Afifah Asli Bcr3055

7/30/2019 Afifah Asli Bcr3055

http://slidepdf.com/reader/full/afifah-asli-bcr3055 1/11

R E S E A R C H A R T I C L E Open Access

Sensitization of epithelial growth factor receptorsby nicotine exposure to promote breast cancercell growth

Takashi Nishioka1, Hyun-Seok Kim1,2, Ling-Yu Luo3, Yi Huang1, Jinjin Guo1 and Chang Yan Chen1*

Abstract

Introduction: Tobacco smoke is known to be the main cause of lung, head and neck tumors. Recently, evidence

for an increasing breast cancer risk associated with tobacco smoke exposure has been emerging. We and other

groups have shown that nicotine, as a non-conventional carcinogen, has the potential to facilitate cancer genesisand progression. However, the underlying mechanisms by which the smoke affects the breast, rather than the

lung, remain unclear. Here, we examine possible downstream signaling pathways of the nicotinic acetylcholine

receptor (nAChR) and their role in breast cancer promotion.

Methods: Using human benign MCF10A and malignant MDA-MB-231 breast cells and specific inhibitors of

possible downstream kinases, we identified nAChR effectors that were activated by treatment with nicotine. We

further tested the effects of these effector pathways on the regulation of E2F1 activation, cell cycle progression and

on Bcl-2 expression and long-term cell survival.

Results: In this study, we demonstrated a novel signaling mechanism by which nicotine exposure activated Src to

sensitize epidermal growth factor receptor (EGFR)-mediated pathways for breast cancer cell growth promotion.

After the ligation of nAChR with nicotine, EGFR was shown to be activated and then internalized in both MCF10A

and MDA-MB-231 breast cancer cells. Subsequently, Src, Akt and ERK1/2 were phosphorylated at different time

points following nicotine treatment. We further demonstrated that through Src, the ligation of nicotine with nAChRstimulated the EGFR/ERK1/2 pathway for the activation of E2F1 and further cell progression. Our data also showed

that Akt functioned directly downstream of Src and was responsible for the increase of Bcl-2 expression and long-

term cell survival.

Conclusions: Our study reveals the existence of a potential, regulatory network governed by the interaction of

nicotine and nAChR that integrates the conventional, mitogenic Src and EGFR signals for breast cancer

development.

Introduction

Tobacco smoke is strongly linked to the onset of various

types of human malignancies. According to epidemiolo-

gical studies, about 30% of cancer deaths every year in

the United States are associated with exposure to

tobacco smoke or tobacco products, indicating the

importance and urgency for cessation of active and pas-

sive cigarette smoke [1,2]. Tobacco smoke is known to

be the main cause of lung, head and neck tumors

[1,3-5]. Recently, evidence has been emerging for the

increasing breast cancer risk associated with tobacco

smoke exposure [6-9]. Nicotine, one of the important

constituents of tobacco interacts with nicotine acetyl-

choline receptors (nAChR) and functions in either the

motor endplate of muscle or at the central nervous sys-

tem for the establishment of tobacco addiction [10-13].

Studies also showed that nAChR is expressed in various

non-neuronal cells and the ligation of the receptor acti-

vates various intracellular signaling pathway s in thes e

cells, suggesting that nicotine has the potential to regu-

late cell proliferation [14-16]. It was reported that nico-

tine potently induced secretion of different types of

* Correspondence: [email protected] Israel Deaconess Medical Center, Harvard Medical School, 330

Brookline Avenue, Boston, MA, 00215, USA

Full list of author information is available at the end of the article

Nishioka et al . Breast Cancer Research 2011, 13:R113

http://breast-cancer-research.com/content/13/6/R113

© 2011 Nishioka et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.

mailto:[email protected]

http://creativecommons.org/licenses/by/2.0

http://creativecommons.org/licenses/by/2.0

mailto:[email protected]



calpain from lung cancer cells, which then promoted

cleavage of various substrates in the extracellular matrix

to facilitate metastasis and tumor progression [5]. In

mammary epithelial or tumor cells, the exposure of

nicotine initiated a signaling cascade that involved PKC

(protein kinase C) and cdc42, and consequently acceler-

ated cell migration [7]. Furthermore, the anti-apoptotic

property of nicotine in breast cancer cells has been

demonstrated to be through upregulation of Bcl-2 family

members [8]. The addition of nicotine desensitized

MCF7 cells to doxorubicin-mediated cyctoxicity [17].

All these data indicate that nicotine plays a positive role

in the regulation of cell growth and survival. However,

the underlying mechanisms of nicotine in facilitating

mitogenic activities remain unclear.

nAChR consists of nine a-subunits (a2 to 10) and two

b-subunits (b2 and 4) [10-13]. The subunits of nAChR

form heteromeric or homoeric channels in differentcombinations in neuronal cells, which are highly Ca++

permeable to allow the penetration of Ca++ flux [10-13].

Upon the engagement with nAChR in non-neuronal

cells, nicotine activates calmodulin-dependent protein

kinase II, PKC, phosphodylinositol-3-kinase (PI3K)/Akt

and Rac family that are often involved in the regulation

of cell growth, adhesion or migration [7,18-20]. The

activation of nicotine receptors was also shown to trig-

ger Ras/Raf/MEK/ERK–Ras/Raf/MEK (mitogen-activated

protein kinase)/ERK (extracellular-signal-reguated

kinase)– signaling [7,21,22]. In addition, the involvement

of nicotine in the activation of the tyrosine kinase JAK-2

(Janus Kinase-2) and transcription factor STAT-3 (Sig-

nal Transducer and Activator of Transcription-3) in oral

keratinocytes was also observed [22].

The epidermal growth factor receptor (EGFR) is a

transmembrane protein receptor that possesses an

intrinsic tyrosine kinase activity [23,24]. The EGFR

family consists of several members, including EGFR,

ERBB2/HER2/NEU, ERBB3 and ERBB4. The ligation of

EFGR activates mitogenic-related signaling pathways,

leading to various cellular responses. An increased

level of mutation of EGFR has been detected in many

human tumors, including breast cancer, which were

often accompanied with a poor prognosis [25 ,26 ].Upon growth factor stimulation, EGFR undergoes con-

formational changes and being phosphorylated, fol-

lowed by being internalizated [24-26]. EGFR signaling

subsequently mobilizes multiple signaling cascades,

including MAPK (microtubule-associated protein

kinase), PI3K (phosphodylinositol-3-kinase) and STAT

(signal transducer and activator of transcription) path-

ways. However, a specific biological outcome, following

EGFR activation, is determined by cross-talk or coop-

eration of its downstream effectors and parallel

pathways.

