Cytokine 60 (2012) 707–717

Contents lists available at SciVerse ScienceDirect

Cytokine

journal homepage: www.journals .e lsev ier .com/cytokine

Age-related changes in phagocytic activity and production of pro-inflammatorycytokines by lipopolysaccharide stimulated porcine alveolar macrophages q

Mohammad Ariful Islam a,b, Muhammad Jasim Uddin a,b, Ernst Tholen a, Dawit Tesfaye a, Christian Looft a,Karl Schellander a, Mehmet Ulas Cinar a,⇑a Institute of Animal Science, University of Bonn, Endenicher Allee 15, 53115 Bonn, Germanyb Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensing 2202, Bangladesh

a r t i c l e i n f o

Article history:Received 16 February 2012Received in revised form 9 July 2012Accepted 10 August 2012Available online 11 September 2012

Keywords:Age-dependentAlveolar macrophagePhagocytosisLipopolysaccharideCytokine

1043-4666/$ - see front matter � 2012 Elsevier Ltd. Ahttp://dx.doi.org/10.1016/j.cyto.2012.08.011

Abbreviations: BAL, bronchoalveolar lavage; AMs,polymorphonuclear neutrophils; qRT-PCR, quantitativreaction; ELISA, enzyme-linked immunosorbent assay;lipopolysaccharide; PHA, phytohaemagglutinin; PA, phcein isothiocyanate; mRNA, messenger ribonucleic acidnecrosis factor alpha; IFN-c, interferon gamma; MIPprotein-2; MCP1, monocyte chemotactic protein-1receptors; PPIA, peptidylprolyl isomerase A (cyclophiliulin; D-PBS, Dulbecco’s phosphate-buffered saline; RPMrial Institute medium-1640; miRNA, micro ribonucleicpico gram; h, hour; min, minute; SEM, standard error

q Author’s contributions: MAI isolated AMs, performPCR, ELISA, prepared and edited the manuscript. MUedited the manuscript. MJU analyzed the data and rresponsible for statistical analysis. DT was responsiblthe experiment. CL edited the manuscript. KS approand edited the manuscript.⇑ Corresponding author. Fax: +49 228 733583.

E-mail addresses: misl@itw.uni-bonn.de (M.A. Is(M.J. Uddin), etho@itw.uni-bonn.de (E. Tholen), dtes@cloo@itw.uni-bonn.de (C. Looft), ksch@itw.uni-bonnitw.uni-bonn.de (M.U. Cinar).

a b s t r a c t

The aim of the present study was to determine the age-related changes of phagocytic capacity and thekinetic production of cytokines in lipopolysaccharide-stimulated porcine alveolar macrophages. For thispurpose, AMs were isolated from 5 (newborn), 40 (post-weaned) and 120 (young) day old pigs. Results ofphagocytosis assay showed that AMs from newborn piglets had less phagocytic capacity than those ofyoung pigs (P < 0.05). For the kinetics study, cells and supernatant were collected at 1, 6, 12, 24, 36and 48 h after LPS stimulation for quantification of cytokine mRNA and protein by quantitative real-timePCR and ELISA, respectively. The kinetics results showed that AMs from newborn piglets were signifi-cantly less capable of producing IL1b, IL6, IL12b, TNFa and IL8 than post-weaned piglets or young pigs.IL18 mRNA did not show significant differences between ages. MIP2 and MCP1 mRNA was higher inyoung pigs. Hence, higher production of cytokines by AMs may be the surfactant factors in the pulmonaryhost defense system. These results indicate that AMs from newborn piglets might be functionally imma-ture, which may lead to increased susceptibility to lung infections. Future studies of cytokine kinetics inmore animals are clearly needed to confirm these results across a wider age range.

� 2012 Elsevier Ltd. All rights reserved.

1. Introduction

The innate immune response plays a critical role in the hostdefense system. In general, neonates have an immature immune sys-

ll rights reserved.

alveolar macrophages; PMNs,e real time polymerase chainTLRs, toll-like receptors; LPS,agocytic assay; FITC, fluores-; IL, interleukin; TNFa, tumor

2, macrophage inflammatory; PRRs, pattern recognitionn A); B2M, beta-2-microglob-

I-1640, Roswell Park Memo-acid; OD, optical density, pg,

of mean.

ed in vitro experiments, qRT-C supervised the work and

ead the manuscript. ET wase for kit and reagents used inved the experimental design

lam), judd@itw.uni-bonn.deitw.uni-bonn.de (D. Tesfaye),.de (K. Schellander), ucin@

tem compared to that of adults. Newborn and early postnatal pigletsare highly susceptible to a wide range of infectious disease, espe-cially respiratory disease complex [1]. In the respiratory tract, alve-olar macrophages (AMs) have important roles in conducting the firstline of defense against invading pathogens by two important andeffective means. First, AMs directly bind, phagocytose, and killpathogens, and whereas some earlier studies have demonstrateddeficient phagocytic capacity of AM in the neonates compared withadults [2,3]. In contrast, other contradictory reports suggest thatneonatal and adult AMs are equivalent in their capacity to phagocy-tose bacteria [4,5]. Second, AMs are able to secrete a large range ofinflammatory mediators including cytokine and chemokine. Cyto-kines are acting directly on the pathogens while others such aschemokines exert their effects indirectly by recruiting other compo-nents of the immune system. The functional deficiency of neonatalAMs includes impaired phagocytosis, chemotaxis, and productionof cytokine and chemokine [2,6,7]. During early postnatal life thereare relative deficiencies in the number and differentiation of AMs.Thus, AMs may contribute to diminish the host’s defense andincreased neonatal susceptibility to respiratory infection [8].

Recently, increasing attention has been paid to the involvementof the cytokine and chemokine response in neonatal immune de-fense mechanism. The ability of newborn children to produce cyto-kine and chemokine is different from adults [9]. Understanding

708 M.A. Islam et al. / Cytokine 60 (2012) 707–717

ontogeny of inflammatory mediators production in pigs is not de-tailed as in humans. The age-dependent variation of cytokineexpression levels in blood plasma, peripheral blood phagocytesand lymphatic organs were observed in pigs [10–12]. Also, measure-ment of some pro-inflammatory cytokines has shown the significantage-related differential production in pigs [13,14]. The altered abil-ity of newborns to produce inflammatory cytokines and chemokinescan be in part responsible for the higher sensitivity of newborns toinfectious diseases. Moreover, it has been reported that differentcytokines can be expressed by immune cells at different time pointsafter initial stimulation with mitogens, such as LPS and phytohem-agglutinin (PHA) [15–17]. Determination of cytokine profiles duringthe time course stimulation would give important information onimmunostimulatory and immunosuppressive mechanism. To theauthors’ knowledge, understanding the age-associated variabilityexpression and the kinetics pattern of pro-inflammatory cytokineand chemokine production by AMs has not been well reported inpigs.

