete β‐1, 4 endoglucanase protein (Cq complete EG: AAD38027.1). Identical and
similar residues are shaded black and grey respectively.
![Page 76: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/76.jpg)
58
Redclaw hepatopancreas trypsin ESTs showed significant alignment similarity with
four trypsin types (trypsin 1a, 1b, 2 and 3) found in Caribbean spiny lobster
(Panulirus argus) and multiple peptide sequence alignments of these fragments
estimated at 77.7% and 59.2% identity pairwise and column wise, respectively
(Figure 3.7). In addition to trypsin, we identified 15 ESTs that representing
carboxypeptidases and 17 ESTs representing aminopeptidases. Furthermore, 16
sequences represented lipase activity and are apparently involved with lipid
metabolic processes.
Figure 3.2. Partial alignment of redclaw (C.q|EM_1) endo‐β‐mannanase
translatedamino acid sequence compared with three GH5 family proteins from L.
quadripunctata (GH5A: ADE58567.1, GH5C: ADE58568.1, GH5E: ADE58569.1).
Identical and similar residues are shaded black and grey respectively.
3.3.4 PCR validation of selected expressed major genes
To validate the reliability of the redclaw transcriptome assembly and annotation,
primers were designed for selected major digestive enzyme genes (Table S3.2) and
amplified using PCR. Single gene fragments were amplified successfully for chitinase,
mannanase, trypsin and lipase via PCR (GeneBank accession numbers: Chitinase:
KJ949130; Lipase: KJ949131; Mannanase: KJ949132; Trypsin: KJ949133 and
KJ949134). These fragments were queried against the BLASTx database and the
same top blast hit results were obtained as for transcriptome contigs (Table S3.3).
Furthermore, nucleotide and translated amino acid sequences of sequenced
fragments showed significant similarity with nucleotide and protein sequences of
![Page 77: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/77.jpg)
59
transcriptome contigs that were used to design the respective primer sets (Figure
S3.2).
Figure 3.3. Nucleotide sequence alignment of redclaw (Cq) endo‐β‐mannanase
sequences reference to Limnoria quadripunctata (Lq) GH5A (ADE58567.1). Identical
and similar residues are shaded black and grey respectively.
3.4Discussion
While commercial farming of redclaw crayfish has developed significantly over the
last two decades (Wingfield, 2008) it remains an industry where production is not
fully optimised, in particular with reference to feed development. Current
![Page 78: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/78.jpg)
60
Figure 3.4. Evolutionary relationship (Neighbour‐Joining consensus tree) of redclaw
endo‐β‐mannanase (C.q|EM_1) compared with mannanase sequences from other
crustacean, mollusc and insect species. L. quadripunctata (GH5A: ADE58567.1,
GH5C: ADE58568.1, GH5E: ADE58569.1), D. pulex (EFX71597.1), Biomphalaria
glabrata (AAV91523.1), Aplysia kurodai (BAJ60954.1), Haliotis discus discus
(BAI99559.1), Callosobruchus maculatus (ADU33271.1), Gastrophysa viridula
(ADU33333.1). (Scale bar represents mean substitutions per site)
production practices commonly rely on use of cheap “crayfish pellets”, a modified
formulated chicken diet made by replacing expensive fishmeal with plant ingredients
and supplemental feeds (e.g. forage) to boost a culture pond’s natural production
(Metts et al. 2007; Saoud et al. 2012;). Recent studies have demonstrated that
redclaw possess endogenous cellulases (Byrne et al. 1999; Figueiredo et al. 2001;
Figueiredo & Anderson 2003; Crawford et al. 2005) that could be used to target
suitable low‐cost plant ingredients in feed development. Despite some promising
![Page 79: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/79.jpg)
61
findings however, there is potential to further exploit this species’ capacity to utilise
plant based ingredients in their diets by investigating the entire spectrum of
Figure 3.5. Translated amino acid sequence alignment of redclaw (Cq) chitinase
reference to Scylla serrata (Ss) chitinase protein (ABY85409.1). Identical and similar
residues are shaded black and grey respectively.
expressed digestive enzymes and to use this information to make more informed
decisions about the type of plant ingredients that potentially can be incorporated
successfully in specific aquafeeds.
Our investigation of the transcripts captured from the redclaw hepatopancreas
revealed an extensive array of digestive enzymes that are representative of
organisms that display omnivorous or detritivorous feeding habits (reviewed in
Saoud et al. 2012). This was evident in the large number of digestive enzyme genes
that we identified that were involved in carbohydrate metabolism, for example
endo‐β‐glucanase and chitinase enzyme genes were highly expressed with 48 and 20
contigs identified, respectively. Furthermore, carbohydrate metabolism was
represented by endo‐β‐mannanase and alpha amylase genes. Presence of many
isoforms of these genes reflects the functional diversity of redclaw digestive enzyme
genes.
![Page 80: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/80.jpg)
62
Figure 3.6. Translated amino acid sequence alignment of alpha amylase of redclaw
(Cq|aa_1, Cq|aa_2, Cq|aa_3, and Cq|aa_4) reference to D. pulex alpha amylase
protein (D. pulex_aa‐EFX66437.1). Identical and similar residues are shaded black
and grey respectively.
According to Beguin & Aubert (1994), different enzyme classes frequently consist of
multiple components that are often produced by different coding sequences of
genes that can vary in their substrate specificity. Synergistic interactions of these
functionally different types of enzyme classes may enhance overall capacity to
![Page 81: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/81.jpg)
63
degrade cellulose substrates (Crawford 2006). The presence of a number of isoforms
of endoglucanase genes identified in redclaw implies broad substrate specificity, a
characteristic that potentially allows them to degrade a diversity of plant‐derived
ingredients present in their natural environment.
Figure 3.7. Translated amino acid sequence alignment of redclaw trypsin ESTs
(Cq|trypsin_1, Cq|trypsin_2 and Cq|trypsin_3) reference to four types of Caribbean
spiny lobster (Panulirus argus) trypsins (trypsin 1a: ADB66711.1, trypsin 1b:
ADB66712.1, trypsin 2: ADB66713.1, trypsin 3: ADB66714.1). Identical and similar
residues are shaded black and grey respectively.
BLASTx results for putative endoglucanases identified in redclaw here showed
significant similarity with published redclaw endoglucanase sequences in addition to
termite endo‐β‐glucanases. Crawford (2006) also identified structural similarities in
GHF9 genes in crustaceans, and other invertebrates. In our study, however, we could
not identify cellobiohydrolases or β‐glucosidases in redclaw, the other two classes of
cellulase enzymes required for complete degradation of cellulose to simple sugars in
addition to endo‐β‐glucanase. β‐glucosidase activity has been reported in a number
of groups of crustaceans and the enzyme has recently been extracted and purified
from the hepatopancreas of the land crab, Gecarcoidea natalis (Allardyce et al.
2010). This study used however, a biochemical analytical approach and to date there
![Page 82: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/82.jpg)
64
is no a molecular evidence or protein/nucleotide sequence data for a corresponding
gene in crustaceans. A β‐glucosidase gene has been characterised however, in a
number of termite species (e.g. Macrotermes barneyi ‐ AFD33364.1, Reticulitermes
flavipes ‐ ADK12988.1, Odontotermes formosanus ‐ ADD92156.1, Neotermes
koshunensis ‐ BAB91145.1) and in some mollusc species (Corbicula japonica ‐
BAH14963.1, BAG75455.1, BAG71912.1). Despite the structural similarities with
redclaw observed in some invertebrates including termites for some enzyme gene
classes (e.g.GHF9) (Crawford et al. 2006), any β‐glucosidase sequences was not
detected in the redclaw transcriptome. This could perhaps result from very low
similarity of these genes with any redclaw gene (if redclaw do in fact possess β‐
glucosidase gene(s)) that did not meet the search criteria, for example, blast expect
value (E value) was set at the very conservative 10‐6 in our Blast2GO search.
Cellobiohydrolase (GH7) genes have also been detected in a Limnoriid (Limnoria
quadripunctata: marine isopod) by King et al. (2010). While endo‐β‐1, 4‐glucanases
and β‐glucosidases appear to be key enzymes that contribute to cellulose
degradation in diverse invertebrate species (reviewed by Allardyce et al. 2010).
Many invertebrates are able to use an alternative pathway and produce glucose
from crystalline cellulose, a pathway that does not require cellobiohydrolase
(Scrivener & Slaytor 1994; Watanabe & Tokuda 2010). Scrivener & Slaytor (1994)
suggested that this may be achieved via production of endo‐β‐1, 4‐glucanases in very
high concentrations and/or by converting soluble oligomers resulting from the action
of endo‐β‐1, 4‐glucanases to glucose without intermediate production of cellobiose.
The relatively high endoglucanase gene expression in redclaw at the transcript level
observed here and very high enzyme activity present in the hepatopancreas
(Dammannagoda et al. 2013) compared with that in other Cherax species, may add
some support for this hypothesis.
Mannans are hemicellulosic polysaccharides that are found in the secondary walls of
plant cells (Handford et al. 2003) and endo‐β‐mannanases (EC 3.2.1.78) are a key
enzyme involved in degradation of plant mannans (Yuan et al. 2007). Here we
identified eight endo‐β‐mannanase ESTs belonging to the same class (GH5 family) in
the redclaw hepatopancreas transcriptome. According to the current NCBI database
![Page 83: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/83.jpg)
65
and to our knowledge, this is the first time that an endo‐β‐mannanase has been
reported from a freshwater crayfish. The redclaw endo‐β‐mannanase showed
significant alignment similarity to the gribble (L. quadripunctata) endo‐β‐mannanase
protein. Limnoriids are marine wood boring invertebrates in the order Isopoda and
their digestive tracts appear to be free from resident symbiotic microbes (Boyle &
Mitchell 1978; Daniel et al. 1991). In fact, the gut environment of Limnoriids
prevents microbial proliferation (King et al. 2010). This suggests that Limnoriids are
producing all of the digestive enzymes necessary for endogenous lignocellulose
digestion (King et al. 2010). As Limnoriids and redclaw appear as sister taxa in the
phylogeny presented here, it may be assumed that their common ancestor also
possessed functional mannanase. This implies potential for redclaw to be able to
utilise lignocellulosic plant materials as part of their diet.
Xylan is another complex polysaccharide often found in the secondary cell walls of
plant cells. While Xue (1998) and Crawford et al. (2005) had earlier reported
endoxylanase activity in the redclaw hepatopancreas, based on the results obtained
by hydrolysing specific substrates we could not detect any xylanase sequences in our
redclaw transcriptome. A gene that encodes xylanase however, has been detected in
a few mollusc species (e.g. Ampullaria crossean ‐ AY941794.1, Corbicula japonica ‐
AB490291.1). In prokaryotes, both endo‐β‐mannanase and endo‐β‐xylanase belong
to the same GH5 family protein class and so King et al. (2010) suggested that
Limnoriid GH5 family proteins (enzymes) may target either or both substrates. In a
previous study, it was shown that in some crustaceans (e.g. Euphausia superba ‐
Antarctic krill) endoxylanses are inactive against certain cellulose substrates
(Turkiewicz et al. 2000) and endoglucanase from the same species could not
hydrolyse xylan substrates (Chen & Chen 1983). They suggested therefore, that
xylanase activity in crustaceans may be derived from a distinct enzyme class rather
than from broad specificity endoglucanases (Crawford et al. 2005). Results obtained
for Limnoriids and observations by King et al. (2010) support this argument and this
could also explain why redclaw show xylanase activity apparently without possessing
a corresponding gene for xylanase while having an endo‐β‐mannanase in the same
![Page 84: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/84.jpg)
66
GH family. Further work however, will be required to confirm or refute presence of
endogenous xylanase gene(s) in the redclaw hepatopancreas.
Chitin is an essential component of fungal cell walls and is a major component of
arthropod exoskeletons. It is a polysaccharide of N‐acetylglucosamine, built with β‐1,
4 linkages (Munro & Gow 2001). Chitinase enzymes are involved in nutrient digestion
(chitin‐containing food), the partial breakdown of the exoskeleton prior to moulting,
and they are present in the hepatopancreas of many crustaceans (Tan et al. 2000).
Ecdysis is a major recurrent life event for crustaceans and often the exuvium is
ingested following moulting. During the post‐moult period, glucose is utilised for
chitin biosynthesis (Saravanan et al. 2008). We identified several chitinase and chitin
metabolism related sequences in redclaw hepatopancreas and the sequences
translated to amino acid sequences that aligned to the mud crab (S. serrata)
chitinase sequence.
Validation of annotated results conducted by PCR and sequencing verified the ESTs
in the redclaw hepatopancreas. Amplified sequences of digestive enzyme genes
were queried against BLASTx and produced similar results to those from genes
identified in the transcriptome (Table S4). Similarities between amplified
nucleotide/amino acid sequences with amino acid/nucleotide sequences of the same
gene fragments in the transcriptome were explored and showed significant
alignment similarities. For example, we obtained 100.0% pairwise and column wise
alignment for both nucleotide (not shown) and translated amino acid sequence for
an amplified lipase sequence with the longest lipase sequence in the redclaw
transcriptome (Figure S6(c)). Translated amino acid sequence alignments for other
enzyme genes amplified (chitinase, endo‐β‐mannanase and trypsin) are shown in
Figure S6 (a – d). Alignment results validate and confirm reliability of sequencing,
assembling and annotation of our transcriptome data.
The digestion of plant ingredients requires efficient hydrolysis of cellulose, the
principal constituent of plant cell walls and involves three classes of cellulases,
including, endo‐β‐glucanase. Molecular discovery of endogenous production of
endo‐β‐glucanase enzyme and its expression in the hepatopancreas of redclaw has
![Page 85: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/85.jpg)
67
directed nutrition studies to test the ability of freshwater crayfish to utilise plant
ingredients in their diets. Accordingly, Pavasovic et al. (2006) have tested and
reported that dietary insoluble cellulose (α‐cellulose) has no detectable nutritive
benefit on freshwater crayfish growth. Meanwhile, in the same study and related
studies (e.g. Crawford et al. 2005), it was demonstrated that enzymes from the
hepatopancreas of freshwater crayfish can liberate glucose from soluble cellulose
(carboxy methyl cellulose). Moreover, Dammannagoda et al. (2013) reported
inclusion of dietary soluble cellulose in general, has no negative effect on relative
growth rates of freshwater crayfish and suggested that some expensive animal
components in aquafeeds could be replaced by plant derived ingredients. Our
transcriptome data that was dominated by endo‐β‐glucanase genes confirms these
findings and molecular data therefore, can provide a foundation for developing a
better understanding of the innate genetic capacity of animals to assimilate certain
compounds. This information can help select suitable dietary ingredients that are
matched to a species’ specific nutritional requirements and its individual digestive
capacity, in particular, low‐cost plant derived components in order to reduce the
total cost of aquafeed.
Complete hydrolysis of lignocellulosic plant material also requires hemicellulases
that degrade xylans, mannans, arabinans and galactans (Shallom & Shoham 2003).
The first report of an endo‐β‐mannanase gene in the redclaw hepatopancreas here
provides further evidence for potential ability of redclaw to utilise woody plant
materials in their diets. The Limnoriids, that possess endo‐β‐mannanase genes that
showed significant similarity with redclaw endo‐β‐mannanase genes mainly consume
marine woody material and sea weed. This suggests that redclaw may also have the
ability to utilise ingredients derived from seaweed that possess high carbohydrate
content (30%‐60%) and that are rich in non‐starch polysaccharides (Sáez et al.
2013). Several studies have demonstrated the positive effects of inclusion of
seaweed in aquafeeds and reported improved growth performance and better feed
utilisation, higher disease resistance and an improved stress responses (Valente et
al. 2006). Seaweed, therefore, could potentially be trialed as a new/alternative
source of feed item in formulated diets for freshwater crayfish.
![Page 86: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/86.jpg)
68
A molecular approach to identifying an animal’s digestive capacity by characterising
the specific genes that encode and regulate production of all digestive enzymes that
an animal is genetically capable of producing can provide a broader picture of its
digestive physiological capacity as opposed to simply testing end product enzyme
activity. A comparative approach also provides more detailed information on the
target species digestive capacity. Testing potential ingredients in experimental diets
can then form the foundation of designing for low‐cost feeds. In the current study,
for example, we detected an endo‐β‐mannanse gene in redclaw for the first time
while some studies have demonstrated better growth performences in marron (C.
cainii) (Sang et al. 2009; Nugroho & Fotedar 2014), and other crustacean species
(Litopenaeus vannamei: Zhang et al. 2012, Panulirus homarus: Do Huu & Jones 2014)
fed mannan oligosaccharides. Given the fact that redclaw has the ability to produce
and secrete endo‐β‐mannanase endogenously, mannan oligosaccharides therefore,
could also be trialed in redclaw diets and may contribute to better growth rates. In
addition, recognition of the ability of freshwater crayfish to utilise plant material
effectively in their diets, may encourage farmers to trial some alternative high‐
protein plant material in addition to Lupins, a feed additive that is currently widely
used in the industry as a supplementary feed, to address the underfeeding issue.
With the increasing price and limited availability of fish meal and due to the
increasing pressure on grain markets (e.g. use of cereal grains for flour milling and
ethanol production), there is trend to use a number of plant by‐products resulting
from other industrial operations for example, distillers dried grains with solubles
(DDGS) in formulated diets for non‐ruminant terrestrial animal species (Zijlstra et al.
2010) and some aquaculture species (Roy et al. 2009; Gatlin et al. 2007). Most of
these plant by‐products are lower in starch and higher in crude protein and fibre
(Shurson et al. 2005) characteristics that can reduce nutrient digestibility and affect
growth rate in many animal species due to high NSP content for example, cellulose.
The ability of redclaw to utilise plant fibre effectively in feeds as evident in a number
of molecular and nutritional studies, suggests an opportunity to trial these plant by‐
products in formulating artificial diets for freshwater crayfish while reducing the
total feed cost.
![Page 87: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/87.jpg)
69
Investigations of expression patterns of digestive enzyme genes in redclaw fed
different dietary sources will provide a better understanding of the ingredients or
sources that they can utilise effectively and use as energy sources. Moreover,
analysis of differentially expressed digestive enzyme genes and other candidate
genes and elucidation of the biological pathways that they are involved in, in
combination with molecular studies, can have additional benefits (e.g. address
disease resistance questions) associated with specific feed ingredients in redclaw
diets. Therefore, studies on expression levels and patterns of endoglucanase and
endo‐β‐mannanase genes should be expanded, because they will provide important
information about crayfish digestive capacity for plant derived materials. Further
studies should also compare differentially expressed digestive enzyme genes in the
hepatopancreas of redclaw fed various plant/animal derived ingredients that have
different structural complexities. In this way, we can develop a comprehensive
understanding of digestive capacity linked to selection of nutritious, low‐cost feed
ingredients that will lead to improved species‐specific, low‐cost aquafeeds for
farmed freshwater crayfish species.
3.5Acknowledgments
The authors would like to thank Kristian Just (Ridley Agri Products, Australia) for
donation of fishmeal and other feed ingredients. We are also grateful to Debbie
White, Peter and Ethel Moore (Cherax Park, Theebine QLD 4570, Australia), for their
kind cooperation and supply of crayfish for this project.