As with EGFR, nAChR subunits appear to be activated

through tyrosine phospohrylation [18,27]. Using Xeno-

pus oocytes, neuroblastoma or other types of cells, it

was shown that the a7 subunit of nAChRs was regu-

lated by tyrosine phosphorylation and Src family kinases

[18]. The treatment of colon cancer cells with nicotine

activated c-Src as well as augmented EGFR expression

[28]. Furthermore, in the colon cancer xenograft model,

inhibitors of EGFR and Src dramatically blocked the

tumor formation promoted by nicotine injection [29].

All studies suggest the existence of cooperation between

nAChR and EGFR.

During the process of tumor initiation and progres-

sion, aberrant growth signaling plays an important role

in the perturbation of growth restriction and cell cycle

checkpoints. Numerous factors play a role in the regula-

tion of this process, which includes growth factors,

kinases, phosphatases as well as extracellular matrixcomponents. Growth receptors, when interacting with

corresponding ligands, initiate the process of cell cycle

progression and migration in cells. In order to success-

fully transmit signaling from the membrane to the

nucleus, receptors appear to communicate with each

other to modulate the magnitude of signaling cascades

and further activate transcription factors for the promo-

tion of various biological processes. Nicotine has been

demonstrated to induce nAChR phosphorylation, which

further stimulated the dissociation of E2F1 from Rb and

subsequent binding to cdc6 and cdc25A promoters for

cell cycle progression in lung cancer cells [18]. These

events which are induced by nicotine are most likely

responsible for the increase of breast cancer risk by

active or passive tobacco smoking.

In this study, we demonstrate a novel signaling

mechanism whereby nAChR promotes breast cell

growth through the sensitization of EGFR-mediated sig-

naling. Upon nicotine-induced EGFR activation, Src, Akt

and ERK1/2 were phosphorylated in MCF10 and MDA-

MB-231 breast cancer cells, leading to the upregulation

of E2F-1, Bcl-2 expression, and long-term cell survival.

In this process, Src functioned directly downstream of

nAChR to activate EGFR/ERK1/2 as well as Akt path-

ways, respectively. The identification of the cross-talkbetween nicotine and EGFR connected through Src pro-

vides a new insight into the potential carcinogenic effect

of tobacco smoke on the breast.

Materials and methods

Cells, reagents and infection procedure

Human benign MCF10A and malignant MDA-MB-231

breast cancer cells were purchased from ATCC (Mana-

ssas, VA, USA). MCF10A cells were cultured in

DMEM/F12 medium supplemented with 5% donor

horse serum and antibiotics without growth factors.



of 11



MDA-MB-231 cells were maintained in Dulbecco’s

Modified Eagle’s Medium (DMEM) with 10% fetal calf

serum, 4 mM L-glutamine and antibiotics. dn-Src or dn-

Akt (dominant-negative Src or Akt ) was inserted into

MSCV (murine stem cell virus) retroviral vector and

subsequently transiently infected into the cells.

Nicotine and the nAChR inhibitor mecamylamine

hydrochloride (MCA) were purchased from Sigma-

Aldrich, Inc. (St. Louis, MO, USA). The Akt inhibitor

KP372-1 and the ERK inhibitor PD98059 were obtained

from EMD Chemicals Inc. (San Diego, CA, USA). The

antibodies were purchased from BD Parmingen (La

Jolla, CA, USA).

The procedure for the infection with genes inserted in

the MSCV retroviral vector was detailed in the User

Manual provided by the company (BD Biosciences Clon-

tech, Heidelberg, Germany). Briefly, after co-transfected

expression vector, Gag and Env constructs, PT67 cellswere grown for 48 hours. Subsequently, the medium

was collected for the infection.

The experiments performed in this study do not

require Institute Ethics Board approval, because only

commercially available cell lines were used.

Immunoblotting

Following treatment, cell lysates were prepared and pro-

teins were separated by SDS-PAGE gels. Membranes

were incubated with the designated primary antibody

(1:1000 for all antibodies) overnight in a cold-room at 4°

C. Bound primary antibodies were reacted with corre-

sponding second antibodies for 2 hours and detected by

chemiluminescence. The anti-phosphor-EGFR (tyr-

1068), EGFR, phosphor-E2F, E2F, phosphor-Src, Src and

Bcl-2 antibodies were purchased from Santa Cruz, Inc.

The anti-phosphor-PDGFRb, PDGFRb, phosphor-ERK1/

2, ERK1/2, phosphor-Akt and Akt antibodies were from

Cell Signaling Technology, Inc, Donvers, MA, USA

GST/Grb2 pull-down assay

GST/Grb2 fusion protein was purchased from Invitro-

gen. After treatments, cell lysates were incubated with

the fusion protein (1 μg) immobilized on glutathione-

sepharose beads as indicated in the protocol providedby the company. Bound proteins were washed and sub-

jected to SDS-PAGE.

ChIP assay

After treatments, cells were cross-linked with 1% formalde-

hyde for 15 minutes at room temperature. The cross-link-

ing was stopped by the addition of glycine. Cells were

harvested and sonicated. Lysates were immunoprecipitated

with the corresponding antibodies. The different bindings

of E2F1, Rb to cdc25A were analyzed by PCR. The

sequences of the primers used are: cdc25A promoter size

of 209 bp (5’-tctgctgggagttttcattgacctc and 3’-ttggcgccaaacg-

gaatccaccaatc); c-Fos promoter size of 209 bp (5’-

tgttggctgcagcccgcgagcagttc and 3’-ggcgcgtgtcctaatctcgtgag-

cat) [18]. PCR products were resolved on a gel.

[3H]thymidine incorporation

Cells were grown in Petri dishes until 60% to 70% con-

fluence and five wells were for the control and each

treatment. The cells were cultured in medium contain-

ing 0.5% serum for 24 hours. Subsequently, the cells

were grown in fresh medium containing 0.5% of serum

plus 4 μCi/ml of [3H]thymidine (Perkin Elmer Life

Sciences, Waltham, MA, USA) with or without various

treatments. The cells were labeled for 8 hours at 37°C.

After precipitation with cold 10% trichloroacetic acid,

the cells were dissolved in 0.5 ml of 0.1 M NaOH over-

night at 4°C. The amount of radioactivity in each sample

was counted using a scintillation machine.

Cell proliferation assay

Cells (2 × 105) were plated in 12-well plates and cul-

tured in medium containing 0.5% serum, which is desig-

nated as day 1. Subsequently, the cells with or without

nicotine treatment were grown for another three days.