In the present study, we first attempted to compare the age-related changes in bronchoalveolar lavage (BAL) fluid cellularcontent and the ability of AM cell functions in terms of their phag-ocytic response for selected Gram-negative bacteria in differentage groups. As the production of inflammatory mediators is highlydependent of the time after stimulation, we sought to determinethe age-related time kinetic profiles of pro-inflammatory cytokineand chemokine production by porcine AMs in response to LPS.Generally, mRNA responses are assumed to correlate with secretedprotein responses as has been confirmed by some studies [18], butnot in others [19,20]. Hence, the kinetics of cytokine expressionduring stimulation with LPS was further investigated comparingcytokine mRNA (analyzed by qRT-PCR) with the correspondingprotein secretion (ELISA).

2. Materials and methods

2.1. Animals

The experiment comprised nine clinically healthy male GermanLandrace pigs in total. All animals were obtained from the teachingand research station of Frankenforst, University of Bonn, Germany.The animals had no history of respiratory diseases. The pigs wereconventionally housed until slaughter and lungs were obtainedat the following three age categories: 5 days (newborn piglets,n = 3), 40 days (post-weaned piglets, n = 3) and 120 days (young,n = 3). The experiments were done according to the institutionalguidelines and animal husbandry regulations of Germany [21].

2.2. Collection of AMs

Pulmonary alveolar macrophages were collected by bronchoal-veolar lavage (BAL). BAL fluids from three animals of each agegroup were collected in separate tubes and filtered through sterilegauze and placed on wet ice. BAL fluids were mixed with RBC lysisbuffer to lyse any residual erythrocytes. BAL cells were pelleted bycentrifugation at 4 �C for 10 min (min) at 400�g. Cells were re-sus-pended and washed twice in calcium–magnesium free Dulbecco’sphosphate-buffered saline (D-PBS; pH 7.4; Sigma–Aldrich) beforefinal re-suspension with RMPI-1640 media (Sigma–Aldrich).

2.3. Cell counts and viability test

The harvested cells were used for determination of AMs cellcount, purity and viability. Assays were completed within 2 h (h)of BAL fluid collection. The differential cell count was performedon cytospins stained with a modified commercially available

Giemsa stain (Reastain Quick-Diff kit, REAGENA). AM purity was93%, 89% and 80% in young, post-weaned and newborn piglets,respectively. Other cells were mostly polymorphonuclear cells(PMNs) and lymphocytes. The total BAL cell count was obtainedfor each BAL fluid using a Haemocytometer. The cell viability wasdetermined using the Trypan blue dye exclusion method. The per-centage of viable AM cells were >98% in all cases.

2.4. Stimulation of AMs with LPS

The collected cells by bronchoalveolar lavage as describedabove were re-suspended in 2 mM L-glutamine-containing com-plete RPMI-1640 medium (Sigma–Aldrich) supplemented with10% fetal calf serum (FCS) (Invitrogen), sodium pyruvate (1 mM)and containing antibiotic and antimycotics (penicillin, streptomy-cin, amphotericin). In all experiments, AMs were cultured sepa-rately at 2 � 106 cells/well into 24-well tissue culture plates.After 1 h incubation, plates were carefully washed with D-PBS toremove any non-adherent cells and 1 mL of fresh complete med-ium was added for further cell culture. The remaining attachedcells were >95% macrophages (as tested in the control well by0.1% neutral dye, 10 min). Adherent cells were treated with LPS(10.0 lg/mL) of Escherichia coli 026:B6 (Sigma–Aldrich) and un-treated wells were considered as control. All plates were incubatedat 37 �C with 5% CO2 and 95% air atmosphere for 48 h. All cells andsupernatants were collected at 1, 6, 12, 24, 36 and 48 h after incu-bation. After each time point of incubation the cells were washedwith cold sterile D-PBS and stored immediately at �80 �C until use.

2.5. Phagocytic assay of AMs

Invitro phagocytosis assay was performed with Vybrant Phagocy-tosis Assay Kit (Molecular Probes Inc.) according to manufacturerinstructions. Using this method, the process of phagocytosis canbe quantified by following the internalization of fluorescentlylabeled bacterial particles. The protocol takes advantage of thedetectability of the intracellular fluorescence emitted by theengulfed bacteria and Trypan blue was shown to effectively quenchthe fluorescence of fluorescein-labeled E. coli as previously de-scribed [22]. Briefly, 50 ll of phagocytosis effectors were seededin a 24-well plate (1 � 106 cells/well) with 100 ll RPMI-1640 med-ia. The cells were then left untreated with 100 ll adjusted cells and50 ll media (positive control) and additionally, as a negative con-trol, wells were left cell-free and filled only with 150 ll of media.Determinations were performed in five wells for experimental,positive and negative samples at each time points. After 2 h of incu-bation, solutions were removed from all microplate wells byvacuum aspiration. Fluorescein-labeled E. coli (K-12 strain) biopar-ticles were added to the wells and phagocytic uptake was allowedto proceed for 30 min, 1 h and 2 h in a 37 �C humidified incubatorwith 5% CO2. Subsequently, the bioparticle suspension was re-moved and 100 ll of Trypan blue suspension was added for 1 minat room temperature. The excess Trypan blue was removed andthe samples were measured in the fluorescence microplate reader(Thermo Electron Co.) using 480 nm for excitation and 520 nmemission wavelengths.

2.6. ELISA assays of cytokines concentration in the supernatant

The concentration of cytokine protein of IL1b, IL12b, TNFa, IL6and IL8 of cells stimulated with LPS in cultured supernatant wasmeasured using commercially available specific porcine ELISA Kits(R&D System), following the manufacturer instructions. The opticaldensity (OD) value was detected using ELISA plate reader using450 nm wavelengths. Standard and sample dilutions were addedin duplicate wells for each time point to each ELISA plate and the

Table 1Oligonucleotide sequences designed for the quantitative real-time PCR analysis of mRNA expression of porcine cytokines and two house keeping genes, with the respectiveannealing temperature, amplicon products (bp) and GenBank accession number.

Gene Primer set Annealing temperature (�C) Amplicon size (bp) GenBank accession number

IL1ß F: GTACATGGTTGCTGCCTGAA 58 137 NM_001005149.1R: CTAGTGTGCCATGGTTTCCA

IL6 F: GGCAGAAAACAACCTGAACC 58 125 NM_214399.1R: GTGGTGGCTTTGTCTGGATT

IL12ß F: GAATCTGCAGCTGAATCCAT 57 186 NM_214013.1R: TCCTTGTGGCATGTAACCTT

IL18 F: GCATCAGCTTTGTGGAAATG 59 174 NM_213997.1R: CTCAAACACGGCTTGATGTC

TNFa F: ACTGCACTTCGAGGTTATCG 58 226 NM_214022.1R: GCTGGTTGTCTTTCAGCTTC

IL8 F: TAGGACCAGAGCCAGGAAGA 58 137 NM_213867.1R: CAGTGGGGTCCACTCTCAAT

MIP2 F: TGCTGTAGCTTTAGCGGAAT 57 186 NM_001001861.1R: GACCTGCCAAACACATTCAT

MCP1 F: ATCCTCCAGCATGAAGGTCT 56 125 NM_214214.1R: ACTTGCTGCTGGTGACTCTT

PPIA F: CACAAACGGTTCCCAGTTT 58 171 NM_214353.1R: TGTCCACAGTCAGCAATGGT

B2 M F: ACTTTTCACACCGCTCCAGT 58 180 NM_213978.1R: CGGATGGAACCCAGATACAT

F: Forward primer; R: Reverse primer; bp: base pair.