![Page 88: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/88.jpg)
70
3.6Supplementarymaterial
Figure S 3.1 Functional annotation of redclaw (C. quadricarinatus) across
different GO term categories.
![Page 89: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/89.jpg)
71
Figure S 3.2 Alignment of translated amino acid sequence of redclaw amplified
chitinase gene fragment (C_amp) with translated amino acid sequences of chitinase
fragments resulted from the transcriptome (C_seq1 and C_seq2). Identical and
similar residues are shaded black and grey respectively (69.8% pairwise identity and
64.2% column wise identity).
Figure S 3.3 Alignment of translated amino acid sequence of redclaw amplified endo‐
β‐mannanase gene fragment (Mann_amp) with translated amino acid sequences of
endo‐β‐mannanase resulted from the transcriptome (Mann_seq1 and Mann_seq2).
Identical and similar residues are shaded black and grey respectively (estimated at
85.2% and 85.8% pair wise and column wise identity, respectively).
![Page 90: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/90.jpg)
72
Figure S 3.4 Alignment of translated amino acid sequence of redclaw amplified lipase
gene fragment (Lip_amp) with translated amino acid sequences of lipase (Lip_seq1)
resulted from the transcriptome. Identical and similar residues are shaded black and
grey respectively (estimated at 100.0% pair wise and column wise identity).
Figure S 3.5 Alignment of translated amino acid sequence of redclaw amplified
trypsin gene fragments (T1_amp and T2_amp) with translated amino acid sequences
of trypsin resulted from the transcriptome (T_seq1 and T_seq2). Identical and similar
residues are shaded black and grey respectively (estimated at 69.9% pair wise and
47.4% column wise identity).
![Page 91: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/91.jpg)
73
Table S 3.1 Top 10 BLASTx results for Cherax quadricarinatus endo‐β‐glucanase,
chitinase and endo‐β‐mannanase sequences.
Description Max Total Query E value Identity Accession No
Endo‐β‐glucanase
beta 1,4‐endoglucanase [Cherax quadricarinatus] 619 5274 69% 0 97% AAD38027.1
cellulase GHF9 [Cherax quadricarinatus] 618 5263 69% 0 97% AAO61672.2
cellulase [Neomysis intermedia] 495 3966 70% 3.00E‐152 57% BAL60587.1
NwEG [Nasutitermes walkeri] 473 3791 67% 1.00E‐144 59% BAA33709.1
Chain A, The Structure Of Endoglucanase From 471 3788 67% 2.00E‐144 59% 1KS8_A
endo‐b‐1,4‐glucanase [Nasutitermes takasagoensis] 472 3791 67% 2.00E‐144 59% BAA33708.1
endo‐beta‐1,4‐glucanase [Coptotermes formosanus] 470 3787 67% 1.00E‐143 58% ADB12483.1
endo‐beta‐1,4‐glucanase [Coptotermes gestroi] 463 3697 68% 2.00E‐141 57% AGS32241.1
cellulase [Coptotermes acinaciformis] 462 3712 67% 7.00E‐141 58% AAK12339.1
endoglucanase [Macrotermes barneyi] 457 3660 66% 5.00E‐139 56% AFD33365.1
Chitinase
chitinase [Scylla serrata] 332 634 71% 2.00E‐165 61% ABY85409.1
chitinase precursor [Litopenaeus vannamei] 310 603 71% 5.00E‐156 56% ABY70643.1
chitinase [Fenneropenaeus chinensis] 311 601 71% 1.00E‐155 57% AAY44300.1
chitinase 3 precursor [Penaeus monodon] 309 598 71% 1.00E‐154 56% ADG22163.1
chitinase [Litopenaeus vannamei] 310 597 71% 2.00E‐154 57% AAN74647.1
Pjchi‐3 [Marsupenaeus japonicus] 311 596 71% 4.00E‐154 57% BAA22854.1
chitinase [Litopenaeus vannamei] 313 568 69% 3.00E‐152 56% AAT80625.1
chitinase [Pandalopsis japonica] 277 572 71% 8.00E‐147 50% AFC60660.1
chitinase [Pandalopsis japonica] 267 533 71% 1.00E‐141 72% AFC60661.1
chitinase [Pandalopsis japonica] 233 457 54% 3.00E‐119 65% AFC60659.1
Endo‐β‐mannanase
GH5 family protein GH5A [Limnoria quadripunctata] 184 1096 72% 6.00E‐47 55% ADE58567.1
GH5 family protein GH5C [Limnoria quadripunctata] 183 1052 67% 8.00E‐47 62% ADE58568.1
GH5 family protein GH5E [Limnoria quadripunctata] 171 1050 69% 2.00E‐42 55% ADE58569.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 149 877 65% 4.00E‐35 49% EFX71597.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 133 833 63% 1.00E‐29 47% EFX71596.1
beta‐1,4‐mannanase [Haliotis discus hannai] 124 709 59% 9.00E‐29 50% BAE78456.1
beta‐1,4‐mannanase [Haliotis discus discus] 124 707 59% 1.00E‐28 50% BAI99559.1
Chain A, Beta‐1,4‐Mannanase From The Common Sea 124 674 63% 7.00E‐27 44% 3VUP_A
beta‐1,4‐mannanase [Aplysia kurodai] 124 676 63% 9.00E‐27 44% BAJ60954.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 122 815 67% 3.00E‐26 44% EFX76384.1
![Page 92: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/92.jpg)
74
Table S 3.2 List of primers designed for selected candidate genes
Primer name Sequence
Product
length/bp
endoglucanase_F AATGCTGAACCCTTGTGAGG 1209
endoglucanase_R TAGAGGGTCTGGGGGTTAGG
Alpha amylase_F GGAGTTCATCGACATGGTGC 1869
Alpha amylase_R AAGACGTTGAGGTAGCCACA
Chitinase_F AGACCTACACCCACCACCAG 771
Chitinase_R AGATGTTAGCGTTGGGGTTG
Mannanase‐F CACTGTGAAGTCAACGAGGC 418
Mannanase_R ATCACTCTCGGCTCTTGGAG
Trypsin_F CCAAGAAACGATGCCAGCTA 705
Trypsin_R TTCGTGTTCTGCCTTCTCCT
Lipase_F TATACGACCTGCCGTGACTG 419
Lipase_R GCTGGAGATCGCATACTTGG
F – Forward R – Reverse
![Page 93: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/93.jpg)
75
Table S 3.3 Top 10 BLASTx results for selected gene fragments sequenced for PCR
validation
Endo‐β‐mannanase Max
score
Total
score
Query
cover E value Identity Accession
GH5 family protein GH5A [Limnoria
quadripunctata] 176 176 96% 7.00E‐51 65%
ADE58567.1
GH5 family protein GH5C [Limnoria
quadripunctata] 166 166 98% 5.00E‐47 61%
ADE58568.1
GH5 family protein GH5E [Limnoria
quadripunctata] 160 160 96% 6.00E‐45 62%
ADE58569.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 151 151 97% 2.00E‐41 50% EFX71597.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 144 144 97% 1.00E‐38 51% EFX71596.1
hypothetical protein DAPPUDRAFT_119876
[Daphnia pulex] 127 127 97% 4.00E‐34 48% EFX62773.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 127 127 97% 2.00E‐32 48% EFX71598.1
beta‐1,4‐mannanase precursor [Cryptopygus
antarcticus] 126 126 97% 4.00E‐32 46% ABV68808.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 125 125 97% 8.00E‐32 48% EFX76384.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 122 122 97% 1.00E‐30 47% EFX76385.1
Chitinase
chitinase [Scylla serrata] 222 222 99% 5.00E‐66 60% ABY85409.1
chitinase [Litopenaeus vannamei] 211 211 99% 5.00E‐62 56% AAN74647.1
chitinase [Litopenaeus vannamei] 210 210 99% 6.00E‐62 56% AAT80625.1
chitinase [Fenneropenaeus chinensis] 210 210 99% 1.00E‐61 56% AAY44300.1
chitinase 3 precursor [Penaeus monodon] 207 207 99% 2.00E‐60 55% ADG22163.1
chitinase precursor [Litopenaeus vannamei] 207 207 98% 3.00E‐60 56% ABY70643.1
Pjchi‐3 [Marsupenaeus japonicus] 204 204 99% 1.00E‐59 55% BAA22854.1
chitinase [Pandalopsis japonica] 177 177 95% 3.00E‐49 48% AFC60660.1
chitinase [Pandalopsis japonica] 177 177 96% 3.00E‐49 47% AFC60661.1
chitinase [Pandalopsis japonica] 165 165 69% 2.00E‐45 51% AFC60659.1
Trypsin
trypsin 2 [Panulirus argus] 304 304 99% 7.00E‐101 73% ADB66713.1
trypsin 1a [Panulirus argus] 298 298 99% 1.00E‐98 71% ADB66711.1
trypsin 1b [Panulirus argus] 297 297 99% 3.00E‐98 71% ADB66712.1
trypsin 3 [Panulirus argus] 294 294 99% 4.00E‐97 70% ADB66714.1
trypsin 4 [Panulirus argus] 292 292 99% 3.00E‐96 71% ADB66715.1
trypsin [Litopenaeus vannamei] 291 291 99% 9.00E‐96 70% CAA75311.1
trypsin [Litopenaeus vannamei] 287 287 99% 3.00E‐94 69% CAA60129.1
trypsinogen 1 [Litopenaeus vannamei] 287 287 99% 4.00E‐94 69% AEZ67461.1
trypsin [Marsupenaeus japonicus] 286 286 99% 4.00E‐94 69% ACE80257.1
trypsin [Litopenaeus vannamei] 286 286 99% 4.00E‐94 69% CAA75309.1
![Page 94: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/94.jpg)
76
CHAPTER4: Expressionpatterns of selecteddigestive enzymesgenes in the hepatopancreas of redclaw (Cheraxquadricarinatus)fedtwodifferentcarbohydratesources
Presented at the annual conference of Genetics Society of AustralAsia (GSA), 6 – 9 July, 2014. University of Sydney, Sydney, Australia (oral presentation).
![Page 95: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/95.jpg)
77
Expression patterns of selected digestive enzyme genes in the
hepatopancreas of redclaw (Cherax quadricarinatus) fed two different
carbohydrate sources
Authors and their affiliations
Dammannagoda L. K.*, Prentis P. J.*, Amin S. #, Hurwood D. A.*, Mather P. B. &
Pavasovic A. #
*School of Earth, Environmental and Biological Sciences, Science and Engineering
Faculty, Queensland University of Technology, GPO Box 2434, Brisbane, Australia.
#School of Biomedical Science, Faculty of Health, Queensland University of
Technology, GPO Box 2434, Brisbane, Australia.
![Page 96: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/96.jpg)
78
Abstract
Despite the rich diversity of freshwater crayfish species, current world aquaculture
production is largely based on only a small number of species. Redclaw, is a relatively
recent entrant into this industry, but has been recognised as a candidate species
with significant potential because of some key physiological traits attractive for
culture. To date however, the industry has yet to develop a specific commercial
formulated diets that is well matched with its nutrient requirements for this species.
Traditional standard dose‐response trials have evaluated effects of different feed
ingredients and their combinations but there is still only limited information on this
animal’s genetic make‐up in relation to digestive metabolism. Here, we examined
expression profiles of expressed sequenced tags (ESTs) from hepatopancreatic
transcriptomes in redclaw individuals fed either starch or soluble cellulose in their
diets at the 20 per cent inclusion level. Individuals were fed with either a starch (RD,
reference diet) or soluble cellulose (TD, test diet) diet for one week and then RNAseq
libraries were constructed from the hepatopancreas and sequenced using the Ion
Proton sequencing platform with data annotated using the NCBI database. Analysis
of ESTs from both test groups revealed that most digestive enzyme genes expressed
in redclaw were involved in carbohydrate metabolism and the diet with soluble
cellulose (TD) showed higher expression levels of carbohydrate metabolism genes. In
particular, genes that encoded enzymes involved in hydrolysis of lignocellulosic
material showed the highest expression levels. In contrast, TD resulted in lower
expression of alpha amylase compared with the RD in redclaw. Identification of a
vast array of redclaw digestive enzyme genes and presence of various isoforms
suggest that redclaw have an innate genetic capacity to utilise a wide range of
carbohydrate substrates of different structural complexity. Thus, there is a potential
to incorporate complex plant polysaccharides into their formulated diets in order to
reduce total feed costs.
Key words:
redclaw, hepatopancreas, digestive enzymes, soluble cellulose, carboxy methyl
cellulose, starch, gene expression
![Page 97: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/97.jpg)
79
4.1 Introduction
Redclaw (Cherax quadricarinatus) supports a developing culture industry in a
number of countries around the world (Saoud et al. 2013, 2012). Currently however,
little knowledge is available about this species’ specific nutritional requirements, so
the industry has yet to develop a species‐specific commercial formulated diet that is
well optimised to redclaw’s nutrient requirements (Saoud et al. 2012). Commercial
production of farmed redclaw in many locations has often used commercial
shrimp/prawn formulated aquafeeds that in general, contain high levels of relatively
expensive fish meal as the main protein source (García‐Ulloa et al. 2003; Cortés‐
Jacinto et al. 2003, 2004, 2005; Thompson et al. 2003a, 2003b). High feed costs
overtime can affect the economic viability and impair development of any
aquaculture industry as feed and feeding is the major operating cost in most
aquaculture ventures that can contribute up to 80% of the total production cost in
intensive culture (Thompson et al. 2010). With a shift over time from extensive to
more intensive culture systems (Saoud et al. 2012), the cost of formulated diets has
become of greater significance and so to promote development of redclaw farming it
will be important to develop species‐specific formulated, low‐cost diets for cultured
redclaw stocks (Webster et al. 1994, 2002; Curtis & Jones 1995). Such diets will also
need to be less expensive than commercial, formulated shrimp feeds while offering a
complete nutrient profile matched to the animal’s digestive capacity and needs
(Saoud et al. 2012).
Redclaw are widely recognised as omnivores and/or detritivores in terms of their
feeding behaviour (Jones 1990; Brown 1995a; Momot 1995) and It is evident that
this species relies on a broad range of plant‐based ingredients in their natural diets
where individuals tend to consume a relatively high proportion of plant material
containing carbohydrates (Hill & Lodge 1994; Vogt 2002; Linton et al. 2009).
Carbohydrates in general possess good protein‐sparing ability (Pavasovic et al. 2006).
Recognition of this fact suggests that a variety of plant derived materials could
potentially be incorporated into feed formulations for practical diets for use in
redclaw aquaculture (Jones 1990; Campaná‐Torres et al. 2005, 2006, 2008; Pavasovic
et al. 2007a) while also reducing significantly the cost of a formulated feed.
![Page 98: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/98.jpg)
80
Figueiredo et al. (2001) reported a variety of digestive enzymes activities in the
hepatopancreas of redclaw that could be linked to their apparent innate ability to
consume a wide variety of feed ingredients and Pavasovic et al. (2007a) showed that
redclaw have the capacity to adapt their digestive physiology in response to changes
in nutrient requirements, nutrient availability, and/or dietary profile (Pavasovic et al.
2007b).
Endogenous cellulase activity and molecular evidence for a corresponding gene(s) in
redclaw that produce endogenous endo beta 1, 4 glucanase have directed recent
research to investigate the potential of redclaw carbohydrase enzyme(s) to digest
and utilise complex polysaccharides for example, cellulose. Pavasovic et al. (2006)
investigated growth, digestibility, enzyme activity and survival of redclaw fed with
insoluble cellulose (α‐cellulose) while Dammannagoda et al. (2013) demonstrated
the effects of soluble cellulose in diets on growth, survival and digestive enzyme
activities. In the latter study, cellulase activity in the hepatopancreas of redclaw fed
soluble cellulose was not significantly different (p>0.05) from animals fed starch at
the 20% inclusion level. This result adds support to reports (Shiau 1997; Pavasovic et
al. 2006) that redclaw are better able hydrolysing complex structural polysaccharides
than other forms of carbohydrates in their diets, which are found in plant material.
Furthermore, Dammannagoda et al. (2014) identified a number of endo beta
glucanase enzyme gene sequences that were expressed in a redclaw hepatopancreas
transcriptome. Endo‐β‐glucanases were the most abundant expressed gene among
the array of enzyme genes identified. In addition, this study was the first to identify
an endo beta mannanase gene in the hepatopancreatic transcriptome of redclaw.
Together, the results of these studies indicate that redclaw has a high utilisation rate
of plant‐derived feed components and has the genetic capacity to digest complex
polysaccharides, naturally.
In the crustacean digestive system, the hepatopancreas plays an important role and
has a variety of functions including synthesis and secretion of digestive enzymes,
absorption and storage of nutrients, metabolism and release of stored reserves
(Ceccaldi 1997; Verri et al. 2001, Vogt 2002). Despite evidence for the ability of
redclaw to produce and secrete a range of digestive enzymes in the hepatopancreas
![Page 99: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/99.jpg)
81
(proteases, amylases, lipases and cellulases), in the past the majority of feeding and
growth studies conducted on redclaw have investigated the activity levels of only a
few of the major digestive enzymes. In addition, biochemical enzyme assays
employed were carried out based on a substrate‐enzyme method that will always
rely on the relative “sensitivity” of the assay and so provide only a relative
quantification of the enzyme produced. This type of study does not provide data on
an individual’s innate genetic ability to produce and secrete the target digestive
enzymes. Molecular approaches for investigating digestive enzyme gene expression
in the hepatopancreas in contrast can provide a more comprehensive picture and
can provide valuable information about each individual’s genetic capacity to produce
enzymes that are involved directly in digestion. This information can be used to
identify the complexity and diversity of different genes that regulate secretion of
digestive enzymes and so provide a better understanding of an individual’s overall
digestive capacity that will allow determination of their specific nutritional
requirements (Dammannagoda et al. 2014). Analysis of expressed sequence tags
(ESTs) provides a comprehensive and widely used approach for discovery of novel,
uniquely expressed genes and also allows for characterisation of expression profiles
in various tissues (Jiang et al. 2009a). López‐López et al. (2005) and Pavasovic et al.(
2007a) observed that digestive enzyme profiles can be affected by diet composition
in crustaceans but to date, no studies have investigated gene expression of redclaw
digestive enzymes in the hepatopancreas in order to characterise gene expression
profiles when individuals are fed different diet formulations.
Here, we examined hepatopancreatic digestive gene expression in redclaw fed either
starch or soluble cellulose at the 20% inclusion level in their formulated diets to
identify differences in digestive enzyme gene expression patterns associated with
inclusion of the two ingredients. We developed a transcriptome from
hepatopancreatic tissue after individual animals had been fed the two diets and
applied next generation sequencing (NGS) technology to analyse associated gene
expression profiles. The specific aim was to determine if certain classes of digestive
enzyme gene expression were up or down‐regulated associated with particular
carbohydrate sources included in the diets.
![Page 100: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/100.jpg)
82
4.2 Materialsandmethods
4.2.1 Experimental animals and diets
Two experimental diets (reference diet ‐ RD/test diet – TD) were prepared as
described in Dammannagoda et al. (2013). The RD contained starch (corn) and the
TD contained soluble cellulose (carboxy methyl cellulose) at the 20% inclusion level.