The numbers of viable cells were determined by trypan

blue staining and counted daily using a hemocytometer.

Colony formation assay

Cells (250 cells/plate) were seeded in 100 mm-Petri

dishes and cultured in growth medium containing nico-

tine alone or nicotine plus other inhibitors for ten days.

The medium with nicotine or its combination with

other inhibitors was changed every four days. After

staining, the numbers of colony were counted.

Statistical analysis

Three to five independent repeats were conducted in all

experiments. Error bars represent these repeats. A Stu-

dent’s T test was used and a P value of < 0.05 was con-

sidered significant.

Results

EGFR was activated and internalized in breast cancer cellsfollowing treatment with nicotine

Upregulation of EGFR signaling plays an important role

in breast cancer development and cooperation between

nAChR and EGFR has been suggested in cancer progres-

sion [29,30]. However, the mechanisms by which cigar-

ette smoke or nicotine exposure promotes breast

tumorigenesis remain unclear. This study aimed at inves-

tigating the existence of a cross-talk between nAChR and

EGFR for the promotion of breast cancer growth. After

treatment with nicotine at different time points, a cell

lysate (without the nucleus) was prepared from human



of 11



breast cancer MCF10A or MDA-MB-231 cells and the

expression of EGFR was then tested by immunoblotting

(Figure 1A). The levels of EGFR in the lysate from cells

treated with nicotine for 30 minutes or 1 hour were simi-

lar to those in untreated cells. Interestingly, EGFR (>

85%) became undetectable in the lysate extracted from

MCF10A cells treated with nicotine for 2 hours. In the

presence of MCA (a nAChR inhibitor), the level of EGFR

in the same cells subjected to the same treatment did not

decline (Figure 1B). It appears that the disappearance of

EGFR was specifically triggered by nicotine treatment.

Upon motigenic activation, EGFR is often seen to be

phosphorylated at its tyrosine residues and then being ter-

minated [23]. Since EGFR in the cells became undetectable

2 hours after nicotine exposure, the phosphorylation status

of the receptor at an earlier time point (1 hour) in the

treatment was examined (Figure 1C). The lysates from

untreated or treated cells were immunoprecipitated withan anti-EGFR antibody and then subjected to immuno-

blotting, using the anti-phosphor-tyrosine antibody (Figure

1C). The phosphorylated EGFR in MCF10A cells was

recognized by the antibody 1 hour after the treatment,

which was abrogated by the addition of either MCA or

AG1478 (an EGFR inhibitor). For confirmation purposes,

the phosphor-(Tyr1068)-EGFR antibody was also used to

detect EGFR phosphorylation status and a similar result as

that shown in Figure 1C was obtained (Figure 1D). It is

known that through association with Grb2, active EGFR

triggers a cascade of its downstream effectors [31]. To test

whether nicotine-activated EGFR was able to bind to

Grb2, MCF10A cells were treated with nicotine or EGFR

and immunoprecipitation was then performed (Figure 1E).

The receptor was found to be bound to a GST (glu-

tathione-S-transferase)/Grb2 fusion protein in either nico-

tine- or EGF-treated cells, but not in untreated control

cells. The data further suggested that the ligation of nico-

tine with nAChR stimulated EGFR.

EGFR in breast cancer cells is specifically activated bynicotine ligation

To test if nAChR activation might globally sensitize cell

surface receptors, MCF10A cells were treated with

0 30’ 1 h 2 h

MCF10A

EGFR

actin

0 30’ 1 h 2 h nicotine

MDA-MB-231A

EGFR

0 1 h 2 h nicotine

actin

- + + MCA

MCF10AB

- + EGF (0.5 M, 30’) nicotien (0.5 M, 1h)

EGFR

Grb2

E

- +

EGFR

Grb2

- + + +- - + -- - - +

nicotine (1h)MCAAG1478

D MCF10A

actin

p-EGFR (tyr-1068)p-EGFR

- + + +- - + -- - - +

nicotine (1h)MCAAG1478

C MCF10A

EGFR

Figure 1 Activation of EGFR in human breast cancer cells after nicotine treatment . (A) Human MCF10A and MDA-MB-231 cells were

treated with nicotine (0.5 μM) for various times and cell lysates (without nucleus) were extracted for testing EGFR expression by immunoblot.

The blot was re-probed with an anti-b-actin Ab for loading control. (B) Expression of EFGR in nicotine-treated MCF10A cells in the presence of

MCA (50 nM) was analyzed by immunoblot. The blot was re-probed with an anti-b-actin antibody for loading control. (C and D) MCF10A cells

were treated with MCA (50 nM) or AG1478 (100 nM) for 15 minutes prior to 1 hour of nicotine exposure. The phospohrylation pattern of EGFR

in nicotine-treated MCF10A cells was examined by immunoprecipitation with anti-EGFR antibody and immunoblotting with the anti-phosphor-

tyrosine antibody, or immunoblotting with the anti-phosphor (Tyr 1068) antibody. The blot was re-probed with an anti-EGFR antibody for

loading control.(E) With or without treatment with nicotine (left panels) or EGF (right panels), the cell lysates were extracted and precipitated

with glutathione S-transferase/growth factor receptor-bound protein 2 (GST/Grb2) fusion protein. Subsequently, the precipitates were subjected

to immunoblotting. The blot was also re-probed with anti-Grb2 antibody for the control.



of 11



nicotine for 2 hours and immunoblotting was performed

using anti-platelet growth factor b subunit (PDGFRb)

antibody (Figure 2A). Unlike EGFR, the level of PDGFR

in nicotine-treated cells was unchanged. To further test

the activation status of PDGFR, MCF10A cells were

treated with PDGF for 30 minutes or nicotine for 1

hour and immunoblotting was performed using the

anti-phosphor-PDGFRb antibody (Figure 2B). The

receptor was phosphorylated after treatment with

PDGF, as expected. However, the phosphor-PDGFRb

was unable to be visualized by the antibody in nicotine-

treated cells. These data suggested that the sensitization

or internalization of EGFR in breast cancer cells is spe-

cifically induced by nicotine exposure.

Downstream effector kinases were activated after

nicotine treatment

It is known that tyrosine kinase Src is not only down-stream of EGFR but also of nAChR [29,30]. Thus, the

activation status of Src in MCF10A cells was examined

after nicotine treatment at different time points (Figure

3A, upper two lanes). Src was not activated in untreated

cells. However, this kinase was phosphorylated 1 hour

after nicotine exposure and an increased amount of the

active form of this kinase was present in the cells 2

hours following treatment.

Akt and ERK1/2 often exert as receptor downstream

effectors of EGFR or Scr in mitogen-induced responses.

