JOURNAL OF VIROLOGY, Sept. 1992, p. 5479-54840022-538X/92/095479-06$02.00/0Copyright X) 1992, American Society for Microbiology

Vol. 66, No. 9

Activation of the Human Immunodeficiency Virus Type 2 EnhancerIs Dependent on Purine Box and KB Regulatory Elements

DAVID M. MARKOVITZ,1* MICHAEL J. SMITH,' JOHN HILFINGER,l MARK C. HANNIBAL 1,2,3BRONISLAWA PETRYNIAK,"12,4 AND GARY J. NABEL,"12'3

Howard Hughes Medical Institute2 and Departments of Internal Medicine, 1 Biological Chemistry,3 andMicrobiologylImmunology,4 University ofMichigan Medical Center, Ann Arbor, Michigan 48109-0680

Received 16 March 1992/Accepted 1 June 1992

Human immunodeficiency virus type 2 (HIV-2) displays several features which distinguish it from HIV-1.Among the differences in these two viruses are the responses of their enhancer regions to T-cell activation. Forexample, stimulation of HIV-1 transcription is largely dependent on two KB regulatory elements. In contrast,the HIV-2 enhancer has a single KB site and contains additional cis-acting sequences responsive to induction.One of these sites, previously termed CD3R, is a purine-rich site, also called PuBl, which is responsive tostimulation of the CD3 component of the T-cell receptor complex and binds Elf-i, a member of the etsproto-oncogene family. In this report, we examine the interaction of the PuBl site with other sites in the HIV-2enhancer. We demonstrate that the PuBl site confers responsiveness to T-cell activators only in cooperationwith additional enhancer elements. Induction of the HIV-2 enhancer is dependent on at least two othercis-acting regulatory elements in addition to PuBl and KB. One of these elements is another purine-rich site(PuB2), which also binds recombinant Elf-i. An adjacent region, proximal to the PuB2 ets (pets) site, showsprotection in DNase footprinting experiments with extracts from Jurkat T cells. Mutation of either the KB,PuBl, PuB2, or pets site significantly reduces the response of the HIV-2 enhancer to T-cell stimulation, an effectwhich is mediated at the RNA level. Therefore, activation of the HIV-2 enhancer is dependent on at least fourcis-acting elements, only one of which is found in HIV-1, which act in synergy with one another. Despite theirsequence similarity, the organization and function of the HIV-2 enhancer have diverged considerably fromthose of HIV-1.

Human immunodeficiency virus type 2 (HIV-2) was firstdescribed as a causative agent of AIDS in West Africa andhas been found more recently throughout the world (1, 5,7-9, 22, 34, 37). While this virus encodes proteins similar tothose of HIV-1, the nucleic acid similarity of the two virusesis only -40% (20), and their biological and clinical behaviorsvary significantly (2, 13, 23, 26, 31). Transcriptional regula-tion of these viruses by their cis-acting regulatory regionsalso differs (3, 29, 44). We have shown that activation of theHIV-2 enhancer in T cells is partly mediated by a site notfound in HIV-1, termed CD3R, which is responsive toantibody-induced stimulation of the CD3 component of theT-cell receptor complex (29). This site, also called PuBl, ispurine rich and contributes to HIV-2 activation by phorbolmyristate acetate (PMA) and phytohemagglutinin (PHA). ADNA-binding protein, termed nuclear factor of the CD3Rsite, recognizes the CD3R site and is likely to be identical toElf-1, a recently described member of the ets proto-onco-gene protein family which binds to this site (45). Elf-1 isrelated to the transcription factor E74, a factor involved inDrosophila metamorphosis (42, 45), and differs from Ets-1and Ets-2 in its ability to bind PuBl. In contrast to HIV-2,HIV-1 is minimally responsive to stimulation of CD3 withmonoclonal antibodies, and stimulation in activated T cells ismediated largely by KB, the major regulatory element of itsenhancer (29, 30, 33). Regulation of the two viruses in tissueculture also differs; production of HIV-2, but not HIV-1, isstimulated with anti-CD3 in latently infected T-cell lines (29).Our previous studies demonstrated that the KB site of the

HIV-2 enhancer acted together with PuBl (CD3R) to medi-

* Corresponding author.

ate the response to T-cell stimulation (29). We thereforeexamined the ability of PuBl to mediate inducible activationof the HIV-2 enhancer and its ability to act in combinationwith KB to mediate transcriptional activation of the en-hancer. Several internal deletions were generated to exam-ine the spacing between these sites. In the process ofcharacterizing these mutants, decreased transcriptional ac-tivation was observed, raising the possibility that othercis-acting elements were present within this region of thelong terminal repeat. We now show that regulation of theHIV-2 enhancer in response to T-cell stimulation is depen-dent on two additional cis-acting elements in this region,recognized by specific DNA-binding proteins. Mutation ofany of these elements results in markedly diminished induc-tion of the enhancer, an effect which is mediated at the RNAlevel. Activation of the HIV-2 enhancer, therefore, is depen-dent on at least four regulatory elements, and its organiza-tion differs significantly from that of HIV-1, which likelyexplains its differential response to T-cell stimulation.