Sub‐adult redclaw (Cherax quadricarinatus) (38.60±1.85 g) were obtained from a
commercial crayfish farm (Cherax Park, Theebine, Queensland) and allocated
randomly to tanks in an automated recirculating, freshwater aquaculture system
(XenopLus Aqua System, Techniplast, Italy). Animals were acclimated to the
experimental conditions (temperature: 26.9±0.04 0C, Conductivity: 614±13.5 μScm‐1,
pH: 7.7±0.02) and to their feeds for 1 week prior to experiments commencing. All
animals were assigned randomly to two groups and fed on one of two diets during
their acclimation period. After acclimation, individuals were starved for 48 hours
(Ong & Johnston 2006) following which they were fed their respective diets. After 90
minutes of feeding time (Gonzales‐Pena et al. 2002), five individuals from each of the
two diet groups were selected at random and euthanized by immediate immersion
in ice water for 10 minutes. Following this, hepatopancreatic tissue was dissected
from each experimental animal, tissue was washed with DNAse/RNAse free water
and samples immediately frozen in liquid nitrogen. Samples were stored at ‐80oC
prior to RNA extraction.
4.2.2 Total RNA extraction
Three replicates from each treatment group were used for RNA extraction. Frozen
samples were homogenised in liquid nitrogen and total RNA was extracted and
purified using a Trizol/Chloroform extraction protocol as per the manufacturer’s
(Qiagen) instructions. Briefly, homogenised samples were added to 1 mL of Trizol
and incubated for 5 minutes at room temperature. Following this, 200 μL of
chloroform was added and the mixture was centrifuged at 15,000 rpm for 10
minutes. Following this, ~500 μL of clear supernatant was separated and purified
using Qiagen RNAsey Mini Kit (Qiagen) as per the manufacturer’s protocols. Quality
integrity of total RNA was tested by measuring RNA concentration (A260/A280 ratio)
![Page 101: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/101.jpg)
83
using a Beckman Coulter spectrophotometer (Beckman Coulter Inc. CA, USA) and
running 5 μL of purified samples on an 1.5% agarose gel and Bioanalyzer 2100 using
a RNA nanochip (Agilent Technologies).
4.2.3 mRNA enrichment
Only RNA samples that had a RNA Integrity Number (RIN) of greater than 8 were
used for isolation of mRNA which was done using a Dynabeads mRNA Purification kit
(Life Technologies). Quality and quantity of isolated mRNA were determined using a
Bioanalyzer 2100 Pico chip (Agilent Technologies).
4.2.4 cDNA synthesis, library preparation and sequencing
High quality (100‐500 ng) mRNA was fragmented into 200‐700 bp templates using
RNase III (Life Technologies) for cDNA synthesis. Fragmented RNA was then
evaluated for yield and size distribution on a Bioanalyzer 2100 using an RNA Pico
chip (Agilent Technologies). cDNA library synthesis for whole transcriptome was
conducted using Ion Total RNA‐Seq Kit. Preparation of templates using emulsion PCR
for sequencing and purification were performed using OneTouch IonTM Template kit
(Life Technologies) as per the manufacturer’s instructions. Each sample was
barcoded and Next Generation Sequencing (NGS) was conducted using two Ion
Proton PI chips (Life Technologies) for RD samples and TD samples, respectively.
4.2.5 Analysis
Raw reads underwent strict quality filtering with removal of all adapters and
sequences with greater than 5% N bases or greater than 10% of bases with Q<20,
prior to downstream analyses. Following quality filtering, high quality reads were
assembled using the Trinity platform, applying default settings. The assembled
transcriptome was referenced to the NR database at NCBI and annotated using
Blast2Go software. All contigs were screened against protein data bases and a
nucleotide database using BLASTx (e‐value<10‐6) and BLASTn (e‐value<10‐6),
respectively. Blast2Go software was also used to determine the functions of contigs
and to assign Gene Ontology (GO) terms to the sequences.
![Page 102: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/102.jpg)
84
4.2.6 Quantitative PCR validation
Validation of transcriptome results was undertaken by conducting relative
quantitative real‐time PCR for selected digestive enzyme genes and a number of
other genes reported in redclaw hepatopancreas in a previous study (Yudkovski et al.
2007) (Table S4.1). Total RNA Samples that were used for NGS sequencing were
converted to cDNA using a Tetro cDNA synthesis kit (Bioline, UK) as per the
manufacturer’s instructions. cDNA was then used as template and a standard PCR
reaction was conducted in 20 μL volume composed of 10 μL of SYBR Green 1 master
mix, 1 μL of each forward and reverse primer (10 mMol), 1 μL of cDNA template and
H2O. Each reaction was performed in triplicate for target genes in a LightCycler®96
PCR thermocycler (Roche, Basel, Switzerland) under the following cycling conditions;
one cycle at 950C for 10 minutes; 40 cycles at 950C, 600C and 720C for 10 second each
followed by one cycle at 950C, 650C for 10 seconds and and 970C for 1 second. 18S
RNA was used for normalisation. Relative ratio (target gene conc./reference gene
conc.) was calculated using LightCycler®96 analysis software (Roche, Basel,
Switzerland).
4.3 Results
4.3.1 Transcriptome sequencing and reads assembly
Summary of transcriptome sequencing data resulted from the two Ion proton chips
and Trinity assembly statistics are shown in Table 4.1. MA and the Volcano plot were
created using EdgeR software and show differential expression of transcripts
between the control (RD) and the treatment (TD) groups (Figure 4.1). After
assembly, data were trimmed by removing contigs that were less than 299 bp and
this generated a total of 65, 399 and 76,121 contigs for the control (RD) and the
treatment groups (TD) respectively. Transcriptome libraries from animals fed the TD
produced a higher number of contigs (10, 722). Contigs were then queried against
the NR and NT databases for blasting and annotation using Blast2GO software
(Conesa et al. 2005).
![Page 103: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/103.jpg)
85
b a
Table 4.1 Summary of sequence and assembly data
Sequence statistics
Treatment RD TD
Total number of bases 7.8 Gb 6.8 Gb
Number of cleaned bases (>Q20) 6.0 Gb 5.4 Gb
Total number of reads 78, 273, 300 66, 837, 666
Mean read length/bp 99 102
Assembly statistics
Total number of contigs (after trimming) 65, 399 76, 121
Longest contig/bp 13, 115 12, 604
Mean contig length (after trimming)/bp 617 615
N50 533 536
Figure 4.1 Pairwise comparisons of transcript abundance between two diet
treatment groups. (a) MA plot for differential expression analysis. log (fold change or
ratio) [log (TD/RD)] for each gene between the two samples against the gene’s log
(average expression) [½log (RD*TD)] in the two samples. (b) Volcano plot for False
Discovery Rate (‐log10FDR) as a function of log (fold change) between the samples.
Transcripts that were differentially expressed (up regulated or down regulated are
shown in red.
![Page 104: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/104.jpg)
86
4.3.2 Functional annotation and gene ontology (GO) assignment
A summary of blast and annotated data distribution is shown in Table 4.2. 18, 283
contigs (27.9% of all contigs) and 21, 728 (28.5% of all contigs) were matched by
BLASTx for RD and TD, respectively. 72.1% of RD contigs and 71.5% TD contigs could
not be matched with any known protein.
Table 4.2 Summary of blast and annotation results
Type No of sequences
RD TD
Without Blast Results 1 1, 361
Without Blast Hits 38, 639 43, 178
With Blast Results 3, 255 3, 686
With Mapping Results 5, 566 6, 168
Annotated Sequences 18, 445 21, 728
Total Sequences 65, 906 76, 121
GO term classifications for functional categories were performed for annotated
contigs from both treatment groups using CateGOrizer software (multiple counting
method). Contigs resulting from both treatments showed highest number of GO
terms assigned for biological process (RD – 60, 935; TD – 109, 792) followed by
cellular component (RD – 40, 878; TD – 51, 751) and molecular function (RD – 29,
170; TD – 39, 931) categories. Assigned GO terms for contigs from both RD and TD in
each category in general, were comparable while TD showed a higher number of
contigs assigned for each term and a higher number of GO terms assigned. This
pattern indicates that soluble cellulose in the diet may “induce” expression of a
number of genes in the redclaw hepatopancreas that results in more diverse and
complex gene expression profiles when individuals are fed with dietary soluble
cellulose compared with those fed with starch.
4.3.3 Candidate digestive enzyme genes and their expression
We explored candidate genes that were involved in regulating digestion of major
ingredients and compared their expression patterns between the two diet
treatments used in this study. A list of candidate digestive enzyme genes and their
individual statistics are shown in Table 4.3.
![Page 105: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/105.jpg)
87
Table 4.3 Selected candidate digestive enzyme genes and statistics
Gene name Contig length range/bp
Total number of contigs
RD TD RD TD
Endoglucanase 317 ‐ 2402 312 ‐ 2419 57 61
Alpha amylase 320 ‐ 1430 315 ‐ 2435 27 5
Chitinase 312 ‐ 2073 328 ‐ 2132 23 26
Endo‐β‐mannanase 668 ‐ 1383 441 ‐ 1196 4 8
Maltase 800 ‐ 2197 962 ‐ 2163 8 10
Trypsin 325 ‐ 1318 415 ‐ 1265 9 11
Lipase 301 ‐ 2044 300 ‐ 2154 41 54
Aminopeptidase 302 ‐2772 300 ‐ 2779 22 30
Carboxypeptidase 315 ‐ 2316 334 ‐ 2327 13 7
Endoglucanase (EG) was the most highly expressed digestive enzyme under both
carbohydrate sources; starch and soluble cellulose, with a slightly higher number of
sequences expressed in individuals fed soluble cellulose. Consumption of soluble
cellulose resulted in a higher number of contigs expressed for most digestive enzyme
genes that were involved in carbohydrate metabolism including chitinase, endo‐β‐
mannanase and maltase. In contrast, with soluble cellulose (TD) alpha amylase
expression was reduced resulting in only 5 contigs while 27 alpha amylase contigs
were recorded for RD.
We performed BLASTx comparisons of “longest” and “best aligned” contigs for major
digestive enzyme genes and compared the results between the two diet treatments
(Table S4.2 (a) and (b)). EG contigs from the RD showed significant similarity with
published β – 1, 4 endoglucanase and the GH 9 family protein in C. quadricarinatus
while EG contigs from the TD showed significant matches with more diverse groups
of animals including with sea squirts, annelids and termites. Chitinase contigs from
both transcriptome libraries showed alignments with chitinases from marine shrimp
and prawns (e.g. Litopenaeus vannamei, Penaeus monodon, Pandalopsis japonica). A
similar pattern of results was obtained for endo‐β‐mannanase with both treatments
and significant matches were evident with endo‐β‐mannanase from Limnoria
quadripunctata and Daphnia pulex. In addition, alpha amylase contigs from the RD
treatment showed significant similarity with that from Litopenaeus vannamei, while
the alpha amylase in the TD treatment showed similarity with a hypothetical protein
![Page 106: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/106.jpg)
88
in Daphnia pulex and alpha amylase 1 in Camponotus floridanus. With regard to
trypsin contigs expressed in the two transcriptome libraries, we observed different
matches in the BLASTx search. Trypsin contigs in the RD, showed significant similarity
with several trypsin types (Trypsin 1a, 1b, 2, 3 and 4) in Caribbean spiny lobster
(Panulirus argus) while trypsin contigs in the TD matched with trypsin from a variety
of species.
We mapped the annotated sequences from both transcriptome libraries (RD – 18,
283; TD – 21, 728) in the Kyoto Encyclopaedia of Genes and Genomes (KEGG) to
identify biological pathways that annotated sequences were involved with (Table
S4.3). We assigned 5445 sequences to 126 known metabolic or signalling pathways
for RD and 6, 392 sequences to 128 pathways for TD, respectively.
4.3.4 Real‐time PCR validation
Relative ratio (abundance) of expression selected genes in individual samples
measured via real‐time RT‐PCR are shown in Figure S4.1. Despite the relatively low
number of contigs that were present in both transcriptomes, RT‐PCR results showed
higher trypsin expression in all samples irrespective of treatment, compared with
other digestive enzyme genes, in particular carbohydrases.
4.4 Discussion
Very little is known currently about genes that are involved in digestive metabolism
in freshwater crayfish and few studies have investigated their genetic characteristics
related to digestive capacity. Dammannagoda et al. (2014) investigated expression
patterns of major digestive enzyme genes in the redclaw hepatopancreas and
characterised them. They identified an extensive array of digestive enzymes
expressed in the redclaw hepatopancreas. Here, we profiled hepatopancreas from
redclaw fed two structurally different carbohydrate sources in order to investigate
and compare differential gene expression patterns in the major digestive enzyme
genes.
Analysis of the data distribution and functional GO term assignments show that the
transcriptome from animals fed the TD produced higher numbers of contigs for all
![Page 107: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/107.jpg)
89
gene types (except for alpha amylase) and higher expression levels with more GO
terms assigned to all categories. This indicates, in general, that inclusion of dietary
soluble cellulose in the diet can have a positive effect on gene expression in redclaw
hepatopancreas. A BLASTx search of these contigs revealed that different isoforms of
digestive enzyme genes were expressed under this treatment.
Structure of carbohydrates is one of the main factors that determines their
utilisation and in general, simple sugars (monosaccharides) appear to be poorly
utilised by crustaceans (Pavasovic et al. 2006). Among complex polysaccharides,
starch is easily digestible and the most commonly used form of carbohydrate
incorporated in crustacean feeds (Stickney 2009; Sanchez‐Paz et al. 2006). Non
starch polysaccharides (NSP), mainly cellulose, hemicellulose and xylan that
constitute the main components of plant cell wall pass through the intestines of
most animals undigested unless they have the required enzymes in their digestive
tract to breakdown such substrates (Stickney 2009). As reported earlier by
Dammannagoda et al. (2014), transcripts from both diet treatments, irrespective of
the dietary source, consisted largely of enzyme genes involved in carbohydrate
metabolism. In particular, genes hydrolysing complex structural polysaccharides like
cellulose, mannan, and chitin etc. This pattern reflects the omnivorous/detritivorous
feeding habit of freshwater crayfish (reviewed in Saoud et al. 2012) and their
preference for plant‐derived ingredients in the diets (Figueiredo & Anderson 2003).
Among the digestive enzyme genes expressed in the RD and TD treatments,
endoglucanases (EG) produced the highest number of contigs with the TD showing
higher expression levels compared with the RD. This indicates that inclusion of
soluble cellulose in the diet has a positive effect on expression levels of
endoglucanase. This results are in par with the results obtained by Dammannagoda
et al. (2013) where cellulase activity in redclaw fed soluble cellulose (TD) was not
significantly different from individuals fed starch (RD). It also agrees with reports of
several studies that suggest dietary ingredients can change digestive enzyme profile
expression patterns in freshwater crayfish (Lopez‐Lopez et al. 2005; Pavasovic et al.
2007). BLASTx search results for the selected EG contigs expressed in the TD showed
that redclaw cellulases/EG had significant similarities with endoglucanases from a
![Page 108: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/108.jpg)
90
diverse groups of animals. Potentially therefore, redclaw may possess a large range
of EG isoforms and expression and level of expression of isoforms may be influenced
by different types of dietary ingredient. Soluble cellulose could be one component
that influences expression of various EG isoforms in the redclaw hepatopancreas.
As with EG, soluble cellulose in the diet also produced higher expression levels of
chitinase and endo‐β‐mannanase sequences in the hepatopancreas of redclaw fed
the TD. In combination with high expression levels of EG contigs under the TD, this
finding suggests that dietary fibre can induce expression of certain classes of
digestive enzymes that are involved in hydrolysis of structural polysaccharides found
in plant cell walls. Dammannagoda et al. (2014) reported presence of an endo‐β‐
mannanase gene in redclaw and showed that it had significant similarity with GH5
family proteins found in Limnorrids that produce all of the digestive enzymes
necessary for lignocellose digestion endogenously. The endo‐β‐mannanase sequence
transcripts we captured here, in both transcriptomes showed a significant match
with the same three types of GH5 family proteins (GH5A, GH5C and GH5C) in the
Limnorrid (Limnoria quadripunctata).
Alpha amylase hydrolyses α bonds in large α‐linked polysaccharides for example;
starch and glycogen and it has been reported that in some crustaceans, alpha
amylase activity is the highest of all carbohydrases expressed (e.g. Crab species:
Johnston & Freeman 2005; Litopenaeus vannamei: Gaxiola et al. 2005). Several
studies conducted on redclaw however, have reported lower alpha amylase
expression levels compared with cellulase activity (e.g. Figueiredo et al. 2001;
Pavasovic et al. 2006; Pavasovic et al. 2007a; Dammannagoda et al. 2013). González‐
Peña et al. (2002) also demonstrated that dietary cellulose can decrease alpha
amylase levels in the hepatopancreas of freshwater prawns (Macrobrachium
rosenbergii). Furthermore, Dammannagoda et al. (2013) observed significantly lower
alpha amylase activity in redclaw fed soluble cellulose (TD) than in individuals fed
starch (RD). Here, we observed only very low alpha amylase expression (only 5
contigs) in animals fed the same TD compared with animals fed the same RD (27
contigs). The two studies show good accord in this regard. We compared KEGG
pathways of annotated sequences from both transcriptomes.
![Page 109: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/109.jpg)
91
Given the fact that results in general, did not show significant differences in the
pathways and number of sequences expressed between the two treatment groups,
further analysis will be required to identify unique or specific pathways where
differentially expressed contigs may be involved.
Lipase enzymes were the second highest class of gene expressed in the
transcriptomes in both treatments groups. Lipids are often incorporated in
formulated diets as a major energy source and provide efficient protein sparing
ability. As the crustacean hepatopancreas is involved not only in digestion and
absorption of nutrients (storing organ) but also in several other metabolic processes,
stored lipids are transported to or utilised in, other organs and tissues during certain
periods for example, during moulting (Yudkovski et al. 2007) and reproduction (Jiang
et al. 2009). Expression of lipase genes can therefore, be affected by a number of
other factors and are affected by the physiological status of the individual. Being the
second highest gene expressed per individual enzyme class, our transcriptome data
indicates high lipid metabolism activity in the redclaw hepatopancreas.
Advanced software features and computational methods used in transcriptome data
analysis now allow us to perform very deep data analysis. Extraction and analysis of
significantly differentially expressed sequences for example, can provide an
important path to group (cluster) genes that show similar expression patterns and
also to group together samples those show similar expression profiles. Such
“extraction” of differentially expressed sequences assist comparing transcriptomes
across samples. In the current study however, we could not perform some
computational methods (e.g. hierarchical clustering) to address this objective due to
the high variance in gene expression among some biological replicates that we used.
As the crustacean hepatopancreas is involved not only in nutrient digestion related
processes but also in a variety of other metabolic functions, gene expression in the
hepatopancreas can potentially be affected significantly by a number of factors,
most importantly the moult stage of the individual. The moult cycle is characterised
by multi‐gene expression patterns (Yudkovski et al. (2007) and individuals being at
different moult stage could result in high variance in our biological samples. We also
did not consider the sex of individuals for RNA sequencing which could be another
![Page 110: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/110.jpg)
92
reason for the high variance in expression pattern observed in this study within
treatments.
