AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83...
Transcript of AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83...
![Page 1: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/1.jpg)
1
Running title: Genome-wide analysis of S. maltophilia biofilm genes 1
2
Genome-Wide Identification of Genes Necessary for Biofilm Formation of 3
Nosocomial Pathogen Stenotrophomonas maltophilia Reveals Orphan 4
Response Regulator FsnR is a Critical Modulator 5
6
Xiu-Min Kang1,2§
, Fang-Fang Wang1§
, Huan Zhang1,3
, Qi Zhang
2#, Wei Qian
1# 7
8
1 State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese Academy of 9
Sciences, Beijing 100101, China. 2 School of Chemical Engineering & Environment, Beijing 10
Institute of Technology, Beijing 100081, China. 3College of Life Sciences, University of 11
Chinese Academy of Sciences, Beijing 100049, China. 12
13
§ These authors contributed equally to this work 14
15
#Corresponding authors. Wei Qian, Tel: +86-10-64806063; Fax: +86-10-64858245; Email: 16
[email protected]. Qi Zhang, Tel: 86-10-68918012; Email: [email protected] 17
18
Keywords: Stenotrophomonas maltophilia, biofilm, transposon mutagenesis, response 19
regulator, flagella assembly 20
AEM Accepts, published online ahead of print on 5 December 2014Appl. Environ. Microbiol. doi:10.1128/AEM.03408-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 2: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/2.jpg)
2
Abstract 21
22
Stenotrophomonas maltophilia is a gram-negative, bacterial pathogen of increasing 23
concern to human health. Most clinical isolates of S. maltophilia efficiently form biofilms on 24
biotic and abiotic surfaces, making this bacterium resistant to a number of antibiotic 25
treatments and hard to be eliminated. To date, very few studies have investigated the 26
molecular and regulatory mechanisms responsible for S. maltophilia biofilm formation. Here 27
we constructed a random transposon insertion mutant library of S. maltophilia ATCC 13637 28
and screened 14,028 clones. A total of 46 non-redundant genes were identified. Mutants of 29
these genes exhibited marked changes in biofilm formation; suggesting multiple physiological 30
pathways, including extracellular polysaccharide production, purine synthesis, transportation, 31
peptide and lipid synthesis, were involved in bacterial cell aggregation. Of these genes, 20 32
putatively contributed to flagella biosynthesis, indicating a critical role for cell motility in S. 33
maltophilia biofilm formation. Genetic and biochemical evidence demonstrated an orphan 34
response regulator, FsnR, activated transcription of at least two flagella-associated operons by 35
directly binding to their promoters. The regulatory protein plays a fundamental role in 36
controlling flagella assembly, cell motility and biofilm formation. These results provide a 37
genetic basis to systematically study biofilm formation of S. maltophilia. 38
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 3: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/3.jpg)
3
INTRODUCTION 39
40
Stenotrophomonas maltophilia (formerly Pseudomonas maltophilia or Xanthomonas 41
maltophilia) are aerobic, gram-negative bacteria belonging to the family Xanthomonadaceae 42
of the γ-Proteobacteria. S. maltophilia are ubiquitous across a diverse range of ecological 43
niches, including foods, soil, plant roots and stems, and aqueous environments. In clinical 44
settings, S. maltophilia is an opportunistic, nosocomial pathogen, predominantly colonizing 45
the skin, respiratory tract, urinary catheters, and breathing tubes such as endotracheal tubes (1, 46
2). Infection generally results in pneumonia, bacteremia, urinary tract infection, and 47
meningitis (3, 4). Over the past three decades, S. maltophilia has become an increasing threat 48
to public health, in particular, immunosuppressed or immunocompetent patients in intensive 49
care units (ICU) undergoing prolonged mechanical ventilation, tracheostomy or 50
broad-spectrum antibiotic therapy (5). The reported mortality rates for S. maltophilia infected 51
patients range between 23% and 77% (4, 6). Treatment of S. maltophilia infection has proven 52
increasingly difficult because of the bacteria’s intrinsic multidrug resistance. S. maltophilia is 53
resistant to treatment with most aminoglycosides, quinolones, β-lactams, and β-lactamase 54
inhibitors (7). Worryingly, research has shown susceptibility of bacterial isolates to the 55
recommended drug for S. maltophilia infection, trimethoprim-sulfamethoxazole, has 56
decreased from >98% to 30–40% for within a decade (8). Therefore, the development of more 57
effective antibiotic agents targeting critical processes of S. maltophilia pathogenesis, 58
nonessential to survival and with minimal selective pressure, will be a challenge faced by 59
researchers in the future. 60
Biofilm is slime-enclosed bacterial aggregates affording protection against antibiotics, 61
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 4: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/4.jpg)
4
host immune responses, and multiple stresses (9). Most clinical strains of S. maltophilia form 62
biofilms efficiently on various abiotic and biotic surfaces, including Teflon, plastic, glass, host 63
tissue, and in-dwelling intravascular devices (10, 11). Environmental factors, including 64
phosphate, pH, temperature, metal ions, and antibiotics were shown to have a profound effect 65
on S. maltophilia biofilm formation (3). To date, however, only a small number of genes or 66
biochemical cascades associated with S. maltophilia biofilm formation have been reported, 67
and these include polysaccharide synthesis genes rmlA, rmlC, and xanB (12), DSF-mediated 68
cell-cell communication (13), small RNA modulator Hfq (14), and ABC-type efflux pump 69
MacABC (15). Hence, it is critical to undertake a systematic approach when elucidating the 70
molecular and regulatory properties of S. maltophilia biofilm development. 71
In this work we constructed a large scale S. maltophilia transposon insertional mutant 72
library which was used to screen for S. maltophilia mutants with altered biofilm forming 73
ability (16). From 14,208 clones we identified 46 genes belonging to mutants exhibiting 74
remarkable changes in biofilm development. Almost half of these genes (20 genes, 43.5%) 75
were involved in bacterial flagella or pili biosynthesis, which suggested cell motility play a 76
critical role in S. maltophilia biofilm development. We confirmed that FsnR, an orphan 77
response regulator of the two-component signal transduction system, directly binds to the 78
promoter region of two gene clusters and activates their transcription. These results provide 79
genetic information to further investigate the molecular process of S. maltophilia biofilm 80
formation. 81
82
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 5: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/5.jpg)
5
MATERIALS AND METHODS 83
84
Bacterial strains, plasmids and culture conditions. The bacterial strains and plasmids used 85
in the present study are described in Table 1. Escherichia coli DH5α was used as the host in 86