MATERIALS AND METHODS

Plasmids. Construction of HIV-2/CAT, HIV-2 AKB/CAT,HIV-2 APuB1(CD3R)/CAT, and pRSV-luciferase has beendescribed elsewhere (11, 15, 29). HIV-2 APuB2/CAT andHIV-2 Apets/CAT were constructed by using the gap-hetero-duplex site-specific mutagenesis protocol as previously de-scribed (33). The plasmids containing site-specific deletionmutants of the HIV-2 enhancer, H1V-2(del1153/-148/CAT,HIV-2(del.153/-1431CAT, and HIV-2dCel-153/,137)/CAT, inwhich 6, 11, or 17 bp 3' of position -153, respectively, wereexcised, were also generated by using the gap-heteroduplexmethod.

5479

5480 MARKOVITZ ET AL.

II-2 pUets PuB2 icB K SpI TATA cap translation from Jurkat cells incubated for 2 h in PMA (16 nM) prior tobox site Initiation harvest. For the probe, oligonucleotides corresponding to

\ // J CATboth/strandsof/thesequencefrompositions-162to-131.174 pi 30 +1 +5 (Fig. 1) were synthesized with an Applied Biosystems 300B

-556 14 -0 3 1 15

l__________________________lsynthesizer. The oligonucleotides were purified from a

/l~ 12.5% polyacrylamide gel, the sense strand was radiolabeled

Pu2B1(CD3R) pets with polynucleotide kinase in the presence of [_y-32P]ATP,-200-180, -160 and equimolar amounts of the two strands were combined by

TGAAAGCAAGAGGAATACCAI | IAGltAAAGACAGG^ACAlGCTATAeTTGGTincubation at 80'C and then slow cooling in 500 mM NaCl.GCTCGAG AGATCT The double-stranded probe was then purified with a Sepha-

PuB2 cB K dex G-50 column. This probe and the Jurkat nuclear extracts.143 .130 -110 (' .e"A4 were then used in an electrophoretic mobility shift assay (29,CACTAACAGAAAGAGCTGAGACTGGAWGAGGGCTGTAAC 40), and methylation interference analysis performed as

nt: GAATTC ATCT described previously (4).IG. 1. Enhancer region of HIV-2. Relevant sites within the long Electrophoretic mobility shift assays with recombinant Ets-1ninal repeat are identified. Altered bases within the mutant and Elf-i proteins. Elf-1 and Ets-1 proteins were prepared in,mids used in the study are shown below the wild-type sequence. rabbit reticulocyte lysates from RNA transcribed in vitrontification of the PuB2 and pets sites is described in the text. The (Promega) or from lysates of Eschenchia coli expressing the31 (CD3R), KB, and K sites have been previously described (29, recombinant protein (21, 42, 45). The truncated Ets-1 pro-The sequence of HIV-2rodhas been published (20). HIV-2-CAT tein, amino acids 325 to 441, includes the DNA bindingkindly provided by M. Emerman (15). Site-directed mutations domain (45). The oligonucleotide probe corresponding to thee introduced by the gap-heteroduplex method as previously sequence from -162 to -131, wild type or mutated (Fig. 1),cribed (33). was prepared as described above. The binding reaction for

the electrophoretic mobility shift assay (29, 40) employed aFicoll buffer, 3 ,ul of recombinant protein, and 250 ng of

tell transfections and CAT assays. The Jurkat T leukemia poly(dI-dC) in a 15-,ul total volume with a final concentrationI line was maintained in RPMI with 10% fetal bovine of 75 mM KCl. The reaction products were run on a 4%um prior to transfection and 5% after transfection. Cells polyacrylamide gel at 4°C in 0.25x Tris-borate-EDTAre grown under standard conditions. Cells (107) were buffer. Antibody directed against Ets-1 was a gift from Takisnsfected with S ,ug of the indicated plasmid, using the Papas (21).