M.A. Islam et al. / Cytokine 60 (2012) 707–717 709

average concentration was used as protein level (pg/mL) in cell cul-ture supernatant. The concentrations were detected according tothe standard using microplate data compliance software SoftMaxPro (Molecular Devices GmbH).

2.7. RNA extraction and cDNA synthesis

At each sampling time (1, 6, 12, 24, 36 and 48 h), harvested AMcells were washed in ice cold D-PBS and the total RNA was ex-tracted using Pico-Pure RNA isolation kit following the manufac-turer manual (Arcturus, Invitrogen). The extracted total RNA wastreated with RNase-Free DNase Set (Qiagen) for 15 min at 37 �C.Total RNA concentration was measured by absorption at 260 nmand purity and concentration were checked by determining theOD ratio 260/280 nm using a NanoDrop-8000 spectrophotometer(ThermoScientific). Total RNA was then reverse transcribed into cDNA withSuperScript-II RT kit for qRT-PCR (Invitrogen). All samples were

Fig. 1. Differential cell count percentages from BALF of 5-day-old newborn piglets,40-day-old post-weaned piglets and 120-day-old young pig lungs. The percentageof AMs in the BALF increased with the advancement of age and the percentage ofneutrophils decreased. Asterisks indicates statistical differences of AMs and PMNscells between age groups (�P < 0.05). Each age group comprised three animals andcounts were made from three slides/pig.

reverse transcribed under the same conditions. The synthesizedcDNA was stored at �20 �C and used in qRT-PCR reactions as atemplate.

2.8. Analysis of gene expression by qRT-PCR

The oligonucleotide gene specific primers were selected for por-cine cytokine mRNA and two house keeping genes (PPIA and B2M)based on the information described in Table 1. Primers were de-signed by using FASTA product of the GenBank mRNA sequencesfor Sus scrofa using Primer3 program [23]. Quantitative geneexpression and subsequent data analysis were performed usingthe StepOnePlus™ qRT-PCR System (Applied Biosystems). The

Fig. 2. Phagocytic ability of AMs from pigs of different ages. Alveolar macrophagesfrom 5-day-old newborn piglets, 40-day-old post-weaned piglets and 120-day-oldyoung pigs were incubated with FITC-labeled E. coli for 30, 60 and 120 min at 37 �Cwith CO2. Fluorescence as a result of bacteria adherent to the outside of the AMswas quenched with trypan blue. The phagocytic capacity of this population isrepresented as percentage, which is indicative of the total number of bacteria eachcell had ingested. Asterisk indicates statistical differences from 5-day-old early bornpiglets (�P < 0.05). Each age group comprised three animals and read made from fivereplicates/pig.

Fig. 3. Expression levels of proinflammatory cytokines mRNA by LPS-stimulated alveolar macrophages relative to that of untreated cells. Alveolar macrophages (2 � 106 cells/mL/well) from 5-day-old newborn piglets, 40-day-old post-weaned piglets and 120-day-old young pigs were incubated with LPS (10 lg/mL). After stimulation for 1, 6, 12, 24,36, and 48 h, the cells were harvested for quantification of cytokines mRNA by qRT-PCR. Data shown is an average of three pigs of each age group ± standard error. Time-dependent expression, (a) IL1b and (c) IL6. Values with different capital, capital italic and small letters denote a statistical difference among time points within 120 days,40 days and 5 days old animals, respectively (P < 0.05). The letter x (P < 0.001) and y (P < 0.05) indicate significant differences between LPS-treated and untreated cells at eachtime point. Age-related changes, (b) IL1b and (d) IL6. Asterisks indicate significant differences among age groups at each time point. ���P < 0.0001, ��P < 0.001, and �P < 0.05.

710 M.A. Islam et al. / Cytokine 60 (2012) 707–717

qRT-PCR was set up using a 2 ll first-strand cDNA template, 7.4 lldeionized H2O, 0.3 lM of forward and reverse gene specific prim-ers and 10 ll 1 � Power SYBR Green I (Bio-Rad) master mix withROX as a reference dye. The thermal cycling conditions were3 min at 95 �C followed by 40 cycles of 15 s at 95 �C and 1 min at60 �C. The mRNA copy numbers of the target and housekeepinggene was calculated according to the standard curve method. Astandard curve was derived from the serial dilutions of plasmidDNA. Plasmid DNA was produced by cloning the amplicons ofinterest into the plasmids. After plasmid DNA isolation, a nine foldserial dilution was adjusted from 109 copies to 10 copies. The dataobtained from the qRT-PCR analysis was expressed as the mean oftriplicate samples ± standard error of mean (SEM). The expressionlevel of transcript (target gene) was normalized relatively to theaverage transcript of porcine housekeeping genes (HKGs) B2Mand PPIA (Table 1), where the expression (copy number) of the tar-get gene was divided by the geometric mean of the expression(copy number) of two HKGs [24]. Final results were reported asthe relative expression level after normalization of each targetcytokine gene using the HKGs.

2.9. Data analysis

Data were subjected to ANOVA procedures using the PROC GLMof SAS (ver9.2; SAS, SAS Institute Inc., Cary, NC, USA). The analysisof variance with Tukey’s test was used to detect any possible effectat different time points on the production of cytokine data (mRNA

and protein) within the same age group. For incubation timecourse study, value of P < 0.05 was considered to be statistical sig-nificant. Within time periods of individual age group, values withsimilar superscripts alphabet letters are not significantly different.Differences in phagocytic activity, differential cells in BAL fluidsand cytokine production levels between age groups at each timepoint were determined using the student’s t-test. Asterisks indicatesignificant differences among age groups at each time point.���P < 0.0001, ��P < 0.001, and �P < 0.05. Comparison of resultsbetween LPS-stimulated cells and untreated cells at different timepoints within each age group were performed using student’s t-testin Excel XP. All values in the figures and text are expressed asmeans of three animals’ ±SEM.

