advancement in DNA Technology

7/27/2019 advancement in DNA Technology

1/28

INTRODUCTION

The beginning of the 21ist century has witnessed a revolution in our

knowledge of the DNA sequences of various organisms, the most notable example being the

sequencing of the human genome in 2003. Analysis of genomic DNA will enable us to learn a

great deal about evolution, the relationship between different organisms, the mechanisms by

which genes are controlled, susceptibility to disease, and the hidden languages within the DNA

sequence. The sequencing of an entire genome is not yet, however, a routine technique, and other

Methods of Genetic Analysisare used to quickly and effectively analyze DNA samples. These

methods, and technologies such as DNA fingerprinting, have also transformed forensic science.

The DNA typing methods shows a mark able difference from 1985 (since its discovery by DR

Sir Alec Jeffrey) to till date. The past 18 years have seen tremendous growth in the use of DNA

evidence in crime scene investigations and paternity testing. This rapid growth is always

accompanied with the revolutions in computer technology. Established methods of DNA

sequencing, genetic and forensic analysis all depend on the use of labelled oligonucleotideand

deoxy- or dideoxy-nucleoside triphosphates, and require a DNA polymerization step. This can be

the polymerase chain reaction (Genetic analysis inSTR analysis)1, a single nucleotide

extension (Mini-sequencing inSNP analysis)2, or a combination of polymerization and DNA

chain termination (Sanger sequencing)3.

.


2/28

DNA TYPING CHRONOLOGY

1985 Sir Alec Jeffreys develops multilocus RFLP probes.

1986 DNA testing goes to public through celmark case of Colin pitch fork.

1988 FBI begins DNA casework with single-locus RFLP probes.

1989 DNA detection by gel silver-staining,slot blot, and reverse dot blots.

1990 Population statistics used with RFLP methods are questioned, PCR starts

With DQA-1.

1991 Fluorescent STR markers first described; Chelex extraction.

1992 FBI starts casework with PCR-DQA1, Capillary arrays first described.

1993 First STR kit available, sex-typing (amelogenin) developed.

First STR results with CE.

1995 ABI 310 Genetic Analyzer and Taq Gold DNA polymerase introduced.

National DNA Database developed by UK 18 loci.

1996 FBI starts mtDNA testing, first multiplex STR kits become available.

1997 13 core STR loci defined, Y-chromosome STRs described.

1998 FBI launches national Combined DNA.

2000 SNP hybridization chip developed, Multiplex STR kits are validated .

ABI 3700 96-capillary array used.

2001 Identifier STR kit released with5-dye chemistry ABI 3100 Genetic

Analyzer.

Year Forensic DNA science and application


3/28

2002 FBI mtDNA population database released-STR 20plex published.

2003 Human genome project completed. ENCODE PROJECT starts.

2004 454 Gs-80 pyro sequencing used. Next GEN starts based on Sanger

Dideoxy chain termination

2005 solexia/illumina sequencing starts.

2006 ABISOLiD sequencing

2007 Roche 454 titanium /Illumina GAIIx used sequencing.

ENCODE completed

2009 Illumina GAIIx, SOLiD 3.0

2010 Illumina Hi-Seq2000

NEXT GEN

2013

454/SOLiD/SolexiaHUMAN GENOME

2005

Y-STRs

NEXT GEN

developed

2004

2000

CE is fairly routine

RFLP

FIRST STR

Historical Perspective on DNA Typing

developed

UK NationalDatabase launched

First commercialMultiplexes

2002

Identifiler 5-dye kit

And ABI 3100

PowerPlex

mtDNA1990

FSS

1992

19961994

1998

Capillary electrophoresis

of STRs first described

CODIS loci

PCR developed

(Dot blot)1985 Multiplex STRsDQA1 & PM

Year Forensic DNA science and application


4/28

THE BEGINNING OF THE REVOLUTION

DNA analysis constitutes the most significant aspect of biotechnology related to forensic

science. Since it was first introduced in the mid-1980s, DNA analysis (formerly called DNA

Fingerprinting, but now increasingly referred to as DNA Typing or DNA Profiling) has

revolutionized forensic science like no other technique has, especially in the area of

identification of individuals. The technique was first described in 1985 by Dr. Alec Jeffreys, a

geneticist in the University of Leicester5. He discovered that certain regions of human DNA

contained sequences that repeated over and over contiguously, and that the number of such

repeats differed from individual to individual. By developing a technique to examine the length

variation of these repeat sequences, Dr. Jeffreys devised the ability to fix the identity of

individuals with a high degree of certainty. The technique developed by him came to be called

restriction fragment length polymorphism (RFLP). This really triggered the era of forensic

biotechnology, which has since moved at an amazing pace, and continues to do so, impacting

virtually every area of forensic investigation of serious crimes such as homicide, rape, and

assault.