During real‐time qRT‐PCR validation, due to the high variation among some
biological replicates in both the RD and TD treatments, relative expression ratios
(∆∆Ct) and fold change in gene expression for target genes in the treatment group
(TD), relative to the control (RD) could not be estimated. We therefore, calculated
relative expression (relative to internal control, 18S gene) of target genes, in each
sample in both treatment groups. We did not observe however, good correlations
between qRT_PCR results and transcriptome data but observed relatively higher
trypsin compared with carbohydrase (endoglucanase, alpha amylase and chitinase)
expression which is contradictory to our transcriptome data. One reason for this
could be the amplification of very specific sequences during qRT‐PCR according to
the primers designed so that not all isoforms we observed in the transcriptome data
were screened. Alternative splicing of pre‐mRNA in eukaryotes is common and in this
process, particular exons in a gene may be included within, or excluded from, the
final processed mRNA transcript produced from a gene (Black 2003). The primers we
used/designed may not have amplified all splice forms of the target genes (for
example, primers designed from junctions which participate in alternative splicing
will not give good correlations) cover all variants and so may have ended up with
lower expression levels following qRT‐PCR regardless of the higher number of contigs
we obtained for endoglucanase and chitinase genes in our transcriptomes. Changing
or re‐designing primers and checking all splice variants of target genes would help to
address this issue.
In conclusion, our results show that addition of dietary soluble cellulose can affect
expression levels of certain digestive enzymes genes involved in carbohydrate
metabolism, in particular, those involved with digestion of lignocellulosic material
where presence of lignocellulose increases enzyme expression levels. This suggests
that redclaw has an innate genetic capacity to utilise complex polysaccharides
efficiently so and there is potential to include more plant‐derived ingredients (NSP)
into commercially formulated diets in order to reduce the cost of feed.
![Page 111: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/111.jpg)
93
4.5 Supplementarymaterial
Table S 4.1. List of selected digestive enzyme and other gene primers used for qRT‐
PCR validation in redclaw.
Gene PCR primer pair
Endoglucanase (EG) F: CCAGTCGTGGAGTGGGTACT
R: TTGGGTGTGACAGGGATCTCA
Alpha amylase (AA) F: CATGGAGTTCATCGACATGG
R: GGGAAGTCAAGTTGGTCAGC
Trypsin (TRP) F: TGAGGGAGGAAAGGACTCTTGC
R: CGTAACCCCAAGACACGATGC
Chitinase (CHIT) F: ACACAACCAAGGATGACCAGTGG
R: GGTCATGGCACCCAGTAGATGC
Hypocretin (HCRT) F: TGATGTCCTTGGTGATGTCATTG
R: AATCTAAAGAATGCTGGGTCGC
Digestive cysteine proteinase 1 (DGP1) F: TCTGGCCATGAACAAGTTTGC
R: TGACTTGGTAGACGGTGTGGG
Pseudohaemocyanin (PHC) F: GAAACCATTGTCAAGGTCTTCAACC
R: GCACTTGTTTCTGTTAATGGTGACG
Haemocyanin 2 (HC2) F: TGAACTTGCCGTGAGGATCACC
R: TGAATCTTCTGCATACAGCGCC
18S RNA (Internal control) F: CCTTCGCACGGTCAAAATACC
R: AGTCTGACCTGCCCATTGGG
![Page 112: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/112.jpg)
94
Table S 4.2. BLASTx results for selected candidate digestive enzyme genes from the RD transcriptome (first 10 results)
Endoglucanase
Description Max score
Total score
Query cover
E value Identity Accession
beta 1,4‐endoglucanase [Cherax quadricarinatus] 183 3404 70% 6.00E‐77 58% AAD38027.1
cellulase GHF9 [Cherax quadricarinatus] 183 3401 70% 7.00E‐77 58% AAO61672.2
endo‐b‐1,4‐glucanase [Perinereis brevicirris] 124 2002 62% 7.00E‐70 42% BAK20401.1
hypothetical protein [Paenibacillus massiliensis] 157 2391 57% 3.00E‐38 49% WP_018886155.1
GH9 family protein [Limnoria quadripunctata] 163 2281 59% 4.00E‐38 39% ADB85442.1
Chain A, The Structure Of Endoglucanase From Termite, Nasutitermes takasagoensis, At pH 2.5 >pdb|1KSC|A Chain A, The Structure Of Endoglucanase From Termite, Nasutitermes takasagoensis, At pH 5.6. >pdb|1KSD|A Chain A, The Structure Of Endoglucanase From Termite, Nasutitermes takasagoensis, At pH 6.5.
158 2584 67% 8.00E‐37 39% 1KS8_A
endo‐b‐1,4‐glucanase [Nasutitermes takasagoensis] >dbj|BAA76619.1| cellulase NtEG [Nasutitermes takasagoensis]
158 2585 67% 1.00E‐36 39% BAA33708.1
endoglucanase‐1,4‐beta‐glucanase [Daphnia pulex] 159 2374 70% 2.00E‐36 38% EFX69372.1
unnamed protein product [Oikopleura dioica] 158 2458 68% 4.00E‐36 39% CBY11538.1
unnamed protein product [Oikopleura dioica] 158 2459 68% 4.00E‐36 39% CBY41392.1
![Page 113: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/113.jpg)
95
Chitinase
Description Max score
Total score
Query cover
E value Identity Accession
chitinase [Pandalopsis japonica] 285 2585 82% 2.00E‐103 48% AFC60661.1
chitinase [Litopenaeus vannamei] 288 2642 79% 4.00E‐101 50% AAT80625.1
chitinase [Litopenaeus vannamei] 290 2637 83% 1.00E‐97 50% AAN74647.1
chitinase 3 precursor [Penaeus monodon] 289 2592 83% 2.00E‐97 50% ADG22163.1
chitinase precursor [Litopenaeus vannamei] 285 2679 86% 4.00E‐97 50% ABY70643.1
chitinase [Scylla serrata] 323 2722 85% 6.00E‐96 46% ABY85409.1
Pjchi‐3 [Marsupenaeus japonicus] 279 2640 84% 3.00E‐83 42% BAA22854.1
chitinase [Pandalopsis japonica] 285 2568 86% 1.00E‐81 41% AFC60660.1
chitinase [Fenneropenaeus chinensis] 287 2626 83% 1.00E‐80 43% AAY44300.1
chitinase [Pandalopsis japonica] 274 2555 77% 3.00E‐79 48% AFC60659.1
endo‐beta‐1,4‐mannanase
Description Max score
Total score
Query cover
E value Identity Accession
GH5 family protein GH5C [Limnoria quadripunctata] 122 177 71% 3.00E‐29 43% ADE58568.1
GH5 family protein GH5A [Limnoria quadripunctata] 121 181 60% 6.00E‐29 44% ADE58567.1
GH5 family protein GH5E [Limnoria quadripunctata] 106 167 60% 8.00E‐24 47% ADE58569.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 89.7 142 60% 6.00E‐18 35% EFX71597.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 75.9 130 60% 6.00E‐13 32% EFX71596.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 68.2 119 60% 3.00E‐10 33% EFX76384.1
beta‐1,4‐mannanase precursor [Cryptopygus antarcticus] 67.4 112 56% 5.00E‐10 37% ABV68808.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 66.6 115 60% 9.00E‐10 33% EFX76385.1
hypothetical protein DAPPUDRAFT_119876 [Daphnia pulex] 60.8 111 60% 1.00E‐08 30% EFX62773.1
beta‐1,4‐mannanase [Haliotis discus hannai] 62.4 113 53% 2.00E‐08 32% BAE78456.1
![Page 114: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/114.jpg)
96
Alpha amylase
Description Max score
Total score
Query cover
E value Identity Accession
alpha‐amylase [Litopenaeus vannamei] 227 4590 70% 8.00E‐60 51% CAB63937.1
preamylase 1 [Litopenaeus vannamei] 220 4705 72% 5.00E‐57 53% CAA54524.1
alpha‐amylase [Litopenaeus vannamei] 214 4622 72% 3.00E‐55 53% CAB65553.1
alpha‐amylase [Myxocyprinus asiaticus] 181 4001 72% 5.00E‐44 47% ABQ45553.1
Pancreatic alpha‐amylase [Columba livia] 179 3972 71% 4.00E‐43 48% EMC78994.1
alpha‐amylase [Helicoverpa armigera] >gb|ACB54942.1| amylase [Helicoverpa armigera]
178 3765 71% 4.00E‐43 47% ABU98614.1
PREDICTED: pancreatic alpha‐amylase‐like [Columba livia] 179 3977 71% 6.00E‐43 48% XP_005498835.1
salivary alpha‐amylase [Myodes glareolus] 177 4036 72% 1.00E‐42 47% ABB96226.1
PREDICTED: pancreatic alpha‐amylase [Otolemur garnettii] 176 3980 72% 3.00E‐42 48% XP_003784145.1
alpha‐amylase [Ephestia kuehniella] 175 4004 72% 7.00E‐42 65% ACL14798.1
Trypsin
Description Max score
Total score
Query cover
E value Ident Accession
trypsin 2 [Panulirus argus] 334 1439 70% 9.00E‐101 74% ADB66713.1
trypsin 4 [Panulirus argus] 333 1148 65% 3.00E‐100 66% ADB66715.1
trypsin 1a [Panulirus argus] 328 1381 70% 1.00E‐98 73% ADB66711.1
trypsin 1b [Panulirus argus] 326 1368 70% 8.00E‐98 72% ADB66712.1
trypsin 3 [Panulirus argus] 324 1378 69% 5.00E‐97 71% ADB66714.1
trypsin [Marsupenaeus japonicus] 316 1368 70% 4.00E‐94 70% ACE80257.1
trypsin [Litopenaeus vannamei] 315 1416 70% 7.00E‐94 70% CAA60129.1
trypsinogen 1 [Litopenaeus vannamei] 315 1422 70% 9.00E‐94 70% AEZ67461.1
trypsin [Litopenaeus vannamei] 313 1403 69% 2.00E‐93 70% CAA75311.1
trypsinogen 2 [Litopenaeus vannamei] 311 1395 70% 2.00E‐92 68% AEZ68613.1
![Page 115: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/115.jpg)
97
Table S 4.3. BLASTx results for selected candidate digestive enzyme genes from the TD transcriptome (first 10 results)
Endoglucanase
Description Max score
Total score
Query cover
E value Identity Accession
PREDICTED: endoglucanase E‐4, partial [Ciona intestinalis] 96.7 3786 69% 9.00E‐59 62% XP_002122707.1
unnamed protein product [Oikopleura dioica] 95.9 3756 70% 2.00E‐52 58% CBY23167.1
putative endo‐beta‐1,4‐glucanase NtEG2 [Nasutitermes takasagoensis] 122 3598 61% 2.00E‐51 56% BAD12011.1
beta‐1,4‐endoglucanase [Eisenia andrei] 90.1 3847 72% 2.00E‐51 58% ACE75511.1
endoglucanase [Macrotermes barneyi] 139 4544 75% 1.00E‐50 48% AFD33365.1
cellulase [Coptotermes acinaciformis] 143 4624 74% 8.00E‐50 49% AAK12339.1
PREDICTED: endo‐beta‐1,4‐glucanase‐like [Saccoglossus kowalevskii] 100 3732 72% 1.00E‐49 46% XP_002739247.1
PREDICTED: cellulase‐like, partial [Saccoglossus kowalevskii] 140 5373 72% 1.00E‐49 31% XP_002742454.1
PREDICTED: predicted protein‐like [Saccoglossus kowalevskii] 100 3781 64% 1.00E‐49 40% XP_002739249.1
endo‐beta‐1,4‐glucanase [Coptotermes formosanus] 142 4703 73% 2.00E‐49 46% ADB12483.1
Chitinase
Description Max score
Total score
Query cover
E value Identity Accession
chitinase precursor [Litopenaeus vannamei] 229 1021 78% 3.00E‐61 38% ABY70643.1
chitinase [Pandalopsis japonica] 226 997 79% 4.00E‐60 36% AFC60660.1
chitinase [Litopenaeus vannamei] 223 1059 77% 2.00E‐59 38% AAN74647.1
chitinase [Fenneropenaeus chinensis] 222 1099 77% 5.00E‐59 37% AAY44300.1
chitinase 3 precursor [Penaeus monodon] 222 1048 78% 6.00E‐59 38% ADG22163.1
chitinase [Scylla serrata] 219 1000 72% 6.00E‐58 39% ABY85409.1
Pjchi‐3 [Marsupenaeus japonicus] 217 1027 77% 3.00E‐57 37% BAA22854.1
chitinase [Pandalopsis japonica] 213 1036 76% 6.00E‐57 38% AFC60659.1
chitinase 2, partial [Procambarus clarkii] 196 672 40% 2.00E‐53 51% AFZ78450.1
chitinase [Pandalopsis japonica] 206 979 75% 3.00E‐53 34% AFC60661.1
![Page 116: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/116.jpg)
98
endo‐beta‐1,4‐mannanase
Description Max score
Total score
Query cover
E value Identity Accession
GH5 family protein GH5A [Limnoria quadripunctata] 174 1676 69% 5.00E‐97 70% ADE58567.1
GH5 family protein GH5C [Limnoria quadripunctata] 154 1522 68% 2.00E‐85 59% ADE58568.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 135 1292 66% 4.00E‐74 58% EFX71596.1
GH5 family protein GH5E [Limnoria quadripunctata] 159 1662 72% 3.00E‐67 63% ADE58569.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 115 1091 56% 6.00E‐66 54% EFX71598.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 141 1295 68% 2.00E‐62 53% EFX71597.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 115 1116 67% 4.00E‐62 44% EFX76384.1
endo‐beta‐1,4‐mannanase [Daphnia pulex] 111 1096 67% 2.00E‐61 43% EFX76385.1
beta‐1,4‐mannanase [Aplysia kurodai] 107 1014 63% 5.00E‐46 51% BAJ60954.1
beta‐1,4‐mannanase [Haliotis discus hannai] 96.7 980 59% 6.00E‐44 48% BAE78456.1
Alpha amylase
Description Max score
Total score
Query cover
E value Identity Accession
hypothetical protein DAPPUDRAFT_64687 [Daphnia pulex] 214 2009 78% 3.00E‐155 66% EFX66437.1
Alpha‐amylase 1 [Camponotus floridanus] 188 1309 61% 1.00E‐124 50% EFN63696.1
Alpha‐amylase 1 [Camponotus floridanus] 190 2243 62% 4.00E‐121 50% EFN63697.1
hypothetical protein SINV_13988 [Solenopsis invicta] 164 1126 60% 3.00E‐114 43% EFZ16139.1
PREDICTED: pancreatic alpha‐amylase‐like [Strongylocentrotus purpuratus] 147 1746 74% 5.00E‐113 49% XP_782094.2
hypothetical protein DAPPUDRAFT_68162 [Daphnia pulex] 204 1004 40% 7.00E‐111 68% EFX62183.1
hypothetical protein CAPTEDRAFT_181675 [Capitella teleta] 175 1543 77% 9.00E‐106 50% ELT92052.1
alpha‐amylase [Crassostrea gigas] 160 1572 65% 1.00E‐99 53% AEA72216.1
alpha‐amylase 2 [Culex quinquefasciatus] >gb|EDS43922.1| alpha‐amylase 2 [Culex quinquefasciatus]
162 1197 58% 6.00E‐99 43% XP_001846546.1
Alpha‐amylase [Crassostrea gigas] 184 1880 78% 1.00E‐93 62% EKC28393.1
![Page 117: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/117.jpg)
99
Trypsin
Description Max score
Total score
Query cover
E value Identity Accession
PREDICTED: serine protease 27‐like [Alligator mississippiensis] 68.6 543 43% 4.00E‐19 38% XP_006274754.1
PREDICTED: trypsin‐1‐like [Ceratitis capitata] 60.1 429 43% 5.00E‐17 37% XP_004517876.1
female reproductive tract protease mayaguana‐2 [Drosophila mayaguana] 72.8 449 42% 7.00E‐17 41% ACR61324.1
PREDICTED: coagulation factor XI [Sarcophilus harrisii] 80.1 452 39% 7.00E‐17 45% XP_003773049.1
trypsin‐1 [Culex quinquefasciatus] >gb|EDS28651.1| trypsin‐1 [Culex quinquefasciatus] 70.9 478 43% 2.00E‐16 37% XP_001848608.1
trypsin 5G1 [Culex quinquefasciatus] >ref|XP_001847362.1| trypsin 5G1 [Culexquinquefasciatus] >gb|EDS26053.1| trypsin 5G1 [Culex quinquefasciatus]
74.3 452 40% 2.00E‐16 37% XP_001847361.1
trypsin [Acartia pacifica] 91.3 547 39% 2.00E‐16 46% AGN29625.1
GH13258 [Drosophila grimshawi] >gb|EDV99046.1| GH13258 [Drosophila grimshawi] 68.2 483 42% 2.00E‐16 37% XP_001993121.1
trypsin [Scylla paramamosain] 86.7 615 38% 4.00E‐16 51% ADB55592.1
trypsin [Anopheles gambiae] 81.3 453 42% 4.00E‐16 42% CAA80517.1
![Page 118: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/118.jpg)
100
Table S 4.4. KEGG pathways of redclaw hepatopancreatic genes (Pathways that only
100 or more sequences are involved, are shown).
RD
Pathway Seqs in Pathway
Purine metabolism 544
Pyrimidine metabolism 184
Pyruvate metabolism 177
Citrate cycle (TCA cycle) 173
Carbon fixation pathways in prokaryotes 153
Aminoacyl‐tRNA biosynthesis 139
Glycolysis / Gluconeogenesis 136
Valine, leucine and isoleucine degradation 132
Glycine, serine and threonine metabolism 132
Thiamine metabolism 127
Phosphatidylinositol signaling system 126
Oxidative phosphorylation 120
Propanoate metabolism 115
Amino sugar and nucleotide sugar metabolism 106
Glyoxylate and dicarboxylate metabolism 102
T cell receptor signaling pathway 101
TD
Pathway Seqs in Pathway
Purine metabolism 656
Citrate cycle (TCA cycle) 223
Aminoacyl‐tRNA biosynthesis 195
Carbon fixation pathways in prokaryotes 192
Pyrimidine metabolism 188
Phosphatidylinositol signaling system 154
Starch and sucrose metabolism 149
Pyruvate metabolism 145
Amino sugar and nucleotide sugar metabolism 136
Propanoate metabolism 134
Oxidative phosphorylation 133
Valine, leucine and isoleucine degradation 133
Glycolysis / Gluconeogenesis 131
Lysine degradation 126
Thiamine metabolism 112
T cell receptor signaling pathway 110
Inositol phosphate metabolism 109
Glycine, serine and threonine metabolism 105
Glyoxylate and dicarboxylate metabolism 105
![Page 119: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/119.jpg)
101
Figure S 4.1. Relative concentrations of selected digestive enzyme and other genes in reference (RD) and treated (TD) samples evaluated by relative quantitative real‐time PCR (for gene names, see Table S 4.1)
![Page 120: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/120.jpg)
102
CHAPTER5: Generaldiscussionandconclusions
While freshwater crustacean production remains of significant and growing
worldwide interest, freshwater crustacean farming to date is restricted to only a few
freshwater prawn species, Chinese mitten crab and some crayfish species (FAO
2012). Despite high diversity of taxa in the world, commercial production of
freshwater crayfish is currently limited to approximately only 10 species and
approximately 35% of the world’s total freshwater crayfish production comes from
just two crayfish species; red swamp crayfish, Procambarus clarkii and white river
crayfish, P. zonangulatus that have faced significant disease issues at times in culture
(Ackefors 2000). This has encouraged diversification of freshwater crayfish
aquaculture where new suitable candidate species are being trialled in commercial
culture in various locations.