DEAE-dextran method (35). Twenty hours after transfec-tion, cells were incubated for an additional 20 h with either16 nM PMA, PHA (2,g/ml) plus PMA, or a 1:1,000 dilutionof mouse ascites fluid containing the monoclonal anti-CD3antibody OKT3. Cell extracts were prepared, and chloram-phenicol acetyltransferase (CAT) activity was determinedaccording to standard methods (18); transfection efficiencieswere normalized by using protein concentration and, incertain experiments, an internal control plasmid in which theluciferase gene is under the control of the Rous sarcomavirus promoter (11).RNA isolation and primer extension. RNA was isolated

from Jurkat T cells transfected with either HIV-2/CAT orHIV-2(del5153/137/CAT, using a modification (24) of themethod of Favaloro. Primer extension analyses were per-formed as described previously (38). Briefly, a primer com-plementary to the 5' end of the CAT gene (5'-TGCCATTGGGATATATCAACGGTG-3') was labeled at its 5' end with32P and hybridized overnight at 30°C with 50 ,ug of RNA in 30,ul of 40% formamide-40 mM piperazine-N,N'-bis(2-ethane-sulfonic acid) (PIPES; pH 6.5)400 mM NaCl-1 mM EDTA.The hybridization mixture was precipitated and washed withethanol and redissolved in 20 RI of 50 mM Tris (pH 7.6)-60mM KCl-10 mM MgCl2-1 mM each deoxynucleosidetriphosphate-1 mM dithiothreitol-50 ,g of actinomycin D.Then 25 U of avian myeloblastosis virus reverse tran-scriptase was added, and the reaction mixture was incubatedat 48°C for 2 h. The cDNA products were analyzed byelectrophoresis through a 6% polyacrylamide gel containing7 M urea.DNase protection assays. Nuclear extracts were prepared

by a modification of the method of Dignam et al. (12). Aradiolabeled probe corresponding to nucleotides -107 to-189 (Fig. 1) was prepared, and DNase protection assayswere performed as previously described (14, 16, 29).

Methylation interference. Nuclear extracts were prepared

RESULTS

Definition of cis-acting elements between the CD3R and KBsites which mediate activation of the HIV-2 enhancer. Muta-tion of the PuBl (CD3R) site within the HIV-2 enhancermarkedly reduces activation by PMA, PHA, or antibodies tothe T-cell receptor (29). However, four copies of the PuBlsite, inserted upstream of the simian virus 40 promoter (28)in either orientation, were insufficient to confer PMA or

PHA responsiveness in Jurkat cells (data not shown). Ittherefore appeared that the PuBl site required the presence

of other enhancer elements, such as the KB site, to providePMA responsiveness.To examine whether the spacing of the KB site relative to

the PuBl site was crucial to function, mutants with deletionsbetween the PuBl and KB sites were generated. Thesespecific mutants were made by eliminating 6, 11, or 17 bpbetween the two sites to determine whether enhancer activ-ity was affected by the position of the two sites relative to

each other on the DNA helix. When these mutant plasmidswere transfected into Jurkat T cells and activated with PMA,decreased responsiveness was observed in all cases (Fig.2A). Elimination of 6 bp (-153 to -148) resulted in an

approximately fivefold decrease in stimulation, as did elim-ination of 11 bp (-153 to -143). Deletion of an additional 6bp (-153 to -137) resulted in loss of all responsiveness to

PMA (Fig. 2A), despite the presence of an intact KB site.These findings suggested that the spacing of KB and PuBl on

the DNA helix was not the crucial factor but that additionalcis-acting regulatory elements might be present in this re-

gion. To test this possibility, we introduced a site-specificmutation which altered, but did not eliminate, the 6 bp whichhad been deleted from the -153 to -148 mutant. Alterationof these 6 bp had the same effect, markedly decreasinginducibility by PMA (Fig. 2B, Apets). By DNase footprint-

H

Mutar

Mutar

FternplasIderPuE44).waswerdes(

(cellserweitrar

J. VIROL.

ACTIVATION OF THE HIV-2 ENHANCER 5481

HIV-2

89.0 1

- +

49.4

HIV-2

85.3

AXE

86

HIV-2

Anti-CD3: - +

ing, a DNA-binding protein was also detected at this site,del del del which we designate the proximal-ets (pets) site (Fig. 1).

-l5/l4l r Similar to the PuBl site, the region between -142 and-137 contains a purine-rich sequence (PuB2; Fig. 1) withsimilarity to an ets binding site (42, 45). A deletion thatextended into this element also affected enhancer function(Fig. 2A, HIV-2(del.153/.137)). We therefore introduced amutation which altered the PuB2 site, and this mutatedplasmid also showed a markedly diminished response toPMA. This effect was specific for mitogen-mediated activa-tion, since basal activity (Fig. 2B) and stimulation by thehuman cytomegalovirus immediate-early transactivatingprotein (10) were unaffected by this mutation (data notshown). Similarly, mutation of the PuB2 or pets site mark-edly reduced the response of the HIV-2 enhancer to anti-bodies to the T-cell receptor (Fig. 2C). The same resultswere obtained following T-cell receptor stimulation whetherCAT activity was normalized for protein concentration (Fig.-

5.8 8.6 1.8 2C) or by cotransfection with a luciferase reporter plasmid(data not shown). Therefore, intact pets and PuB2 sites, inaddition to KB and PuBl sites, are necessary for optimal

APOuB 1 &pets APuB2 HIV-2 enhancer function. Although additional purine box3 m m m sites are found upstream of PuBl (CD3R), deletion of the

enhancer to position -188, which eliminated them, did notalter the response to PMA (data not shown).