3. Results

3.1. Age-dependent increases in the percentage of AMs in the BAL fluid(Fig. 1)

Differential cell counts indicated that in all age groups, AMs werethe predominant cell type present in the BAL fluids (80.33 ± 4.16–92.67 ± 3.21%). Other cells were mostly polymorphonuclearneutrophils (PMNs) (6.33 ± 2.51–18.33 ± 5.03%) and lymphocytesrepresented 61% of total cells in the three age categories analyzed.The percent content of AMs in the BAL fluids increased significantlyfrom 5-day-old newborn piglets (80.33 ± 4.16%) to 40-day-old post-weaned (89.00 ± 3.00%) and 120-day-old young pigs (92.67 ±

Fig. 4. Expression levels of IL12b and TNFa were quantified using the same samples presented in Fig. 3. Data shown is an average of three pigs ± standard error. Kineticsexpression, (a) IL12b, and (c) TNFa. Values with different capital, capital italic and small letters denote a statistical difference among time points within 120 days, 40 days and5 days old animals, respectively (P < 0.05). The letter x (P < 0.001) and y (P < 0.05) indicate significant differences between LPS-treated and un-treated cells at each time point.Age-related changes, (b) IL12b, and (d) TNFa. Asterisks indicate significant differences among age groups at each time point. ��P < 0.001, and �P < 0.05.

M.A. Islam et al. / Cytokine 60 (2012) 707–717 711

3.21%). The percentage of PMNs decreased significantly fromnewborn piglets (18.33%) and post-weaned (10.33%) to young pigs(6.33%). Between newborn and post-weaned piglets, there was noappreciable change in the percentages of PMN cells.

3.2. Phagocytosis of opsonised particles increases with age (Fig. 2)

After 30 and 120 min incubation, the percentage of phagocyticAM cells in 5-day-old piglets (38.4 ± 4.51% and 42.8 ± 8.26%,respectively) was significantly lower than that of 120-day-oldyoung pigs (55.4 ± 7.37% and 63.2 ± 9.68%, respectively). On thecontrary, after 60 min incubation, there was no statistically differ-ence in the number of AMs that were able to ingest FITC-labeledE. coli (44.2 ± 8.35% in newborn piglets compared with58.0 ± 7.35% in young pigs). On the other hand, after 60 min incu-bation the phagocytic activity in 5-day-old piglets (44.2 ± 8.35%)was significantly lower than that of 40-day-old post-weaned pig-lets (58.4 ± 7.98%). In general, the result suggests that AMs fromnewborn born piglets had a significantly lower phagocytic capacitythan their post-weaned and young counterparts. The phagocyticactivity was not statistically different between post-weaned pig-lets and young pigs.

3.3. Time and age-dependent LPS effects on cytokine gene expressionin AMs

In order to examine the time-course effects of LPS on cytokineand chemokine mRNA expression, AM cells from 5-day (newborn

piglets), 40-day (post-weaned piglets) and 120-day (young) oldpigs were incubated for 1, 6, 12, 24, 36 and 48 h. In general, quan-titative cytokine mRNA expression was significantly affected bythe time of incubation and the age of animals (Figs. 3–6).

In newborn piglets and young pigs the expression of IL1b mRNAwas significantly increased, with a peak at 6 h after induction(Fig. 3a), and declined thereafter. The IL1b gene expression level in-creased between 6 and 24 h with a peak at 12 h in post-weanedpiglets (Fig. 3a). LPS initiated the significant up-regulation of theIL1b gene in young pigs during 6–36 h and post-weaned pigletsat 6 h compared with those of newborn piglets (Fig. 3b). The IL6gene rose significantly as early as 6 h, peaked at 12 h, and re-mained at higher levels up to 36 h in young and post-weaned pigs(Fig. 3c). In newborn piglets, IL6 mRNA expression was signifi-cantly increased only at 6 and 24 h compared to untreated cellsbut time-course expression was not significantly different(Fig. 3c). After stimulation, IL6 mRNA level remained significantlyhigher from 12 to 24 h in young compared to newborn piglets.No significant difference was observed between newborn andpost-weaned piglets.

The IL12b gene expression was significantly elevated in all agegroups as early as 6 h. The expression was highest at 12 h in youngand post-weaned pigs and 24 h in newborn piglets (Fig. 4a). Inyoung animals the IL12b mRNA expression was significantly higherthan newborns and post-weaned piglets at 6–12 h, and 12 h,respectively (Fig. 4b). The TNFa mRNA peaked at 6 h and remainedat significantly higher levels up to 24 h in all age groups (Fig. 4c).Only at 6 h of post LPS exposure, TNFa expression from AMs of

Fig. 5. Expression levels of IL18 and IL8 were quantified using the same samples presented in Fig. 3. Data shown is an average of three pigs ± standard error. Kineticsexpression, (a) IL18 and (c) IL8. Values with different capital, capital italic and small letters denote a statistical difference among time points within 120 days, 40 days and5 days old animals, respectively (P < 0.05). The letter x (P < 0.001) and y (P < 0.05) indicate significant differences between LPS-treated and un-treated cells at each time point.Age-related changes, (d) IL8. Asterisks indicate significant differences among age groups at each time point. ��P < 0.001, and �P < 0.05.

712 M.A. Islam et al. / Cytokine 60 (2012) 707–717

young pigs was higher than those of newborn piglets. No signifi-cant difference was observed between newborn and post-weanedpiglets (Fig. 4d). The IL18 mRNA level was first evident at 6 h inyoung, and at 12 h in newborn and post-weaned piglets (Fig. 5a).In all age groups, the expression peaked at 12 h and decreasedthereafter. The expression of IL18 was not significantly differentamong the age groups.

3.4. Time and age-dependent LPS effects on chemokine mRNAexpression by AMs

The chemokine IL8 mRNA expression underwent a massive ele-vation at 1 h and peaked at 6 h in post-weaned piglets. In youngand newborn pigs, IL8 showed sensitivity to LPS as early as 6 hwith peaked levels, and declined thereafter. Significant upregula-tion was maintained up to 36 and 48 h in both piglets and youngpigs, respectively (Fig. 5c). The IL8 expression trend showed signif-icant differences from 6 to 24 h between young and newborn ani-mals. At only 24 h, the young group showed higher expression thanthose of post-weaned piglets.

An increase of MIP2 mRNA expression was only observed be-tween 24 and 36 h in post-weaned pigs (Fig. 6a). No statisticallysignificant expression of MIP2 by AMs in young pigs and newbornpiglets was observed, as compared to un-treated cells (Fig. 6a). Therelative level of MIP2 was significantly higher during 24–36 h inyoung, and at 24 h in post-weaned piglets than those of newbornpiglets (Fig. 6b). The MCP1 mRNA expression showed a slight in-crease at 6 and 24 h in young animals but was not significantly de-

tected in newborn and post-weaned piglets (Fig. 6c). In age-relatedexpression, the MCP1 gene was significantly higher in young pigsonly at 36 h after LPS exposure, compare to newborn piglets.

3.5. Time and age-dependent LPS effects on cytokine release by AMs

In order to assay the time-course effects of LPS on cytokine andchemokine release, cell cultured supernatant fluids were collectedat 1, 6, 12, 24, 36 and 48 h from the three age groups. Overall, theconcentration of protein in supernatant was significantly affectedby the time of incubation and the age of animals (Figs. 7–9).