DNA level individual people are 99.9% identical

1 out of 1000 base pairs differs.

Some DNA differences lead to differences in appearance.

Some differences are found in non-coding DNA.

There are repeats of short nucleotide sequences which are known as VNTRs (Variable

Number Tandem Repeats).

There are dozens or hundreds of alleles in a given population each person having two alleles,

one on each chromosome.

Identification is made based on the VNTRs found in junk DNA.

DNA Information


5/28

1. DNA is isolated from the tissue sample.

2. DNA is then cut (at the molecular level) using an enzyme. The restriction enzymes areable to break apart the DNA molecule in a specific place. There are over 100 different

types of restriction enzymes but some are used commonly.

EcoRI came from bacteria called E.coli; HIND III came from Hemolphilous influenza,strain d

3. These enzymes cut the DNA in areas which are the same in everyone (not the junk DNAwhich varies in different individuals)

4. HIND III recognizes the DNA sequences6

5AAGCTT33TTCGAA5

and it cuts between the two As leaving

5AGCTT

TTCGA 5

5. This sequence is found frequently in the human genome, therefore HIND III cuts the

DNA into many pieces

6. DNA is then separated by loading it into an apparatus which will allow electricity to runthrough a gel plate holding the DNA sample. Different sized pieces of the DNA willseparate and a banding pattern will form allowing identification of matching DNA to

occur.

7. Fragments are separated by size

Wells (Negative End) are filled with DNA

DNA has a negative charge

Small pieces of DNA move farther away from the wellas electricity is run through the

gel.

Note: Though RFLP was the initial method adopted for use, it is no longer the preferred approach

in majority of the forensic laboratories because, it requires good amount of non-degraded DNA (~

1.0 g) which is often very difficult to obtain from the crime scene. Moreover, it uses radiolabel

(Ethidium Bromide) which is hazardous and takes 1-2 weeks for the result to be processed7.

Techniques in RFLP


6/28

The polymerase chain reaction (PCR) is a technique invented by kary mullis in 19808, used

widely in molecular biology, diagnostics, forensic science and molecular genetics, to amplify a

specific region (the amplicon) of and A sample. PCR can amplify a few molecules of a precious

DNA sample (e.g. at the scene of a crime) to produce large quantities of DNA, from 50 to over

25 000 base pairs in length. In PCR, two short oligonucleotide (PCR primers) are designed such

that each is complementary to the 3-end of one of the two target strands at the region to be

amplified: the two PCR primers define the amplicon. The region of the template bound by the

primers is amplified in a series of cycles.PCR requires a DNA polymerase enzyme. While all

organisms contain DNA polymerases, the polymerase that is used in PCR comes from the

thermophilic bacterium Thermus aquaticus. This Taq polymeraseis heat-resistant, meaning that

temperatures of up to 95 C can be used in PCR, conditions of low DNA duplex stability9.

In the first cycle, the double stranded target is separated into two single template strands by

heating to 95 C. It is then cooled to 55 C to allow the synthetic oligonucleotide primers to

anneal to the template strands with their 3' ends facing each other. The temperature is then

increased to 72 C, the optimum temperature for activity of the thermo stable Taq DNA

polymerase. The polymerase utilizes deoxyribonucleotide triphosphates (dNTPs) to extend the

primers along the length of the template producing two new double strands of DNA.

The second cycle of PCR is a repeat of the first cycle, and each newly synthesized single strand

also acts as a template for primer annealing and extension. The polymerase can only be extend

the DNA as far as the locus of the first primer, producing DNA duplexes of a specific length. In

all subsequent cycles amplification produces PCR products of a length specified by the loci of

the two primers, and these PCR products soon outnumber the original target molecules. In

theory, ncycles of PCR will produce 2nPCR products.