While three Cherax species have been shown to have aquaculture potential and
currently are being cultured commercially in Australia and elsewhere (in the case of
redclaw), lack of specific knowledge about each species nutritional requirements and
digestive enzyme activity has become a significant limitation on development of
specis‐specific formulated diet and thereby growth of the culture industry. Feed
formulations and feeding practices that are not optimised to a particular species’
specific nutritional requirements can affect the industry negatively in two ways; it
can increase the cost of production and also compromise optimum growth of each
farmed species and hence their relative productivity in culture. This has direct
impacts on economic viability of the industry and can impair development. It is
therefore, essential to understand not only each individual species’ digestive enzyme
characteristics related to diet but also the underlying genetic factors that allow
farmers to fully exploit the digestive capacity of specific freshwater crayfish species
so that specific formulated diets that provide adequate nutrition to support their
optimum growth can be developed. Development of diets well‐matched to each
target species can reduce production costs and improve industry efficiency. Hence,
the key aims of the current study were to evaluate the ability of the three Cherax
species farmed in Australia to utilise plant‐based feed ingredients (soluble cellulose)
![Page 121: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/121.jpg)
103
in their diets and to investigate associated digestive enzyme gene expression
patterns in redclaw exposed to two different carbohydrate sources that possess
different structural complexities (one that incorporated soluble cellulose).
Recent findings on endogenous cellulase activities and recognition of molecular
evidence for a corresponding gene(s) (Byrne et al. 1999; Xue et al. 1999; Figueiredo
et al. 2001; Crawford et al. 2005) provide evidence that freshwater crayfish often
ingest and utilise structural plant polysaccharides in their natural diets in the wild.
Dietary composition potentially affects the active digestive enzyme profile expressed
as well as their relative secretion levels in freshwater crayfish (Pavasovic et al.
2007b). Controlling expression and secretion of particular enzymes could be an
evolutionary response to reduce energy expenditure until specific dietary
components are detected by crayfish. When specific dietary components are
detected, they may stimulate enzyme production and increase secretion levels of
relevant digestive enzymes to match dietary levels leading to allow efficient
hydrolysis of the substrate. Essentially, this means that in crayfish, digestive
enzymes may be expressed in a constitutive manner in response to detection of
specific dietary components in ingested food. Considering the natural feeding habit
and detection of endogenous cellulase activity in freshwater crayfish, there have
been few attempts to date to evaluate plant fibre (mainly cellulose) as a potential
feed ingredient in their diets. While Pavasovic et al. (2006) indicated that there are
no nutritive benefits to be gained by inclusion of insoluble cellulose (α‐cellulose) in
redclaw diets because this can produce a significant reduction in growth
performance and feeding efficiencies, in contrast, here (Chapter 2), higher levels
(although not significant) of cellulase activity were observed in redclaw fed soluble
cellulose, compared with starch. This suggests that soluble cellulose can be
hydrolysed by redclaw cellulases efficiently and therefore is a potential energy
source for them. This finding was confirmed by results from molecular studies
(Chapters 3 and 4) where endo‐β‐glucanase provided the highest number of contigs
for any enzyme and similar numbers of contigs were expressed in animals fed either
starch or soluble cellulose.
![Page 122: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/122.jpg)
104
While significantly lower enzyme activities were observed for all digestive enzymes
tested in yabby and marron compared with redclaw fed identical diets, of interest,
their specific growth rates were not significantly different between the two
treatments. Given that all three Cherax species responded in similar ways to the two
carbohydrate sources in their diets, this suggests that soluble cellulose could be
included in diets for yabby or marron without having any significant negative impact
on their relative growth performance and hence could potentially be an efficient
energy source for them as well. Differences in relative enzyme activity levels and
relative growth rates observed among the three species however, suggest that they
do show different abilities to digest and utilise various carbohydrate sources,
differences that may relate to their adaptation in nature to different habitat
conditions and food sources in different climatic and geographical locations across
Australia.
The physical process of cellulose digestion in invertebrates has been explained based
on a traditional model developed for fungal cellulase systems (Allardyce et al. 2010).
According to this model, there are three enzyme classes (endo‐β‐1, 4‐glucanases ‐ EC
3.2.1.4, exoglucanases, including both cellobiohydrolases ‐ EC 3.2.1.91 and
sometimes glucohydrolases ‐ EC 3.2.1.74 and β‐glucosidases ‐ EC 3.2.1.21) that are
involved in cellulose digestion and presence and synergistic activity of all three
classes of enzyme are needed for complete hydrolysis of cellulose to simple sugars
(Lynd et al. 2002; Watanabe & Tokuda 2010). Of the three enzyme classes, endo‐β‐1,
4‐glucanases and β‐glucosidases play key roles in the cellulose hydrolysis process.
Endo‐β‐1, 4‐glucanases have been identified in a wide range of crustacean species
including freshwater crayfish and β‐glucosidase activity has also been recorded
recently in a small number of crustaceans, notably Land crab, Gecarcoidea natalis
(Allardyce et al. 2010), but to date not in freshwater crayfish. While redclaw
hepatopancreatic transcriptomes analysed in this study did not consist genes
expressed and that represent cellobiohydrolases or β‐glucosidases, Pavasovic et al.
(2006) reported that redclaw can liberate glucose from carboxymethyl cellulose (a
derivative of soluble cellulose). One suggestion is that secretion of high
concentrations of multiple forms of endo‐β‐1, 4‐glucanases in redclaw could
![Page 123: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/123.jpg)
105
overcome low activity levels, or even absence of other classes of cellulase and allow
complete cellulose digestion (Scrivener & Slaytor 1994). Future molecular and
biochemical studies will be necessary to understand and to characterise, the
complete cellulose process digestion in redclaw. Moreover, similar studies will be
required to determine if the same enzyme classes are present in the other two
Cherax species tested here in order to understand and compare the cellulose
digestion process across species. This future work would identify the unique aspects
cellulose digestion among Cherax species and allow potential ingredients well‐
matched to specific digestion enzyme profiles in each species to be identified and
trialled in experimental formulated feeds.
Non starch polysaccharides (NSP; e. g. cellulose, hemicellulose) have sometimes
been considered to be anti‐nutritional factors that are present in plant derived
ingredients. Inclusion of these NSPs in formulated feeds can limit effectiveness of
aquafeeds by affecting ingredient digestibility (Francis et al. 2001). Soluble NSP
potentially increases the viscosity of the intestinal digesta potentially inhibiting
normal digestive enzyme activity (Pavasovic et al. 2006; Crawford et al. 2005). In
general, the very low enzyme activities observed here in all three species (except for
cellulase activity in redclaw) may potentially have been affected by this process. In
redclaw in particular, however, a significant differences in gene expression levels
were not detected for alpha amylase, trypsin or any other protease between diets
with the two carbohydrate sources. This suggests that at least redclaw does have the
innate capacity to secrete similar levels of digestive enzymes (other than endo‐β‐
glucanase) in the presence of soluble cellulose compared with starch. Thus,
potentially chemical/physical or biotechnological technologies may be used to
increase overall digestibility of NSP (Marsman et al. 1997; Drew et al. 2007; de Vries
et al. 2012) and so possibly eliminate or reduce any anti‐nutritional effects so that
digestive enzymes have free access to NSP’s in diets and make them digestible to
freshwater crayfish. Future research therefore, should target ways to improve
digestibility of certain structural polysaccharides in freshwater crayfish and then
evaluate treated ingredients for their relative digestibility, enzyme expression
profiles and impacts on relative growth performance.
![Page 124: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/124.jpg)
106
While traditional growth and feeding trials provide important information about a
target species’ specific nutritional requirements that can be related to their
individual digestive physiology, a molecular approach to identify digestive enzyme
gene expression patterns used in parallel with traditional standardised dose‐
response growth trials can provide “hidden” information about the innate capacity
of an animal’s digestive capacity. To date however, there has been only limited
examination of the specific molecular basis for feed utilisation conducted on
freshwater crayfish taxa. At the same time, recent advances in next generation
sequencing (NGS) have contributed to a situation where genomic data can be
developed readily and rapidly for most species (Zend & Extavour 2012) and analysis
of expressed sequence tags (ESTs) provides a comprehensive method for discovery
of novel, uniquely expressed genes. Despite this, few studies of freshwater crayfish
have investigated the transcript level, or examined expression patterns of specific
digestive enzyme genes. It is therefore, considered that, transcriptome analysis of
the hepatopancreas and other digestive tissues will, in the future allow a much more
detailed understanding of the entire spectrum of expressed digestive enzymes in
farmed freshwater crayfish species to be developed.
A key finding in the current study, was the first report of the presence and
expression of an endo‐β‐mannanase gene in a freshwater crayfish. Importantly, this
novel gene showed significant similarity and a close molecular relationship with the
same enzyme class (GHF5) identified earlier in a marine isopod (Limnorrid).
Limnorrids are believed to have digestive tracts free from resident symbiotic
microbes (Boyle & Mitchell 1978; Daniel et al. 1991). The close molecular
relationship between the genes suggests that redclaw like Limnorrids may be
capable of producing and secreting endo‐β‐mannanase endogenously. If confirmed,
this suggests that redclaw and potentially other freshwater crayfish taxa may
produce most (if not all) of the digestive enzymes endogenously that can hydrolyse
structural polysaccharides present in secondary plant cell wall in addition to cellulose
and mannan. Xue (1999) and Crawford et al. (2005) for example, had previously
reported xylanase activity in the redclaw hepatopancreas but in the current study a
single EST that encoded a xylanase enzyme could not be found in the redclaw
![Page 125: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/125.jpg)
107
transcriptome. Crawford et al. (2005) suggested that xylanase activity in crustaceans
may have been derived from a distinct enzyme class rather than resulting from the
broad specificity action of redclaw endoglucanases. Their evidence included multiple
pH peaks for xylanase activity in both studies indicating presence of several xylanase
iso‐enzymes (Xue et al. 1999; Crawford et al. 2005). In a recent study conducted by
King et al. (2010) their transcriptome from the Limnoriid digestive tract was
dominated by glycosyl hydrolase (GH) genes and putative cellulase and
cellobiohydrolase genes were also highly represented, endoxylanase (endo β‐1, 4
xylanse) however, was not detected although it has been detected in a few animal
species (e.g. Ampullaria crossean ‐ AY941794.1, Corbicula japonica ‐ AB490291.1). In
prokaryotes, both endo‐β‐mannanase and endo‐β‐xylanase belong to the same GH5
family protein class and so King et al. (2010) suggested that Limnoriid GH5 family
proteins (enzymes) may target either or both substrates. In a previous study, it was
shown that some crustacean (e.g. Euphausia superba ‐ Antarctic Krill) endoxylanases
are inactive on certain cellulose substrates (Turkiewicz et al. 2000) and
endoglucanase from the same species could not hydrolyse xylan substrates (Chen &
Chen 1983). Crawford et al. (2005) suggested therefore, that xylanase activity in
crustaceans may be derived from a distinct enzyme class rather than broad specifity
endoglucanases. Results obtained for Limnoriids and observations by King et al.
(2010) support this argument and could also explain why redclaw show xylanase
activity apparently without possessing a corresponding gene for xylanase while
having an endo‐β‐mannanase in the same GH family. Therefore, a key aim of future
redclaw digestive enzyme gene expression studies would be to search specifically for
molecular evidence for presence, and expression of an endogenous xylanase gene(s)
in this organism. Future work will also be required to characterise the complete gene
sequence of the redclaw endo‐β‐mannanase and to characterise the protein it
encodes to determine its properties and dietary targets.
Differences we observed in expression patterns in redclaw fed the two different
carbohydrate sources provide compelling molecular support for results reported in
some earlier studies. Pavasovic et al. (2007b) suggested that diet components can
influence freshwater crayfish digestive enzyme profiles and expression patterns.
![Page 126: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/126.jpg)
108
Here, we showed that soluble cellulose apparently affected expression of not only
digestive enzyme genes but also that of other genes present in the hepatopancreas.
Specifically, expression of genes that encode enzymes involved in carbohydrate
metabolism (except for alpha amylase) were upregulated, in particular enzymes that
hydrolyse structural polysaccharides (e.g. endo‐β‐glucanase, endo‐β‐mannanase and
chitinase). This finding should encourage future redclaw nutrition studies to be
expanded to trial specific, targeted low‐cost plant derived ingredients in redclaw
experimental diets to identify the best options for the industry.
Ingredient digestibility tests are an important component of most growth and
feeding trials as an ingredient must be digested efficiently by an animal in order to
provide energy (Stone 2003). In our first study (Chapter 2) however, the
requirements of the trial did not allow a digestibility test for soluble cellulose
because we could not obtain sufficient faecal material from single animals used in
the trial. Future digestibility studies may provide possible reasons why redclaw fed
soluble cellulose showed significantly lower specific growth rates even when their
cellulase activity levels were apparently not significantly lower compared with
animals fed starch in their diets. i.e. growth was not restricted apparently by
secretion of lower levels of the relevant digestive enzyme but by some other
factor(s). This study could also explain why yabby and marron in general, showed
significantly lower enzyme activities compared with redclaw while their relative
growth rates were not significantly different between the two diets.
Inclusion level of a specific dietary ingredient in a compound diet will be determined
by a number of factors viz; the type, cost and quality of an ingredient, species and
requirement of the species etc. The recommended dietary inclusion levels for
carbohydrates in aquafeeds is up to 20 % for carnivorous species while it can be up
to 40 % for omnivorous species (Stone 2003). Here, a 20 % inclusion level of test
carbohydrate ingredients, soluble cellulose was tested but it is suggested that future
growth and enzyme activity studies should trial lower inclusion levels as specific
growth rate of redclaw and digestive enzyme activity levels in the other two Cherax
species fed soluble cellulose appeared to be affected adversely. It will be, important
therefore, to investigate lower inclusion levels linked to appropriate digestibility
![Page 127: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/127.jpg)
109
tests to determine if the species show the same patterns or better growth
performances when levels of inclusion are reduced. Profile of redclaw
hepatopancreatic transcriptome and investigation of digestive enzymes expressed in
the hepatopancreas however, have provided explanations for some of the growth
performance results observed in redclaw in the first study (Chapter 2). An important
future step will be to perform therefore, similar comparative molecular
transcriptomic studies on the other two Cherax species in order to characterise their
specific digestive enzyme gene expression patterns that can then be used to
interpret results obtained in the growth trial. This approach could also identify
unique genes (allelic forms of genes) that are directly related to each species specific
adaptations to different natural habitats and diets, including types and availability of
natural food types. Future studies could then compare digestive physiology and
innate differences among the three Cherax species. Moreover, the same type of
molecular studies conducted on animals of varying age would help to identify gene
expression patterns specific to growth stage of the species and thereby identify
specific nutritional requirements particular to age groups because different aged
crayfish have different nutritional requirements and so may require different diets
for their optimum growth (Figueiredo & Anderson 2003).
The molecular studies here are the first to investigate and characterise candidate
genes in the freshwater crayfish hepatopancreas in particular, in relation to digestive
metabolism. Data produced here can serve as a basis for future nutritional studies in
freshwater crayfish including other Cherax species. In addition to the selected
candidate digestive enzyme genes targeted in the third study (Chapter 4) for
expression analysis, other transcripts present in the redclaw hepatopancreas provide
a very good resource in particular, from animals fed soluble cellulose. Further
analysis of these transcripts will allow us potentially to identify and characterise
more candidate genes involved in different biological pathways in redclaw. Specially,
characteristics of differentially expressed sequences and characterisation of their
individual roles in metabolism could help to identify key genes affecting production
traits including growth enhancement, disease resistance etc. that are influenced epi‐
genetically by inclusion of plant components in crayfish diets.
![Page 128: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/128.jpg)
110
With the increasing price and limited availability of fish meal much attention is
focussed at present on incorporation of low‐cost plant‐based protein sources into
formulated animal feeds. In addition, due to the increasing pressure on grain
markets (e.g. use of cereal grains for flour milling and ethanol production), there is
trend to use a number of plant by‐products resulting from other industrial
operations for example, distillers dried grains with solubles (DDGS) in formulated
diets for non‐ruminant terrestrial animal species (Zijlstra et al. 2010) and some
aquaculture species (Roy et al. 2009; Gatlin et al. 2007). Most of these plant by‐
products are lower in starch and higher in crude protein and fibre (Shurson et al.
2005) characteristics that can reduce nutrient digestibility and affect growth rate due
to high content of NSP such as cellulose and arabinoxylan. Inclusion of exogenous
enzymes, for example endoglucanase and endoxylanase enzymes that hydrolyse the
b‐1, 4‐bonds in cellulose and xylan polymers as feed additives in plant‐based diets
potentially could greatly improve feed utilisation in terrestrial animals (Bedford
1995; Bedford 2000; Crawford et al. 2005). Further work to fully understand the
cellulose digestion process in decapod crustaceans and activities of enzymes
involved may expand knowledge and potentially allow commercial use of some
enzymes in plant based aquafeeds for more carnivorous crustaceans that have no or
reduced activities of carbohydrase enzymes in particular, enzymes that hydrolyse
structural polysaccharides. Crustacean enzyme additives may work more efficiently
in the digestive systems of other crustacean species than the enzymes extracted
from microorganisms and so could enhance the digestion efficiency.
Another potential application for crustacean carbohydrases may be their use in bio‐
fuel production. This will require transgenic yeasts to be constructed with inserted
crustacean carbohydrase DNA sequences that express genes capable of converting
carbohydrate substrates to ethanol. Since both crayfish and yeasts are eukaryotes,
gene transfer and successful expression of crustacean carbohydrases (in yeasts) may
be less problematic than producing transgenic yeasts containing microbial
carbohydrase genes.
The general findings from the current study have significantly contributed to, and
expanded on, the current body of knowledge about freshwater crayfish nutrition, in
![Page 129: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/129.jpg)
111
particular, farmed parastacid species. Results obtained here have confirmed
previous findings of endoglucanase activity and broad carbohydrase enzyme
substrate specificity in parastacid crayfish (e.g Xue et al. 1998; Figueiredo, et al.
2001; Crawford et al. 2005). In addition, activity of endo‐β‐mannanase, another key
enzyme involved in plant cell wall digestion has been detected in redclaw. Evidence
for endogenous production of this enzyme would confirm redclaw’s apparent ability
to hydrolyse complex structural polysaccharides to glucose molecules and to use
them as energy sources. In an independent recent study (Nugroho & Fotedar 2014)
showed higher specific growth and survival rates in marron fed mannan
oligosaccharides. This indicates that a parastacid at least among freshwater crayfish
can degrade lignocellulosic plant material and other complex polysaccharides to
glucose molecules directly without requirement for microbial or physical
contribution to the degradation process.