The phosphorylation status of these kinases was also

examined after MCF10A cells were treated with nicotine.

Two hours after nicotine treatment, the phosphorylated

forms of ERK1 and 2 were detected by the antibody in

the cells (Figure 3A, middle two lanes). Also, a high level

of phospohrylated Akt was detected by the antibody 1

hour after nicotine exposure and a smaller amount of the

phosphorylated protein was seen at 2 hours of the treat-

ment (Figure 3A, bottom two lanes). The same activation

patterns of these kinases were seen in nicotine-treated

MDA-MB-231 cells (data not shown). In comparison, a

fast activation pattern of these kinases was seen in

response to EGFR treatment in the cells. Following the

treatment with EGF for 10 or 15 minutes, Src, ERK1/2 or

Akt was phosphorylated (Figure 3B). One hour after the

treatment, these kinases were no longer active (data not

shown). Since these kinases activated with different acti-

vation kinetics upon nicotine treatment, the results indi-

cated that distinct mechanisms are involved in the

regulation of these nAChR downstream effectors.

nAChR, via Src, activates EGFR-dependent or

-independent downstream pathways following nicotine

treatment

Since c-Src, Akt, and ERK1/2 in the cells were activated

after nicotine treatment, it was possible that these

kinases were subjected to different regulations. To test

this, we treated MCF10A cells with MCA (a nAChR

inhibitor), and then with nicotine for various time points

(Figure 4A). Neither ERK1/2 nor Akt was phosphory-

lated in nicotine-treated cells after the blockade of

nAChR. A dominant-negative src was then used to sup-

press Src. To verify if the dn-src had an inhibitory effect

on endogenous Src, we transiently transfected the con-

struct into MACF10A cells and treated the cells with

EGF (a known Src activator). Indeed, the introduction

of dn-src efficiently blocked EGF-induced Src phosphor-

ylat ion (more than 90%) (Figure 4B, left panels). After

dn-src was transiently transfected into the cells, the

phosphorylated form of ERK1/2 or Akt could not be

detected in nicotine-treated cells (Figure 4B, middle and

right panels). We then treated MCF10A cells with

AG1478 prior to nicotine exposure. The inhibition of

EGFR by the inhibitor prevented nicotine-mediated

phosphorylation of ERK1/2 (Figure 4C, upper panels),but had no effect on nicotine-induced Akt activation.

Subsequently, the cells were exposed to PD168393 (an

ERK inhibitor) (Figure 4C, middle panels) or KP372-1

(an Akt inhibitor) (Figure 4C, bottom panels), prior to

the addition of nicotine. The inhibitors suppressed the

activation of the corresponding kinases, respectively.

The data suggested that Src is downstream of nAChR

and responsible for the sensitization of EGFR or Akt

pathway. However, ERK1/2 signaling appeared to be

controlled by EGFR in nicotine-mediated, growth-

related action.

- + nicotine (0.5 PM, 2 h)

PDGFR

actin

A

- + -- - + nicotine (0.5 M, 1h)

PDGF (250 ng/ml, 30’)

p-PDGFR

PDGFR

B

Figure 2 Activation status of PDGFR in MCF10A cells in

response to nicotine treatment. (A) After the treatment with

nicotine, the expression of PDGFR in MCF10A cells was analyzed by

immunoblotting. The blot was re-probed with an anti-b-actin

antibody for loading control. (B) Following the treatments, the

expression of the phosphor-PDGFR in MCF10A cells was assayed

and the blot was re-probed with an anti-b-actin antibody for

loading control.



of 11



E2F1 activity was upregulated by nicotine through EGFR

pathway

EGF/EGF-related signals are able to activate down-

stream pathways to inactivate Rb, leading to the release

of E2F from its sequestration and the entry of cells to S

phase of the cell cycle [32]. To test whether nicotine

treatment could affect E2F1 activity in breast cancer

cells, a ChIP assay was conducted to analyze the occu-

pancy of E2F1 on its responsive cdc25A promoter (Fig-ure 5A, left panel). Stimulation with nicotine for 2

hours induced the association of E2F1 with cdc25A pro-

moter in MCF10A cells. The blockade of Src by dn-src

or suppression of EGFR signaling by AG1478 abolished

the binding of E2F1 to the promoter induced by nico-

tine. Consistently, the inhibition of Akt by KP372-1 did

not affect E2F1 association with the promoter in nico-

tine-treated cells and the addition of PD168393 comple-

tely interfered with the binding. The promoter of c- Fos

was used as the control in the ChIP assay and E2F1 did

not bind to this promoter in response to nicotine treat-

ment (data not shown). The activation of E2F was alsotested by immunoblotting using the anti-phosphor-E2F

antibody and results similar to those found in the ChIP

assay were obtained (Figure 5A, right panels). The

results supported the notion that E2F1 activity induced

by nicotine treatment was governed by nAChR/Src/

EGFR/ERK1/2 signaling and Akt appeared to play no

role in this nicotine-mediated, growth promotion.

Since E2F1 was activated by the EGFR/ERK1/2 path-

way in our experimental setting, the [3H]thymidine

incorporation assay was used to determine the role of

this pathway in DNA uptake in nicotine-treated

MCF10A and MDA-MB-231 cells (Figure 5B). After

serum starvation for 48 hours, the cells were treated

with nicotine or co-treated with various inhibitors in the

presence of [3H]thymidine. Rates of DNA synthesis were

then measured. Under serum depletion conditions, little

[3H]thymidine incorporation was observed in the cells.

A moderate amount of [3H]thymidine (about 5 to 6

fold) was incorporated in nicotine-treated cells under

serum-starvation conditions. However, the addition of AG1478 or PD168393 blocked the nicotine-induced

[3H]thymidine incorporation into the cell genomes. In

comparison, KP372-1 treatment had a minimal, negative

role in DNA synthesis promoted by nicotine. As

expected, co-treatment of PD168393 and KP372-1 com-

pletely suppressed the incorporation of [3H]thymidine.

Next, the effect of Src or Akt on cell growth in

response to nicotine exposure was assayed by cell prolif-

eration analysis. After 24 hours of serum starvation,

MCF10A or MDA-MB231 cells in the medium contain-

ing 0.5% serum were treated with PD168393, KP372-1

or infected with dn-src, prior to nicotine exposure, andthe number of cells was then counted for four consecu-

tive days (Figure 5C). MCF10A or MDA-MB231 cells

did not grow under serum-depletion conditions. How-

ever, the numbers of the cells were increased at day 2

after the treatment. The addition of PD168393 signifi-

cantly prevented nicotine-mediated growth promotion.