Following LPS exposure for 48 h, AMs released IL1b at 6 h with apeak at 24 h in all age groups (Fig. 7a). Except newborn piglets,IL1b remained at a higher level up to 48 h. In age-related changes,IL1b secretion was significantly higher from 6–24 h to 6–36 h inyoung animals than those of post-weaned and newborn piglets,respectively (Fig. 7b). Secretion of IL1b between newborn andpost-weaned piglets was not significantly different. LPS stimulatedAMs from all ages secreted significantly at higher levels of IL6 asearly as 1 h and plateaued between 6 and 24 h, compared to thoseof untreated cells. The highest concentration was observed at 24 inyoung, and at 6 h in newborn and post-weaned piglets. The IL8secretion from AMs of young pigs showed significant differencesfrom 6–24 h to 12–36 h than newborn and post-weaned piglets,respectively.

Release of IL12b was significantly detected as early as 6 h,peaked at 24 h and was maintained at higher concentrations upto 48 h in young, newborn and post-weaned pigs (Fig. 8a). All pigs

Fig. 6. Expression levels of MIP2 and MCP1 were quantified using the same samples presented in Fig. 3. Data shown is an average of three pigs ± standard error. Kineticsexpression, (a) MIP2 and (c) MCP1. Values with different capital and capital italic letters denote a statistical difference among time points within 120 days, 40 days and 5 daysold animals, respectively (P < 0.05). The letter x (P < 0.001) and y (P < 0.05) indicate significant differences between LPS-treated and un-treated cells at each time point. Age-related changes, (b) MIP2 and (d) MCP1. Asterisks indicate significant differences among age groups at each time point. �P < 0.05.

M.A. Islam et al. / Cytokine 60 (2012) 707–717 713

released IL12b early at 1 h, but not in a significant quantity. AMs ofyoung pigs released significantly more IL12b from 6 to 24 h thannewborn and post-weaned piglets (Fig. 8b). At 12 h, the concentra-tion was significantly higher in post-weaned than newborn piglets(Fig. 8b). The TNFa concentration was first detected at 1 h and re-mained significantly higher up to 48 h, with peak levels at 6 h inboth young and newborn animals as compared to untreated cells(Fig. 8a). Release of TNFa was significantly detected as early as1 h, peaked at 12 h and was maintained at higher concentrationsup to 48 h in post-weaned piglets (Fig. 8b). Between 6 and 12 h,the concentration was significantly higher in young than newbornpiglets (Fig. 8d). Secretion of TNFa between 12 and 24 h, the con-centration was significantly higher in post-weaned piglets thannewborn piglets (Fig. 8d).

3.6. Time and age-dependent LPS effects on chemokine secretion byAMs

The CXC motif chemokine IL8 secretion by LPS-stimulated AMsof young pigs showed a significant increase as early as 1 h, peakedat 6 h and continued at higher levels up to 48 h (Fig. 9a). In bothpiglets, IL8 release significantly increased at 6 h and remained ata higher level, compared with untreated cells, until the end of incu-bation period (Fig. 9a). In young pigs, a significantly increasingtrend was observed from 1 to 24 h as compared to both newbornand post-weaned piglets (Fig. 9b). IL8 secretion was significantlyhigher at 6 h in post-weaned piglets in comparison with newbornpiglets (Fig. 9b).

3.7. Comparison between mRNA expression and protein secretionlevels

In order to examine whether cytokine mRNA expression wasassociated with the secretion of the respective protein, we ana-lyzed the time-dependent expression manner between mRNAand protein levels (Supplementary Figs. 1–3). The IL1b mRNAexpression and protein secretion curve peaked at 6 h and 24 h,respectively, and decreased thereafter up to 48 h in young pigs.In post-weaned piglets, production (mRNA and protein) patternwas similar with a higher peak between 12 and 24 h post-induc-tion. In newborn piglets, the production curve was same between6 and 12 h; thereafter a discrepancy was observed (SupplementaryFig. 1). The IL6 distribution pattern of mRNA expression and pro-tein secretion was similar with a highest peak between 12 and24 h in young pigs. In post-weaned piglets, IL6 production (mRNAand protein) curve was somewhat consistent during 6–24 h with amild drop of the protein level at 12 h. In newborn piglets, theexpression pattern (mRNA and protein) clearly achieved its highestlevel at 6 h; but thereafter was not consistent (SupplementaryFig. 1).

The pro-inflammatory cytokine IL12b mRNA expression andprotein secretion was similar with a peak between 12 and 24 hin post-weaned and young pigs. On the other hand, the peakedcurve of IL12b (mRNA and protein) was clearly similar at 6 h innewborn piglets (Supplementary Fig. 2). The TNFa mRNA expres-sion and protein secretion curve was similar with a peak at 6 hand decreased thereafter in post-weaned and young pigs. In new-

Fig. 7. Concentration levels of pro-inflammatory cytokines protein by LPS-stimulated alveolar macrophages relative to that of un-treated cells. Alveolar macrophages(2 � 106 cells/mL/well) from 5-day-old newborn piglets, 40-day-old post-weaned piglets and 120-day-old young pigs were incubated with LPS (10 lg/mL). After stimulationfor 1, 6, 12, 24, 36, and 48 h, the supernatant fluids were collected for measurement of cytokines protein levels by ELISA. Data shown is an average of three pigs of each agegroup ± standard error. Kinetics concentrations, (a) IL1b and (c) IL6. Values with different capital, capital italic and small letters denote a statistical difference among timepoints within 120 days, 40 days and 5 days old animals, respectively (P < 0.05). The letter x (P < 0.001) and y (P < 0.05) indicate significant differences between LPS-stimulatedand un-stimulated cells at each time point. Age-related changes, (b) IL1b and (d) IL6. Asterisks indicate significant differences among age groups at each time point.���P < 0.0001, ��P < 0.001, and �P < 0.05.

714 M.A. Islam et al. / Cytokine 60 (2012) 707–717

born piglets, the expression curve shows highest peak at between 6and 12 h with decreasing and increasing tendency at 24 and 36 hpost-induction, respectively (Supplementary Fig. 2). The chemo-kine IL8 distribution pattern of mRNA and protein was almost sim-ilar in all age groups with a higher peak between 6 and 12 h anddecreased thereafter up to 48 h (Supplementary Fig. 3).

4. Discussion

It is becoming increasingly clear that many factors contribute tothe age-related susceptibility of neonates to bacterial infections ofthe respiratory system. In particular, the innate immune responseplays a critical role in the host’s defense. This strenuous host reac-tion to bacteria is influenced by the complex interplay betweengenetics, epigenetics and the environment, and can be organ spe-cific in regards of functional maturation [25–28]. Herein, we haveshown that a major component of the innate arm of the immunesystem in the lung of piglets, i.e. the AM population, is not com-pletely efficient in function when compared with young animals.In particular, several key functions of AMs such as phagocytosis,production of pro-inflammatory cytokine and chemokine in re-sponse to bacterial products appear to be less efficient in newbornsthan in older animals.