molecular cloning procedures, and routinely cultured at 37°C in Luria-Bertani (LB) medium. 87
S. maltophilia ATCC 13637, obtained from stocks of CGMCC, was cultured at 28°C in NYG 88
medium (5 g/L tryptone, 3 g/L yeast extract, 20 g/L glycerol; pH 7.0). Competent cells of S. 89
maltophilia were prepared by culturing in 210 medium (4 g/L yeast extract, 8 g/L casein 90
enzymatic hydrolysate, 5 g/L sucrose, 3 g/L K2HPO4, 0.3 g/L MgSO4.7H2O; pH 7.0) and 91
washed in ice-cold glycerol (10%). Antibiotics were used at the following concentrations: 92
ampicillin, 100 μg/ml; kanamycin, 50 μg/ml; spectinomycin, 100 μg/ml; and streptomycin, 93
200 μg/ml. Electroporation conditions for the transformation of both S. maltophilia and E. 94
coli were set at 18 kVcm−1
, 25 μF and 200 Ω and conducted in a Bio-Rad Pulser XCell™ 95
Electroporation System (Hercules, USA). 96
97
Construction of insertional mutant library and genetic manipulation of bacterial strains. 98
The S. maltophilia transposon insertional mutant library was constructed using the EZ::TN 99
<KAN-2> Tnp transposome kit (Epicentre, USA), as described previously and in accordance 100
with the manufacturer’s protocol (17, 18). A total of 14,208 kanamycin resistant transformants 101
were selected and stored in 37 384-well plates at −80°C until use. Southern blot hybridization 102
was used to determine transgene copy number. In brief, total DNA was extracted from 103
bacterial strains, the electrophoresed fragments transferred to a Hybond N+ membrane, and 104
hybridized with a [α-32
P]-dCTP labelled PCR probe (Prime-A-Gene, Promega, USA). PCR 105
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 6: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/6.jpg)
6
primers used to amplify the kanamycin resistant sequence and used as DNA probes are listed 106
in Table 2. 107
General molecular cloning procedures, including PCR, DNA extraction and ligation, 108
restriction enzyme digestions, and Southern blotting were conducted as per the methods of 109
Sambrook (19). All primers used for mutagenesis, protein expression and RT-PCR are listed 110
in Table 2. The in-frame deletion mutant of fsnR was constructed by homologous, 111
double-crossover recombination using the suicide vector pk18mobsacB (20). Correction of 112
the in-frame deletion mutant was verified by PCR and sequencing. A genetic complementary 113
strain was constructed as outlined below. EcoRI and HindIII restriction sites were introduced 114
into full-length fsnR, the gene sequence amplified by PCR, the amplicon ligated with pHM1 115
broad-host vectors, and electroporated into S. maltophilia strains. In this construct, fsnR is 116
under the control of a placZ promoter. 117
118
Biofilm assay and quantification. The crystal violet staining method for the quantification of 119
biofilm formation was adapted from a previously described method (21, 22). In brief, S. 120
maltophilia cultures were inoculated quantitatively into NYG medium within 96-well 121
polystyrene plates and incubated at 28°C for 8 hours without shaking. The optical density 122
(OD600) for each well was measured on a TECAN Infinite 200 PRO microplate reader. The 123
wells were washed rigorously with water prior to staining with 1% crystal violet solution for 124
20 min. The wells were washed, the crystal violet stain solubilized in absolute ethanol, and 125
biofilm formation measured at OD590 on a microplate reader. Each data point was averaged 126
from at least four replicates. 127
128
Swimming motility and transmission electron microscopy. For the swimming motility 129
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 7: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/7.jpg)
7
assay, bacterial strains were inoculated into 0.1% NYG agar with a toothpick, cultured for 24 130
hours at 28°C, and the diameters of the swimming zones measured. 131
Transmission electron microscopy was used to observe flagella morphology. Briefly, 132
bacterial suspensions prepared from cultures of S. maltophilia were placed directly on 133
glow-discharged carbon-coated grids, stained with 2.0% uranyl acetate for 2 min, washed 134
twice with water, and air dried. Bacterial flagella were then visualized using a JEDL 135
JEM-1400 transmission electron microscope (JEOL, USA). 136
137
RNA extraction and semi-quantitative RT-PCR. Total bacterial RNA was extracted using 138
TRIzol (Invitrogen, USA) according to the manufacturer’s instructions. The extracted RNA 139
was quantified with a NanoDrop spectrophotometer (Thermo Fisher, USA). Total RNA was 140
treated with DNA-free DNAse (Life Technologies, USA) to remove contaminating DNA. The 141
first strand of cDNA was synthesized using random primers (Promega, USA) and Superscript 142
III reverse transcriptase (Invitrogen, USA). Controls used in the semi-quantitative RT-PCR 143
assay are as follows: DNA templates of the WT strain were included as the positive control 144
for PCR, tmRNA amplification was the loading control for RT-PCR, and samples that lacked 145
reverse transcriptase during cDNA synthesis were included as negative controls to evaluate 146
potential DNA contamination. Primers used for the amplification of sample genes and tmRNA 147
genes are listed in Table 2. 148
149
Protein expression and electrophoretic mobility shift assay (EMSA). Recombinant 150
FsnR-His6 protein was expressed in E. coli BL21(DE3) cells transformed with a recombinant 151
pET30a (Novagen) expression vector. PCR primers used in the construction of the 152
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 8: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/8.jpg)
8
recombinant vector are listed in Table 2. FsnR-His6 protein was purified by Ni-NTA affinity 153
chromatography according to the manufacturer’s instructions (Novagen). The purified protein 154
was concentrated using Centricon YM-10 columns (Millipore, Austrilia), and the buffer 155
exchanged with storage buffer (50 mM Tris-HCl, 0.5 mM EDTA, 50 mM NaCl, 5% glycerol; 156
pH 8.0) for further use. 157
For the EMSA, promoter regions of the Smlt2303 and Smlt2318 operons were amplified 158
by PCR (Table 2 for primer sequences). The PCR products (299 bp and 267 bp, respectively) 159
were labeled with [α-32
P]-dCTP using the Prime-A-Gene Kit (Promega, USA), and free 160
[α-32
P]-dCTP removed by a ProbeQuant G-50 column (GE, USA). DNA probes (4 fmol) and 161
proteins (1 μg) were co-incubated in reaction buffer containing 10 mM Tris (pH 7.0), 50 mM 162
KCl, 1 mM DTT (pH 7.5), 2.5% glycerol, 5 μl MgCl2, 50 ng/μl poly(dI:dC), 0.05% NP-40, 163
and 10 mM EDTA for 20 minutes at room temperature. A 4 μl aliquot of DNA loading buffer 164
(0.25% bromophenol blue, 40% sucrose) was added to stop the reaction and the samples 165
loaded into a 5% native PAGE gel. Electrophoresis was performed at 120 V for about 40 min 166
using 0.5 × TBE buffer. The gel was placed in a zip-lock bag and phosphor imaging screens 167
used for signal detection. Unlabeled probes were used in the competitive experiments. 168
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 9: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/9.jpg)