While currently yabbies (C. destructor) contribute the highest share of Australian
national crayfish production (Wingfield 2008), production practices for this species
are still very primitive and are limited to extensive culture in farm dams that are
harvested opportunistically. This is mainly to keep the cost associated with
production very low and farmed yabbies are provided only periodically with cheap
commercial pellets as a supplementary feed, if at all, hence underfeeding is a major
and widespread problem for yabby culture (Lawrence & Jones 2002). Knowing the
ability of freshwater crayfish to utilise plant material effectively in their diet, a result
confirmed in the present study, may encourage farmers to trial some suitable high‐
protein plant material in addition to Lupins that are currently widely used in the
industry as a supplementary feed, to address the underfeeding issue. Availability of
low‐cost formulated feed can address this underfeeding problem in the future. It can
also help to shift farmers away from using expensive shrimp feeds as supplementary
feeds and focus their attention on matching diets to each species innate nutrient
requirements.
Results obtained here can move current freshwater crayfish nutrition research
forward in the direction of development and use of low‐cost fibre in diets.
Importantly, various forms of soluble cellulose could provide potentially low‐cost
![Page 130: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/130.jpg)
112
ingredients targeted for trial in low‐cost formulated feeds. Ability of Cherax species
to hydrolyse dietary fibre efficiently will be evidenced by confirmation of
endogenous production of endo‐β‐mannase enzymes in this group. Future
formulated diets for parastacid crayfish potentially caneliminate expensive animal
based protein sources and be formulated effectively only with plant‐based
substitutes. As the culture industry is moving from extensive to semi‐intensive
culture systems with ongoing increase in demand, specific supplementary feeds for
crayfish will become essential to maintain and increase productivity. Results
reported here can be used to formulate specific formulated diets that incorporate
complex plant polysaccharides and replace expensive animal derived ingredients
including fish meal. Potentially, “low‐cost” diets can balance high costs associated
with increased intensity of production while maintaining productivity. Nutrition
studies of parastacid crayfish have and potentially will continue to contribute to
transforming culture industries for native freshwater crayfish in Australia from
essentially “hobby” farming to a high throughput, intensive agribusiness.
![Page 131: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/131.jpg)
113
Reference
Ackefors, H. E. G. (2000) Freshwater crayfish farming technology in the 1990s: a
European and global perspective. Fish and Fisheries 1 (4): 337‐359.
Ackefors, H., Castell, J. D., Boston, L. D., Räty, P. & Svensson, M. (1992) Standard
experimental diets for crustacean nutrition research. II. Growth and survival of
juvenile crayfish Astacus astacus (Linné) fed diets containing various amounts of
protein, carbohydrate and lipid. Aquaculture 104 (3‐4): 341‐356.
Ali, S. A. (1993) Evaluation of different carbohydrates in the diet of the prawn
Penaeus indicus. Journal of Aquaculture in the Tropics 8: 13‐23.
Ali, S. A. (1996) Carbohydrate nutrition under different dietary conditions in prawn
Penaeus indicus. Journal of Aquaculture in the Tropics 11: 13‐25.
Allardyce, B. J., Linton, S. M. & Saborowski R. (2010) The last piece in the cellulase
puzzle: the characterisation of β‐glucosidase from the herbivorous gecarcinid land
crab Gecarcoidea natalis. The Journal of experimental biology 213: 2950‐2957.
Allardyce, B. J. & Linton, S. M. (2008) Purification and characterisation of endo‐β‐1,4‐
glucanase and laminarinase enzymes from the gecarcinid land crab Gecarcoidea
natalis and the aquatic crayfish Cherax destructor. Journal of Experimental Biology
211 (14): 2275‐2287.
Austin C. M., Jones P. L., Stagnitti F. & Mitchell B. D. (1997) Response of the yabby,
Cherax destructor Clark, to natural and artificial diets: Phenotypic variation in
juvenile growth. Aquaculture 149: 39‐46.
Austin, C. M. (1995) Effect of temperature and salinity on the survival and growth of
juvenile redclaw (Cherax quadricarinatus). Freshwater Crayfish 10: 419‐426.
Bai, Z., Yin, Y., Hu, S., Wang, G., Zhang, X. & Li, J. (2009) Identification of Genes
Involved in Immune Response, Microsatellite, and SNP Markers from Expressed
Sequence Tags Generated from Hemocytes of Freshwater Pearl Mussel (Hyriopsis
cumingii). Marine Biotechnology 11 (4): 520‐530.
![Page 132: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/132.jpg)
114
Beatty, S. J. (2006) The diet and trophic positions of translocated, sympatric
populations of Cherax destructor and Cherax cainii in the Hutt River, Western
Australia: evidence of resource overlap. Marine and Freshwater Research 57: 825‐
835.
Bedford, M. R. (1995). Mechanism of action and potential environmental benefits
from the use of feed enzymes. Animal Feed Science and Technology 53 (2): 145‐155.
Bedford, M. R. (2000) Exogenous enzymes in monogastric nutrition ‐ their current
value and future benefits. Animal Feed Science and Technology 86 (1‐2): 1‐13.
Beguin, P. & Aubert, J. P. (1994) The biological degradation of cellulose. Fems
Microbiology Reviews 13 (1): 25‐58.
Bell, J. G. & Waagbø, R. (2008) Safe and Nutritious Aquaculture Produce: Benefits
and Risks of Alternative Sustainable Aquafeeds. In: Aquaculture in the Ecosystem,
(Holmer, M., Black, K., Duarte, C. M., Marbà N. & Karakassis, I. eds.), pp. 185‐225:
Springer, Netherlands.
Black, D. L. (2003) Mechanisms of alternative pre‐messenger RNA splicing. Annual
Review of Biochemistry 72 (1): 291‐336.
Bostock, J., McAndrew, B., Richards, R., Jauncey, K., Telfer, T., Lorenzen, K., Little, D.
et al. (2010) Aquaculture: global status and trends. Philosophical Transactions of the
Royal Society B‐Biological Sciences 365 (1554): 2897‐2912.
Boyle, P. J. & Mitchell, R. (1978) Absence of microorganisms in crustacean digestive
tracts. Science 200 (4346): 1157‐9.
Brown, P. B. (1995a) A review of nutritional research with crayfish. Journal of
Shellfish Research 14 (2): 561‐568.
Brown, P. B. (1995b) Physiological Adaptations in the Gastrointestinal Tract of
Crayfish. American Zoologist 35 (1): 20‐27.
![Page 133: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/133.jpg)
115
Byrne, K. A., Lehnert, S. A., Johnson, S. E. & Moore, S. S. (1999) Isolation of a cDNA
encoding a putative cellulase in the red claw crayfish Cherax quadricarinatus. Gene
239 (2): 317‐324.
Campana‐Torres, A., Martinez‐Cordova, L. R., Villarreal‐Colmenares, H. & Civera‐
Cerecedo, R. (2006) Carbohydrate and lipid digestibility of animal and vegetal
ingredients and diets for juvenile Australian redclaw crayfish, Cherax
quadricarinatus. Aquaculture Nutrition 12: 103‐109.
Campana‐Torres, A., Martinez‐Cordova, L. R., Villarreal‐Colmenares, H. & Civera‐
Cerecedo R. (2008) Carbohydrate and lipid digestibility of animal and vegetal
ingredients and diets for the pre‐adult redclaw crayfish, Cherax quadricarinatus (von
Martens). Aquaculture Research 39: 1115‐1121.
Campana‐Torres, A., Martinez‐Cordova, L. R., Villarreal‐Colmenares, H. & Civera‐
Cerecedo, R. (2005) In vivo dry matter and protein digestibility of three plant‐derived
and four animal‐derived feedstuffs and diets for juvenile Australian redclaw, Cherax
quadricarinatus. Aquaculture 250 (3‐4): 748‐754.
Ceccaldi, H. J. (1997) Anatomy and physiology of the digestive system. In: Crustacean
Nutrition (D’Abramo, L. R., Conklin, D. E. & Akiyama, D. M. eds.), Vol. 6, pp. 261–291.
Advances in World Aquaculture, World Aquaculture Society, Baton Rouge, LA.
Ceccaldi, H. J. (1998) A synopsis of the morphology and physiology of the digestive
system of some crustacean species studied in France. Reviews in Fisheries Science 6
(1): 13 ‐ 39.
Chen, C. S. & Chen, H. Y. (1983) Purification and properties of carboxymethyl
cellulase from Antarctic krill Euphausia superba. Journal of the Chinese Biochemical
Society 12: 61‐70.
Cho, C. Y. & Bureau, D. P. (2001) A review of diet formulation strategies and feeding
systems to reduce excretory and feed wastes in aquaculture. Aquaculture Research
32: 349‐360.
![Page 134: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/134.jpg)
116
Conesa, A., Götz, S., García‐Gómez, J. M., Terol, J., Talón, M. & Robles, M. (2005)
Blast2GO: a universal tool for annotation, visualization and analysis in functional
genomics research. Bioinformatics 21 (18): 3674‐3676.
Cortés‐Jacinto, E., Villarreal‐Colmenares, H., Civera‐Cerecedo, R. & Martínez‐
Córdova, R. (2003) Effect of dietary protein level on growth and survival of juvenile
freshwater crayfish Cherax quadricarinatus (Decapoda: Parastacidae). Aquaculture
Nutrition 9: 207‐213.
Cortés‐Jacinto, E., Villarreal‐Colmenares, H., Civera‐Cerecedo, R. & Naranjo‐páramo,
J. (2004) Effect of dietary protein level on the growth and survival of pre‐adult
freshwater crayfish Cherax quadricarinatus (von Martens) in monosex culture.
Aquaculture Research 35 (1): 71‐79.
Cortés‐Jacinto, E., Villarreal‐Colmenares, H., Cruz‐SuáRez, L., Civera‐Cerecedo, R.,
Nolasco‐Soria, H. & Hernandez‐Llamas, A. (2005) Effect of different dietary protein
and lipid levels on growth and survival of juvenile Australian redclaw crayfish, Cherax
quadricarinatus (von Martens). Aquaculture Nutrition 11 (4): 283‐291.
Crandall, K. A. & Buhay, J. E. (2008) Global diversity of crayfish (Astacidae,
Cambaridae, and Parastacidae‐Decapoda) in freshwater. Hydrobiologia 595: 295‐
301.
Crawford, A. C., Richardson, N. R. & Mather, P. B. (2005) A comparative study of
cellulase and xylanase activity in freshwater crayfish and marine prawns.
Aquaculture Research 36: 586‐592.
Crawford, A. C. (2006) Evolution and function of cellulase genes in Australian
freshwater crayfish. PhD Thesis, Queensland University of Technology.
Crawford, A. C., Kricker, J. A., Anderson, A. J., Richardson, N. R. & Mather, P. B.
(2004) Structure and function of a cellulase gene in redclaw crayfish, Cherax
quadricarinatus. Gene 340 (2): 267‐274.
![Page 135: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/135.jpg)
117
Crawford, A. C., Richardson, N. R. & Mather, P. B. (2005) A comparative study of
cellulase and xylanase activity in freshwater crayfish and marine prawns.
Aquaculture Research 36 (6): 586‐592.
Curtis, M. C. & Jones C., M. (1995) Observations on Monosex Culture of Redclaw
Crayfish Cherax quadricarinatus von Martens (Decapoda: Parastacidae) in Earthen
Ponds. Journal of the World Aquaculture Society 26 (2): 154‐159.
Cuzon, G., Guillaume, J. (1997) Energy and protein: energy ratio. In: Crustacean
Nutrition (D’Abramo, L. R., Conklin, D. E., & Akiyama, D. M., eds.), pp. 51‐70, vol.6.
World Aquaculture Society, Baton Rouge, Louisiana, U.S.A.
D’Abramo, L. R. & Robinson, E.H. (1989) Nutrition of crayfish. CRC Crit. Rev. Aquat.
Sci., 1, 711–728.
Dall, W. & Moriarty, D. J. W. (1983) Functional aspects of nutrition and digestion. In
The biology of crustacea, (Mantel, L. H. ed.) pp. 215‐261. New York: Academic Press.
Dammannagoda, L. K., Pavasovic A., Prentis P. J., Hurwood D. A. & Mather P. B.
(2014) Expression and characterisation of digestive enzyme genes from
hepatopancreatic transcripts of redclaw crayfish (Cherax quadricarinatus).
Aquaculture Nutrition. Accepted on 06/05/2014.
Dammannagoda, L. K., Pavasovic, A., Hurwood, D. A. & Mather, P. B. (2013) Effects of
soluble dietary cellulose on specific growth rate, survival and digestive enzyme
activities in three freshwater crayfish (Cherax) species. Aquaculture Research
DOI:10.1111/are.12209
Daniel, G., Nilsson, T. & Cragg, S. (1991) Limnoria lignorum ingest bacterial and
fungal degraded wood. Holz als Roh‐ und Werkstoff 49 (12): 488‐490.
Demura, T. & Fukuda, H. (2007) Transcriptional regulation in wood formation. Trends
in Plant Science 12 (2): 64‐70.
de Vries, S., Pustjens, A. M., Schols, H. A., Hendriks, W. H. & Gerrits, W. J. J. (2012)
Improving digestive utilisation of fiber‐rich feedstuffs in pigs and poultry by
![Page 136: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/136.jpg)
118
processing and enzyme technologies: A review. Animal Feed Science and Technology
178(3–4): 123‐138.
Do Huu, H. & Jones, C. M. (2014) Effects of dietary mannan oligosaccharide
supplementation on juvenile spiny lobster Panulirus homarus (Palinuridae).
Aquaculture 432: 258‐264.
DPI (Department of Primary Industries) (2006) Fisheries and mines. Northern
Territory, Darwin.
Drew, M. D., Borgeson, T. L. & Thiessen, D. L. (2007) A review of processing of feed
ingredients to enhance diet digestibility in finfish. Animal Feed Science and
Technology 138(2): 118‐136.
Duffy, R. E., Godwin, I., Nolan, J. & Purvis, I. (2011) The contribution of naturally
occurring food items to the diet of Cherax destructor when fed formulated diets of
differing protein levels. Aquaculture 313 (1‐4): 107‐114.
Edgerton, B. (2005) Freshwater crayfish production for poverty alleviation. World
Aquaculture 36:48–64.
FAO, 2007. The State of World Fisheries and Aquaculture ‐ 2006: Fisheries and
Aquaculture Department, Food and Agriculture Organization of the United Nations.
Rome.
FAO, 2009. The State of World Fisheries and Aquaculture ‐ 2008: Fisheries and
Aquaculture Department, Food and Agriculture Organization of the United Nations.
Rome.
FAO, 2010. The State of World Fisheries and Aquaculture ‐ 2010: Fisheries and
Aquaculture Department, Food and Agriculture Organization of the United Nations.
Rome.
FAO, 2012. The State of World Fisheries and Aquaculture ‐ 2012: Fisheries and
Aquaculture Department, Food and Agriculture Organization of the United Nations.
Rome.
![Page 137: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/137.jpg)
119
Fernández, I., Oliva, M., Carrillo, O. & Wormhoudt, A. V. (1997) Digestive enzyme
activities of Penaeus notialis during reproduction and moulting cycle. Comparative
Biochemistry and Physiology Part A: Physiology 118 (4): 1267‐1271.
Figueiredo, M. S. R. B. & Anderson, A. J. (2003) Ontogenetic changes in digestive
proteases and carbohydrases from the Australian freshwater crayfish, redclaw
Cherax quadricarinatus (Crustacea, Decapoda, Parastacidae). Aquaculture Research
34, 1235‐1239.
Figueiredo, M. S. R. B., Kricker, J. A. & Anderson, A. J. (2001) Digestive enzyme
activities in the alimentary tract of redclaw crayfish, Cherax quadricarinatus
(Decapoda : Parastacidae). Journal of Crustacean Biology 21, 334‐344.
Figueiredo, M. S. R. B. & Anderson, A. J. (2009) Digestive enzyme spectra in
crustacean decapods (Paleomonidae, Portunidae and Penaeidae) feeding in the
natural habitat. Aquaculture Research 40 (3): 282‐291.
Fotedar, R. (2004) Effect of dietary protein and lipid source on the growth, survival,
condition indices, and body composition of marron, Cherax tenuimanus (Smith).
Aquaculture 230 (1‐4): 439‐455.
Francis, G., Makkar, H. P. S. & Becker, K. (2001) Antinutritional factors present in
plant‐derived alternate fish feed ingredients and their effects in fish. Aquaculture
199 (3‐4): 197‐227.
Gabriela, G., Cuzon, G., García, T., Taboada, G., Brito, R., Chimal, M. E., Paredes, A.,
Soto, L., Rosas, C. & Wormhoudt, A. V. (2005) Factorial effects of salinity, dietary
carbohydrate and moult cycle on digestive carbohydrases and hexokinases in
Litopenaeus vannamei (Boone, 1931). Comparative Biochemistry and Physiology Part
A: Molecular & Integrative Physiology 140 (1): 29‐39.
Gamboa‐Delgado, J., Molina‐Poveda, C. & Cahu, C. (2003) Digestive enzyme activity
and food ingesta in juvenile shrimp Litopenaeus vannamei (Boone, 1931) as a
function of body weight. Aquaculture Research 34 (15): 1403‐1411.
![Page 138: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/138.jpg)
120
Garcia, S. M. & Rosenberg, A. A. (2010) Food security and marine capture fisheries:
characteristics, trends, drivers and future perspectives. Philosophical Transactions of
the Royal Society B‐Biological Sciences 365 (1554): 2869‐2880.
Garcia‐Ulloa, G. M., Lopez‐Chavarin, H. M., Rodriguez‐Gonzalez, H. & Villarreal‐
Colmenares, H. (2003) Growth of redclaw crayfish Cherax quadricarinatus (Von
Martens 1868) (Decapoda : Parastacidae) juveniles fed isoproteic diets with partial
or total substitution of fish meal by soya bean meal: preliminary study. Aquaculture
Nutrition 9 (1): 25‐31.
Garza de Yta, A., Davis, D. A., Rouse, D. B., Ghanawi, J. & Saoud, I. P. (2012)
Evaluation of practical diets containing various terrestrial protein sources on survival
and growth parameters of redclaw crayfish Cherax quadricarinatus. Aquaculture
Research 43 (1): 84‐90.
Gatlin, D. M., Barrows, F. T., Brown, P., Dabrowski, K., Gaylord, T. G., Hardy, R. W.,
Herman, E. et al. (2007). Expanding the utilisation of sustainable plant products in
aquafeeds: a review. Aquaculture Research 38 (6): 551‐579.
Genious version 6.1.6 created by Biomatters: available from
http://www.genious.com
Ghanawi, J. & Saoud, I. P. (2012) Molting, reproductive biology, and hatchery
management of redclaw crayfish Cherax quadricarinatus (von Martens 1868).
Aquaculture 358–359, 183‐195.
Glass, H. J. & Stark, J. R. (1995) Carbohydrate Digestion in the European Lobster
Homarus gammarus (L.). Journal of Crustacean Biology 15: 424‐433.