Polymerase chain reaction


7/28

Real-time PCR is a variation on the PCR theme that combines normal PCR amplification of

DNA with simultaneous detection of the PCR product, usually in a single reaction tube. In PCR,

the amount of double-stranded DNA increases with each cycle. After multiple cycles of PCR,

there is a large increase in the amount of DNA. In real-time PCR (also called quantitative PCR,

or qPCR), an agent that binds to double-stranded DNA is added to the PCR reaction. As double-

stranded DNA is produced, the agent binds to the newly-synthesized DNA, and produces a signal

allowing the reaction to be monitored in real time. While the aim of PCR is the amplification of

DNA, the purpose of real-time PCR is the analysis of a DNA sample or reaction.

Fluorescent real-time PCR is a combination of PCR amplification and fluorescence detection. In

its simplest form, fluorescent real-time PCR involves the use of an organic dye that is fluorescent

only when bound to a DNA duplex. When such a dye is added at the beginning of a PCR

reaction an increase in fluorescence occurs as the number of DNA duplexes increases, and this is

indicative of successful PCR. SYBR Green is an example of a molecule that binds to double-

stranded DNA and becomes fluorescent on binding (the ds-DNA-dye complex is fluorescent).

SYBR GREEN

Note: TheSYBR-Green real-time PCR method has severe limitations as it is non-specific,

i.e. a positive result is obtained regardless of the nature of the PCR product. As PCR is

prone to arte facts such as primer-dimer formation, simple amplification using unselective

dyes is not always very informative, and probe-based methods provide more meaningful

results10

.

Real Time PCR


8/28

When using PCR in human diagnostics it is important to be certain of the precise nature of the

product. Identification of a key sequence in the PCR product (the amplicon) can be achieved by

adding a fluorogenic DNA probe (a short synthetic oligonucleotide that is complementary to a

specific sequence in the PCR amplicon, and does not fluoresce unless it binds to the amplicon) to

the PCR reaction.When a DNA probe is used in real-time PCR, a positive signal is obtainedonly if the PCR amplicon contains the complementary sequence to the fluorogenic probe: the

fluorescent signal is sequence-specific. In general "fluorogenic" probes contain a fluorescentdyes and a fluorescence quencher. They are non-fluorescent in the absence of a target nucleic

acid because the quencher absorbs energy from the excited fluorophore, and this energy is

dissipated as heat or radiation at a higher wavelength.

Probe based Real Time PCR

Probe Based Real Time PCR


9/28

The Taq Man assay is the most widely used real-time method for the analysis of PCR products,

and is used extensively in SNP analysis and mutation detection. A Taq Man probe consists of an

oligonucleotide labeled with a fluorophore at one end, e.g. 5-FAM (5-fluorescein), and a

fluorescent quencher at the other, e.g. 3-TAMRA. Excitation of fluoresce in at its absorptionwavelength of 495 nm would normally lead to fluorescence emission at 525 nm. However, this

falls within the broad absorption spectrum of the TAMRA dye which is in close proximity in the

Taq Man probe, so energy is absorbed by the TAMRA dye owing to fluorescence resonance

energy transfer (FRET) and fluorescence is observed at the emission wavelength of TAMRA

(585 nm) rather than at the emission frequency of FAM

11

.

The Taq Man assay

The Taq Man assay


10/28

DNA fingerprinting depends on the analysis of short tandem repeats (STRs), short repeating

patterns of two or more nucleotides (e.g. (CA)nor (ACGT)n, where nis several hundred). For

example, in the sequence CGTCAGCACACACACACACACACACACACACATGGCGTG,

the dinucleotide CAis repeated 13 times (n= 13).

Tens of thousands of different short tandem repeats, or microsatelliteshave been identified in

the human genome. STRs are observed at the same positions on chromosomes (loci) in different

members of the population, but the number of repeats (n) varies between individuals. This

variation in number of repeats is an example of polymorphism.

STR analysis uses PCR to measure the number of repeats at specific loci. Primers bind to the

DNA at specific STR loci and, are extended by PCR. The length of the PCR product depends on

the number of repeats. If the PCR primers are labeled, the PCR products will be labeled,

allowing the products to be detected at the end of the reaction. For each STR locus, there will be

two PCR products (one for each of two alleles)12

.