9
RESULTS 169
170
Construction and screening of the random insertion mutant library of S. maltophilia 171
S. maltophilia ATCC 13637 is a clinical strain isolated from the oropharyngeal region of 172
a patient with mouth cancer. It was chosen for use in the current study as it rapidly forms 173
biofilms within several hours. A random, Tn5 transposon insertion mutant library was 174
constructed with the EZ::TN transposome system (16). The library comprises 37 384-well 175
plates and 14,208 kanamycin resistant transformants. To evaluate the randomness and 176
proportion of single-copy insertions, total DNA from 29 randomly chosen clones was 177
extracted, digested with SmaI, and analyzed by Southern blotting. As shown in Figure 1A, 27 178
clones (93%) contained single-copy insertions, whilst two clones (7%, lanes 13 and 14) were 179
simultaneously inserted with two EZ::TN transposons. Additionally, six clones cultivated in 180
NYGB media in the absence of kanamycin for 20 generations maintained their resistance to 181
kanamycin, confirming the stability of the transposon inserts (Fig. S1 in supplementary 182
information). 183
The library was then screened for mutants with altered biofilm-forming capabilities using 184
the crystal violet staining assay. Bacterial growth was also quantified to eliminate potential 185
growth-associated contributions to changes in biofilm formation. The primary screening 186
round identified a total of 396 clones exhibiting changes in the quantity of biofilm on the 187
polypropylene surface (Fig. 1B). These clones were selected, propagated in 96-well plates, 188
and subjected to four additional rounds of screening by biofilm assay. Of the 396 clones 189
selected, 244 were identified as false-positive because their phenotypic change failed to be 190
stably replicated throughout the screening process. Additionally, 53 clones with poor or no 191
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 10: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/10.jpg)
10
growth were excluded from subsequent analyses because the decrease in biofilm formation 192
could be caused by auxotrophy or slow growth. Thermal asymmetric interlaced (TAIL)-PCR 193
was used to identify genomic sequences flanking the EZ::TN transposon insertion sites for 99 194
clones exhibiting decreased (80 clones) and increased (19 clones) biofilm formation. 195
196
Identification of genes responsible for biofilm formation emphasizes the role of flagella 197
biosynthesis 198
TAIL-PCR analysis successfully identified the transposon insertional sites in each of 199
these clones. A total of 46 non-redundant genes, 4 intergenic regions, and 2 undefined 200
insertion sites within a multicopy locus were identified (Fig. 2A and Table S1). Because the 201
genome of S. maltophilia ATCC 13637 has not been sequenced, the inserted genes were 202
mapped onto the complete genome of S. maltophilia reference strain K279a (1). The mutant 203
genes can be functionally classified into nine categories: 1) flagella and pili assembly; 2) 204
polysaccharide biosynthesis, e.g. xanA; 3) peptide and lipid synthesis; 4) purine biosynthesis, 205
e.g. purE, purK, guaA, and purC; 5) transmembrane transportation; 6) gene expression 206
regulation; 7) oxidoreduction; 8) transposable elements, and 9) unknown function (Fig. 2B 207
and Table S1). Overall, mutations identified in five genes were associated with an increase in 208
biofilm formation, whilst the remaining 41 genes showed deficits. Southern blotting analysis 209
revealed that all the above identified mutants contain a single-copy of transposon (Fig. S2). 210
Almost half of the genes identified (20 genes, 43.5%) were associated with flagella 211
structure and regulation; highly suggestive that the flagellum plays a prominent role in S. 212
maltophilia biofilm formation. As shown in Figure 3, these genes were organized into 10 213
putative operons in the genome of S. maltophilia reference strain K279a. These operons 214
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 11: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/11.jpg)
11
encode structural and assembly proteins associated with different stages of flagellar assembly. 215
FlhA, FliO, FliN, FliM, FliI, FliF, FlgI, FlgH, and FlgG are structural components of the basal 216
body. FliD is the flagellar filament capping protein, whilst FliK controls flagellar hook length 217
during assembly. FlhF is a putative GTPase that is often necessary for assembly and 218
placement of polar flagellar. FliJ acts as a chaperone, exporting flagellar proteins from the 219
cytoplasm into the periplasm. FlgL, FlgK, FlgJ, and FlgE are components of the flagellar 220
hook and assist in connecting the basal body to the filament. 221
It is noteworthy, that five regulatory genes were identified within or in the vicinity of 222
flagellar gene clusters. Smlt2270 (fliA) and Smlt2297 encode σ28
and σ54
, respectively. These 223
alternative sigma factors are involved in regulating flagellar gene transcription. Smlt0158 224
encodes a histidine kinase (NRII or GlnL) which may phosphorylate the putative cognate 225
response regulator Smlt0159 (NRI or GlnG). Smlt2324 encodes a PAS/PAC 226
domain-containing histidine kinase that is orthologous to RavS of Xanthomonas campestris 227
(23). In the vicinity of ravS, there was another histidine kinase gene (ravA, Smlt2322) and a 228
GGDEF/EAL domain-containing response regulator gene Smlt2323 (orthologue of ravR). 229
Additionally, a response regulator gene, Smlt2299, was also identified. Smlt2299 encodes a 230
putative protein product with 210 amino acid residues in length. The protein contains an 231
N-terminal receiver domain for accepting phosphoryl groups, and a C-terminal LuxR-type 232
DNA-binding domain. In the absence of a histidine kinase gene near Smlt2299, its product 233
Smlt2299 was considered an “orphan” response regulator. To our knowledge Smlt2299 and its 234
orthologues have not been reported previously. As this gene is not an ortholog of known 235
flagella-associated response regulators, such as FlgR of Campylobacter jejuni and 236
Helicobacter pylori, we proposed “FsnR” was a more suitable name for the flagella 237
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 12: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/12.jpg)
12
biosynthesis regulator Smlt2299. The regulatory role of FsnR was investigated further in the 238
current study. 239
240
FsnR controls biofilm development and flagella biosynthesis 241
Since fsnR is putatively located in an operon and transposon insertion may lead to polar 242
effect to complicate the genetic analysis, we constructed a non-polar, in-frame deletion mutant 243
of fsnR via homologous double cross-over recombination. This mutant strain was labeled 244
SM001 (ΔfsnR). To generate the complement gene mutation, the full-length sequence of fsnR 245
was amplified by PCR, cloned into the broad-host vector pHM1, and transformed into SM001, 246
giving rise to strain SM002 (ΔfsnR-fsnR). In this construct, fsnR was under the control of the 247