Mutation of the PuB2 and pets sites affects induction ofthe HIV-2 enhancer at the RNA level but does not alterthe RNA start site. These data demonstrated that mutationof the PuB2 or pets site significantly reduces inductionof the HIV-2 enhancer in response to T-cell stimulation.To examine whether this effect occurred at the RNA leveland to determine its effect on the transcriptional initiationsite, we performed primer extension experiments usingRNA from resting or PMA-stimulated Jurkat T cells.HIV-2(del153/l137/CAT, in which both the PuB2 and petssites have been deleted, was used in these experiments.

- 22 R Similar to the findings with CAT assays (Fig. 2A), induction+ + + +

of the intact enhancer was much more pronounced than that7.9 35 9.2 9.5 of the mutant (Fig. 3). Mutation of the enhancer did not alter

the RNA start site (Fig. 3). Therefore, alteration of thesecis-acting elements leads to correctly initiated, although

Apets APuB2 markedly diminished, levels of RNA following stimulation ofII IIEthe HIV-2 enhancer by PMA.

The PuB2 and pets sites are recognized by specific nuclearfactors from Jurkat T cells. It has previously been demon-strated that the PuBl (CD3R) site binds a nuclear proteinwhich is a member of the Ets family (29, 42, 45). To examinewhether the PuB2 and pets sites were recognized by specificproteins found in nuclear extracts from Jurkat T cells, weperformed DNase footprinting using unstimulated Jurkatextracts (Fig. 4A). Protected sequence was found betweenpositions -144 to -150 (overlying the pets site), and anotherfootprint was noted between positions -136 and -141 (Fig.4A). Both of these regions were functionally significant (Fig.2B), and the downstream footprint extended over the purine-rich (PuB2) downstream sequence (Fig. 1). Methylationinterference analysis also revealed contact with the PuB2site (Fig. 4B). Although these studies were performed with

+ PMA-stimulated nuclear extracts, DNase studies (Fig. 4A)fold induction: 6.1 1.7 1.0

FIG. 2. Activation of the HIV-2 enhancer following T-cell stim-

ulation is dependent on elements between the PuBl and KB sites.

(A) Effect of site-specific deletion mutations (at the indicated

positions) on the response of the HIV-2 enhancer to PMA. Results

shown are representative of four independent transfections. del,deletion. (B) Site-specific mutational analysis of PMA-responsiveelements in the HIV-2 enhancer. Mutated sites are illustrated in

Fig. 1. Results are representative of four independent transfections.

(C) Site-specific mutational analysis of anti-CD3-responsive ele-

ments in the HIV-2 enhancer. Results are representative of three

independent transfections. Standard deviations were <10%.

ATransfected

Plasm id:

10

C0D2

cnL-a) 5

0(

Stimulant

PMA:

fold induction:

BTransfected

Plasm id:

20

U)

a1)

0U

Stimulant

PMAfold induction:

cTransfected

Plasm id:

0 10

-2

U)L-a1)c0o 5

Stimulant

VOL. 66, 1992

5482 MARKOVITZ ET AL.

delPlasmid: HlV-2 -153 -137

PMA: -I+ -

_!-.

BProbe: PuB2 \PuB2

r' -- 'IF--- - -m

Protein: (2 e-Ie<> Cf <e.

Ab: "s

Protein: 6' pts t... .....1--1

- 307Etsi 1 Ab * "

-- 242

-- 2 17

1 2 3 4FIG. 3. Deletion of the PuB2 and pets sites affects induction of

the HIV-2 enhancer at the RNA level. Primer extension analysiswas performed with RNA isolated from Jurkat cells transfected withHIV-2/CAT (lanes 1 and 2) or HIV-2(dell13/_l37/CAT (lanes 3 and4) with (lanes 1 and 3) or without (lanes 2 and 4) the addition ofPMA. Positions (nucleotides) of the relevant size markers are shownon the right. The arrow indicates the predicted size for the correctlyinitiated primer extension product.