The simultaneous analysis of multiple different STR loci enables a unique profile of an

individual to be built up. Several PCR reactions are carried out simultaneously in a single tube at

different STR loci, giving several products (two for each locus). The following components are

required.

A DNA sample, e.g. a single human hair from the scene of a crime, or buccal cells from a

mouth scrape of a suspect.

Two oligonucleotide PCR primers: one primer labeled at the 5-end with32

P, and one

unlabelled reverse primer

A thermo stable DNA polymerase

Four deoxynucleoside triphosphates: dATP, dGTP, dCTP, dTTP.

When the labeled PCR products are run on a polyacrylamide gel, they separate according to size.

The result is a "DNA ladder" that is characteristic of an individual.

Short Tandem Repeats

STR Analysis


11/28

DNA Fingerprinting By STR

The use of multiple loci provides a very high degree of certainty that no two individuals in a

population will have the same profile (unless they are identical twins). Some current forensic

systems use 10 (e.g. United Kingdom) or 13 (e.g. United States) and others 16 STR loci . Kits

containing PCR primers for the standard STR loci are sold commercially.

13 CODIS Core STR LociWith Chromosomal Positions

13

CSF1PO

D5S818

D21S11

TH01

TPOX

D13S317

D7S820

D16S539 D18S51

D8S1179

D3S1358

FGA

VWA

AMEL

AMEL


12/28

In a more modern variant of STR analysis, the PCR primers are labeled with fluorescent dyes.

Primers for different STR loci are labelled with different fluorescent dyes, adding a second

dimension to the assay .As it has so far been possible to develop only a limited number of

fluorescent dyes with well-resolved spectral characteristics, three different fluorescent dyes are

typically used.

Fluorescent STR Analysis

NOTE: Conventional STR multiplex analysis works best where there is at least 1ng of good

quality DNA present and fewer than 28 PCR cycles are required to generate sufficient material

for a full PCR profile. However, many forensic samples contain much lower levels of DNA than

this and/or the DNA is degraded and in these circumstances a different approach is required.

Low copy number STR analysis (LCN - STR) is employed where there is less than 100 pg

DNA and despite the miniscule amounts of DNA present a full STR profile can be generated.

Some workers consider that defining LCN - STRin terms of the amount of DNA present in the

sample is not appropriate and prefer to consider it to be an approach adopted for the analysis of

results that occur below the stochastic threshold (i.e. the point below which their interpretation of

peaks or bands would be considered unreliable) using normal techniques. Using LCN - STR, it is

possible to obtain a full profile from the DNA of a single cell. LCN - STRmay employ up to 60

PCR cycles and although it is extremely sensitive the results need to be interpreted with care,

especially where the DNA of two or more people is present14.15

.

Fluorescent STR Analysis


13/28

Since most DNA applications in the early years had been developed for the specific detection of

human DNA,only a few VNTRs of invertebrate DNA were known. This limitation was

overcome by a new technique that could be used on virtually any organism: randomly amplified

polymorphic DNA (RAPD). In this method, non-specific primers are used that can amplify many

regions of a sample DNA at once. The resulting PCR products are separated by electrophoresis,

and a band or peak of a particular length can be considered a locus even though it is not

known what portion of the sample DNA it represents. RAPDs can allow up to 100 or more loci

in one PCR. Since the high number of amplified RAPD loci can render the sorting of informative

PCR polymorphisms from non-informative ones difficult or confusing, specialised

electrophoresis unit and software programme must be used. In the forensic area, RAPD has

special importance in the entomological investigation of decaying corpses16

.

RAPD Profile

Randomly Amplified Polymorphic DNA


14/28

In comparison to nuclear DNA, mitochondrial DNA (mtDNA) has some significant advantages

in forensic investigations. Firstly, it is present in high copy number, and can provide better

results when nuclear DNA is scanty, e.g., analysis of hair shafts, teeth, skin, etc.Secondly,

mtDNA is transmitted exclusively maternally to the offspring without undergoing

recombination. This clonal inheritance is of great use in identity testing because it allows direct

comparison of DNA sequences of relatives with the same maternal lineage, without the

ambiguities caused by meiotic shuffling and the mixing of nuclear genes.