In comparison, KP372-1 had no negative effect on nico-

tine-mediated growth promotion. Again, concurrent

treatment with KP372-1 and PD168393 completely

blocked the nicotine-mediated effect on the growth of

MCF10A and MDA-MB-231 cells. The data further

B

p-Src

Src

ERK1/2

p-Akt

Akt

p-ERK1/2

0 10’ 15’ 30’ EGF

MCF10A

p-Src

Src

MCF10AA

p-ERK1/2

ERK1/2

0 30’ 2h

p-Akt

Akt

nicotine

Figure 3 Activation status of Src, ERK1/2 and Akt in MCF10A cells following nicotine exposure. (A) After nicotine treatment for different

time periods, the phospohrylation form of Src, ERK1/2 or Akt in MCF10A cells was analyzed by the corresponding antibodies, using immunoblot.

(B) The expression of the phosphorylated Src, ERK1/2 or Akt in EGF-treated cells.



of 11



supported the notion that nicotine may sensitize EGFR/

ERK1/2/E2F1 signaling to promote cell growth.

Akt was involved in the regulation of cell survival upon

nicotine treatment

Persistent nicotine exposure was shown to upregulate

Bcl-2, which enhances cell survival as well as resistance

of cancer cells to chemo-drugs [33-36]. To test how

nicotine-mediated effector pathways were involved in

the regulation of Bcl-2 or cell survival, MCF10 cells

were co-treated with various inhibitors and nicotine for

two days and the expression of Bcl-2 was assayed by

immunoblotting (Figure 6A). The level of Bcl-2 expres-

sion in the cells was increased (about 2 fold) after nico-

tine treatment, which was not affected by its co-

treatment with PD168393. Interestingly, this nicotine-

mediated upregulation of Bcl-2 expression in the cells

was blocked by co-treatment with KP372-1. A similar

result was obtained in MDA-MB231 cells (data not

shown).

To determine the effect of various nicotine-mediated

signaling pathways on long-term cell survival, a colony

formation assay was performed (Figure 6B). After being

seeded, MCF10A and MDA-MB-231 cells formed colo-

nies 12 days later, and the addition of nicotine stimu-

lated the ability of the cells to form colonies (about 2

fold). Treatment with PD168393 or KP372-1 alone had

no obvious effect on the formation of colonies of the

cells. The co-treatment of nicotine with KP372-1, but

not with PD168393 significantly reduced the numbers of

p-ERK1/2

ERK1/2

nicotine0 30’ 2 h

dn-Src - + +

A

- + + MCA0 30’ 2 h nicotine

p-ERK1/2

ERK1/2

p-Akt

Akt

- + + MCA

0 30’ 2 h nicotine

p-Src

Src

- - + + dn-Src

- + - + EGF

Akt

p-Akt

nicotine0 30’ 2 h dn-Src - + +

C

nicotine0 30’ 2 h PD168393

p-Akt

Akt

- + +

p-ERK1/2

ERK1/2

nicotine0 30’ 2 h PD168393- + +

p-ERK1/2

ERK1/2

nicotine0 30’ 2 h

KP372-1- + +nicotine0 30’ 2 h KP372-1- + +

Akt

p-Akt

0 30’ 2 h

AG1478- + +nicotine

p-ERK1/2

ERK1/2

p-Akt

Akt

0 30’ 2 h

AG1478- + +nicotine

Figure 4 The hierarchy order of nAChR downstream effectors in MCF10A cells . (A) After the suppression of nAChR by MCA, the

phosphorylation status of ERK1/2 or Akt was tested by immunoblot. (B) After transient transfection of dn-src , MCF10A cells were treated with

EGF (100 ng/ml) for 15 minutes and the expression of the phosphorylated form of Src was then examined by immunoblot (left panels). The

expression of phosphorylated ERK1/2 or Akt in nicotine-treated MCF10A cells with or without transiently expressing dn-src was analyzed by

immunoblot (middle and right panels). (C) The cells were treated with AG1478 (100 nM), PD168393 (5 μM) or KP372-1 (1 μM) for 15 minutes,

prior to nicotine exposure. Subsequently, the expression of the phosphorylated ERK1/2 or Akt was analyzed. -the full names of all abbreviations

(including the inhbitors) are provided in the text.



of 11



the cells that formed colonies. Concurrent treatmentwith PK372-1 and PD168393 completely blocked

MCF10A or MDA-MB-231 cells from generating colo-

nies, with or without nicotine exposure. Overall, the

data indicated that Akt might be responsible for nico-

tine-promoted cell survival.

Discussion

Cigarette smoke contains a variety of genotoxic carci-

nogens, many of which are derivatives of nicotine that

are formed during the curing of tobacco [1-3]. The

direct link between cigarette smoke and the onset of

lung cancer has long been established. Although thecorrelation of the smoke with other types of cancer, in

particular breast cancer, has been suggested by epide-

miological investigations, the underlying molecular

mechanisms by which cigarette smoke promotes breast

cancer genesis and progression remain unclear. It is

known that nAChR is widely expressed in neurons and

neuromuscular junctions, but is also present in various

non-neuronal organs, tissues or cells, such as epithelial

cells from different organs and endothelial cells. Liga-

tion of nAChR has been shown to facilitate cell growth

and promote pro-survival activities in lung cancer or

C MCF10A

N u m b e r s o f

V i a b l e c e l l s ( 1 x 1 0 5 )

Days of Post-Treatment

0

2

4

6

8

10

12

1 2 3 4

0

2

4

6

8

10

12

1 2 3 4

control (0.5% serum)nicotine

nicotine+PD168393nicotine+KP372-1+PD168393

nicotine+KP372-1

MDA-MB-231

Days of Post-Treatment

0

2

4

6

8

10

12

14

1 2 3 4

0

2

4

6

8

10

12

14

1 2 3 4

Control (0.5% serum)nicotine

nicotine+PD168393nicotine+KP372-1+PD168393

nicotine+KP372-1

0

1000

2000

3000

4000

5000

6000

7000

8000

1 2 3 4 5 6 7

1. control

2. 0.5% serum

3. 0.5% serum+nicotine4. 0.5% serum+nicotine+AG1478

5. 0.5% serum+nicotine+PD168393

6. 0.5% serum+nicotine+KP372-17. 0.5% serum+nicotine

+KP372-1+PD168393

MCF10A MDA-MB-231

[ 3 H ] I n c o r p o r a t i o n

B

0

2 0 0 0

4 0 0 0

6 0 0 0

8 0 0 0

10000

12000

1 2 3 4 5 6 7

- + + + + +- - + - - -

nicotine

- - - + - -

PD168393

dn-src

- - - - + -KP372-1

- - - - - +AG1478

A MCF10A

cdc25A p-E2F1

-actin

MCF10A

- + + + + +- - + - - -nicotine

- - - + - -

PD168393

dn-src

- - - - + -KP372-1

- - - - - +AG1478

Figure 5 Involvement of E2F1 in cell growth promotion by nicotine. (A) Left panel: ChIP analysis of nicotine-treated MCF10A cells in the