placZ promoter. As shown in Figures 4A and 4B, SM001 biofilm production had decreased 248
significantly to 27.5% of WT strain, whilst genetic complementation substantially restored the 249
bacteria’s biofilm forming ability (77.6% of WT strain). Similar growth curves were observed 250
for SM001 and WT strain, whilst SM002 grew comparatively slower (Fig. 4C). The disparity 251
in growth curves may be caused by overexpression of the fsnR gene for SM002. These results 252
demonstrated that mutations in the fsnR gene were responsible for deficiencies in bacterial 253
biofilm formation, and that the phenotypic change was not due to changes in growth rate. 254
Because fsnR resides in an operon with fliS, fliD, and two as yet functionally unknown 255
genes Smlt2300 and Smlt2301, we surmised Smlt2299 may be required for the regulation of 256
flagellar biosynthesis and bacterial motility. As such, swimming motility and flagella 257
morphology were investigated for each of the bacterial strains. The mutant SM001 was found 258
to be non-motile on semi-solid NYG agar plates containing 0.1% agar, whilst genetic 259
complementation partially restored the swimming ability of SM002 to 50.5% of WT strain 260
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 13: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/13.jpg)
13
(Fig. 5A). Transmission electron microscopy confirmed the presence of clearly visible polar, 261
single flagellum for most WT and SM002 cells, whilst SM001 cells lacked flagella (Fig. 5B). 262
These results demonstrate that the response regulator FsnR controls flagella biosynthesis and 263
cell motility. 264
265
FsnR directly binds to promoters of flagellar genes and activates their transcription 266
Semi-quantitative RT-PCR was used to establish whether FsnR is a critical transcription 267
factor in controlling flagellar gene expression. The transcription levels of 11 genes located in 268
the 5' region of operons associated with flagella assembly (Fig. 3) were measured. As shown 269
in Figure 6A, with the exception of Smlt0710 whose expression was at undetectable levels, 270
the quantity of mRNA for these representative genes was markedly reduced in the fsnR 271
mutant. In contrast, the transcriptional levels of all genes was either restored, or increased to 272
levels greater than for WT, for complementary strain SM002. This result suggests that FsnR is 273
a canonical, positive regulator, directly or indirectly controlling the transcription of most 274
flagellar genes. 275
FsnR encodes a C-terminal LuxR-type DNA binding domain and may act as a 276
transcription factor. A recombinant FsnR-His6 protein expressed in E. coli and purified by 277
Ni-NTA affinity chromatography was used in EMSAs to establish whether FsnR binds to the 278
5' promoter of operons Smlt2303 and Smlt2318. The promoter region of the Smlt2303 operon 279
was selected because fsnR is putatively located within this operon. If FsnR binds to the 280
cis-regulatory elements of the Smlt2303 operon, it will form an autoregulation loop. 281
Conversely, the 5' promoter sequence of the Smlt2318 operon was selected because the operon 282
contains 12 genes (Smlt2307-Smlt2318) and is the largest gene cluster of all 283
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 14: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/14.jpg)
14
flagellar-associated operons. FsnR-His6 formed stable protein-DNA complexes with the 284
promoter sequences of both Smlt2303 (Fig. 6B) and Smlt2318 (Fig. 6C). The addition of 285
unlabeled probes effectively competed with the binding of FsnR-His6 to isotope-labeled 286
probes. These results demonstrated FsnR specifically binds to the promoter regions of the 287
Smlt2303 and Smlt2318 operons and activates their transcription, which may be a critical 288
regulatory process during S. maltophilia biofilm development. 289
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 15: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/15.jpg)
15
DISCUSSION 290
291
The molecular process of S. maltophilia biofilm formation is important to defend this 292
emergent pathogen (3). Here we identified 46 genes containing mutations associated with 293
changed biofilm formation (Fig. 2 and Table S1). As these genes are involved in multiple 294
biochemical and regulatory cascades, we could surmise that S. maltophilia biofilm formation 295
is a tightly controlled, and highly complex process. With the exception of a few genes, such as 296
xanA which is involved in polysaccharide biosynthesis (12), all remaining genes had not 297
previously been reported, hence their roles in biofilm development require further 298
investigation. We provided evidence that an orphan response regulator, FsnR, directly binds to 299
promoters of at least two flagella-associated operons, activating their transcription (Fig. 6). 300
Inactivation of fsnR resulted in deficiencies in flagella assembly, swimming motility and 301
biofilm formation (Fig. 4 and Fig. 5). These results identify FsnR as a pivotal modulator of S. 302
maltophilia biofilm formation, and as such a desirable target in the development of novel 303
antibacterial agents. 304
In the current study, we identified 17 structural and three regulatory genes associated with 305
flagellar assembly (Table S1). The vital role bacterial flagella play in biofilm development is 306
well recognized (24). Flagella not only contribute to cell motility during biofilm formation 307
and dispersal, but also take part in surface sensing and colonization (25). Consequently, subtle 308
regulation of flagellar biosynthesis and cell motility behavior are important in generating and 309
maintaining the bacterial biofilm matrix. In general, regulatory genes of flagella can be 310
assigned to one of three groups: Group I regulates flagella gene expression and assembly, 311
Group II regulates flagella-associated chemotaxis, and Group III regulates modes of flagella 312
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 16: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/16.jpg)
16
operation (24). To date, these regulatory genes have not been studied in S. maltophilia. Here 313
we identified a number of regulatory genes. fsnR was characterized as a Group I transcription 314
regulator responsible for activation of a number of flagellar genes of S. maltophilia. BlastP 315
sequence alignment revealed FsnR shared the greatest homology with E. coli UvrY (e = 1e-40, 316
identity = 38%, 100% coverage). Inactivation of uvrY caused deficiencies in biofilm 317
formation and virulence for a number of enterobacterial species. A uvrY gene mutation 318
down-regulated type 1 and Pap fimbriae in E. coli (26). Teplitski et al (2006) reported that 319
uvrY (sirA) inactivation caused the repression of the master regulator of flagellar genes, flhDC 320
in Salmonella enterica (27). The present study provides molecular evidence that FsnR is a 321
transcription activator directly binding to the promoter regions of flagellar genes (Fig. 6B). 322
Collectively, these results indicate that a UvrY/FsnR-like response regulator may modulate 323