and electrophoretic mobility shift assays (data not shown)demonstrated that protein binding to this region was notdependent on PMA stimulation. As with the factor whichrecognizes PuBl (29), posttranslational modifications ofthese DNA-binding proteins are, therefore, likely requiredfor transcriptional activation.The PuB2 site binds recombinant Elf-i and Ets-1. It has

previously been demonstrated that the PuBl site of theHIV-2 enhancer, while not recognized by Ets-1, binds Elf-1,a member of the Ets family which is related to the Droso-phila E74 transcription factor (42, 45). PuB2 also bound Elf-1and, in contrast to PuBl, also bound full-length, in vitro-translated Ets-1 and a truncated form of Ets-1 (Fig. SA).Mutation of PuB2 eliminated binding of both Elf-1 and Ets-1(Fig. SA). Similarly, full-length, bacterially produced Ets-1bound the PuB2 site, and a supershift could be induced with

G F BA w

_,

_..No

El _ *Se-ts- *ab( a**-

Truncatedet- 1

Ets'- *

9

1 2 3 4 5 6 7 8

FIG. 5. Binding of recombinant Elf-1 and Ets-1 by the PuB2 site.(A) In vitro-transcribed and translated Ets-1 (lanes 2 and 6), trun-cated Ets-1 (lanes 3 and 7), Elf-1 (lanes 4 and 8), and a control rabbitreticulocyte lysate (lanes 1 and 5) were incubated with a radiola-beled probe corresponding to positions -162 to -131 of the HIV-2enhancer (Pub2; lanes 1 to 4) or mutated probe (APuB2; lanes 5 to 8).(B) Ets-1 protein made in a bacterial expression system (lanes 2 to 4)and a control bacterial extract (lane 1) were incubated with antibodydirected against Ets-1 (lane 3), the interleukin-2 receptor (a negativecontrol; lane 4), or no antibody (lanes 1 and 2) prior to binding withradiolabeled PuB2 probe.

antibodies directed against Ets-1 (Fig. SB, lane 3), confirm-ing that recombinant Ets-1 can bind the PuB2 site. ThatPuB2, but not PuBl, binds recombinant Ets-1 may be due tosmall differences in the flanking sequences of these two sites(42, 45), consistent with recent studies which demonstrate

BF B

* go

-_--

1 2/ 3 f,%

CT ATA CTT GGTTCG- A L; C;G (-A2AAGTAAC- TA A, 5 COATA C T G ( T rACC) 7.SAAGCTAAC1TAA!7:GAThA-GAA CCAG7CCIC2( CC ITCATTGAT rGA'TrATGAA CCAGIC'C ("CCG rC T CA T'GT T

FIG. 4. Characterization of nuclear factors which bind the PuB2 and pets sites. (A) DNase protection was performed, with a G+A reaction(lane 1), no nuclear extract (lane 2), or 150 ,ug of nuclear extract from unstimulated Jurkat cells (lane 3). A radioactive probe labeled on thenoncoding strand was used. Protected sites are bracketed in the sequence shown at the bottom. (B) Methylation interference assayscomparing free (lane 1) and bound (lane 2) probe. Arrows indicate bases which, when methylated, inhibited protein binding. These bases areindicated by the dots in the sequence shown at the bottom.

J. VIROL.

t-̂' .1

ACTIVATION OF THE HIV-2 ENHANCER 5483

that proteins of the Ets family often require cofactors tofunction fully (42, 43, 45).

DISCUSSION

The organization and responsiveness of the HIV-2 en-hancer to T-cell activation differ from those of HIV-1 (29, 30,33). In contrast to the HIV-1 enhancer, which contains twoKB elements (33), HIV-2 has a single KB site (29). Inaddition, a purine-rich enhancer element (PuBl) binds Elf-1,a member of the ets proto-oncogene protein family that isclosely related to the E74 protein involved in Drosophilamorphogenesis (42, 45). Regulation of the HIV-2 enhancer isdependent on the PuBl and KB sites and sequences which liebetween these two elements. This region includes PuB2,which, like PuBl, binds to Elf-1 and shows a methylationinterference pattern consistent with binding by this protein.In addition, the pets site, which is proximal to PuB2 and hasnot been previously described, was defined by functionalanalysis and DNase footprinting. Mutations in this site didnot alter basal enhancer function but markedly reducedHIV-2 enhancer induction in response to PMA or anti-CD3.Taken together, these data imply that several distinct regu-latory elements contribute to HIV-2 enhancer function, andmutation of any one of these sites (PuBl, PuB2, pets, or KB)can markedly reduce the response to T-cell activation. Infurther contrast to HIV-1, the HIV-2 enhancer is responsiveto stimulation by soluble antibodies to the T-cell receptor(29). This effect is mediated by the PuBi, PuB2, and petssites, enhancer elements not found in HIV-1. Therefore, inaddition to activation via the protein kinase C pathway, acharacteristic it shares with HIV-1, the HIV-2 enhancer canbe stimulated more efficiently than the HIV-1 enhancer bythe calcium-mediated signal transduction pathway activatedby soluble anti-CD3.The proteins which bind to PuBi and PuB2 include

