Frequency distribution of autoimmunity associated FCGR3B gene copynumber in Indian population

S. H. Almal & Harish Padh

Summary

Amongst several human genome variations, copy num-ber variations (CNVs) are considered as an importantsource of variability contributing to susceptibility towide range of diseases. Although CNV is scattered forgenes throughout the human genome, several of au-toimmunity related genes have CN variation andtherefore play an important role in susceptibility toautoimmune diseases. The association of the Fcgamma receptor 3B (FCGR3B) gene copy number inautoimmunity is well characterized in various popula-tions studied. The Fc gamma receptor is a low affinity,glycosylphosphatidylinositol-linked receptor for IgGmolecule predominantly expressed on human neu-trophils. The variable gene copy number of FCGR3Bis found to be involved in the impaired clearance ofimmune complexes, which significantly contribute tothe pathogenesis of several autoimmune diseases suchas systemic lupus erythematosus (SLE), rheumatoidarthritis (RA), type-1 diabetes and others. TheFCGR3B copy number ranged from 0 to 2 copies perdiploid genome in other populations, but yet notexplored in Indian population. Hence, this study aimsto evaluate the variation in the frequency distributionof FCGR3B CNV in Indian population. FCGR3B genecopy number varied significantly when compared toother population of the world. This observation willhelp us in exploring the potential role of CNV inFCGR3B gene and its association to autoimmunedisorders in Indian population.

Introduction

The human genome is populated with several types ofgenetic variations such as chromosomal translocations,variable number tandem repeats (VNTRs), inversions,single nucleotide polymorphism (SNPs), copy numbervariations (CNVs) and insertions and deletions (Indels).The concept of genome diversity has been redefinedwith the realization of copy number variation (CNV),covering to about 12% of human genome. Amongstall, during past decade, copy number variation (CNV)has gained much importance in understanding humanhealth and its correlation to disease susceptibility. Ithas been seen that these CNVs comprise of the dele-tions, duplications, segmental duplications, transloca-tions and inversions covering single gene or multiple ofthem. The association of some of the CNVs to diseasesusceptibility or protection is well reported and analy-sed by several researchers around the world. With theadvancements in the techniques to detect CNVs(Dhawan & Padh, 2009), a clearer picture of the asso-ciation between the CNV in disease related genes, itseffect on protein expression and function, contributingto disease aetiology has emerged.There are some common CNV genes that have been

associated with wide range of complex diseases suchas several autoimmune disorders, neurological disor-ders, HIV-1 infection, cancer and drug metabolizingenzymes (Almal & Padh, 2012). Amongst the severalcandidate genes studied, CNV in Fc gamma receptor3B (FCGR3B) gene is found associated with suscepti-bility to several autoimmune diseases (Schaschl et al.,2009; Graf et al., 2012).FCGR3B gene maps on chromosome 1q23.3 and

encodes for the activatory low-affinity Fcc receptor,FccRIIIb (CD16b). This FCGR3B belongs to one ofthe three families of FccR in human, discriminatedbased on the affinity to IgG. FCGR3B, the low-affinityreceptor, is expressed mainly on neutrophils and eosin-ophils attached by the glycosylphosphatidyl-inositol(GPI) anchor (Bournazos et al., 2011). Basically, theFCGR3B interacts with the Fc portion of the IgG mol-ecule involved in the immune regulation (Takai, 2002).Copy number variation (CNV) of FCGR3B is well

characterized (Schaschl et al., 2009) and its association

Department of Cell and Molecular Biology, B.V. Patel PharmaceuticalEducation and Research Development (PERD) Centre, Thaltej,Ahmedabad, Gujarat, India

Received 27 May 2014; revised 12 September 2014; accepted 23October 2014

Correspondence: Harish Padh, Department of Cell and MolecularBiology, B.V. Patel Pharmaceutical Education and ResearchDevelopment (PERD) Centre, Thaltej-Gandhinagar Highway, Thaltej,Ahmedabad, 380 054 Gujarat, India. Tel: +91 79 27439375;Fax: +91 79 27450449; E-mail: hpadh@yahoo.com

2014 John Wiley & Sons Ltd26 International Journal of Immunogenetics, 2015, 42, 2630

doi: 10.1111/iji.12165

with risk to autoimmune disorders is extensively analy-sed in several populations (Mamtani et al., 2010). Theassociation of low FCGR3B gene copy number (CN)with increased susceptibility to rheumatoid arthritis(RA) (McKinney et al., 2010; Graf et al., 2012), sys-temic lupus erythematosus (SLE) (Aitman et al., 2006;Fanciulli et al., 2007; Willcocks et al., 2008) amongstEuropean population is well illustrated, FCGR3B copynumber less than or greater than two copies as a risk toprimary Sjogrens syndrome (Mamtani et al., 2010),idiopathic pulmonary fibrosis (IPF) (Bournazos et al.,2011) and ulcerative colitis in Japanese populations(Asano et al., 2009) is also well documented. It hasbeen conjectured that low copy number of FCGR3B orcomplete absence might lead to reduced expression ofFCGR3B which in turn lowers the clearance of immunecomplexes in varied systemic autoimmune diseases likeSLE (Aitman et al., 2006). On the other hand, high CNof FCGR3B is also found to be associated with risk torheumatoid arthritis (RA) (Marques et al., 2010). Thus,it has been postulated that the role of FCGR3B CNVin autoimmunity is well established but its mechanismstill remains unclear (McKinney & Merriman, 2012).Besides the role of FCGR3B CN in autoimmune disor-der, recently, the CNV of Fc gamma receptor gene wasanalysed in HIV-infected and HIV-tuberculosis co-infected individuals in sub-Saharan Africa population(Machado et al., 2013). It was been highlighted in thisstudy that the clinical trials showing an effective anti-HIV response was correlated with non-neutralizingantibodies. Further, as Fcc receptors are critical inmediating the non-neutralizing effects of antibodies,the genetic variation of Fcc receptor genes can be takeninto account whilst studying the association of Fccreceptors genetic variants with HIV load, response tohighly-active antiretroviral therapy (HAART) andco-infection with TB. A small effect in Ethiopians wasobserved in the study, where CNV of FCGR3B (dele-tion) was more frequent in HIV-TB co-infected patientsthan those infected with HIV alone (Machado et al.,2013). Thus, the association of FCGR3B CNV can alsobe evaluated in varied range of diseases.The preliminary aim of our study was to determine