presence or absence of dn-src , PD168393, AG1478 or KP372-1. Sonicated, cross-linked chromatin was immunoprecipitated with an anti-E2F1

antibody, and the purified DNA was assayed by PCR with the primers for cdc25A promoter. Right panels: After the same treatments as described

above, cell lysates were prepared and subjected to immunoblotting with the anti-phosphor-E2F antibody. (B) After different treatments, [3H]

thymidine incorporation in the cells was measured. (C) After being serum-starved for 24 hours, the cells were cultured in the medium containing

0.5% serum plus various inhibitors, and the numbers of viable cells were counted for 4 days. Error bars represent SD (standard deviation), n = 5.



of 11



other types of malignant cells [4-6]. We previously

demonstrated that exposure to nicotine augmented the

migration or invasion ability of benign or malignant

breast cancer cell l ines, in which PKC and cdc42

played a crucial role [7]. As the continuation of the

investigation of the role of nicotine exposure in breast

tumorigenesis, we found that the engagement of nico-

tine with nAChR sensitized EGFR signaling via Src,

resulting in the activation of ERK1/2 and upregulation

of E2F1 transcriptional activity. We also found that the

inhibition of nAChR or Src abrogated the promotion

of cell proliferation conferred by nicotine treatment.Furthermore, in response to nicotine treatment, ERK1

and 2 functioned downstream of EGFR and the sup-

pression of these kinases prevented the nicotine-

mediated activation of E2F1 and DNA synthesis. We

also showed that Akt appeared to be directly activated

by Src in nicotine-governed action and responsible for

upregulated Bcl-2 expression and increase cell survival

activity. Collectively, these findings identified the novel

intracellular targets Src/Akt and EGFR/ERK1/2 that

are differentially affected by nicotine exposure to facili-

tate breast cancer progression.

Since there is a lack of understanding about the

underlying molecular mechanisms by which tobacco

smoke promotes turmorigenesis in other organs of

human body, rather than in the lung, nicotine has

become a major object of investigation, because it exists

in high concentrations in the blood stream of first-,

heavy second-hand smokers and nicotine users [37-39].

Although nicotine is not a conventional carcinogen, this

tobacco smoke-related compound has been shown to

induce the secretion of growth factors (such as bFGF,

TGF-a, calpains, and VEGF), resulting in the activation

of Raf, Akt or PKC pathways for the growth promotionof lung epithelial or cancer cells and upregulation of

Bcl-2 signaling that is responsible for the increase in the

resistance to anti-cancer therapies [35,36]. The binding

of nicotine to nAChR initiated the activation of Src tyr-

osine kinase that further mediated cell cycle progression

of non-small cell lung cancer (NSCLC) [18]. Our cur-

rent study demonstrated that exposure of human breast

benign or malignant cancer cells to nicotine induced the

phosphorylation of Src that augmented cell growth- and

survival-related signaling. As a substance, nicotine is

able to diffuse rapidly into various organs and tissues.

- - - +

- + + +- - + -

Bcl-2

actin

nicotine

PD168393

KP372-1

MCF10AA

MDA-MB-231

PD168393KP372-1

MCF10AB

N u m b e r s o f C o l o

n i e s

0

10

20

30

40

50

60

1 2 3 4 5 6 7 8

untreated

nicotine

0

20

40

60

80

100

120

140

1 2 3 4 5 6 7 8

untreated

nicotine

- - + + - - + +- - - - + + + +

- - + + - - + +- - - - + + + +

Figure 6 Long term cell survival promoted by nicotine exposure. (A) MCF10A cells were co-treated with different inhibitors and nicotine for

2 days. Subsequently, the expression of Bcl-2 was assayed by immunoblot. The blot was re-probed with an anti-b-actin antibody for loading

control. (B) The cells (250 cells/per dish) were seeded and grown in the medium containing nicotine plus different inhibitors. The number of

colonies was counted 12 days later. Error bars represent SD (standard deviation), n = 5.



of 11



Thus, it is conceivable that this major component of

tobacco smoke in the blood stream can efficiently reach

the breast and bind to nAChR on the surface of breast

epithelial or cancer cells, which provides a growth

advantage locally. Indeed, studies have demonstrated

that cancer patients who were smokers or nicotine users

were more resistant to chemotherapy and had increased

metastasis of breast cancer. Furthermore, nicotine was

also reported to augment the proliferation of cell lines

derived from gastric, colon, bladder or pancreatic

tumors [14-16]. Therefore, the interaction of nicotine

and nAChR is an un-neglected factor in the regulation

of the growth in different tissues or organs.

EGFR belongs to a family of the receptor tyrosine

kinases and functions as a mediator to transmit cell sig-

naling initiated by extracellular growth factors to the

nucleus. Overexpression of EGFR or other family mem-

bers is frequently found in human tumors of epithelialorigin. Targeting EGFR family members has been attrac-

tive for developing new therapeutics with promising

clinical results [23-26]. In our current investigation, we

demonstrated that EGFR was activated and subsequently

internalized in breast cancer cells in response to nico-

tine treatment, accompanied by the cascade of the phos-

phorylation of several intracellular effector kinases.

Among these kinases, Src acted as a key regulator to

link nAChR signaling to EGFR and ERK1/2. In nicotine-

treated neuroblastoma or Xenopus oocytes cells, the a7

subunit of nAChR has been shown to undergo tyrosine

phosphorylation and Src was responsible for the activa-

tion of this subunit of the receptor [18]. Using in vitro

and xenograft assays, it was also reported that the levels

of Src and EGFR in colon cancer cells were significantly

increased following nicotine exposure [18]. Our experi-

ments showed that Src functions as a key downstream

effector of nAChR and links nicotine signals to EGFR

and ERK1/2 to promote transient cell growth activities.