González‐Peña, M. D. C., Anderson, A. J., Smith, D. M. & Moreira, G. S. (2002) Effect
of dietary cellulose on digestion in the prawn Macrobrachium rosenbergii.
Aquaculture 211, 291‐303.
![Page 139: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/139.jpg)
121
Grabherr, M. G., Haas, B. J., Yassour, M., Levin, J. Z., Thompson, D. A., Amit, I.,
Adiconis, X. et al. (2011) Full‐length transcriptome assembly from RNA‐Seq data
without a reference genome. Nature Biotechnology 29 (7): 644‐652.
Guillaume, J. & Choubert, G. (2001) Digestive physiology and nutrient digestibility in
fishes. In: Nutrition and Feeding of Fish and Crustaceans (Guillaume, P. J., Kaushik, P.
B., & Metailler, R. eds.), pp. 27–56. Springer‐Praxis Publishing, Chichester.
Guillaume, J. (1997) Protein and amino acids. In: Crustacean Nutrition (D’Abramo, L.
R., Conklin, D. E. & Akiyama, D. M. eds), pp. 26 – 41. World Aquaculture Society,
Louisiana State University, Baton Rouge, LA.
Hai‐peng, L., Rong‐yuan, C., Qiu‐xia, Z., Hui, P. & Ke‐jian, W. (2011) Differential gene
expression profile from haematopoietic tissue stem cells of redclaw crayfish, Cherax
quadricarinatus, in response to WSSV infection. Developmental & Comparative
Immunology 35 (7): 716‐724.
Hammer, H. S., Bishop, C. D. & Watts, S. A. (2000) Activities of three digestive
enzymes during development in the crayfish Procambarus clarkii (decapoda). Journal
of Crustacean Biology 20 (4): 614‐620.
Handford, M. G., Baldwin, T. C., Goubet, F., Prime, T. A., Miles, J., Yu, X. & Dupree, P.
(2003) Localisation and characterisation of cell wall mannan polysaccharides in
Arabidopsis thaliana. Planta 218 (1): 27‐36.
Hardy, R. W. & Tacon, A. G. J. (2002) Fish meal: historical uses, production trends and
future outlook for supplies. In: Responsible Marine Aquaculture (Stickney, R. R. &
MacVey, J. P. eds.), CABI Publishing, New York, pp. 311–325.
Harlio lu, M. M. & Harlio lu, A. G. (2006) Threat of non‐native crayfish introductions
into Turkey: global lessons. Reviews in Fish Biology and Fisheries 16 (2): 171‐181.
He, L., Xie, Y., Lu, W., Wang, Y., Chen, L. L., Mather, P. B., Zhao, Y. L.,. Wang, Y. P. &
Wang, Q. (2012) Genetic diversity in three redclaw crayfish (Cherax quadricarinatus,
von Martens) lines developed in culture in China. Aquaculture Research 43:75–83.
![Page 140: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/140.jpg)
122
Hernández, M. P., Rouse, D. B. & Olvera, M. A. (2002) Effect of dietary protein‐lipid
ratios on survival and growth of Australian crayfish (Cherax quadricarinatus)
hatchlings and juveniles. Freshwater crayfish 13: 36‐45.
Hill, A. M. & Lodge, D. M. (1994) Diel Changes in Resource Demand: Competition and
Predation in Species Replacement among Crayfishes. Ecology 75: 2118‐2126.
Holdich, D. M. (1993) A review of astaciculture: freshwater crayfish farming. Aquatic
Living Resources 6 (4): 307‐317.
Hubbard, D. M., Robinson, E. H., Brown, P. B. & Daniels, W. H. (1986) Optimum ratio
of dietary protein to energy for red crayfish (Procambarus clarkii). The Progressive
Fish‐Culturist 48 (4): 233 ‐ 237.
Huner, J. V. (1995) An overview of the status of freshwater crawfish culture. Journal
of Shellfish Research 14 (2): 539‐543.
Jiang, H., Cai Y., Chen, L., Zhang, X., Hu, S. & Wang, Q. (2009a) Functional annotation
and analysis of expressed sequence tags from the hepatopancreas of mitten crab
(Eriocheir sinensis). Marine Biotechnology 11 (3): 317‐326.
Jiang, H., Yin, Y., Zhang, X., Hu, S. & Wang, Q. (2009b) Chasing relationships between
nutrition and reproduction: A comparative transcriptome analysis of hepatopancreas
and testis from Eriocheir sinensis. Comparative Biochemistry and Physiology Part D:
Genomics and Proteomics 4 (3): 227‐234.
Johnston, D. & Feeman, J. (2005) Dietary preference and digestive enzyme activities
as indicators of trophic resource utilisation by six species of crab. The Biological
Bulletin 208 (1): 36‐46.
Johnston, D. J. (2003) Ontogenetic changes in digestive enzyme activity of the spiny
lobster, Jasus edwardsii (Decapoda; Palinuridae). Marine Biology 143 (6): 1071‐1082.
Jones, C. M. (1990) The biology and aquaculture potential of the tropical freshwater
crayfish Cherax quadricarinatus. Queensland Department of Primary Industries
Information Series QI90028, 109 pp.
![Page 141: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/141.jpg)
123
Jones, C. M. & Ruscoe, I. M. (1996a) Evaluation of six diets fed to redclaw, Charax
quadricarinatus (von martens) (Decapoda: Parastacidae), under laboratory
conditions. In Production technology for redclaw crayfish (Cherax quadricarinatus),
pp. 20–31. Final Report FRDC Project 92/119. Fisheries Research and Development,
Canberra.
Jones, C. M. & Ruscoe, I. M. (1996b) Evaluation of six diets fed to redclaw, Cherax
quadricarinatus (von Martens), (Decapoda: Parastacidae) held in pond enclosures. In
Production technology for redclaw crayfish (Cherax quadricarinatus), pp. 8–19. Final
Report FRDC Project 92/119. Fisheries Research and Development, Canberra.
Jones, C. M. & Ruscoe, I. M. (1996c) Production technology for red‐claw crayfish
(Cherax quadricarinatus). Final Report, Freshwater Fisheries & Aquaculture Centre,
Fisheries Research and Development Corporation, Walkamin, Australia.
Jones, C. M. & Ruscoe, I. M. (2000) Assessment of stocking size and density in the
production of redclaw crayfish, Cherax quadricarinatus (von Martens) (Decapoda:
Parastacidae), cultured under earthen pond conditions. Aquaculture 189 (1–2): 63‐
71.
Jones, C. M. (1990) The biology and aquaculture potential of the tropical freshwater
crayfish Cherax quadricarinatus. Queensland Department of Primary Industries
Information Series. QI90028, 109 pp.
Jones, C. M. (1995a) Production of juvenile redclaw crayfish, Cherax quadricarinatus
(von Martens) (Decapoda, Parastacidae) I. Development of hatchery and nursery
procedures. Aquaculture 138 (1‐4): 221‐238.
Jones, C. M. (1995b) Production of juvenile redclaw crayfish, Cherax quadricarinatus
(von Martens) (Decapoda, Parastacidae) II. Juvenile nutrition and habitat.
Aquaculture 138 (1): 239‐245.
Jones, C. M., McPhee, C. P. & Ruscoe, I. M. (2000) A review of genetic improvement
in growth rate in redclaw crayfish Cherax quadricarinatus (von Martens) (Decapoda:
Parastacidae). Aquaculture Research 31 (1): 61‐67.
![Page 142: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/142.jpg)
124
Jones, P. L., De Silva, S. S. & Mitchell, B. D. (1996a) Effect of dietary protein content
on growth performance, feed utilisation and carcass composition in the Australian
freshwater crayfish, Cherax albidus Clark and Cherax destructor Clark (Decapoda,
Parastacidae). Aquaculture Nutrition 2 (3): 141‐150.
Jones, P. L., De Silva, S. S. & Mitchell, B. D. (1996b) Effects of replacement of animal
protein by soybean meal on growth and carcass composition in juvenile Australian
freshwater crayfish. Aquaculture International 4 (4): 339‐359.
Jones, P. L., Silva, S. S. & Mitchell, B. D. (1996c) Effects of replacement of animal
protein by soybean meal on growth and carcass composition in juvenile Australian
freshwater crayfish. Aquaculture International 4 (4): 339‐359.
Jukes, T. H. & Cantor, C. R. (1969) Evolution of Protein Molecules. New York:
Academic Press. pp. 21–132.
Kanazawa, A. & Koshio, S. (1994) Lipid Nutrition of the Spiny Lobster Panulirus
japonicus (Decapoda, Palinuridae): A Review. Crustaceana 67 (2): 226‐232.
Karplus, I., Barki, A., Cohen, S. & Hulata, G. (1995) Culture of the Australian redclaw
crayfish Cherax quadricarinatus in Israel: I. Polyculture with fish in earthen ponds.
Karplus, I., Zoran, M., Milstein, A., Harpaz, S., Eran, Y., Joseph, D. & Sagi, A. (1998)
Culture of the Australian red‐claw crayfish (Cherax quadricarinatus) in Israel: III.
Survival in earthen ponds under ambient winter temperatures. Aquaculture 166 (3–
4): 259‐267.
King, A. J., Simon, M. C., Yi, L., Jo, D., Matthew, J. G., Bowles, D. J., Bruce, N. C.,
Graham, I. A. & McQueen‐Mason, S. J. (2010) Molecular insight into lignocellulose
digestion by a marine isopod in the absence of gut microbes. Proceedings of the
National Academy of Sciences 107 (12): 5345‐5350.
Kleine, R. (1967) Occurrence and properties of proteolytic enzymes in the gastric
juice and hepatopancreas of the crayfishes Astacus astacus (L.) and Cambarus affinis
(Say). Zeitschrift fiir vergleichende Physiologic 55:51‐69.
![Page 143: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/143.jpg)
125
Lawrence, C. & Jones, C. M. (2002) Cherax. In: Biology of Freshwater Crayfish
(Holdich, D. M. ed.), pp. 635–654. Blackwell Science, Oxford.
Lawrence, C. (2007) Improved performance of marron using genetic and pond
management strategies. Final report to fisheries research and Development
Corporation on project no. 2000/215. Department of fisheries, Western Australia.
Lawrence, C., Jones, C. (2002) Cherax. In: Biology of freshwater crayfish (Holdich, D.
M. ed.) 635‐669. Oxford: Blackwell.
Lee, P. G., Smith, L. L. & Lawrence, A. L. (1984) Digestive proteases of Penaeus
vannamei Boone: Relationship between enzyme activity, size and diet. Aquaculture
42 (3‐4): 225‐239.
Lim, C. & Sessa, D. J. (1995) Nutrition and utilisation technology in aquaculture. AOCS
Press, Champaign, IL.
Linton, S. M. & Greenaway, P. (2007) A review of feeding and nutrition of
herbivorous land crabs: adaptations to low quality plant diets. Journal of
Comparative Physiology B‐Biochemical Systemic and Environmental Physiology 177:
269‐286.
Linton, S. M., Allardyce, B. J., Hagen, W., Wencke, P. & Saborowski, R. (2009) Food
utilisation and digestive ability of aquatic and semi‐terrestrial crayfishes, Cherax
destructor and Engaeus sericatus (Astacidae, Parastacidae). Journal of Comparative
Physiology B‐Biochemical Systemic and Environmental Physiology 179: 493‐507.
Linton, S., Greenaway, P. & Towle, D. (2006) Endogenous production of endo‐beta‐
1,4‐glucanase by decapod crustaceans. Journal of Comparative Physiology B‐
Biochemical Systemic and Environmental Physiology 176 (4): 339‐348.
Lochmann, R., McClain, W. R. & Gatlin, D. M. (1992) Evaluation of practical feed
formulations and dietary supplements for red swamp crayfish. Journal of the World
Aquaculture Society 23 (3): 217‐227.
![Page 144: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/144.jpg)
126
Lopez‐Lopez, S., Nolasco H., Villarreal‐Colmenares, H. & Civera‐Cerecedo, R. (2005)
Digestive enzyme response to supplemental ingredients in practical diets for juvenile
freshwater crayfish Cherax quadricarinatus. Aquaculture Nutrition 11: 79‐85.
López‐López, S., Nolasco, H. & Vega‐Villasante, F. (2003) Characterization of digestive
gland esterase‐lipase activity of juvenile redclaw crayfish Cherax quadricarinatus.
Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular
Biology 135 (2): 337‐347.
Lundstedt, L. M., Melo, J. F. B. & Moraes, G. (2004) Digestive enzymes and metabolic
profile of Pseudoplatystoma corruscans (Teleostei: Siluriformes) in response to diet
composition. Comparative Biochemistry and Physiology Part B 137,331‐339.
Lynd, L. R., Weimer, P. J., van Zyl, W. H. & Pretorius, I. S. (2002) Microbial cellulose
utilization: Fundamentals and Biotechnology. Microbiology and Molecular Biology
Reviews 66 (3): 506‐577.
Ma, K., Qiu, G., Feng, J. & Li, J. (2012) Transcriptome analysis of the oriental river
prawn, (Macrobrachium nipponense) using 454 Pyrosequencing for discovery of
genes and markers. PLoS ONE 7 (6): e39727.
Manomaitis, L. (2001) Assessment of the crude protein requirement of juvenile red
claw crayfish Cherax quadricarinatus. Masters thesis, Auburn University, Auburn, AL,
USA.
Marsman, G., Gruppen, H., van der Poel, A., Kwakkel, R., Verstegen, M. & Voragen,
A. (1997) The effect of thermal processing and enzyme treatments of soybean meal
on growth performance, ileal nutrient digestibilities, and chyme characteristics in
broiler chicks. Poultry Science 76(6): 864‐872.
Martinez‐Cordova, L. R., Torres, A. C. & Porchas‐Cornejo, M. A. (2003) Dietary
protein level and natural food management in the culture of blue (Litopenaeus
stylirostris) and white shrimp (Litopenaeus vannamei) in microcosms. Aquaculture
Nutrition 9 (3): 155‐160.
![Page 145: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/145.jpg)
127
Masser, M. P., Rouse, D. B. (1997) Australian redclaw crayfish: SRAC Publication No.
244. SRAC Publication No. 244.
Meade, M. E., Doeller, J. E., Kraus, D. W. & Watts, S. A. (2002) Effects of temperature
and salinity on weight gain, Oxygen consumption rate, and growth efficiency in
juvenile redclaw crayfish Cherax quadricarinatus. Journal of the World Aquaculture
Society 33 (2): 188‐198.
Meakin, C. A., Qin, J. G. & Mair, G. C. (2008) Feeding behaviour, efficiency and food
preference in yabbies Cherax destructor. Hydrobiologia 605: 29‐35.
Medale, F. & Kaushik, S. (2008) Evolution of INRA research in the field of fish
nutrition: exploring alternatives to marine fishery‐derived ingredients. Productions
Animales 21 (1): 87‐94.
Metts, L. S., Thompson, K. R., Xiong, Y. L., Kong, B. H., Webster, C. D. & Brady, Y.
(2007) Use of alfalfa hay, compared to feeding practical diets containing two protein
levels, on growth, survival, body composition, and processing traits of Australian red
claw crayfish, Cherax quadricarinatus, grown in ponds. Journal of the World
Aquaculture Society 38 (2): 218‐230.
Mills, B. J., Morrissy, N. M. & Huner, J. V. (1994) Cultivation of freshwater crayfishes
in Australia. In Freshwater crayfish aquaculture, edited by J. V. Huner, 217‐89. New
York: The Haworth Press.
Mitchell, B. D., Anderson, T., De Silva, S. S., Collins, R. O., Chavez, J. R., Jones, P. L. &
Austin, C. M. (1995) A conceptual production model for freshwater crayfish pond
culture incorporating detrital forage. Aquaculture Research 26: 117‐127.
Momot, W. T. (1984) Crayfish Production: A Reflection of Community Energetics.
Journal of Crustacean Biology 4: 35‐54.
Momot, W. T. (1995) Redefining the role of crayfish in aquatic ecosystems. Reviews
in Fisheries Science 3: 33‐63.
![Page 146: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/146.jpg)
128
Momot, W., Gowing, H. & Jones, P. D. (1978) The dynamics of crayfish and their role
in ecosystems. Am. Midl. Nat. 99:10–35.
Morrissy, N. M. (1989) A Standard Reference Diet for Crustacean Nutrition Research:
IV. Growth of Freshwater Crayfish Cherax tenuimanus. Journal of the World
Aquaculture Society 20: 114‐117.
Moss, S. M., Divakaran, S. & Kim, B. G. (2001) Stimulating effects of pond water on
digestive enzyme activity in the Pacific white shrimp, Litopenaeus vannamei (Boone).
Aquaculture Research 32: 125‐131.
Munro, C. A. & Gow, N. A. (2001) Chitin synthesis in human pathogenic fungi.
Medical Mycology 39 Suppl 1: 41‐53.
Muzinic, L. A., Thompson, K. R., Morris, A., Webster, C. D., Rouse, D. B. &
Manomaitis, L. (2004) Partial and total replacement of fish meal with soybean meal
and brewer's grains with yeast in practical diets for Australian redclaw crayfish
Cherax quadricarinatus. Aquaculture 230 (1‐4): 359‐376.
Navarrete del Toro, M.A., García‐Carreño, F.L., Dıáz, L. M., Celis‐Guerrero, L. &
Saborowski R. (2006) Aspartic proteinases in the digestive tract of marine decapod
crustaceans. Journal of Experimental Zoology 305A: 645–654.
Naylor, R. L., Goldburg, R. J., Primavera, J. H., Kautsky, N., Beveridge, M. C. M., Clay,
J., Folke, C., Lubchenco, J., Mooney H. & Troell, M. (2000) Effect of aquaculture on
world fish supplies. Nature 405 (6790): 1017‐1024.
Nugroho, R. A. & Fotedar, R. (2014). Comparing the effects of dietary Selenium and
mannan oligosaccharide supplementation on the growth, immune function, and
antioxidant enzyme activity in the cultured marron Cherax cainii (Austin, 2002).
Aquaculture International 22 (2): 585‐596.
Nyström, P. (2002) Ecology. In: Biology of freshwater crayfish. (Holdich, D. M. ed.),
pp. 192–235. Blackwell.
![Page 147: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/147.jpg)
129
Ong, B. L. & Johnston, D. (2006) Influence of feeding on hepatopancreas structure
and digestive enzyme activities in Penaeus monodon. Journal of Shellfish Research 25
(1): 113‐121.
Pavasovic, A., Anderson, A. J., Mather, P. B. & Richardson, N. A. (2007a) Influence of
dietary protein on digestive enzyme activity, growth and tail muscle composition in
redclaw crayfish, Cherax quadricarinatus (von Martens). Aquaculture Research 38:
644‐652.
Pavasovic, A., Richardson, N. A., Mather, P. B. & Anderson, A. J. (2006) Influence of
insoluble dietary cellulose on digestive enzyme activity, feed digestibility and survival
in the redclaw crayfish, Cherax quadricarinatus (von Martens). Aquaculture Research
37 (1): 25‐32.
Pavasovic, M., Richardson, N. A., Anderson, A. J., Mann, D. & Mather, P. B. (2004)
Effect of pH, temperature and diet on digestive enzyme profiles in the mud crab,
Scylla serrata. Aquaculture 242: 641‐654.