In fact, when the sample sequence is compared to that of a reference person, the possibility of a

maternal relationship can be assessed. One significant disadvantage of mtDNA has been that

compared to nuclear DNA, the genome organization is very compact and, therefore less

polymorphic: over 90.0%of the genome is coding, introns are lacking, intergenic sequences are

very small or absent, and repetitive classes of DNA are relatively uncommon. For forensic DNA

testing, the most extensively studied region of mtDNA has been the non-coding DNA replication

control region (D-loop), located between the genes for tRNA-Pro and tRNA-Phe, at positions

16,024 to 576. mtDNAhas been used with great success in the forensic analysis of bones and

historical or ancient remains. However, amplification of mtDNA D-loop fragments with a length

of 200 bp or more from ancient and even from fairly recent biological samples, can lead to

erroneous results. Use of short PCR fragments for the analysis of mtDNA from shed hair, in

Mitochondrial DNA Testing


15/28

combination with competitive PCR assay to determine the state of degradation, should improve

the reliability of forensic mtDNA analysis considerably. Due to the erroneous database

collection, the validity of sequence analysis of the mtDNA-loop hypervariable regions for

anthropological information about the maternal lineage has been questioned in many cases. To

avoid this, recommendations and guidelines have been proposed for the validity of mtDNA

sequence analysis and their interpretation in the forensic context17

.

Since heteroplasmy(same individual harboring more than one mtDNA sequence) is a potential

drawback to forensic mtDNA analysis, newer methods have focused on overcoming this problem

by enhancing detection capability of this phenomenon, for e.g., denaturing gradient gel

electrophoresis (DGGE). Several other technologies are also now being applied to mtDNA

analysis to make it more popular among the forensic community, including Mass

spectrometry18

, Microchip instrumentation19

, and Molecular beacon analysis20

.


16/28

There has been an increasing interest among forensic investigators, in Y-chromosome markers,

not only for gender determination, but also for identity fixation. Y-chromosome markers are

useful for discriminating male DNA from female DNA in forensic situations such as sexual

assault, when a vaginal swab is submitted for DNA analysis. However, the amplification of Y-

chromosomal STRs is also known to result in the formation of artefactual amplification products,

mainly due to insufficient PCR specificity. This is a major drawback of the method, as both the

sensitivity as well as the correct Y-STR interpretation are affected. The addition of a PCR

enhancer to the reaction master-mix is claimed by some investigators to result in significant

increase of specificity of Y-STR typing-STRs are also useful for tracing paternal lineages, just as

mtDNA is used to match maternal lineages.21.22

YChromosome STR

Y-Chromosome STR


17/28

Single nucleotide polymorphisms (SNPs) represent the ultimate in the trend toward smaller DNA

fragments. Recent advances in SNP research have raised the possibility that these markers could

replace the forensically established STRs. SNPs are more numerous than other polymorphisms,

and occur in coding and non-coding regions throughout the genome. They are single base-pair

changes in the DNA sequence, which can be detected by sequencing, RFLP-PCR or single-

strand conformational polymorphism (SSCP) techniques. A set of SNPs decoding identification

of an individual demands only a short stretch of DNA (


18/28

An alternativeto SNPsfor the identification of racial characteristics from DNA is the analysis

of mobile element insertion polymorphisms based on short interspersed elements (SINEs). The

commonest class of these are the so - called Alu elementsthat are about 300 nucleotides long25

.

Most Alu elements are fixed at a particular locus but a few subfamilies are polymorphic for

insertion presence/absence and can be used to determine genetic relationships between

populations .Alu family of short interspersed nuclear elements (SINEs) is distributed throughout

the primate lineage and is the predominant SINE within the human genome. The Alu family has

spread throughout the genome by an RNA-mediated transposit ion process known as retro

position and is present in the genome in extremely high copy number (in excess of 500,000

copies per haploid human genome). The majority of Alu family members are pseudo gene

products of a single master gene. Sequence divergence in the master gene and its progeny

occurs with time, resulting in subfamilies. Young Alu subfamilies are polymorphic and are

present or absent on given chromosomes. The first appearance of the Alu insertion represents the

beginning of the family tree, and can be used as a molecular clock to estimate the time that

family or subfamily arose. Thus, unlike other forensic DNA markers, the distribution of Alu

insertions, and possibly long interspersed nuclear elements (LINEs) and other SINEs loci, permit

tracing of population ancestral heritages. Information about the likely ethnicity of the sources of

the sample is one piece of information that investigators may use when pursuing leads based on

the genetic analysis of crime scene evidence.26

Alu Repeats

Mobile Element Insertion polymorphism


19/28

DNA microarray technology (also known as DNA arrays, DNA chips or biochips) represents one

of the latest breakthroughs and indeed major achievements in experimental molecular biology.