members of the Ets family of DNA-binding proteins (21, 25,36, 42, 43, 45). Ets binding motifs have been identified inother type C mammalian retroviruses (6, 17, 19, 41). Wehave demonstrated that, in contrast to HIV-1 (30), elementsin the HIV-2 enhancer bind proteins of the Ets family (42, 45)and regulate activation of the HIV-2 enhancer. Interestingly,the HIV-1 enhancer contains a purine-rich region whichresembles an Ets binding site (39), but this element is notfunctional (30). The HIV-2 sites PuBl and PuB2 both bindElf-1, and PuB2 is also recognized by recombinant Ets-1 (42,45; this report), suggesting a potential interaction betweenthe PuB2 site and Ets-1 or Elf-i in vivo. Supershift assaysindicate that in nuclear extracts from peripheral blood Tcells, Elf-i is the dominant protein binding to the PuB2 site(27). As protein binding does not always correlate withfunction, further studies will be needed to demonstratewhether either Ets-1 or Elf-i is capable of activating tran-scription from the HIV-2 enhancer. Differential binding andtranscriptional activation by members of the Ets family maybe due to subtle sequence differences, inherent differences inthe Ets proteins, or additional transcription factors, such asNF-KB or the pets-binding protein, which could facilitateactivation by distinct Ets proteins. The latter model isconsistent with recent findings that cofactors are oftennecessary for binding and transcriptional activation by Etsproteins (42, 43). The pets binding site, which has not beendescribed previously, lies proximal to one of the Ets bindingsites (PuB2) of HIV-2. Mutation of either the pets or PuB2site has a marked functional effect, and these effects appearto be complementary. Therefore, it is likely that the factors

which bind to these sites interact with one another. Itappears that these protein-protein interactions play an im-portant role in regulating transcription of HIV-2 and mayaccount, in part, for the clinical differences seen in HIV-2and HIV-1 infections.

ACKNOWLEDGMENTSWe thank Craig Thompson and Jeffrey Leiden for helpful advice

and Takis Papas for the Ets-1 antibody. We are also grateful to MaraVan Dusen for typing the manuscript.

This work was supported in part by Public Health Service grantsCA01479 and AI30924 (D.M.M.) and AI29179 (G.J.N.) and by theLife and Health Insurance Medical Research Fund (D.M.M.).

REFERENCES1. Albert, J., U. Bredberg, F. Chiodi, B. Bottinger, E. M. Fenyo, E.

Norrby, and G. Biberfeld. 1987. A new pathogenic humanretrovirus of West African origin (SBL-6669) and its relationshipto HTLV-IV, LAV and HTLV-IIIB. AIDS Res. Hum. Retro-viruses 3:3-10.

2. Ancelle, R., 0. Bletry, A. C. Baglin, F. Brun-Vezinet, M. A. Rey,and P. Godeau. 1987. Long incubation period for HIV-2 infec-tion. Lancet i:688-689.

3. Arya, S. K. 1990. Human immunodeficiency virus type-2 geneexpression: two enhancers and their activation by T-cell activa-tors. New Biol. 2:57-65.

4. Baldwin, A. S., and P. A. Sharp. 1988. Two transcriptionfactors, NFKB and H2TF1, interact with a single regulatorysequence in the class I major histocompatibility complex pro-moter. Proc. Natl. Acad. Sci. USA 85:723-727.

5. Barabe, P., J. P. Digoutte, J. F. Tristan, M. Peghini, P. Griffet,P. Jean, P. Seignot, J. L. Sarthou, B. Leguenno, and C. Berlioz.1988. Human immunodeficiency virus infections (HIV-1 andHIV-2) in Dakar. Med. Trop. 48:337-344.

6. Bosselut, R., J. F. Duvall, A. Gegonne, M. Bailly, A. Hemar, J.Brady, and J. Ghysdael. 1990. The product of the c-ets-1proto-oncogene and the related Ets2 protein act as transcrip-tional activators of the long terminal repeat of human T cellleukemia virus HTLV-1. EMBO J. 9:3137-3144.

7. Clavel, F., D. Guetard, F. Brun-Vezinet, S. Chamaret, M. A.Rey, M. 0. Santos-Ferreira, A. G. Laurent, C. Dauguet, C.Katlama, C. Rouzioux, D. Klatzmann, J. Champalimaud, and L.Montagnier. 1986. Isolation of a new human retrovirus fromWest African patients with AIDS. Science 233:343-346.

8. Clavel, F., K. Mansinho, S. Chamaret, D. Guetard, V. Favier, J.Nina, M.-O. Santos-Ferreira, J.-L. Champalimaud, and L. Mon-tagnier. 1987. Human immunodeficiency virus type 2 infectionassociated with AIDS in West Africa. N. Engl. J. Med. 316:1180-1185.