flagellar gene expression on multiple levels, or that they have experienced functional 324
differentiation of signal rewiring during bacterial evolution. Furthermore, FsnR is an “orphan” 325
response regulator whose cognate histidine kinase remains unknown. Identification of its 326
cognate histidine kinase, using computational methods for prediction of protein-protein 327
interactions together with phosphorylation profiling (28, 29), will improve our understanding 328
of the effects environmental stimuli have on FsnR-mediated flagella assembly. 329
Four other regulatory genes (Smlt2270, Smlt0158, Smlt2297, and Smlt2324) associated 330
with S. maltophilia biofilm formation were identified in the current study. Smlt2270 (fliA) 331
encodes flagella sigma factor FliA (σ28
). The σ28
-containing holoenzyme of S. typhimurium 332
was shown to selectively bind to the -35 region downstream of fliC and anti-sigma factor fliM, 333
activating their transcription at a late stage of flagella assembly (30). Further to this, σ28
was 334
shown to control type III secretion system gene expression in S. typhi (31), suggesting it is a 335
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 17: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/17.jpg)
17
global regulator connecting different physiological pathways. Regulatory gene Smlt2297 336
resides in the fsnR operon, hence its transcription is also modulated by FsnR autoregulation. 337
Smlt2297 encodes an alternative sigma factor (σ54
), known to regulate flagellar gene 338
expression in a diverse range of bacterial species, including Enterococcus faecalis (32), Vibrio 339
fischeri (33), Pseudomonas aeruginosa (34), Burkholderia cenocepacia (35). Consequently, 340
inactivation of σ28
or σ54
has been shown to result in deficiencies in motility, virulence and 341
biofilm formation. To date, the consensus binding motifs of σ28
and σ54
in most of the 342
aforementioned bacteria and including S. maltophilia remain unclear. 343
As with fsnR, the two regulatory genes, glnL and ravS, encode histidine kinase sensors 344
belonging to two-component signal transduction systems. GlnL (Smlt0158, NRII) is a 345
putative histidine kinase with a predicted transmembrane domain. The presence of a PAS 346
domain at the N-terminal region of GlnL suggests GlnL has the capacity to detect intracellular 347
redox potentials, oxygen, or other stimuli. Not surprisingly, glnL is situated with a putative 348
cognate response regulator gene, glnG (Smlt0159). GlnG (NRI) is a NtrC-family transcription 349
factor containing the receiver AAA, and a helix-turn-helix output domain. Future studies will 350
focus on the GlnL-GlnG regulon and its relationship with S. maltophilia biofilm formation. 351
The fourth regulatory gene identified in the present study was Smlt2324, an ortholog of the 352
ravS gene of X. campestris. In X. campestris, ravS encodes a PAS domain-containing histidine 353
kinase and appears to constitute a “three-component” signal transduction system (RavSAR) 354
with histidine kinase RavA and response regulator RavR (23, 36). The RavSAR system seems 355
to regulate bacterial gene expression by affecting turnover of the second messenger c-di-GMP; 356
conceivable as RavR encodes both a putative diguanylate cyclase (GGDEF) and c-di-GMP 357
phosphodiesterase (EAL) domain (23). RavSAR gene inactivation markedly attenuated the 358
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 18: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/18.jpg)
18
virulence of X. campestris (23, 36). However, comparatively little is known of the RavSAR 359
regulation, and it would be worthwhile investigating the role of RavS during RavA-RavR 360
phosphotransfer, the nature of the signals detected by RavS and RavA, and establishing how 361
these three proteins constitute a dynamic protein complex during regulation. 362
Gene mutations causing increased biofilm formation have been identified in other 363
bacterial species, including lipopolysaccharide related genes in E. coli (37), a 364
S-ribosylhomocysteinase gene luxS in Listeria monocytogenes (38), and two-component 365
signaling system genes in P. aeruginosa (39). We identified five genes whose mutants 366
exhibited a substantial increase in biofilm formation compared with that of the WT strain (Fig 367
2A and Table S1). Four of these genes, Smlt3804, Smlt4259, Smlt0490 and Smlt0625 encode 368
enzymes, whilst Smlt0416 encodes a protein of unknown function. Insufficient information 369
was obtained in the current study to elucidate a relationship between biofilm formation and 370
the functionality of these genes. For example, Smlt3804 encodes a glyceraldehyde 371
3-phosphate dehydrogenase (GAPDH) which is involved in glycolysis. Studies have 372
suggested a role for GAPDH in bacterial biofilm formation. GAPDH expression was altered 373
in mutants with biofilm deficiencies for Streptococcus suis and S. mutans (40, 41). In S. oralis, 374
cell-surface GAPDH acts as the binding site for periodontopathic bacteria Porphyromonas 375
gingivalis biofilm formation (42, 43). These studies indicated that GAPDH has a role in 376
bacterial biofilm. However, further experimental evidence is needed to elucidate why 377
mutations in the five genes listed above resulted in an increase in S. maltophilia biofilm 378
production. 379
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 19: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/19.jpg)
19
ACKNLOWEDGEMENTS 380
381
This study was financially supported by the Strategic Priority Research Program of the 382
Chinese Academy of Sciences (Grant No. XDB11040700), the National Basic Research 383
Program of the Ministry of Science and Technology of China (Grant No. 2011CB100700), 384
National Science Foundation of China (Grant Nos. 31370127, 31070081, and 31400071), and 385
China Ocean Mineral Resources R & D Association (Grant No. DY125-15-T-07). 386
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 20: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/20.jpg)
20
TABLE 1 Bacterial strains and plasmids used in this study 387
388
Strains or plasmids Genotype or description1 Resources
Strains
S. maltophilis ATCC 13637 WT, wild-type strain CGMCC
E. coli strain DH5α Host strain for molecular cloning Lab collection
E. coli strain BL21(DE3) Host strain for protein expression (KanR) Lab collection
SM001 ΔfsnR, in-frame deletion mutant of fsnR This study
SM002 ΔfsnR-fsnR, genetic complementary strain of
SM001 mutant (StrR)
This study
SM003 CK, SM001 containing a blank pHM1 vector
(StrR)
This study
Clones from mutant library EZ::TN transposon mutants of WT strain with
biofilm deficiency (KanR)
Table S1 for details
Plasmids
pK18mobsacB Suicide vector to create mutant by double
cross-over (KanR)
Schafer et al. 1994
pET30a Protein expression vector (KanR) Novagen
pHM1 Broad-host vector for genetic complementation
(SpR)
Lab collection
pHM2299 pHM1::fsnR, genetic complementary vector (StrR) This study
pET2299 pET30a::fsnR, vector expression FsnR (KanR) This study
1. Kan
R: kanamycin resistant; Str
R: streptomycin resistant. 389