In the present study, first we describe the age-related changesin BAL fluid cellular content and phagocytic capacity of AMs for se-lected Gram-negative bacteria (fluorescein-labeled E. coli, K-12) innewborn, post-weaned piglets and young pigs. Alveolar macro-phages were relatively less abundant in structurally immaturelungs in newborn piglets. As AM cell density in the lung increasedwith advancement of age, however, phagocytic activity also in-creased with maturational changes of AMs in young pigs. In gen-eral, the phagocytic activity results suggest that AMs fromnewborn piglets had a significantly lower phagocytic capacity thantheir post-weaned and young counterparts. Consistent with earlierinvestigations [29,30], we observed that the phagocytosis percent-age of opsonised particles was significantly lower in 5-day-old pig-lets than older pigs. There was also a tendency of age-relatedchange in the proportion of phagocytic cells between post-weanedand young pigs, but statistically this was not significantly different.Thus, it may not be surprising that cells of the same lineage,namely AMs, present at a site of high antigenic challenge (thelungs), would be highly efficient in bacterial clearance. Alveolarmacrophage maturation, moreover, is likely influenced by themany changes occurring in the neonatal lung environment [31].For example, surfactant production and composition changespost-natally in pigs [32]. Moreover, changes both in the relativeproportions of cell types and in cellular functional maturity may

Fig. 8. Concentrations of cytokines protein IL12b and TNFa was assayed using the same samples presented in Fig. 7. Data shown is an average of three pigs ± standard error.Kinetics concentration, (a) IL1b and (c) IL6. Values with different capital, capital italic and small letters denote a statistical difference among time points within 120 days,40 days and 5 days old animals, respectively (P < 0.05). The letter x (P < 0.001) and y (P < 0.05) indicate significant differences between LPS-treated and un-treated cells at eachtime point. Age-related changes, (b) IL1b and (d) IL6. Asterisks indicate significant differences among age groups at each time point. ���P < 0.0001, ��P < 0.001, and �P < 0.05.

Fig. 9. Concentration of chemokine IL8 was assayed using the same samples presented in Fig. 7. Data shown is an average of three pigs ± standard error. Kineticsconcentration, (a) IL8. Values with different capital, capital italic and small letters denote a statistical difference among time points within 120 days, 40 days and 5 days oldanimals, respectively (P < 0.05). The letter x (P < 0.001) and y (P < 0.05) indicate significant differences between LPS-treated and un-treated cells at each time point. Age-related changes, (b) IL8. Asterisks indicate significant differences among age groups at each time point. ���P < 0.0001, ��P < 0.001, and �P < 0.05.

M.A. Islam et al. / Cytokine 60 (2012) 707–717 715

contribute to age-dependent improvement in AM performance[33]. Early impairment of AM function may be one factor underly-ing the enhanced susceptibility to pulmonary infections found inearly born neonates, as well as in newborn of other species.

Little is known so far about the age-related kinetic productionof pro-inflammatory cytokines and chemokines (both mRNA andprotein) by porcine AMs in response to LPS. In the present study,increased IL1b and IL12b mRNA expressions were accompanied

716 M.A. Islam et al. / Cytokine 60 (2012) 707–717

by increased production of protein in post-weaned and young pigsthan in newborn piglets in a time-dependent manner. This result issomewhat consistent with a previous report of decreased produc-tion of IL1b in newborn human babies compared to adults [34].IL1b and IL12b cytokines are secreted by monocytes and macro-phages in response to bacteria and bacterial products. However,these cytokines have pleiotrophic effects, which influence manyphysiological processes throughout the whole body [35]. The pres-ent work showed that age had an affect on IL6 and TNFa at mRNAand protein levels in a time-dependent manner, indicating a localresponse in the lung. This result was consistent with other reportsthat showed higher IL6 and TNFa concentrations in older piglets incomparison with those of newborn piglets [12–14]. The ability ofnewborn children to produce pro-inflammatory cytokines (likeIL6 and TNFa) was found to be lower compared to adults by manyresearchers [34,36,37]. In contrast, LPS did not differentially regu-late IL18 mRNA expression among age groups. This result is some-what consistent with earlier reports; that IL18 shows to LPSresponse in porcine AMs [38]. However, it has been suggested thatthe onset of the respiratory diseases or endotoxemia caused byGram-negative bacterial infection is induced by the expression ofpro-inflammatory cytokine, such as ILb, IL6, IL12b, TNFa [39–41].

From the present study, it also appears that the ability of AMs toproduce chemokines increased with advancement of age in a time-course manner. Following exposure to LPS, the production of IL8(both mRNA and protein) significantly increased as very early as1 h in all ages. This result is consistent with a previous study; thatporcine AMs are able to produce IL8 within 1 h after stimulation[42]. Induction of IL8 mRNA expression in porcine macrophagesby LPS has been reported [43], but this author did not include dif-ferent ages. On the other hand, the kinetics mRNA level of MIP2and MCP1 was also significantly higher in older pigs than in new-born piglets. In general, the chemokines are involved in the onsetof inflammation; it mediates mainly the chemotaxis of macro-phages and monocytes by controlling leukocyte recruitment andclearance of pathogens [44–47].

It is generally accepted that newborn and early postnatal pigsare analogously to newborn children more susceptible to a widerange of infectious diseases compared to adults [1]. The discussionof inflammatory mediators production in relation to sensitivity ofpostnatal piglets and young pigs to LPS is difficult. However, thefindings of the present study may be plausible that age-associatedproduction of pro-inflammatory cytokine and chemokine by AMsmay be a significant factor in pulmonary host defense and in thepathogenesis of pulmonary infections. The reasons for differencesin cytokine and chemokine production in pigs may reflect matura-tion of immune cells which indicate functional differences of cellpopulation. At present there are very limited reports on geneticvariation in pig inflammatory mediator production levels. Apartfrom genetic differences in immune capacity, epigenetic and envi-ronment can also be considered as an important determinant ofcytokine and chemokine production.

Furthermore, we observed that the time-dependent comparisonbetween cytokine/chemokine mRNA expression (by qRT-PCR) andcorresponding protein secretion (by ELISA) was not always consis-tent over the incubation time of cells in all ages (SupplementaryFigs. S1–S3). In general, almost similar production curves betweenthe levels of mRNA transcription and the respective secreted pro-teins were found during 6–24 h of stimulation period. From thisdata, we could not explain in detail how protein release is regu-lated by cytokine mRNA with age. However, a good relation be-tween mRNA expression and protein secretion would beexpected for cytokines and chemokine when both are assayed atthe same time of culture and within 24 h after stimulation [48].It has been reported that kinetics TNFa mRNA (qRT-PCR) was notfollowed by a protein response (ELISA) in LPS-induced porcine

blood mononuclear cells [49]. The differences observed could beexplained by the test system used and variability among samplesmust be taken into consideration. On the other hand, biological fac-tors of importance could be the post-transcriptional and post-translational regulation of protein production, for example,through processes that influence mRNA stability and efficiency oftranslation. The miRNA directly or indirectly regulate the expres-sion of cytokine genes, post-translational regulation of protein syn-thesis and influence the innate immune response of the host[50,51]. From the present study, it also appeared that age and incu-bation time has a significant effect on mRNA expression and pro-tein secretion in pigs. It cannot be excluded that age andindividual animal variation-related factors affect the post-tran-scriptional regulation of cytokine production.