By studying the mechanisms of nicotine-mediated

cell growth promotion, we revealed that a cross-talk

occurred specifically between two important cell sur-

face receptors: nAChR and EGFR. This is the first

demonstration of nicotine-induced sensitization of

EGFR in benign and malignant breast cancer cells.Intriguingly, we found that in nicotine-mediated

action, EGFR activation led to an increase of E2F1

activity, resulting in the promotion of DNA synthesis

and cell proliferation. In this process, EGFR appears as

a rate limiting factor and ERK1/2 functions as an

executor of the cell growth program. Previously, we

established that exposure to nicotine activates Raf and

PKC pathways in Rat or murine lung epithelial or can-

cer cells, which facilitate the genesis and development

of tumors [23-26]. EGFR has been shown to mediate

at least two pathways in cancer cells: the cytosolic and

the nuclear pathways. Emerging evidence indicates that

upon activation, some of EGFR or its family members

in cancer cells relocate to the nucleus, where they par-

ticipate in the regulation of gene transcription, cell

cycle checkpoints and DNA repair. It is still under

investigation whether EGFR upon nicotine treatment

in our experimental setting translocates to the nucleus

or is degraded. The present data suggest that upon

nicotine exposure, EGFR appears to play a significant

role in breast tumorigenesis.

Tobacco smoke or nicotine can reduce the efficacy of

chemo-treatments and increase cancer onset, develop-

ment or recurrence. Studies showed that in response to

nicotine exposure, cancer cells became resistant to cyto-

toxicity triggered by anti-cancer drugs. Bcl-2 was

reported to play an important role in nicotine-induced

anti-apoptotic or pro-survival activities [35,36]. It was

demonstrated that nicotine treatment significantly pro-tected breast cancer cells against the cytotoxicity of dox-

orubicin [35,36]. Here, we determined that Bcl-2 is one

of the targets of nicotine exposure. Our study also

demonstrated that Akt was involved in the regulation of

Bcl-2 expression and responsible for the long-term sur-

vival of the breast cancer cells. Together, it seems that

nicotine, through activation of Src and Akt, promotes

anti-apoptotic or pro-survival activities in breast cancer

cells. Thus, Src and Akt pathways might be the intracel-

lular targets for improving the treatment efficacy of

breast cancer patients who are active or passive smokers

or nicotine users.

Conclusions

In summary, our findings suggest that Src and EGFR

play pivotal roles in regulating nicotine-treated breast

cancer cell proliferation and survival. The molecular

mechanisms of the activation of Src and EGFR in nico-

tine-mediated action involve ERK1/2/E2F1 and Akt/Bcl-

2 pathways. The cooperation of these pathways causes a

full magnitude of the promotion of cell growth and sur-

vival, which are attractive targets for developing better

treatments for breast cancer.

Abbreviations

nAChR: nicotinic acetylcholine receptor; EGFR: epidermal growth factor

receptor; Src: sarcoma; ERK1/2: extracellular signal regulated kinases 1 and 2;

PI3K: phosphodylinositol-3-kinase; JAK-2: Janus kinase 2; STAT-3: signal

transducers and activators of transcription protein-3; Rb: retinoblastoma

protein; NSCLC: non-small cell lung cancer; Raf, PKC: protein kinase C; MEK:

mitogen activated protein kinase; MAPK: microtule-associated protein kinase;

PI3K: phosphodylinositol-3-kinase; PDGFRβ: platelet growth factor β subunit.

Acknowledgements

We thank Dr. Z. Luo (Boston University) for providing various constructs and

reagents. This work was supported by Flight Attendant Medical ResearchInstitute (062450-CIA, CC) and by the National Institutes of Health Grant

(R01CA124490, CC). H.S. Kim is supported by the Research Clerkship Program

of Yonsei University College of Medicine.



of 11



Author details1Beth Israel Deaconess Medical Center, Harvard Medical School, 330

Brookline Avenue, Boston, MA, 00215, USA. 2Yonsei University College of

Medicine, 134 Shin-chon Dong, Seodaemoon-gu, Seoul, 120-749, Republic of Korea. 3 The First Hospital of Nanchang University, 17 Yongwai Zhengjie,

Nanchang, 330047, China.

Authors’ contributions

TK, HK, LL, YH and JG carried out the experiments and initial analysis and

interpretation of the data. CC conceived and designed the studies, made

further data interpretations and wrote the manuscript. All authors approved

the final version of the manuscript.

Competing interests

The authors declare that they have no competing interests.

Received: 30 June 2011 Revised: 3 November 2011

Accepted: 15 November 2011 Published: 15 November 2011

References

1. Karnath B: Smoking cessation. Am J Med 2002, 112:399-405.

2. Hecht SS: Cigarette smoking and lung cancer: chemical mechanisms and

approaches to prevention. Lancet Oncol 2002, 3:461-469.

3. Arredondo J, Chernyavsky AI, Jolkovsky DL, Pinkerton KE, Grando SA:

Receptor-mediated tobacco toxicity: acceleration of sequential

expression of alpha5 and alpha7 nicotinic receptor subunits in oral

keratinocytes exposed to cigarette smoke. FASEB J 2008, 22:1356-1368.4. Hesechen C, Jang JJ, Weis M: Nicotine stimulates angiogenesis and

promotes tumor growth and atherosclerosis. Nat Med 2001, 7:833-839.

5. Dagupta P, Rizwani W, Pilai S: Nicotine induces cell proliferation, invasionand epithelial-mesenchymal transition in a variety of human cancer cell

lines. Int J Cancer 2009, 124:36-45.

6. Sagiv SK, Gaudet MM, Eng SM: Active and passive cigarette smoke and

breast cancer survival. Ann Epidemiol 2007, 17:385-393.

7. Guo J, Ibaragi S, Zhu T : Nicotine promotes mammary tumor migration via

a signaling cascade involving protein kinase C and cdc42. Cancer Res

2008, 68:8473-8481.

8. Connors SK, Balusu R, Kundu CN, Jaiswai AS, Gairola CG, Narayan S: C/

EBPbeta-mediated transcriptional regulation of bcl-xl gene expression in

human breast epithelial cells in response to cigarette smokecondensate. Oncogene 2009, 28:921-932.

9. Xue F, Willett WC, Rosner BA, Hankinson SE, Michels KB: Cigarette smoking

and the incidence of breast cancer. Arch Intern Med 2011, 171:125-133.

10. Arredondo J, Chernyavsky AI, Grando SA: Nicotinic receptors mediatetumorigenic action of tobacco-derived nitrosamines on immortalized

oral epithelial cells. Cancer Biol Ther 2006, 5:511-517.

11. Seguela P, Wadiche J, Dineley-Miller K, Dani JA, Patrick JW: Molecular

cloning, functional properties, and distribution of rat brain α7: a

nicotinic cation channel highly permeable to calcium. J Neurosci 1993,

13:596-604.