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 21: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/21.jpg)
21
TABLE 2. Primers used in this study. 390
391
Primer
name
Sequence (5ˊ-3ˊ)1 Purpose
SP1 GATAGATTGTCGCACCTGATTG Specific primer 1, For TAIL-PCR
SP2 AAGACGTTTCCCGTTGAATATG Specific primer 2, For TAIL-PCR
SP3 GCAATGTAACATCAGAGATTTTGAG Specific primer 3, For TAIL-PCR
AD1 NTCGASTWTSGWGTT Arbitrary primer, for TAIL-PCR
AD4 TGWGNANCASAGA Arbitrary primer, for TAIL-PCR
AD5 AGWGNAGWANCAWAGG Arbitrary primer, for TAIL-PCR
AD6 CAWCGICNGAIASGAA Arbitrary primer, for TAIL-PCR
AD8 STTGNTASTNCTNTGC Arbitrary primer, for TAIL-PCR
Kan Sense: GCAATCAGGTGCGACAATC
Antisense: AAGTCAGCGTAATGCTCTGC
DNA probe used in Southern
Blotting
IFD2299 Sense-W: GAATTCTTACTCCAGCTCGTGCTG
Antisense-X: ACTAGTAGCAACAAGGAAATCGCC
Sense-Y: ACTAGTGTCCATCAGGACCACGTC
Antisense-Z: AAGCTTGTGCGAGTTCTCATCGTC
For ΔfsnR mutant construction
C2299 Sense: AAGCTTGTGCGAGTTCTCATCGTC
Antisense: GAATTCTTACTCCAGCTCGTGCTG
For ΔfsnR-fsnR construction
P2299 Sense: CGCCATATGCGAGTTCTCATCGTCGAC
Antisense: AAGCTTCTCCAGCTCGTGCTGATG
For FsnR protein expression
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 22: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/22.jpg)
22
Pb2303 Sense: GTGATTCTCCTGGATCC
Antisense: CTCTTTCAGCGCTGTACCT
For EMSA probe of Smlt2303
Pb2318 Sense: GGCTGCTGTATCGGCGGGGT
Antisense: GGCGCCTCCTGTCGATGG
For EMSA probe of Smlt2318
0706 Sense: GTGCCGTTGCCGGTCGTAC
Antisense: GGACCTGGTTGTTCGAGC
Semi-qRT-PCR analysis of Smlt0706
0710 Sense: CATCAACCGGCCGTGGCC
Antisense: CTACGGTCTGCTGCAGGG
Semi-qRT-PCR analysis of Smlt0710
2274 Sense: GTGGGAGCATTCATGGTC
Antisense: GAAATGAAGGAGAGCGAG
Semi-qRT-PCR analysis of Smlt2274
2283 Sense: GAGAACAGCATCAGCAGG
Antisense: CTTCACCCAGTCCAAGCAC
Semi-qRT-PCR analysis of Smlt2283
2290 Sense: GACCATCACCTTGGCGAG
Antisense: CTGCCGGGCACGGTGCTG
Semi-qRT-PCR analysis of Smlt2290
2297 Sense: GACGGTGGACTCGTGCATG
Antisense: AGTACGAACAGGCGCTGG
Semi-qRT-PCR analysis of Smlt2297
2303 Sense: GCTGACGTAGCCGTCGAC
Antisense: TGGGACTGCAGACGCGTG
Semi-qRT-PCR analysis of Smlt2303
2306 Sense: GAGATCTGCAGGCCGGAG
Antisense: TCCTTCACCAGCCAGCTG
Semi-qRT-PCR analysis of Smlt2306
2318 Sense: GTTCTCGCCTGAGGCGTG
Antisense: GTGCTCGATCCGGCGATG
Semi-qRT-PCR analysis of Smlt2318
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 23: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/23.jpg)
23
2319 Sense: CAACACCACGGTGGAGGT
Antisense: CCGGGCAGCGTCACGCTG
Semi-qRT-PCR analysis of Smlt2319
2324 Sense: TCGTCTTCCTGCAGGGAG
Antisense: CAGCTTCCATGCCGGCCTG
Semi-qRT-PCR analysis of Smlt2324
tmRNA Sense: GGGGGTGCACTGGTTTCG
Antisense: TGGTGGAGGTGGGCGGAAT
Semi-qRT-PCR analysis of tmRNA
1 Standard IUB/IUPAC nucleic acid codes 392
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 24: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/24.jpg)
24
FIGURE LEGENDS 393
394
FIG 1. Construction and screening of a random transposon insertion mutant library of S. 395
maltophilia. (A) Determination of randomness, and insertional copy numbers of mutants. 396
Twenty-nine randomly chosen colonies of EZ::TN transposon insertional transformants and of 397
wild-type (WT) strain were analyzed by Southern blotting. Total DNA was extracted from the 398
bacterial strains, digested with SmaI, and fractionated in a 1% agarose gel. A PCR product of 399
EZ::TN transposon was labeled with [α-32
P]-dCTP and used as the DNA hybridization probe. 400
M: 1 kb DNA ladder. (B) Pipeline of screening for mutants with biofilm deficiency. The 401
number of mutants obtained after each round of screening is shown. Details of the screens 402
were described in the Materials and Methods section of this report. 403
404
FIG 2. Mapping the insertional sites on the genome of S. maltophilia. (A) Schematic view of 405
the insertional sites on the genome of S. maltophilia, using the complete genome of K279a as 406
a reference. Coding sequences (CDSs) were as per the genomic annotation for K279a. Genes 407
carrying mutations which resulted in a decrease or increase in biofilm formation are depicted 408
in black and red, respectively. (B) Functional classification of the mutated genes. Detailed 409
information on the mutated genes in (A) and (B) is provided in Table S1. 410
411
FIG 3. Transposon insertions in gene clusters associated with flagella or pili assembly. White 412
arrows indicate CDSs and the direction in which they are transcribed. Black arrows indicate 413
genes disrupted by transposon insertions. Black triangles indicate independent EZ::TN 414
transposon insertions. Virtual Institute of Microbial Stress and Survival (VIMSS) operon 415
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 25: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/25.jpg)
25
predictions are illustrated below. 416
417
FIG 4. Mutations in fsnR substantially reduced biofilm formation. (A) Crystal violet stained 418
biofilm formed by bacterial strains. (B) Quantification of bacterial biofilm formation by 419
optical density (OD590) measurements. Bars represent standard deviations (n = 4). **, P < 0.01, 420
calculated by Student’s t-test. WT: wild-type strain; ΔfsnR: fsnR in-frame deletion mutant 421
SM001; ΔfsnR-fsnR: complementary strain SM002; CK: ΔfsnR containing a blank pHM1 422
vector SM003. (C) Growth curves of bacterial strains in rich NYG medium. Bars represent 423
standard deviations (n = 4). 424
425
FIG 5. fsnR mutation resulted in deficiencies in swimming motility and flagellar development. 426
(A) Swimming motility of bacterial strains. All strains were inoculated into 0.1% NYG agar 427
and grown for 24 hours. WT: wild-type strain; ΔfsnR: fsnR in-frame deletion mutant SM001; 428
ΔfsnR-fsnR: complementary strain SM002; CK: ΔfsnR containing a blank pHM1 vector 429
SM003. (B) fsnR mutation caused abnormalities in flagella assembly. Bacterial morphology 430
was observed with a scanning transmission electron microscope. Magnification 4000×. Black 431
arrows indicate the presence of flagella. 432
433
FIG 6. FsnR controls expression of flagellar genes and directly binds to promoter regions. (A) 434
Semi-quantitative RT-PCR assays of flagella-associated gene transcriptions. RT represents 435
RT-PCR amplification using cDNAs synthesized from total RNA of bacterial strains; −RT 436
denotes the negative control in which reverse transcriptase was absent during cDNA synthesis; 437
amplification using bacterial DNA and cDNA of tmRNA as templates were used as the 438
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 26: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/26.jpg)
26
positive control and loading control, respectively. WT: wild-type strain; ΔfsnR: fsnR in-frame 439
deletion mutant; ΔfsnR-fsnR: complementary strain. (B) and (C) EMSA detected FsnR 440
directly binds to promoter regions of Smlt2303 (B) and Smlt2318 (C) operons, respectively. 441
Four fmol of [α-32
P]-dCTP-labeled double-stranded DNA corresponding to the Smlt2303 and 442
Smlt2318 promoter regions, respectively, were used in each reaction. Increasing amounts of 443
unlabeled probes were used as competitors (10 – 250×) for binding to 1 μg of FsnR-His6 444
