Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty,...

56
Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield, ME Contributing editor,

Transcript of Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty,...

Page 1: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Advances in Genomics Since the Publication of

the Human GenomeGreg Feero, M.D., Ph.D.

Faculty, Maine-Dartmouth Family

Practice Residency Program, Fairfield, ME

Contributing editor,

Journal of the American Medical Association

Page 2: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Disclosures• No financial or intellectual conflicts of

interest.

• I am a primary care doctor.

• For better or worse, my opinions are my own!!

Page 3: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Outline

• Still waiting for the revolution?

• Discovery apace.

• An unsatisfying answer?

• The final word – education!

Page 4: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Science 4 Feb 2011

Page 5: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Degree of specialization

Imp

act

of

gen

om

ics

Page 6: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

February 2011NHGRI Published New Vision for Genomics

Page 7: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Understandingthe Structure of

Genomes

Understandingthe Biology of

Genomes

Understandingthe Biology of

Disease

Advancingthe Science of

Medicine

Improving theEffectivenessof Healthcare

1990-2003Human Genome Project

2004-2010

2011-2020

Beyond 2020

Genomic Accomplishments: Base Pairs to Bedside

Page 8: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Sequence from chromosome 7

GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCTGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACATATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTGAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA

About 2000 bases

Page 9: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Only about 3,000,000 more slides to go.

Page 10: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

At one slide per second, this lecture will be done in about 35 days!

Page 11: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

The human genome is pretty darn big.

Page 12: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

“The race was to sequence the human genome, all 3 billion genetic letters of it… a race not to the finish but to the starting line. Moreover, … the new race marked by that starting line was a marathon.”

Page 13: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Circa 2000

Page 14: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 15: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Circa 2012

Page 16: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Understandingthe Structure of

Genomes

Understandingthe Biology of

Genomes

Understandingthe Biology of

Disease

Advancingthe Science of

Medicine

Improving theEffectivenessof Healthcare

1990-2003Human Genome Project

2004-2010

2011-2020

Beyond 2020

Genomic Accomplishments: Base Pairs to Bedside

Page 17: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Progress in Mendelian disease gene discovery

KnownUnknown, suspected Mendelian

1990 2011

Sources: Lander, E. Nature , Feb. 2011www.genetests.org, Feb 2011

Page 18: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 19: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 20: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Cystic fibrosis Adult onset diabetes AIDS

Page 21: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 22: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Diabetes Diabetes

Unaffected Unaffected

SNP A SNP B

Page 23: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

0

300

600

900

1200

1500

1800

Jul-05 Oct-05 Jan-06 Apr-06 Jul-06 Oct-06

Affymetrix 500K

Illumina 317K

Illumina 550K

Illumina 650Y

Continued Progress in Genotyping Technology

Courtesy S. Gabriel, Broad/MIT

July 2005 Oct 2006

Cost

per

pers

on

(U

SD

)

Page 24: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

NHGRI Catalog of Published Genome-Wide Association Studies (GWAS)

> 5619 SNPs!!

Page 25: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Equation of a Variant’s Predictive Potential

Effect size

X =AssociationStrength

PredictivePotential

Page 26: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Classical genetic study“mutation”

Effect size

X =AssociationStrength

PredictivePotential

Association => Causality

Page 27: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Genome Wide Association Study“SNP”

Effect size

X =AssociationStrength

PredictivePotential

Page 28: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Genome Wide Association Study“SNPs”

Effect size

?X =AssociationStrength

PredictivePotential

Page 29: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Nature, April 2003

Quantum Leaps in Technology:

.….Genome sequencing at $1000 or less for a

mammalian genome…..

Page 30: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Advances in Genome Biology and Technology Conference

February 2012

Page 31: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

genome.gov/sequencingcosts

Page 32: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 33: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 34: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Sequencing

???

Effect size

X =AssociationStrength

PredictivePotential

Page 35: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 36: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Frequency vs. Effect

Frequency in population

Effe

ct s

ize Classical

mutation

SNP-like variation

?

Page 37: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Published online April 2, 2012

Page 38: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 39: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Nature 9/23/12

Page 40: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

30 JUNE 2011

Page 41: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

16 June 2011

Page 42: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

You are not alone in there….

Page 43: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 44: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Genomics

Personalized Medicine

Quality Health Care

Page 45: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 46: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

JAMA, March 14,2012

Page 47: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Solutions – primary care style…

• 33% of diabetics are undiagnosed --- blood glucose. (Almanac, 2008)

• 24% of hypertensives undiagnosed --- blood pressure measurements. (Almanac, 2008)

• 37% of high cholesterol undiagnosed --- fasting lipid panel. (Almanac, 2008)

• Universal health care, better screening programs, smoking cessation, exercise programs, improved nutrition etc…

Page 48: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

WSJ, Nov. 2, 2013

$1,600,000!!!!!!

Page 49: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Are the expenses of targeted treatments sustainable?

For:Patients?Insurers?

State budgets?National economies?

Page 50: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,
Page 51: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Understandingthe Structure of

Genomes

Understandingthe Biology of

Genomes

Understandingthe Biology of

Disease

Advancingthe Science of

Medicine

Improving theEffectivenessof Healthcare

1990-2003Human Genome Project

2004-2010

2011-2020

Beyond 2020

Genomic Accomplishments: Base Pairs to Bedside

Page 52: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

2011Medical Education Issue9/7/2011

Page 53: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Genomics theme issues:JAMAArchives of:DermatologyFacial Plastic SurgeryGeneral PsychiatryInternal MedicineNeurologyOphthalmologyOtolaryngology—Head & Neck SurgeryPediatrics & Adolescent MedicineSurgery

Coming April 2013!

Page 54: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

2012 – The rising tide of genomics….2000 – The genomic tsunami

Page 55: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Conclusions

• The revolution is here, and happening all about you.

• The front lines are in specialty care, but not for long.

• Considerably more basic, clinical, and translational research will be need to answer the “cost curve” question.

Page 56: Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield,

Some slides courtesy of:

Eric Green, NHGRI

Jean Jenkins, NHGRI

Teri Manolio, NHGRI

THANKS!