the frequency distribution of CNV in FCGR3B genein Indian population and then comparing it with fre-quency observed in other populations, to analyse theethnic variability amongst different populations.

Materials and methods

Study samples

The study samples comprised of 100 healthy individu-als (male/female = 79 /21) in the age group of2050 years, recruited at B. V. Patel PERD Centre,Ahmedabad comprising of heterogeneous population.Indian population is and admix of heterogenous popu-lations derived from several migratory waves with dif-ferent ancestries over a period of time which cannot

be demarcated on the basis of current geographicalregions. The study was approved by the institutionalethics committee, and written informed consent formwas obtained prior to blood collection from individu-als. Isolation of genomic DNA was carried out usingthe phenol-chloroform method (Sambrook et al.,1989; Dhawan et al., 2013) from 5 mL of blood with-drawn from healthy individuals. The blood sampleswere collected in the anticoagulant (K2 EDTA orSodium heparin) precoated vaccutainers using dispos-able syringe.

Determination of FCGR3B gene copy number

FCGR3B gene copy number was determined usingTaqMan-based chemistry on the ABI StepOne instru-ment. The target gene (FCGR3B) probe was labelledwith FAM, and RNase P (reference gene, two copiesper diploid genome) was labelled with VIC. Theprimer and probe sequences for target and referencegene used in this study are as follows: FCGR3B for-ward primer 50 CCCCTCCACCTTTTCTGGTAAG 30;reverse primer 50 TGGATCTGGGCTGGTCTGT 30;probe 50 FAM-CAGCTTTCCCAGATGC-MGB 30 andfor RNase P forward primer 50 AGATTTGGACCTGCGAGCG 30; reverse primer 50 GAGCGGCTGTCTCCACAAGT 30; probe 50 VIC-TTCTGACCTGAAGGCTCTGCGCG-MGB 30. The method of determiningFCGR3B gene copy number is similar to as describedpreviously for CCL3L1 (Gonzalez et al., 2005;McKinney et al., 2010). However, two approacheswere used inorder to assign copy number to a particu-lar sample as described by McKinney et al., 2012. Allsamples were assayed in triplicate, and the mean CNvalues were taken in consideration. Initially, all thesamples were scored based on the DDCT analysis toget the CN estimate to integer via Applied BiosystemsCopyCaller V2.0 software with the assumption of CN2 as the most common CN. Samples having

with the highest of 77% for individuals having 2copies of FCGR3B (Table 1). However, completedeletion of FCGR3B (zero copies) was not found inour study samples. Further, the distribution ofFCGR3B CN

comprised of the heterogeneous population represent-ing admix of varied genetic origin whose identificationbased on ancestry cannot be deciphered by race, reli-gion, caste or geographical location. The FCGR3BCN ranged from 1 to 3 per diploid genome, with anaverage gene dose of two copies in Indian healthyindividuals.For comparison of CN frequency in our sample with

the distribution of CN in different populations acrossglobe was plotted on the worldmap. The populationwith lower frequency of copy number (

Molokhia, M., Hoggart, C., Patrick, A.L., Shriver, M., Parra, E.,

Ye, J. et al. (2003) Relation of risk of systemic lupus

erythematosus to west African admixture in a Caribbean

population. Human Genetics, 112, 310.

Molokhia, M., Fanciulli, M., Petretto, E., Patrick, A.L.,

McKeigue, P., Roberts, A.L. et al. (2011) FCGR3B copy

number variation is associated with systemic lupus

erythematosus risk in Afro-Caribbeans. Rheumatology

(Oxford), 50, 1206.

Niederer, H.A., Willcocks, L.C., Rayner, T.F., Yang, W., Lau,

Y.L., Williams, T.N. et al. (2010) Copy number, linkage

disequilibrium and disease association in the FCGR locus.

Human Molecular Genetics, 19, 3282.

Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular

Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, NY.

Schaschl, H., Aitman, T.J. & Vyse, T.J. (2009) Copy number

variation in the human genome and its implication in

autoimmunity. Clinical & Experimental Immunology, 156, 12.

Takai, T. (2002) Role of Fc receptors in autoimmunity. Nature

Review Immunology, 2, 580.

Willcocks, L.C., Lyons, P.A., Clatworthy, M.R., Robinson, J.I.,

Yang, W., Newland, S.A. et al. (2008) Copy number of

FCGR3B, which is associated with systemic lupus

erythematosus, correlates with protein expression and immune

complex uptake. Journal of Experimental Medicine, 205, 1573.

2014 John Wiley & Sons LtdInternational Journal of Immunogenetics, 2015, 42, 2630

30 S. H. Almal & Harish Padh