9. Cortes, E., R. Detels, D. Aboulafia, X. L. Li, T. Moudgil, M.Alam, C. Bonecker, A. Gonzaga, L. Oyafuso, M. Tondo, C.Boite, N. Hammershlak, C. Capitani, D. J. Slamon, and D. D.Ho. 1989. HIV-1, HIV-2, and HTLV-1 infection in high riskgroups in Brazil. N. Engl. J. Med. 320:953-958.

10. Davis, M., S. Kenney, J. Kamine, J. Pagano, and E. S. Huang.1987. Immediate early gene region of human cytomegalovirustransactivates the promoter of human immunodeficiency virus.Proc. Natl. Acad. Sci. USA 84:8642-8646.

11. de Wet, J. R., K. V. Wood, M. DeLuca, D. R. Helinski, and S.Subramani. 1987. The firefly luciferase gene: structure andexpression in mammalian cells. Mol. Cell. Biol. 7:725-737.

12. Dignam, J. D., R. M. Lebowitz, and R. G. Roeder. 1983.Accurate transcription initiation by RNA polymerase II in a

soluble extract from isolated mammalian nuclei. Nucleic AcidsRes. 11:1475-1489.

13. Dufoort, G., A. M. Courouce, R. Ancelle-Park, and 0. Bletry.1988. No clinical signs 14 years after HIV-2 transmission viablood transfusion. Lancet ii:510.

14. Dynan, W. D., and R. Tjian. 1983. The promoter-specifictranscription factor Spl binds to upstream sequences in theSV40 early promoter. Cell 35:79-87.

15. Emerman, M., M. Guyader, L. Montagnier, D. Baltimore, and

VOL. 66, 1992

5484 MARKOVITZ ET AL.

M. A. Muesing. 1987. The specificity of the human immunode-ficiency virus type 2 transactivator is different from that ofhuman immunodeficiency virus type 1. EMBO J. 6:3755-3760.

16. Galas, D. J., and A. Schmitz. 1978. DNase footprinting: a simplemethod for the detection of protein-DNA binding specificity.Nucleic Acids Res. 5:3157-3170.

17. Golemis, E. A., N. A. Speck, and N. Hopkins. 1990. Alignment ofU3 region sequences of mammalian type C viruses: identifica-tion of highly conserved motifs and implications for enhancerdesign. J. Virol. 64:534-542.

18. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982.Recombinant genomes which express chloramphenicol acetyl-transferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051.

19. Gunther, C. V., J. A. Nye, R. S. Bryner, and B. J. Graves. 1990.Sequence-specific DNA binding of the proto-oncoprotein ets-1defines a transcriptional activator sequence within the longterminal repeat of the Moloney murine sarcoma virus. GenesDev. 4:667-679.

20. Guyader, M., M. Emerman, P. Sonigo, F. Clavel, L. Montagnier,and M. Alizon. 1987. Genome organization and trans-activationof HIV-2. Nature (London) 326:662-669.

21. Ho, I.-C., N. K. Bhat, L. R. Gottschalk, T. Lindsten, C. B.Thompson, T. S. Papas, and J. M. Leiden. 1990. Sequence-specific binding of human Ets-1 to the T cell receptor alpha geneenhancer. Science 250:814-818.

22. Ishikawa, K., H. Tsujimoto, M. Nakai, J. A. A. Mingle, M.Osei-Kwasi, S. E. Aggrey, V. B. A. Nettey, S. N. Afoakwa, M.Fukasawa, T. Kodama, M. Kawamura, and M. Hayami. 1988.Isolation and characterization of HIV-2 from an AIDS patient inGhana. AIDS 2:383-388.

23. Kanki, P. 1989. Clinical significance of HIV-2 infection in WestAfrica, p. 95-108. In P. Volberding and M. Jacobson (ed.), 1989AIDS clinical reviews. Marcel Dekker, New York.

24. Kenney, S., J. Kamine, D. M. Markovitz, R. Fenrick, and J. S.Pagano. 1988. An Epstein-Barr virus immediate-early geneproduct trans-activates gene expression from the human immu-nodeficiency virus long terminal repeat. Proc. Natl. Acad. Sci.USA 85:1652-1656.

25. Klemsz, M. J., S. R. McKercher, A. Celada, C. Van Beveren,and R. A. Maki. 1990. The macrophage and B cell-specifictranscription factor PU.1 is related to the ets oncogene. Cell61:113-124.

26. Kong, L. I., S. W. Lee, J. C. Kappes, J. S. Parkin, W. D. Decker,J. A. Hoxie, B. H. Hahn, and G. M. Shaw. 1988. West AfricanHIV-2 related human retrovirus with attenuated cytopathicity.Science 240:1525-1529.