Pavasovic, A., Anderson, A. J., Mather, P. B. & Richardson, N. A. (2007b) Effect of a
variety of animal, plant and single cell‐based feed ingredients on diet digestibility
and digestive enzyme activity in redclaw crayfish, Cherax quadricarinatus (Von
Martens 1868). Aquaculture 272 (1‐4): 564‐572.
Perera, E., Moyano, F. J., Díaz, M., Perdomo‐Morales, R., Montero‐Alejo, V.,
Rodriguez‐Viera, L., Alonso, E., Carrillo O. & Galich, G. S. (2008) Changes in digestive
enzymes through developmental and molt stages in the spiny lobster, Panulirus
argus. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular
Biology 151 (3): 250‐256.
Péres, A., Zambonino Infante, J. L. & Cahu, C. (1998) Dietary regulation of activities
and mRNA levels of trypsin and amylase in sea bass (Dicentrarchus labrax) larvae.
Fish Physiology and Biochemistry 19 (2): 145‐152.
Pillay, T. V. R. & Kutty, M. N. (2005) Aquaculture, Principles and Practices, 2nd edn.
pp. 630. Blackwell Publishing Ltd, Oxford, UK.
![Page 148: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/148.jpg)
130
Prentis, P. J., Woolfit, M., Thomas‐Hall, S. R., Ortiz‐Barrientos, D., Pavasovic, A.,
Lowe, A. J. & Schenk, P. M. (2010) Massively parallel sequencing and analysis of
expressed sequence tags in a successful invasive plant. Annals of Botany 106: 1009‐
1017.
Reid, D. J., Quinn, G. P., Lake, P. S. & Reich, P. (2008) Terrestrial detritus supports the
food webs in lowland intermittent streams of south‐eastern Australia: a stable
isotope study. Freshwater Biology 53: 2036‐2050.
Reigh, R. C., Braden, S. L. & Craig, R. J. (1990). Apparent digestibility coefficients for
common feedstuffs in formulated diets for red swamp crayfish, Procambarus clarkii.
Aquaculture 84(3‐4): 321‐334.
Robalino, J., Carnegie, R. B., O'Leary, N., Ouvry‐Patat, S. A., De la Vega, E., Prior S.,
Gross, P. S., Browdy, C. L., Chapman, R. W., Schey, K. L. & Warr G. (2009)
Contributions of functional genomics and proteomics to the study of immune
responses in the Pacific white leg shrimp Litopenaeus vannamei. Veterinary
Immunology and Immunopathology 128(1‐3): 110‐118.
Rodgers, L. J., Saoud, P. I. & Rouse, D. B. (2006) The effects of monosex culture and
stocking density on survival, growth and yield of redclaw crayfish (Cherax
quadricarinatus) in earthen ponds. Aquaculture 259 (1–4): 164‐168.
Rouse, D. B. (1995) Australian crayfish culture in the Americas. Journal of Shellfish
Research 14 (2): 569‐572.
Roy, L. A., Bordinhon, A., Sookying, D., Davis, A. D., Brown, T. W. & Whitis, G. N.
(2009). Demonstration of alternative feeds for the Pacific white shrimp, Litopenaeus
vannamei, reared in low salinity waters of west Alabama. Aquaculture Research 40
(4): 496‐503.
Rozen, S. & Skaletsky, H. J. (2000) Primer3 on the WWW for general users and for
biologist programmers. In: Bioinformatics Methods and Protocols: Methods in
Molecular Biology (Krawetz, S. & Misener, S. eds). Humana Press, Totowa, NJ, pp.
365‐386 Source code available at http://fokker.wi.mit.edu/primer3/
![Page 149: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/149.jpg)
131
Saitou, N. & Nei, M. (1987) The neighbour‐joining method: a new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 4 (4): 406‐425.
Sánchez‐Paz, A., F. García‐Carreño, A. Muhlia‐Almazán, A. B. Peregrino‐Uriarte, J.
Hernández‐López and G. Yepiz‐Plascencia (2006). Usage of energy reserves in
crustaceans during starvation: Status and future directions. Insect Biochemistry and
Molecular Biology 36(4): 241‐249.
Sang, H. M., Ky, L. T. & Fotedar, R. (2009) Dietary supplementation of mannan
oligosaccharide improves the immune responses and survival of marron, Cherax
tenuimanus (Smith, 1912) when challenged with different stressors. Fish & Shellfish
Immunology 27(2): 341‐348.
Saoud, I. P., Garza De Yta, A. & Ghanawi, J. (2012) A review of nutritional biology and
dietary requirements of redclaw crayfish Cherax quadricarinatus (von Martens
1868). Aquaculture Nutrition 18: 349‐368.
Saoud, I. P., Ghanawi, J., Thompson, K. R. & Webster, C. D. (2013) A Review of the
Culture and Diseases of Redclaw Crayfish Cherax quadricarinatus (Von Martens
1868). Journal of the World Aquaculture Society 44 (1): 1‐29.
Saoud, I. P., Rodgers, L. J., Davis, D. A. & Rouse, D. B. (2008) Replacement of fish
meal with poultry by product meal in practical diets for redclaw crayfish (Cherax
quadricarinatus). Aquaculture Nutrition 14 (2): 139‐142.
Saravanan, S., Biju, S. K. J. & Kumar, J. S. S. (2008) Moulting and behaviour changes in
freshwater prawn, Macrobrachium rosenbergii. Shellfish News Spring‐Summer 25:
13‐16.
Scrivener, A. M. & Slaytor, M. (1994) Properties of the endogenous cellulase from
Panesthia cribrata Saussure and purification of major endo‐β‐1, 4‐glucanase
components. Insect Biochemistry and Molecular Biology 24: 223‐231.
Shiau, S. Y. & Peng, C. Y. (1992) Utilisation of different carbohydrates at different
dietary protein levels in grass prawn, Penaeus monodon, reared in seawater.
Aquaculture 101 (3‐4): 241‐250.
![Page 150: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/150.jpg)
132
Shiau, S. Y. (1997) Carbohydrates and fiber. In: Crustacean Nutrition. (D’Abramo, L.
R., Conklin, D. E. & Akiyama, D. M. eds.), Vol. 6, pp. 108–122. Advances in world
aquaculture, World Aquaculture Society, Baton Rouge, LA.
Shurson, J., Noll, S. & Goihl, J. (2005). Corn by‐product diversity and feeding value to
non‐ruminants. In: Proc. 66th Minnesota Nutrition Conference and Technical
Symposium: Future of Corn in Animal Feed. University of Minnesota, St. Paul. MN.
pp. 50‐68.
Smith, D. M., Allan, G. L., Williams, K. C. & Barlow, C. G. (2001) Fishmeal replacement
research for shrimp feeds in Australia. Paper presented at the New Wave
Proceedings of the Special Session on Sustainable Shrimp Farming, Baton Rouge.
World Aquaculture Society.
Sokol, A. (1988) The Australian yabby. In: Freshwater Crayfish: Biology, Management
and Exploitation. (Holdich, D. M. & Lowery, R.S. eds.), pp. 401‐475. Croom Helm:
London.
Stickney, R. R. (2009) Aquaculture: an introductory text. 2nd edn. Oxfordshire: CAB
International.
Stone, D. A. J. (2003). Dietary carbohydrate utilisation by fish. Reviews in Fisheries
Science 11(4): 337‐369.
Tacon, A. G. J. & Metian, M. (2008) Global overview on the use of fish meal and fish
oil in industrially compounded aquafeeds: Trends and future prospects. Aquaculture
285 (1‐4): 146‐158.
Tacon, A. G. J., Metian, M., Turchini G. M. & De Silva, S. S. (2010) Responsible
aquaculture and trophic level implications to global fish supply. Reviews in Fisheries
Science 18 (1): 94‐105.
Tan, S. H., Degnan, B. M. & Lehnert, S. A. (2000) The Penaeus monodon Chitinase 1
gene is differentially expressed in the hepatopancreas during the moult cycle.
Marine Biotechnology 2 (2): 126‐135.
![Page 151: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/151.jpg)
133
Thompson, K. R., Bailey, T. J., Metts, L. S., Brady, Y. J. & Webster, C. D. (2010) Growth
response and fatty acid composition of juvenile red claw crayfish (Cherax
quadricarinatus) fed different sources of dietary lipid. Aquaculture Nutrition 16 (6):
604‐615.
Thompson, K. R., Muzinic, L. A., Christian, T. D., Webster, C. D., Manomaitis, L. &
Rouse, D. B. (2003a) Lecithin requirements of juvenile Australian red claw crayfish,
Cherax quadricarinatus. Aquaculture Nutrition 9 (4): 223‐230.
Thompson, K. R., Muzinic, L. A., Christian, T. D., Webster, C. D., Manomaitis, L. &
Rouse, D. B. (2003b) Effect on growth, survival, and fatty acid composition of
Australian red claw crayfish, Cherax quadricarinatus fed practical diets with and
without supplemental lecithin and/or cholesterol. Journal of the World Aquaculture
Society 34 (1): 1‐10.
Thompson, K. R., Muzinic, L. A., Engler, L. S. & Webster, C. D. (2005) Evaluation of
practical diets containing different protein levels, with or without fish meal, for
juvenile Australian red claw crayfish (Cherax quadricarinatus). Aquaculture 244: 241‐
249.
Thompson, K. R., Bailey, T. J., Metts, L. S., Brady, Y. J. & Webster, C. D. (2010) Growth
response and fatty acid composition of juvenile redclaw crayfish (Cherax
quadricarinatus) fed different sources of dietary lipid. Aquaculture Nutrtition 16 (6):
604‐615.
Thompson, K. R., Muzinic, L. A., Christian, T. D., Webster, C. D., Manomaitis, L. &
Rouse D. B. (2003a) Lecithin requirements of juvenile Australian redclaw crayfish,
Cherax quadricarinatus. Aquaculture Nutrition 9 (4): 223‐230.
Thompson, K. R., Muzinic, L. A., Christian, T. D., Webster, C. D., Manomaitis, L. &
Rouse, D. B. (2003b) Effect on growth, survival, and fatty acid composition of
Australian redclaw crayfish, Cherax quadricarinatus fed practical diets with and
without supplemental lecithin and/or cholesterol. Journal of the World Aquaculture
Society 34 (1): 1‐10.
![Page 152: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/152.jpg)
134
Thompson, K. R., Muzinic, L. A., Engler, L. S. & Webster C. D. (2005a) Evaluation of
practical diets containing different protein levels, with or without fish meal, for
juvenile Australian redclaw crayfish (Cherax quadricarinatus). Aquaculture 244 (1‐4):
241‐249.
Thompson, K. R., Muzinic, L. A., Engler, L. S., Morton, S. R. & Webster, C. D. (2004)
Effects of feeding practical diets containing various protein levels on growth,
survival, body composition, and processing traits of Australian red claw crayfish
(Cherax quadricarinatus) and on pond water quality. Aquaculture Research 35 (7):
659‐668.
Thompson, K., Metts, L., Muzinic, L., Dasgupta, S. & Webster, C. (2006) Effects of
feeding practical diets containing different protein levels, with or without fish meal,
on growth, survival, body composition and processing traits of male and female
Australian red claw crayfish (Cherax quadricarinatus) grown in ponds. Aquaculture
Nutrition 12 (3): 227‐238.
Tomme, P., Warren, R. A. J. & Gilkes, N. R. (1995) Cellulose hydrolysis by bacteria and
fungi. In: Advances in Microbial Physiology (Poole, R. K. ed.), pp. 1‐81: Academic
Press.
Turkiewicz, M., Kalinowska, H., Zielinśka M. & Bielecki, S. (2000) Purification and
characterization of two endo‐1, 4‐beta‐xylanases from Antarctic krill, Euphausia
superba Dana. Comparative biochemistry and physiology. Part B, Biochemistry and
molecular biology 127 (3): 325‐335.
Vazquez, F. J. & López Greco, L. S. (2007) Intersex females in the redclaw crayfish,
Cherax quadricarinatus (Decapoda: Parastacidae). Revista de Biologia Tropical
55:25–32.
Vega‐Villasante, F., Fernández, I., Preciado, R. M., Oliva, M., Tovar, D. & Nolasco, H.
(1999) The activity of digestive enzymes during the molting stages of the arched
swimming Callinectes arcuatus Ordway, 1863 (Crustacea: Decapoda: Portunidae).
Bulletin of Marine Science 65 (1): 1‐9.
![Page 153: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/153.jpg)
135
Verhoef, G. D., Jones, P. L. & Austin, C. M. (1998) A Comparison of aatural and
artificial Diets for Juveniles of the Australian freshwater crayfish Cherax destructor.
Journal of the World Aquaculture Society 29: 243‐248.
Verri, T., Mandal, A., Zilli, L., Bossa, D., Mandal, P. K., Ingrosso, L., Zonno, V., Vilella,
S., Ahearn, G. A. & Storelli, C. (2001) D‐Glucose transport in decapod crustacean
hepatopancreas. Comparative Biochemistry and Physiology 130A, 585–606.
Vogt, G. (2002) Functional anatomy. In: Biology of Freshwater Crayfish (Holdrich, D.
M. ed.), pp. 105–107. Blackwell Science, NewYork, NY.
Wang, C., Xie, S., Zhu, X., Lei, W., Yang, Y. & Liu, J. (2006) Effects of age and dietary
protein level on digestive enzyme activity and gene expression of Pelteobagrus
fulvidraco larvae. Aquaculture 254 (1–4): 554‐562.
Watanabe, H. & Tokuda, G. (2010) Cellulolytic Systems in Insects. Annual Review of
Entomology 55 (1): 609‐632.
Webster, C. D., Goodgame‐Tiu, L. S., Tidwell, J. H. & Rouse, D. B. (1994) Evaluation of
practical feed formulations with different protein levels for juvenile redclaw crayfish
(Cherax quadricarinatus). Transactions of the Kentucky Academy Science 55: 108–
112.
Webster, C. D., Thompson, K. R., Muzinic, L. A., Rouse, D. B. & Manomaitis, L. (2002a)
Culture and nutrition of redclaw crayfish: part one. Aquaculture Magazine 28(4):34–
38.
Webster, C. D., Thompson, K. R., Muzinic, L. A., Rouse, D. B. & Manomaitis, L. (2002b)
Culture and nutrition of Redclaw crayfish: part two. Aquaculture Magazine 28(5):35–
40.
Wickins, J. F. & Lee, D. O. C. (2002) Crustacean Farming: Ranching and Culture. 2nd
edn. pp. 52‐58. Hoboken: Wiley‐Blackwell.
Wingfield, M. (2008) An updated overview of the Australian freshwater caryfish
farming industry. Freshwater Crayfish 16: 15‐17.
![Page 154: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/154.jpg)
136
Wu, P., Qi, D., Chen, L., Zhang, H., Zhang, X., Qin, J. G. & Hu, S. (2009) Gene discovery
from an ovary cDNA library of oriental river prawn Macrobrachium nipponense by
ESTs annotation. Comp Biochem Physiol Part D Genomics Proteomics 4 (2): 111‐20.
Xiaoxuan, C. & Edgerton B. F. (2001) Freshwater crayfish culture in China.
Aquaculture Magazine (November–December): 41–44.
Xue, X. M., Anderson, A. J., Richardson, N. A., Xue, G. P. & Mather, P. B. (1999)
Characterisation of cellulase activity in the digestive system of the redclaw crayfish
(Cherax quadricarinatus). Aquaculture 180: 373‐386.
Xue, X. (1998) Enzymic studies of cellulase and xylanase from the digestivesystem of
the redclaw crayfish Cherax quadricarinatus. Masters by Research thesis,
Queensland University of Technology.
Yokoe, Y. & Yasumasu, I. (1964) The distribution of cellulase in invertebrates.
Comparative Biochemistry and Physiology 13: 323‐338.
Yuan, J. S., Yang, X., Lai, J., Lin, H., Cheng, Z. M., Nonogaki, H. & Chen, F. (2007) The
endo‐β‐mannanase gene families in Arabidopsis, rice, and poplar. Functional &
Integrative Genomics 7(1): 1‐16.
Yudkovski, Y., Glazer, L., Shechter, A., Reinhardt, R., Chalifa‐Caspi, V., Sagi, A. & Tom,
M. (2010) Multi‐transcript expression patterns in the gastrolith disk and the
hypodermis of the crayfish Cherax quadricarinatus at premolt. Comp.
Biochem.Physiol., Part D Genomics and Proteomics 5 (2): 171‐177.
Yudkovski, Y., Shechter, A., Chalifa‐Caspi, V., Auslander, M., Ophir, R., Dauphin‐
Villemant, C., Waterman, M., Sagi, A. & Tom, M. (2007) Hepatopancreatic multi‐
transcript expression patterns in the crayfish Cherax quadricarinatus during the
moult cycle. Insect Molecular Biology 16 (6): 661‐674.
Yuniarti, A., Aan, K. & Hariarti, A. M. (2011) Utilisation of golden apple snail
(Pomacea canaculata) meat meal in the diet of redclaw crayfish (Cherax
![Page 155: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/155.jpg)
137
quadricarinatus). Book of Abstracts. Pg. 619. Asian‐Pacific aquaculture and giant
prawn conference ‐ 2011, India.
Zambonino Infante, J. L. & Cahu, C. L. (2001) Ontogeny of the gastrointestinal tract of
marine fish larvae. Comparative Biochemistry and Physiology Part C: Toxicology &
Pharmacology 130 (4): 477‐487.
Zeng, D., Chen, X., Xie, D., Zhao, Y., Yang, C., Li, Y., Ma, N. et al. (2013) Transcriptome
Analysis of Pacific White Shrimp (Litopenaeus vannamei) Hepatopancreas in
Response to Taura Syndrome Virus (TSV) Experimental Infection. PLoS ONE 8 (2):
e57515.
Zeng, V. & Extavour, C. G. (2012) ASGARD: an open‐access database of annotated
transcriptomes for emerging model arthropod species. Database‐the Journal of
Biological Databases and Curation.
Zhang, J., Liu, Y., Tian, L., Yang, H., Liang, G. & Xu, D. (2012) Effects of dietary mannan
oligosaccharide on growth performance, gut morphology and stress tolerance of
juvenile Pacific white shrimp, Litopenaeus vannamei. Fish & Shellfish Immunology
33(4): 1027‐1032.
Zijlstra, R. T., Owusu‐Asiedu, A. & Simmins, P. H. (2010). Future of NSP‐degrading
enzymes to improve nutrient utilisation of co‐products and gut health in pigs.
Livestock Science 134 (1–3): 255‐257.
Zwilling, R. H. & Neurath, H. (1981) Invertebrate proteases. In: Methods in
Enzymology, vol. 80. (Wood, W. A. & Kellogg, S. T. eds.) pp. 633–664. Academic
Press, San Diego, CA.
![Page 156: An investigation of functional diversity of endogenous cellulase … · 2014-09-09 · An investigation of functional diversity of endogenous cellulase and expression of other digestive](https://reader033.fdocuments.us/reader033/viewer/2022042411/5f2a25b5a37f5b7c0d44b7cf/html5/thumbnails/156.jpg)
138
Appendices‐Publications