recombinant protein. Black triangle (right) indicates the protein-DNA binding complexes. 445
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 27: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/27.jpg)
27
REFERENCES 446
447
1. Crossman LC, Gould VC, Dow JM, Vernikos GS, Okazaki A, Sebaihia M, 448
Saunders D, Arrowsmith C, Carver T, Peters N, Adlem E, Kerhornou A, Lord A, 449
Murphy L, Seeger K, Squares R, Rutter S, Quail MA, Rajandream MA, Harris D, 450
Churcher C, Bentley SD, Parkhill J, Thomson NR, Avison MB. 2008. The 451
complete genome, comparative and functional analysis of Stenotrophomonas 452
maltophilia reveals an organism heavily shielded by drug resistance determinants. 453
Genome Biol. 9:R74. 454
2. Ryan RP, Monchy S, Cardinale M, Taghavi S, Crossman L, Avison MB, Berg G, 455
van der Lelie D, Dow JM. 2009. The versatility and adaptation of bacteria from the 456
genus Stenotrophomonas. Nat. Rev. Microbiol. 7:514-525. 457
3. Brooke JS. 2012. Stenotrophomonas maltophilia: an emerging global opportunistic 458
pathogen. Clin. Microbiol. Rev. 25:2-41. 459
4. Looney WJ, Narita M, Muhlemann K. 2009. Stenotrophomonas maltophilia: an 460
emerging opportunist human pathogen. The Lancet Infect. Dis. 9:312-323. 461
5. Brooke JS. 2014. New strategies against Stenotrophomonas maltophilia: a serious 462
worldwide intrinsically drug-resistant opportunistic pathogen. Expert. Rev. Anti. Infect. 463
Ther. 12:1-4. 464
6. Safdar A, Rolston KV. 2007. Stenotrophomonas maltophilia: changing spectrum of a 465
serious bacterial pathogen in patients with cancer. Cli. Infect. Dis. 45:1602-1609. 466
7. Nicodemo AC, Paez JI. 2007. Antimicrobial therapy for Stenotrophomonas 467
maltophilia infections. Eur. J. Cli. Microbiol. Infect. Dis. 26:229-237. 468
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 28: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/28.jpg)
28
8. Toleman MA, Bennett PM, Bennett DM, Jones RN, Walsh TR. 2007. Global 469
emergence of trimethoprim/sulfamethoxazole resistance in Stenotrophomonas 470
maltophilia mediated by acquisition of sul genes. Emerg. Infect. Dis. 13:559-565. 471
9. Pompilio A, Piccolomini R, Picciani C, D'Antonio D, Savini V, Di Bonaventura G. 472
2008. Factors associated with adherence to and biofilm formation on polystyrene by 473
Stenotrophomonas maltophilia: the role of cell surface hydrophobicity and motility. 474
FEMS Microbiol. Lett. 287:41-47. 475
10. de Oliveira-Garcia D, Dall'Agnol M, Rosales M, Azzuz AC, Alcantara N, 476
Martinez MB, Giron JA. 2003. Fimbriae and adherence of Stenotrophomonas 477
maltophilia to epithelial cells and to abiotic surfaces. Cell. Microbiol. 5:625-636. 478
11. Jucker BA, Harms H, Zehnder AJ. 1996. Adhesion of the positively charged 479
bacterium Stenotrophomonas (Xanthomonas) maltophilia 70401 to glass and Teflon. J. 480
Bacteriol. 178:5472-5479. 481
12. Huang TP, Somers EB, Wong AC. 2006. Differential biofilm formation and motility 482
associated with lipopolysaccharide/exopolysaccharide-coupled biosynthetic genes in 483
Stenotrophomonas maltophilia. J. Bacteriol. 188:3116-3120. 484
13. Ryan RP, Fouhy Y, Garcia BF, Watt SA, Niehaus K, Yang L, Tolker-Nielsen T, 485
Dow JM. 2008. Interspecies signalling via the Stenotrophomonas maltophilia 486
diffusible signal factor influences biofilm formation and polymyxin tolerance in 487
Pseudomonas aeruginosa. Mol. Microbiol. 68:75-86. 488
14. Roscetto E, Angrisano T, Costa V, Casalino M, Forstner KU, Sharma CM, Di 489
Nocera PP, De Gregorio E. 2012. Functional characterization of the RNA chaperone 490
Hfq in the opportunistic human pathogen Stenotrophomonas maltophilia. J. Bacteriol. 491
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 29: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/29.jpg)
29
194:5864-5874. 492
15. Lin YT, Huang YW, Liou RS, Chang YC, Yang TC. 2014. MacABCsm, an 493
ABC-type tripartite efflux pump of Stenotrophomonas maltophilia involved in drug 494
resistance, oxidative and envelope stress tolerances and biofilm formation. J. 495
Antimicrob. Chemoth. doi: 10.1093/jac/dku317 496
16. Goryshin IY, Jendrisak J, Hoffman LM, Meis R, Reznikoff WS. 2000. Insertional 497
transposon mutagenesis by electroporation of released Tn5 transposition complexes. 498
Nat. Biotechnol. 18:97-100. 499
17. Qian W, Jia Y, Ren SX, He YQ, Feng JX, Lu LF, Sun Q, Ying G, Tang DJ, Tang H, 500
Wu W, Hao P, Wang L, Jiang BL, Zeng S, Gu WY, Lu G, Rong L, Tian Y, Yao Z, 501
Fu G, Chen B, Fang R, Qiang B, Chen Z, Zhao GP, Tang JL, He C. 2005. 502
Comparative and functional genomic analyses of the pathogenicity of phytopathogen 503
Xanthomonas campestris pv. campestris. Genome Res. 15:757-767. 504
18. Sun Q, Wu W, Qian W, Hu J, Fang R, He C. 2003. High-quality mutant libraries of 505
Xanthomonas oryzae pv. oryzae and X. campestris pv. campestris generated by an 506
efficient transposon mutagenesis system. FEMS Microbiol. Lett. 226:145-150. 507
19. Sambrook JR, D. W. 2001. Molecular Cloning. Cold Spring harbor Laboratory, Cold 508
Spring Harbor, New York. 509
20. Schafer A, Tauch A, Jager W, Kalinowski J, Thierbach G, Puhler A. 1994. Small 510
mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids 511
pK18 and pK19: selection of defined deletions in the chromosome of 512
Corynebacterium glutamicum. Gene 145:69-73. 513
21. Musken M, Di Fiore S, Romling U, Haussler S. 2010. A 96-well-plate-based optical 514
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 30: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/30.jpg)
30
method for the quantitative and qualitative evaluation of Pseudomonas aeruginosa 515
biofilm formation and its application to susceptibility testing. Nat. Protoc. 516
5:1460-1469. 517
22. O'Toole GA, Kolter R. 1998. Initiation of biofilm formation in Pseudomonas 518
fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic 519
analysis. Mol. Microbiol. 28:449-461. 520
23. He YW, Boon C, Zhou L, Zhang LH. 2009. Co-regulation of Xanthomonas 521
campestris virulence by quorum sensing and a novel two-component regulatory 522
system RavS/RavR. Mol. Microbiol. 71:1464-1476. 523
24. Guttenplan SB, Kearns DB. 2013. Regulation of flagellar motility during biofilm 524
formation. FEMS Microbiol. Rev. 37:849-871. 525
25. Belas R. 2014. Biofilms, flagella, and mechanosensing of surfaces by bacteria. Trends 526
in Microbiol.. 22:517-527. 527
26. Mitra A, Palaniyandi S, Herren CD, Zhu X, Mukhopadhyay S. 2013. Pleiotropic 528
roles of uvrY on biofilm formation, motility and virulence in uropathogenic 529
Escherichia coli CFT073. PloS One 8:e55492. 530
27. Teplitski M, Al-Agely A, Ahmer BM. 2006. Contribution of the SirA regulon to 531
biofilm formation in Salmonella enterica serovar Typhimurium. Microbiol. 532
152:3411-3424. 533
28. Skerker JM, Perchuk BS, Siryaporn A, Lubin EA, Ashenberg O, Goulian M, 534
Laub MT. 2008. Rewiring the specificity of two-component signal transduction 535
systems. Cell 133:1043-1054. 536
29. Skerker JM, Prasol MS, Perchuk BS, Biondi EG, Laub MT. 2005. Two-component 537
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 31: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/31.jpg)
31