27. Leiden, J. M., C.-W. Wang, B. Petryniak, D. M. Markovitz,G. J. Nabel, and C. B. Thompson. A novel Ets-related transcrip-tion factor, Elf-1, binds to human immunodeficiency virus type2 regulatory elements that are required for inducible transactivation. J. Virol., in press.

28. Leung, K., and G. J. Nabel. 1988. HTLV-1 transactivatorinduces interleukin-2 receptor expression through an NF-KB-like factor. Nature (London) 333:776-778.

29. Markovitz, D. M., M. Hannibal, V. L. Perez, C. Gauntt, T. M.Folks, and G. J. Nabel. 1990. Differential regulation of humanimmunodeficiency viruses (HIVs): a specific regulatory elementin HIV-2 responds to stimulation of the T-cell antigen receptor.Proc. Natl. Acad. Sci. USA 87:9098-9102.

30. Markovitz, D. M., M. Hannibal, M. Smith, R. Cossman, andG. J. Nabel. 1992. Activation of the human immunodeficiency

virus type 1 enhancer is not dependent on NFAT-1. J. Virol.66:3961-3965.

31. Marlink, R. G., D. Ricard, S. M'Boup, P. J. Kanki, J. L.Romet-Lemonne, I. N'Doye, K. Diop, M. A. Simpson, F. Greco,M. J. Chou, and M. Essex. 1988. Clinical, hematologic andimmunologic cross-sectional evaluation of individuals exposedto human immunodeficiency virus type 2 (HIV-2). AIDS Res.Hum. Retroviruses 4:137-148.

32. Metz, T., and T. Graf. 1991. Fusion of the nuclear oncoproteinsv-Myb and v-Ets is required for the leukemogenicity of E26virus. Cell 66:95-105.

33. Nabel, G., and D. Baltimore. 1987. An inducible transcriptionfactor activates expression of human immunodeficiency virus inT cells. Nature (London) 326:711-713.

34. Poulsen, A.-G., B. Kvinesdal, P. Anaby, K. Molbak, K. Fred-eriken, F. Dias, and E. Lauritzen. 1989. Prevalence of andmortality from human immunodeficiency virus type 2 in Bissau,West Africa. Lancet i:827-831.

35. Queen, C., and D. Baltimore. 1983. Immunoglobulin gene tran-scription is activated by downstream sequence elements. Cell33:741-748.

36. Ravel-Chapuis, P., D. Leprince, B. Pain, R. Li, C. Domenget, D.Stehelin, J. Samarut, and P. Jurdic. 1991. v-myb and v-etscooperate for the mitogenic stimulation of primary fibroblastsby avian E26 retrovirus. J. Virol. 65:3928-3931.

37. Ruef, C., P. Dickey, C. A. Schable, B. Griffith, A. E. Williams,and R. T. D'Aquila. 1989. A second case of the acquiredimmunodeficiency syndrome due to human immunodeficiencyvirus type 2 in the United States: the clinical implications. Am.J. Med. 86:709-712.

38. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual. Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, N.Y.

39. Shaw, J.-P., P. J. Utz, D. B. Durand, J. J. Toole, E. A. Emmel,and G. R. Crabtree. 1988. Identification of a putative regulatorof early T cell activation genes. Science 241:202-205.

40. Singh, H., R. Sen, D. Baltimore, and P. Sharp. 1986. A nuclearfactor that binds to a conserved motif in transcriptional controlelements of immunoglobulin genes. Nature (London) 319:154-158.

41. Speck, N. A., B. Renjifo, and N. Hopkins. 1990. Point mutationsin the Moloney murine leukemia virus enhancer identify alymphoid-specific viral core motif and 1,3-phorbol myristateacetate-inducible element. J. Virol. 64:543-550.

42. Thompson, C. B., C.-Y. Wang, I.-C. Ho, P. R. Bohjanen, B.Petryniak, C. H. June, S. Miesfeldt, L. Zhang, G. J. Nabel, B.Karpinski, and J. M. Leiden. 1992. cis-acting sequences re-quired for inducible interleukin-2 enhancer function bind a novelEts-related protein, Elf-1. Mol. Cell. Biol. 12:1043-1053.

43. Thompson, C. C., T. A. Brown, and S. L. McKnight. 1991.Convergence of Ets- and notch-related structural motifs in aheteromeric DNA binding complex. Science 253:762-768.

44. Tong-Starksen, S. E., T. M. Welsh, and B. M. Peterlin. 1990.Differences in transcriptional enhancers of HIV-1 and HIV-2:response to T cell activation signals. J. Immunol. 145:4348-4354.

45. Wang, C.-Y., B. Petryniak, I.-C. Ho, C. B. Thompson, and J. M.Leiden. 1992. Evolutionarily conserved sub-families of ets pro-teins display distinct DNA binding specificities. J. Exp. Med.175:1391-1399.

J. VIROL.