In conclusion, the phagocytic activity and the ability of AMsfrom newborn piglets to produce pro-inflammatory cytokinesand chemokines were reduced compared to older pigs in a time-dependent manner. These may reflect the development of the rel-atively immature immune system and influence the pathogenesisof pulmonary infection in pigs. Besides cytokines, other compo-nents of innate immunity could play a role in defense against infec-tion [52]. The reasons for genetic differences and influences incytokine and chemokine production in pigs are unknown with re-spect to the present state of knowledge. However, we can only the-orize that many factors are responsible including the increasingability of phagocytes to respond to the stimulators, maturation ofsignaling pathways and a numerical decrease and an increase inmaturity of phagocytes from the newborn to young BAL fluid.These factors were all observed in the present study. These mech-anisms exist in the age-dependent changes [53], the understandingof ontogeny of the cytokine and chemokine production could helpto explain the practical questions regarding a higher susceptibilityof newborn piglets to infectious diseases. It will be of concern tolearn to what extent genetic and age-related factors contribute tothe variation in cytokine and chemokine production in pigs. Suchknowledge will unwrap an era in obtaining better immunologicalresistance through breeding programmes.

Acknowledgements

This Project was supported by the Gene Dialog Project, FUGATOPlus, BMBF, Grant No.: 0315130C, Germany. The authors are in-debted to Ludger Buschen in the Research Station ‘‘Frankenforst’’at University of Bonn for providing pigs. Authors are also thankfulto Ms. Maren Pröll, Ms. Christiane Neuhoff and Ms. Nadine Leyerfor their assistance during the experiment.

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.cyto.2012.08.011.

References

[1] Cutler RS, Fahy VA, Cronin GM, Soicer EM. Preweaning mortality. In: Straw BE,Zimmerman JJ, D́Allaire S, Taylor DJ, editors. Diseases of swine. IA(USA): Blackwell Publishing; 2006. p. 993–1011.

[2] Sherman M, Goldstein E, Lippert W, Wennberg R. Neonatal lung defensemechanisms: a study of the alveolar macrophage system in neonatal rabbits.Am Rev Respir Dis 1977;116:433–40.

[3] Kurland G, Cheung AT, Miller ME, Ayin SA, Cho MM, Ford EW. The ontogeny ofpulmonary defenses: alveolar macrophage function in neonatal and juvenilerhesus monkeys. Pediatr Res 1988;23:293–7.

[4] Conly ME, Speert DP. Human neonatal monocyte-derived macrophages andneutrophils exhibit normal nonopsonic and opsonic receptor-mediatedphagocytosis and superoxide anion production. Biol Neonate 1991;60:361–6.

[5] Speer CP, Gahr M, Wieland M, Eber S. Phagocytosis-associated functions inneonatal monocyte-derived macrophages. Pediatr Res 1988;24:213–6.

M.A. Islam et al. / Cytokine 60 (2012) 707–717 717

[6] Cheung AT, Kurland G, Miller ME, Ford EW, Ayin SA, Walsh EM. Host defensedeficiency in newborn nonhuman primate lungs. J Med Primatol1986;15:37–47.

[7] Mills EL. Mononuclear phagocytes in the newborn: their relation to the state ofrelative immunodeficiency. Am J Pediatr Hematol Oncol 1983;5:189–98.

[8] Coonrod JD, Jarrells MC, Bridges RB. Impaired pulmonary clearance ofpneumococci in neonatal rats. Pediatr Res 1987;22:736–42.

[9] Marodi L. Neonatal innate immunity to infectious agents. Infect Immun2006;74:1999–2006.

[10] Zelnickova P, Leva L, Stepanova H, Kovaru F, Faldyna M. Age-dependentchanges of proinflammatory cytokine production by porcine peripheral bloodphagocytes. Vet Immunol Immunopathol 2008;124:367–78.

[11] Mikami O, Muneta Y, Mori Y, Yokomizo Y, Nakajima Y. Expression ofproinflammatory cytokine mRNA in the lymphatic organs of adult andneonatal pigs. Vet Immunol Immunopathol 2002;90:203–7.

[12] Moya SL, Boyle LA, Lynch PB, Arkins S. Age-related changes in proinflammatorycytokines, acute phase proteins and cortisol concentrations in neonatal piglets.Biol Neonate Neonatol 2007;91:44–8.

[13] Islam MA, Cinar MU, Uddin MJ, Tholen E, Tesfaye D, Looft C, et al. Expression oftoll-like receptors and downstream genes in lipopolysaccharide-inducedporcine alveolar macrophages. Vet Immunol Immunopathol 2012;146:62–73.

[14] Matteri RL, Klir JJ, Fink BN, Johnson RW. Neuroendocrine-immune interactionsin the neonate. Domest Anim Endocrinol 1998;15:397–407.

[15] Choi IS, Shin NR, Shin SJ, Lee DY, Cho YW, Yoo HS. Time course study ofcytokine mRNA expression in LPS-stimulated porcine alveolar macrophages. JVet Sci 2002;3:97–102.

[16] Yoo HS, Maheswaran SK, Lin G, Townsend EL, Ames TR. Induction ofinflammatory cytokines in bovine alveolar macrophages followingstimulation with Pasteurella haemolytica lipopolysaccharide. Infect Immun1995;63:381–8.

[17] Reddy NR, Borgs P, Wilkie BN. Cytokine mRNA expression in leukocytes ofefferent lymph from stimulated lymph nodes in pigs. Vet ImmunolImmunopathol 2000;74:31–46.

[18] Greenbaum D, Colangelo C, Williams K, Gerstein M. Comparing proteinabundance and mRNA expression levels on a genomic scale. Genome Biol2003;4:117.

[19] Nie L, Wu G, Zhang W. Correlation of mRNA expression and protein abundanceaffected by multiple sequence features related to translational efficiency inDesulfovibrio vulgaris: a quantitative analysis. Genetics 2006;174:2229–43.

[20] Gry M, Rimini R, Stromberg S, Asplund A, Ponten F, Uhlen M, et al. Correlationsbetween RNA and protein expression profiles in 23 human cell lines. BMCGenomics 2009;10:365.

[21] ZDS. Richtlinie für die Stationsprüfung auf Mastleistung, Schlachtkörperwertund Fleischbeschaffenheit beim Schwein; 2003 [10.12.03].