This novel technology, which started to appear during the second half of the 1990s,

Oligonucleotide can be chemically attached to the surface of materials such as glass or silicon,

on which they form small "spots" of around 100 m (104

m) in diameter. Large numbers of

oligonucleotide can be laid down on a single slide to form a microarray, and single strands of

fluorescently-labelled DNA (labelled PCR products or cDNA) can be captured by hybridization.

(cDNA is single stranded DNA complementary to the RNA from which it is synthesized by

reverse transcription. It gives indirect information on the nature of the various RNA messages

expressed in a cell (expression analysis)). If such a microarray contains 1000 spots then in theory

it is possible to hybridize a unique complementary nucleic acid sequence to each spot. The

identity of the DNA sequence is deduced from the location of the spot to which it hybridizes

using a fluorescence scanner. The fluorescent label attached to the captured nucleic acid strand

can be added by a number of different methods. PCR products can be labelled at the 5 -end

simply by using a PCR primer containing a 5-fluorescent dye. PCR primers can be labelled with

multiple fluorophore, but these tend to quench each other and also inhibit the PCR reaction. A

better way to introduce multiple labels into the PCR product is to use fluorescently labelled

deoxynucleoside triphosphates in the PCR or reverse transcriptase reaction (e.g.fluorescein-

labelled dT). However, the efficiency of the PCR reaction may be compromised by the chemical

modification on the heterocyclic base, which can inhibit the Taq polymerase. A carefully

determined mixture of unlabelled and labelled deoxynucleoside triphosphates must therefore be

used, and it is rare to achieve labeling densities greater than one fluorophore per 30 nucleotides.

Microarray assays can also be carried out in the reverse format by attaching individual PCR

DNA Microarray


20/28

products to the slide as discrete spots and probing with a pool of fluorescently labeled

oligonucleotide.27

DNA microarrays are useful in high-throughput mutation, SNP and gene expression analysis

because very large numbers of DNA strands can be attached to a single array. Microarrays are

amenable to automation by robotic systems, allowing very high throughput. However, they

present challenges owing to some undesirable chemical and biophysical properties of molecules

on surfaces. Firstly, it is difficult to create very dense arrays. A spot size of 100 m is

achievable, but smaller spots (e.g. 1 m) would allow far higher numbers of spots per array,

permitting the use of smaller volumes of solution-phase DNA and greater throughput. Secondly,

the hybridization of complementary DNA molecules on a surface is not nearly as efficient as

solution hybridization. To make the system workable, the properties of the surface and the nature

of the linker between the surface and the attached DNA must be carefully controlled.

DNA Microarrays


21/28

In situ hybridization (ISH), which allows the identification and visualization of specific DNA

sequences on chromosomes using radioactive labels, are discussed in. The synthesis and

applications of chemically modified oligonucleotide. Fluorescence in situ hybridization (FISH),

which extends ISH by employing fluorescence-based detection and visualization by fluorescence

microscopy, is an important tool in genetic analysis. The principle of FISH lies in the annealing

of a labelled probe to its complementary strand within the chromosomes of fixed cells or tissues,

followed by detection of the fluorescent label. The probes (DNA or RNA) are usually prepared

by one of three polymerase enzyme-based methods (nick translation, random priming or PCR)

which allow the incorporation of fluorescently-labelled deoxynucleoside triphosphates. An

average incorporation level of one fluorescent label per 30 nucleotides is typical. The length of a

DNA probe can be between 100 bp and 1000 bp. Longer probes increase non-specific

background fluorescence but short probes can be difficult to detect owing to insufficient

hybridization and low levels of labeling. It is important that the target is accessible to the probe

and must be retained in situ, not degraded by nuclease enzymes. Visualization limits span from

an entire chromosome to a 40 kb chromosomal section.28

Radio Active Chips

Fluorescence In Situ Hybridization (FISH)


22/28

All this has been possible because of methods developed by Fred Sanger in Cambridge over 30

years ago. Sanger developed a novel method of DNA sequencing (the dideoxy method) for

which he was awarded his second Nobel Prize, in 198029

.

