Advances in Genomics Since the Publication of the Human Genome
description
Transcript of Advances in Genomics Since the Publication of the Human Genome
![Page 1: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/1.jpg)
Advances in Genomics Since the Publication of
the Human GenomeGreg Feero, M.D., Ph.D.
Faculty, Maine-Dartmouth FamilyPractice Residency Program, Fairfield, ME
Contributing editor, Journal of the American Medical Association
![Page 2: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/2.jpg)
Disclosures• No financial or intellectual conflicts of
interest.
• I am a primary care doctor.
• For better or worse, my opinions are my own!!
![Page 3: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/3.jpg)
Outline• Still waiting for the revolution?
• Discovery apace.
• An unsatisfying answer?
• The final word – education!
![Page 4: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/4.jpg)
Science 4 Feb 2011
![Page 5: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/5.jpg)
Degree of specialization
Impa
ct o
f gen
omic
s
![Page 6: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/6.jpg)
February 2011NHGRI Published New Vision for Genomics
![Page 7: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/7.jpg)
Understandingthe Structure of
Genomes
Understandingthe Biology of
Genomes
Understandingthe Biology of
Disease
Advancingthe Science of
Medicine
Improving theEffectivenessof Healthcare
1990-2003Human Genome Project
2004-2010
2011-2020
Beyond 2020
Genomic Accomplishments: Base Pairs to Bedside
![Page 8: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/8.jpg)
Sequence from chromosome 7
GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCTGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACATATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTGAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA
About 2000 bases
![Page 9: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/9.jpg)
Only about 3,000,000 more slides to go.
![Page 10: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/10.jpg)
At one slide per second, this lecture will be done in about 35 days!
![Page 11: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/11.jpg)
The human genome is pretty darn big.
![Page 12: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/12.jpg)
“The race was to sequence the human genome, all 3 billion genetic letters of it… a race not to the finish but to the starting line. Moreover, … the new race marked by that starting line was a marathon.”
![Page 13: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/13.jpg)
Circa 2000
![Page 14: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/14.jpg)
![Page 15: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/15.jpg)
Circa 2012
![Page 16: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/16.jpg)
Understandingthe Structure of
Genomes
Understandingthe Biology of
Genomes
Understandingthe Biology of
Disease
Advancingthe Science of
Medicine
Improving theEffectivenessof Healthcare
1990-2003Human Genome Project
2004-2010
2011-2020
Beyond 2020
Genomic Accomplishments: Base Pairs to Bedside
![Page 17: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/17.jpg)
Progress in Mendelian disease gene discovery
KnownUnknown, suspected Mendelian
1990 2011
Sources: Lander, E. Nature , Feb. 2011www.genetests.org, Feb 2011
![Page 18: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/18.jpg)
![Page 19: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/19.jpg)
![Page 20: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/20.jpg)
Cystic fibrosis Adult onset diabetes AIDS
![Page 21: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/21.jpg)
![Page 22: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/22.jpg)
Diabetes Diabetes
Unaffected Unaffected
SNP A SNP B
![Page 23: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/23.jpg)
0
300
600
900
1200
1500
1800
Jul-05 Oct-05 Jan-06 Apr-06 Jul-06 Oct-06
Affymetrix 500K
Illumina 317K
Illumina 550K Illumina
650Y
Continued Progress in Genotyping Technology
Courtesy S. Gabriel, Broad/MITJuly 2005 Oct 2006
Cost
per
per
son
(USD
)
![Page 24: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/24.jpg)
NHGRI Catalog of Published Genome-Wide Association Studies (GWAS)
> 5619 SNPs!!
![Page 25: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/25.jpg)
Equation of a Variant’s Predictive Potential
Effect size
X =AssociationStrength
PredictivePotential
![Page 26: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/26.jpg)
Classical genetic study“mutation”
Effect size
X =AssociationStrength
PredictivePotential
Association => Causality
![Page 27: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/27.jpg)
Genome Wide Association Study“SNP”
Effect size
X =AssociationStrength
PredictivePotential
![Page 28: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/28.jpg)
Genome Wide Association Study“SNPs”
Effect size
?X =AssociationStrength
PredictivePotential
![Page 29: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/29.jpg)
Nature, April 2003
Quantum Leaps in Technology:
.….Genome sequencing at $1000 or less for a
mammalian genome…..
![Page 30: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/30.jpg)
Advances in Genome Biology and Technology Conference
February 2012
![Page 31: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/31.jpg)
genome.gov/sequencingcosts
![Page 32: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/32.jpg)
![Page 33: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/33.jpg)
![Page 34: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/34.jpg)
Sequencing
???
Effect size
X =AssociationStrength
PredictivePotential
![Page 35: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/35.jpg)
![Page 36: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/36.jpg)
Frequency vs. Effect
Frequency in population
Effe
ct s
ize Classical
mutation
SNP-like variation
?
![Page 37: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/37.jpg)
Published online April 2, 2012
![Page 38: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/38.jpg)
![Page 39: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/39.jpg)
Nature 9/23/12
![Page 40: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/40.jpg)
30 JUNE 2011
![Page 41: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/41.jpg)
16 June 2011
![Page 42: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/42.jpg)
You are not alone in there….
![Page 43: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/43.jpg)
![Page 44: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/44.jpg)
Genomics
Personalized Medicine
Quality Health Care
![Page 45: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/45.jpg)
![Page 46: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/46.jpg)
JAMA, March 14,2012
![Page 47: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/47.jpg)
Solutions – primary care style…
• 33% of diabetics are undiagnosed --- blood glucose. (Almanac, 2008)
• 24% of hypertensives undiagnosed --- blood pressure measurements. (Almanac, 2008)
• 37% of high cholesterol undiagnosed --- fasting lipid panel. (Almanac, 2008)
• Universal health care, better screening programs, smoking cessation, exercise programs, improved nutrition etc…
![Page 48: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/48.jpg)
WSJ, Nov. 2, 2013
$1,600,000!!!!!!
![Page 49: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/49.jpg)
Are the expenses of targeted treatments sustainable?
For:Patients?Insurers?
State budgets?National economies?
![Page 50: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/50.jpg)
![Page 51: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/51.jpg)
Understandingthe Structure of
Genomes
Understandingthe Biology of
Genomes
Understandingthe Biology of
Disease
Advancingthe Science of
Medicine
Improving theEffectivenessof Healthcare
1990-2003Human Genome Project
2004-2010
2011-2020
Beyond 2020
Genomic Accomplishments: Base Pairs to Bedside
![Page 52: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/52.jpg)
2011Medical Education Issue9/7/2011
![Page 53: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/53.jpg)
Genomics theme issues:JAMAArchives of:DermatologyFacial Plastic SurgeryGeneral PsychiatryInternal MedicineNeurologyOphthalmologyOtolaryngology—Head & Neck SurgeryPediatrics & Adolescent MedicineSurgery
Coming April 2013!
![Page 54: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/54.jpg)
2012 – The rising tide of genomics….2000 – The genomic tsunami
![Page 55: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/55.jpg)
Conclusions• The revolution is here, and happening all about
you.
• The front lines are in specialty care, but not for long.
• Considerably more basic, clinical, and translational research will be need to answer the “cost curve” question.
![Page 56: Advances in Genomics Since the Publication of the Human Genome](https://reader035.fdocuments.us/reader035/viewer/2022062501/568164c9550346895dd6e575/html5/thumbnails/56.jpg)
Some slides courtesy of:
Eric Green, NHGRI
Jean Jenkins, NHGRI
Teri Manolio, NHGRI
THANKS!