[22] Loike JD, Silverstein SC. A fluorescence quenching technique using trypan blueto differentiate between attached and ingested glutaraldehyde-fixed red bloodcells in phagocytosing murine macrophages. J Immunol Methods1983;57:373–9.

[23] Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologistprogrammers. In: Krawetz S, Misener S, editors. Bioinformatics methods andprotocols: methods in molecular biology. Totowa (NJ): Humana Press; 2000.

[24] Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al.Accurate normalization of real-time quantitative RT-PCR data by geometricaveraging of multiple internal control genes. Genome Biol 2002;3[RESEARCH0034].

[25] Barnes KC. Genetic determinants and ethnic disparities in sepsis-associatedacute lung injury. Proc Am Thorac Soc 2005;2:195–201.

[26] Garcia JG, Moreno Vinasco L. Genomic insights into acute inflammatory lunginjury. Am J Physiol Lung Cell Mol Physiol 2006;291:L1113–7.

[27] Raz E. Organ-specific regulation of innate immunity. Nature Immunol2007;8:3–4.

[28] Sokka T, Abelson B, Pincus T. Mortality in rheumatoid arthritis: 2008 update.Clin Exp Rheumatol 2008;26:S35–61.

[29] Dickie R, Tasat DR, Alanis EF, Delfosse V, Tsuda A. Age-dependent changes inporcine alveolar macrophage function during the postnatal period ofalveolarization. Dev Comp Immunol 2009;33:145–51.

[30] Zeidler RB, Kim HD. Phagocytosis, chemiluminescence, and cell volume ofalveolar macrophages from neonatal and adult pigs. J Leukoc Biol1985;37:29–43.

[31] Farver CF, Kobzik L. Lung macrophage differentiation antigens in developingfetal and newborn rat lungs: a quantitative flow cytometric analysis withimmunohistochemistry. Lung 1999;177:205–17.

[32] Rau GA, Vieten G, Haitsma JJ, Freihorst J, Poets C, Ure BM, et al. Surfactant innewborn compared with adolescent pigs: adaptation to neonatal respiration.Am J Respir Cell Mol Biol 2004;30:694–701.

[33] Weiss RA, Chanana AD, Joel DD. The status of pulmonary host defense in theneonatal sheep: cellular and humoral aspects. Ann NY Acad Sci1985;459:40–55.

[34] Peters AM, Bertram P, Gahr M, Speer CP. Reduced secretion of interleukin-1and tumor necrosis factor-alpha by neonatal monocytes. Biol Neonate1993;63:157–62.

[35] Dinarello CA, Muegge K, Durum SK. Measurement of soluble and membrane-bound interleukin 1 using a fibroblast bioassay. Curr Protoc Immunol 2001[chapter 6:unit 6 2].

[36] Chang M, Suen Y, Lee SM, Baly D, Buzby JS, Knoppel E, et al. Transforminggrowth factor-beta 1, macrophage inflammatory protein-1 alpha, andinterleukin-8 gene expression is lower in stimulated human neonatalcompared with adult mononuclear cells. Blood 1994;84:118–24.

[37] Schibler KR, Trautman MS, Liechty KW, White WL, Rothstein G, ChristensenRD. Diminished transcription of interleukin-8 by monocytes from pretermneonates. J Leukoc Biol 1993;53:399–403.

[38] Oem JK, Song HJ, Kang SW, Jeong WS. Cloning, sequencing, and expression ofporcine interleukin-18 in Escherichia coli. Mol Cells 2000;10:343–7.

[39] Murtaugh MP, Baarsch MJ, Zhou Y, Scamurra RW, Lin G. Inflammatorycytokines in animal health and disease. Vet Immunol Immunopathol1996;54:45–55.

[40] Fossum C, Wattrang E, Fuxler L, Jensen KT, Wallgren P. Evaluation of variouscytokines (IL-6, IFN-alpha, IFN-gamma, TNF-alpha) as markers for acutebacterial infection in swine – a possible role for serum interleukin-6. VetImmunol Immunopathol 1998;64:161–72.

[41] Nakagawa M, Oono H, Nishio A. Enhanced production of IL-1beta and IL-6following endotoxin challenge in rats with dietary magnesium deficiency. J VetMed Sci 2001;63:467–9.

[42] Lin G, Pearson AE, Scamurra RW, Zhou Y, Baarsch MJ, Weiss DJ, et al.Regulation of interleukin-8 expression in porcine alveolar macrophages bybacterial lipopolysaccharide. J Biol Chem 1994;269:77–85.

[43] Sacco RE, Nibbelink SK, Baarsch MJ, Murtaugh MP, Wannemuehler MJ.Induction of interleukin (IL)-1beta and IL-8 mRNA expression in porcinemacrophages by lipopolysaccharide from Serpulina hyodysenteriae. InfectImmun 1996;64:4369–72.

[44] Dawson TC, Beck MA, Kuziel WA, Henderson F, Maeda N. Contrasting effects ofCCR5 and CCR2 deficiency in the pulmonary inflammatory response toinfluenza a virus. Am J Pathol 2000;156:1951–9.

[45] Dessing MC, van der Sluijs KF, Florquin S, van der Poll T. Monocytechemoattractant protein 1 contributes to an adequate immune response ininfluenza pneumonia. Clin Immunol 2007;125:328–36.

[46] Harada A, Sekido N, Akahoshi T, Wada T, Mukaida N, Matsushima K. Essentialinvolvement of interleukin-8 (IL-8) in acute inflammation. J Leukoc Biol1994;56:559–64.

[47] Melgarejo E, Medina MA, Sanchez-Jimenez F, Urdiales JL. Monocytechemoattractant protein-1: a key mediator in inflammatory processes. Int JBiochem Cell Biol 2009;41:998–1001.

[48] Verfaillie T, Cox E, To LT, Vanrompay D, Bouchaut H, Buys N, et al. Comparativeanalysis of porcine cytokine production by mRNA and protein detection. VetImmunol Immunopathol 2001;81:97–112.

[49] Sorensen NS, Skovgaard K, Heegaard PM. Porcine blood mononuclear cellcytokine responses to PAMP molecules: comparison of mRNA and proteinproduction. Vet Immunol Immunopathol 2011;139:296–302.

[50] Asirvatham AJ, Magner WJ, Tomasi TB. MiRNA regulation of cytokine genes.Cytokine 2009;45:58–69.

[51] Bi Y, Liu G, Yang R. MicroRNAs: novel regulators during the immune response.J Cell Physiol 2009;218:467–72.

[52] Elahi S, Buchanan RM, Attah-Poku S, Townsend HG, Babiuk LA, Gerdts V. Thehost defense peptide beta-defensin 1 confers protection against Bordetellapertussis in newborn piglets. Infect Immun 2006;74:2338–52.

[53] Levy O. Innate immunity of the newborn: basic mechanisms and clinicalcorrelates. Nature Rev Immunol 2007;7:379–90.