Sanger's dideoxy method of DNA sequencing was the first method that was used routinely for

sequencing of DNA in the laboratory. The following components are required for Sanger

sequencing:

A DNA template to be sequenced

An oligonucleotide primer labelled at the 5-end with32

P

A DNA sequencing polymerase

Four deoxynucleoside triphosphates: dATP, dGTP, dCTP, dTTP

Four dideoxy nucleoside triphosphates (nucleoside triphosphates lacking both 2- and 3-

hydroxyl groups): ddATP, ddGTP, ddCTP, ddTTP .

Sanger sequencing is a modified form of DNA Raplication.The primer hybridizes to a specific

locus on the template and the polymerase binds and incorporates nucleotides to assemble a

reverse complimentary copy of the template.30

Dideoxy Sequencing

DNA Sequencing

Sanger Dideoxy DNA Sequencing


23/28

In the automated high-throughput fluorescent version of Sanger sequencing, an unlabelled

oligonucleotide primer is used, along with a thermostable DNA polymerase, four normal

deoxynucleoside triphosphates, and four dideoxy nucleoside triphosphates with different

fluorescent labelson them.31

Now onlyonesequencing reaction is necessary because termination in ddA gives the DNA

fragment a particular fluorescent colour, ddG a different colour, ddC a third colour and ddT a

fourth colour. The nature of the fluorescent dyes depends upon the DNA sequence used, but the

basic requirement is four dyes with well-resolved fluorescence emission spectra. A common

system uses FAM, JOE, TAMRA and ROX as the four dyes.

Fluorescence Dideoxy Sequencing

Existing DNA sequencing methods (including next-generation sequencing) are not able to detect

modified bases. With the recent surge in interest in Epigenetic, the failure to distinguish between

cytosine and 5-methylcytosine (both of which form Watson-Crick base pairs with guanine) is a

serious drawback of current sequencing technologies.

Fluorescence Dideoxy DNA Sequencing


24/28

Bisulfite (HSO3-) deaminates unmethylated cytosine to uracil, but does not react with methyl

cytosine (Figure 7). This provides a method for sequencing DNA containing 5-methylcytosine

bases. The DNA is sequenced before and after bisulfate treatment: any change from cytosine to

uracil is ascribed to unmethylated cytosine, while cytosine bases that remain after bisulfite

treatment are assumed to be methylated in the original sample. This provides a method for

sequencing DNA containing 5-methylcytosine bases. The DNA is sequenced before and after

bisulfite treatment: any change from cytosine to uracil is ascribed to unmethylated cytosine,

while cytosine bases that remain after bisulfite treatment are assumed to be methylated in the

original sample.32

Bisulfite Sequencing

Bisulfite Sequencing


25/28

Three main companies occupy the bulk of the next generation sequencing market.

454/pyrosequencing (Roche).

SOLiD (Applied Biosystems).

Solexia Illumina.

However, increased bases sequenced at a reduced cost have always been desired. For this reason

new theories were developed in the late 90s. These have come to fruition in the last 5 years or so

with advances in chemical and physical technology. Thus, we have now entered the next

generation era of sequencing. The analysis techniques are always being improved with new

algorithms developed all the time. In addition, we are now seeing newer sequencing theories

being developed, so called, next-next generation sequencing.

National Human Genome Resource Institute


26/28

Over the recent years, DNA profiling has become a cutting-edge crime investigating technique

and an invaluable instrument in search of justice. With its capability to implicate or eliminate,

DNA evidence may play a significant role at various points throughout the life of a criminal

case, from initiation of a case to post-conviction confirmation of the truth. There are few

techniques in the history of forensic science that have thoroughly scrutinized and validated than

forensic DNA typing. The introduction of this new technology therefore, would be considered a

milestone in criminal investigation and legal system of our country.

The main aims of the new technology can be summarized:

To enable faster processing.

To reduce costs.

To improve sensitivity

To produce portable instruments.

To de-skill and to automate the interpretation process.

To improve success rates.

To improve quality of the result and to standardize processes.

To develop the kits for individual identification.

The next few years will probably see a new revolution as this new technology comes of age with

advances in the next generation era of sequencing and becomes widely available.

Conclusion


27/28


28/28

advancement in DNA Technology

Documents

Transcript of advancement in DNA Technology