signal transduction pathways regulating growth and cell cycle progression in a 538
bacterium: a system-level analysis. PLoS Biol. 3:e334. 539
30. Schaubach OL, Dombroski AJ. 1999. Transcription initiation at the flagellin 540
promoter by RNA polymerase carrying sigma28 from Salmonella typhimurium. J. Biol. 541
Chem. 274:8757-8763. 542
31. Eichelberg K, Galan JE. 2000. The flagellar sigma factor FliA (sigma(28)) regulates 543
the expression of Salmonella genes associated with the centisome 63 type III secretion 544
system. Infect. Immun. 68:2735-2743. 545
32. Iyer VS, Hancock LE. 2012. Deletion of sigma(54) (rpoN) alters the rate of autolysis 546
and biofilm formation in Enterococcus faecalis. J. Bacteriol. 194:368-375. 547
33. Wolfe AJ, Millikan DS, Campbell JM, Visick KL. 2004. Vibrio fischeri sigma54 548
controls motility, biofilm formation, luminescence, and colonization. Appl. Environ. 549
Microbiol. 70:2520-2524. 550
34. Thompson LS, Webb JS, Rice SA, Kjelleberg S. 2003. The alternative sigma factor 551
RpoN regulates the quorum sensing gene rhlI in Pseudomonas aeruginosa. FEMS 552
Microbiol. Lett. 220:187-195. 553
35. Saldias MS, Lamothe J, Wu R, Valvano MA. 2008. Burkholderia cenocepacia 554
requires the RpoN sigma factor for biofilm formation and intracellular trafficking 555
within macrophages. Infect. Immun. 76:1059-1067. 556
36. Tao J, Li C, Luo C, He C. 2014. RavA/RavR two-component system regulates 557
Xanthomonas campestris pathogenesis and c-di-GMP turnover. FEMS Microbiol. Lett. 558
358:81-90. 559
37. Nakao R, Ramstedt M, Wai SN, Uhlin BE. 2012. Enhanced biofilm formation by 560
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 32: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/32.jpg)
32
Escherichia coli LPS mutants defective in Hep biosynthesis. PLoS One 7:e51241. 561
38. Sela S, Frank S, Belausov E, Pinto R. 2006. A Mutation in the luxS gene influences 562
Listeria monocytogenes biofilm formation. Appl. Environ. Microbiol. 72:5653-5658. 563
39. Zhang L, Fritsch M, Hammond L, Landreville R, Slatculescu C, Colavita A, Mah 564
TF. 2013. Identification of genes involved in Pseudomonas aeruginosa 565
biofilm-specific resistance to antibiotics. PLoS One 8:e61625. 566
40. Palmer SR, Crowley PJ, Oli MW, Ruelf MA, Michalek SM, Brady LJ. 2012. 567
YidC1 and YidC2 are functionally distinct proteins involved in protein secretion, 568
biofilm formation and cariogenicity of Streptococcus mutans. Microbiol. 569
158:1702-1712. 570
41. Wang Y, Zhang W, Wu Z, Zhu X, Lu C. 2011. Functional analysis of luxS in 571
Streptococcus suis reveals a key role in biofilm formation and virulence. Vet. 572
Microbiol. 152:151-160. 573
42. Maeda K, Nagata H, Kuboniwa M, Ojima M, Osaki T, Minamino N, Amano A. 574
2013. Identification and characterization of Porphyromonas gingivalis client proteins 575
that bind to Streptococcus oralis glyceraldehyde-3-phosphate dehydrogenase. Infect. 576
Immun. 81:753-763. 577
43. Nagata H, Iwasaki M, Maeda K, Kuboniwa M, Hashino E, Toe M, Minamino N, 578
Kuwahara H, Shizukuishi S. 2009. Identification of the binding domain of 579
Streptococcus oralis glyceraldehyde-3-phosphate dehydrogenase for Porphyromonas 580
gingivalis major fimbriae. Infect. Immun. 77:5130-5138. 581
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 33: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/33.jpg)
1 2 3 4 5 6 7 8 9 10 11 12 13 14
15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 WT M
1 kb
2 kb
3 kb
4 kb
6 kb
10 kb
1 kb
2 kb
3 kb
4 kb
6 kb
10 kbEZ::TN transposon mutant library
(14,208 clones)
396 primary positive mutants
Primary screen
Progeny production
99 positive mutants
Test for auxotrophy and slow growth
Four repeated experiments
53 auxotrphy or slow growth
19 with increased biofilm 80 with decreased biofilm
6 unique sequences 68 unique sequences
13 Incorrect sequences 12 Incorrect sequences
46 genes
4 intergenic regions
2 undefined regions
A B
152 positive mutants
244 false positive clones
Fig. 1
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 34: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/34.jpg)
A
4,851,126 bp
1,2
12,7
80 b
p
2,425,563 bp
3,6
38,3
40 b
p
Sm
lt0158
Sm
lt0208
Sm
lt0209
Sm
lt0276
Sm
lt04
16
Sm
lt04
17-0
418
Smlt0
490
Smlt0518
Smlt0625
Smlt0639
Smlt0653
Smlt0684
Smlt0707
Smlt0708
Smlt0709
Smlt0845Smlt0857
Stenotrophomonas maltophiliausing K279a complete genome as a reference
Smlt1613Smlt1614
Smlt2272
Smlt2072Sm
lt2273
Smlt2280
Smlt2281
Sm
lt2282
Sm
lt2284
Sm
lt2286
Sm
lt2289
Sm
lt2297
Sm
lt2299
Sm
lt2303
Sm
lt2308
Sm
lt2310
Sm
lt2311
Sm
lt2312
Sm
lt2314
Sm
lt2324
Smlt3167Smlt3
426
Smlt3804
Sm
lt4318
Sm
lt4552
Sm
lt4645-4
647
Smlt0722-0723
Sm
lt4554
Sm
lt4259
Smlt0704-0706
Sm
lt04
18
Smlt3195
Smlt2070
B
Flagella and pili structural genes
Polysaccharide and carbohydrate
Purine biosynthesis
Transpotation
Gene regulation
Peptide and lipid synthesis
Oxioreduction
Function unknown
Transposable elements
Intergenic region
Undefined
17
4
63
5
3
3
4
1
42
Fig. 2
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 35: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/35.jpg)
2270 2271 2272 2273 2274 2275 2276 2277 2278 2279 2280 2281 2282 2283 2284 2285 2286 2287 2288 2289 2290 2291 2292Smlt2263
fliA flhF flhA flhB fliR fliQ fliP fliO fliN fliM fliL fliK fliJ fliI fliH fliG fliF fliE
2297
ISPsy9 ISPsy9
Smlt2293 2294 2295 2296 2299 2300 2301 2302 2303 2304 2305 2306 2307 2308 2309 2310 2311 2312 2313 2314 2315 2316 2317
NRI SigmaN fliS fliD fliC flaA flgI flgH flgG flgF flgD flgC flgB
Smlt2319 2320 2321 2322 2323 2324 2325 2326
flgA flgM flgN ravA ravR ravSSmlt0706 0707 0708 0709 0710 0711 0712 0713
smf-1 mrkC wecB nfrB
Putative operon
Putative operon Putative operon Putative operon
Putative operon Putative operon Putative operon Putative operon
2318
Putative operon Putative operon
......
fsnR flgL flgK flgJ flgE
Fig. 3
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 36: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/36.jpg)
WT ΔfsnR ΔfsnR-fsnR CK
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
0.80
0.90
1.00
WT ΔfsnR ΔfsnR-fsnR CK
AB
S O
D590
** **
B
C
0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
10 20 30
AB
S O
D600
Time (h)
WT
ΔfsnR
ΔfsnR-fsnR
CK
A
Biofilm
Fig. 4
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 37: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/37.jpg)
WT ΔfsnR
ΔfsnR-fsnRCK
WT
(Φ = 3.13 ± 0.09 cm)
ΔfsnR
(Φ = 0.45 ± 0.07 cm)
CK
(Φ = 0.48 ± 0.04 cm)
ΔfsnR-fsnR
(Φ = 1.58 ± 0.10 cm)
A B
Fig. 5
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 38: AEM Accepts, published online ahead of print on 5 December ...€¦ · 02/12/2014 · 5 83 MATERIALS AND METHODS 84 85 Bacterial strains, plasmids and culture conditions . The bacterial](https://reader033.fdocuments.us/reader033/viewer/2022050415/5f8b5cb3cf90cb0c262c0735/html5/thumbnails/38.jpg)
tmRNA
Smlt0706
Smlt0710
Smlt2274
Smlt2283
Smlt2290
Smlt2297
Smlt2303
Smlt2318
Smlt2319
Smlt2324
Smlt2306
-RT
WT DNAΔfsnR-
fsnR
Probe: 5’ region of Smlt2303
Free
probe FsnR 10× 50× 200×
Probe: 5’ region of Smlt2318
Free
probeFsnR 25× 250×100×
A B
C200×
ΔfsnR CK
Fig. 6
on October 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from