12. Castro NG, Albuquerque EX: α-Bungarotoxin-sensitive hippocampal

nicotinic receptor channel has high calcium permeability. Biophys J 1995,

68:516-524.

13. Alkondon M, Albuquerque EX: The nicotinic acetylcholine receptor

subtypes and their function in the hippocampus and cerebral cortex.

Prog Brain Res 2004, 145:109-120.

14. Heeschen C, Weis M, Aicher A, Dimmeler S, Cooke JP: A novel angiogenic

pathway mediated by non-neuronal nicotinic acetylcholine receptors. J

Clin Inves 2002, 110:527-536.15. Minna JD: Nicotine exposure and bronchial epithelial cell nicotinic

acetylcholine receptor expression in the pathogenesis of lung cancer. J

Clin Inves 2003, 111:31-90.16. Shi VY, Wu WK, Chu KM: Nicotine induces cyclooxygenase-2 and vascular

endothelial growth factor receptor-2 in association with tumor-

associated invasion and angiogenesis in gastric cancer. Mol Cancer Res

2005, 3:607-615.

17. Zhou Y, Gu X, Ashayeri E, Zhang R, Sridhar R: Nicotine decreases the

cytotoxicity of doxorubicin towards MCF-7 and KB-3.1 human cancer

cells in culture. J Nat Med Assoc 2007, 99:319-327.

18. Dasgupta P, Rastogi S, Pillai S: Nicotine induces cell proliferation by beta-

arrestin-mediated activation of Src and Rb-Raf-1 pathways. J Clin Invest

2006, 116:2208-2217.

19. Guo J, Chu M, Abbeyquaye A, Chen CY: Persistent nicotine treatment

potentiates amplification of the dihydrofolate reductase gene in rat lung

epithelial cells as a consequence of Ras activation. J Biol Chem 2006,

280:30422-30431.20. Nishioka T, Guo J, Yamamoto D, Chen L, Huppi P, Chen CY: Nicotine,

through upregulating pro-survival signaling, cooperates with NNK topromote transformation. J Cell Biochem 2010, 109:152-161.

21. Bose C, Zhang H, Udupa KB, Chowdhury P: Activation of p-EKR1/2 by

nicotine in pancreatic tumor cell line AR42J: effects on proliferation and

secretion. Am J Physiol Gastrointest Liver Physiol 2005, 289:G926-G934.22. Arredondo J, Chernyavsky AI, Jolkosky DL, Pinkerton KE, Grando SA:

Receptor-mediated tobacco toxicity: cooperation of the Ras/Raf-1/MEK1/

ERK and JAK2/STAT-3 pathways downstream of alpha-7 nicotinic

receptor in oral keratinocytes. The FASEB J 2006, 20:2093-2102.

23. Nicholson RI, Gee JM, Harper ME: EGFR and cancer prognosis. Eur J Cancer

2006, 37:S9-15.

24. Lo HW, Hwu SC, Ali-Seyed M: Nuclear interaction of EGFR and STAT3 in

the activation of the iNOS/NO pathway. Cancer Cell 2001, 7:575-589.

25. Hoshino M, Fukui H, Ono Y: Nuclear expression of phosphorylated EGFR

is associated with poor prognosis of patients with esophageal

squamous cell carcinoma. Pathobiology 2007, 74:15-21.26. Hsu S-C, Miller SA, Wang Y, Huang M-C: Nuclear EGFR is required for

cisplatin resistance and DNA repair. Am J Transl Res 2009, 1:249-258.

27. Arias HR, Richards VE, Ng D, Ghafoori ME, Le V, Mousa S: Role of non-neuronal nicotinic acetylcholine receptors in angiogenesis. Int J Biochem

Cell Bio 2009, 41:1441-1451.

28. Wong HP, Yu L, Lam EK, Tai EK, Wu WK, Cho CH: Nicotine promotes cell

proliferation via alpha7-nicotinic acetylcholine receptor and

catecholamine-synthesizing enzymes-mediated pathway in human colon

adnocarcinoma HT-29 cells. Toxicol Appl Phamacol 2007, 221:261-267.

29. Wong HP, Yu L, Lam EK, Wu WK, Cho CH: Nicotine promotes colon tumor

growth and angiogenesis through beta-adrenergic activation. Toxicol Sci

2007, 97:279-287.

30. Shin VY, Wu WK, Chu KM: Functional role of beta-adrenergic receptors in

the mitogenic action of nicotine on gastric cancer cells. Toxicol Sci 2007,

96:21-29.

31. Daub H, Weiss FU, Wallasch C, Ullrich A: Role of transactivation of the EGFreceptor in signaling by G-protein-coupled receptors. Nature 1996,379:557-560.

32. Real S, Meo-Evoli N, Espada L, Tauler A: E2F1 regulates cellular growth by

mTORC1 signaling. Plos One 2011, 16:e16163.

33. Denis GV, Yu Q, Ma P, Chen CY: Bcl-2, via its BH4 domain, blocksapoptotic signaling mediated by mitochondrial Ras. J Biol Chem 2003,

278:5775-5782.

34. Kurinna S, Konopleva M, Palla SL: Bcl-2 phosphorylation and active PKC

alpha are associated with poor survival in AML. Leukemia 2006,

20:1316-1319.

35. Mai H, May WS, Gao F, Jin Z, Deng X: A functional role for nicotine in Bcl-

2 phosphorylation and suppression of apoptosis. J Biol Chem 2003,

278:6369-6379.

36. Assis GF, Ceolin DS, Marques ME, Salvadori DM, Ribeiro DA: Cigarette

smoke affects apoptosis in rat tongue mucosa: role of bcl-2 gene family.

J Mol Histol 2005, 36:483-489.

37. American Cancer Society: Atlanta, GA. Cancer facts and figures ACS; 2002.38. Mahai M, Skinner A, Lawton K, Weinding AM: Maternal smoking, urinary

nicotine levels and birth-weight. Aust N Z J Obstet Gynaecol 1990,30:33-36.

39. Thompson SG, Stone R, Nanchahal K, Wald NJ: Relation of urinary nicotine

concentrations to cigarette smoking and to exposure to other people’s

smoke. Thorax 1990, 45:356-361.

doi:10.1186/bcr3055

Cite this article as: Nishioka et al .: Sensitization of epithelial growthfactor receptors by nicotine exposure to promote breast cancer cellgrowth. Breast Cancer Research 2011 13:R113.



of 11

http://www.ncbi.nlm.nih.gov/pubmed/11904115?dopt=Abstract
















































































































































Afifah Asli Bcr3055

Documents

Transcript of Afifah Asli Bcr3055