Activation and Promotionof Adipose Stem Cellsby Tumour NecrosisFactor-Alpha Preconditioningfor Bone RegenerationZUFU LU, GUOCHENG WANG, COLIN R. DUNSTAN, YONGJUN CHEN,

WILLIAM YENN-RU LU, BEN DAVIES AND HALA ZREIQAT*

Biomaterials and Tissue Engineering Research Unit, School of AMME, the University of Sydney, Sydney, Australia

There is a major medical need for developing novel and effective approaches for repairing non-union and critical-sized bone defects.Although the mechanisms remain to be determined, it is known that inflammation plays a crucial role in initiating bone repair andregeneration. This study investigated the effect of short-term (3 days) preconditioning with tumor necrosis factor-alpha (TNF-a) onproliferation, mobilization, and differentiation of adipose tissue-derived mesenchymal stem cells (ASCs). We demonstrated that TNF-apre-conditioning increased proliferation, mobilization, and osteogenic differentiation of ASCs and up-regulated bone morphogeneticprotein-2 (BMP-2) protein level. BMP-2 silencing by siRNApartially inhibited osteogenic differentiation of ASCs induced by TNF-a; BMP-2pre-conditioning also significantly increased osteogenic differentiation of ASCs but the effects were significantly smaller than thoseobserved for TNF-a preconditioning. Furthermore, TNF-a treatment promoted extracellular-signal-regulated kinases(Erk)1/2 and p38mitogen-activated protein kinase (MAPK) signaling pathways, but only Erk1/2 inhibition reduced the BMP-2 levels and osteogenicdifferentiation induced by TNF-a preconditioning. Together, these results support the hypothesis that inflammation contributes to boneregeneration by promoting proliferation, mobilization, and osteogenic differentiation of ASCs; 3 days of TNF-a preconditioning,mimicking the short boost of inflammation normally occurring after bone injury, might serve as a feasible approach for directing stem cellsinto osteogenic differentiation.J. Cell. Physiol. 228: 1737–1744, 2013. � 2013 Wiley Periodicals, Inc.

Bone has the innate capability for self-repair or regenerationthroughout life, however, repairing non-union and critical-sizedbone defects remains a significant challenge. Currenttreatments, including autologous bone grafting or allologousbone grafting, have significant drawbacks, such as limitedavailability and second site surgery or issues of diseasetransmission, respectively (Laurie et al., 1984; Lord et al., 1988;Mankin et al., 1996; Quarto et al., 2001). Therefore, there is amajor medical need for developing novel, safe, and effectiveapproaches to meet the challenge of repairing non-union,critical-sized bone defects, and/or other bone regeneration-related applications.

Mesenchymal stem cells (MSCs) are multipotent cellscapable of self-renewal and differentiating into different lineagesincluding osteoblasts, chondrocytes, adipocytes, and otherconnective tissue cells; they hold a great promise for tissuerepair or regeneration (Wang et al., 2011). A number of studieshave demonstrated the efficacy of utilizing MSCs for boneregeneration either by promoting recruitment/mobilization orosteogenic differentiation via various strategies (Griffin et al.,2011; Frith et al., 2012; Phipps et al., 2012; Yuan et al., 2012; Luet al., 2012a,b). Current strategies for recruiting or directingendogenousMSCs, orMSC’s harvested fromother tissues, intothe osteogenic lineage are not optimal. For example, bonemorphogenetic protein-2 (BMP-2) has been found to be potentin inducing bone formation both in vitro and in vivo, probably byrecruiting/mobilizing endogenous MSCs and promoting theminto osteogenic differentiation. BMP-2 is already used clinicallyfor spinal fusion (Bishop and Einhorn, 2007; Kanakaris andGiannoudis, 2008); however, concerns regarding its deliveryand bio-safety remain an obstacle to its extended clinical

application (Garrison et al., 2007). In this respect, pre-conditioning of MSCs by some factors such as growth factorsmay be a simple strategy to overcome the concerns of safety ordosage, and still be effective in improving the survival,mobilization, and/or differentiation capability ofMSCs for tissuerepair or regeneration (Nirmalanandhan et al., 2009; Perez-Amodio et al., 2011).

Recently, the role of inflammatory cytokines for tissue repairhas attracted extensive attention (Cooper et al., 2010; Liu et al.,2011; Mountziaris et al., 2011) with increasing evidencesuggesting that inflammation plays a vital role in the initiation ofbone repair (Glass et al., 2011). Within 24 h of bone fracture inmice there is a transient burst in expression of variouscytokines, such as tumor necrosis factor-alpha (TNF-a), IL-1,and IL-6, at the fracture site that last for 3 days then decline(Kon et al., 2001). TNF-a receptor knockout mice have

Contract grant sponsor: Australia National Health and MedicalResearch Council (NHMRC).Contract grant sponsor: Early Career Fellowships (ECFs);Contract grant number: APP1036370.

*Correspondence to: Hala Zreiqat, Biomaterials and TissueEngineering Research Unit, School of AMME, the University ofSydney, Sydney 2006, Australia. E-mail: hala.zreiqat@sydney.edu.au

Manuscript Received: 12 November 2012Manuscript Accepted: 16 January 2013

Accepted manuscript online in Wiley Online Library(wileyonlinelibrary.com): 28 January 2013.DOI: 10.1002/jcp.24330

ORIGINAL RESEARCH ARTICLE 1737J o u r n a l o fJ o u r n a l o f

CellularPhysiologyCellularPhysiology

� 2 0 1 3 W I L E Y P E R I O D I C A L S , I N C .

impaired fracture healing, suggesting a critical role for TNF-a inbone fracture repair (Gerstenfeld et al., 2003). We havepreviously shown that short-term (3 days) exposure of primaryhuman bone derived cells (HOBs) to TNF-a resulted in afavorable osteogenicmicroenvironment which is able to induceosteogenic differentiation of MSCs (Lu et al., 2012b). However,whether inflammatory cytokines can serve as preconditioningfactors to control the mobilization and differentiation fates ofhuman MSCs and its underlying mechanism(s) for these effectshas not been determined.

This study assessed the effects of short-term (3 days) TNF-apreconditioning, mimicking the boost of inflammation cytokineafter bone injury, onmobilization and osteogenic differentiationof adipose tissue-derived mesenchymal stem cells (ASCs). Wedemonstrated that 3 days TNF-a pre-conditioning is able topromote proliferation, mobilization, and osteogenicdifferentiation of ASCs. The osteogenic differentiation inducedby TNF-a may be partially attributed to triggering a BMP-2autocrine loop inASCs.We further provide evidence that Erk1/2mitogen-activated protein kinase (MAPK) signaling pathway isinvolved in BMP-2 induction by TNF-a in ASCs and thesubsequent osteogenic differentiation.

Materials and MethodsASCs culturing and TNF-a preconditioning

ASCs (Invitrogen, Carlsbad, CA) were propagated until passage 4according to the manufacturer’s instructions in MesenPRO RSTMBasal Medium (Invitrogen) with the supplement of 2mM L-glutamine and MesenPRO RS Growth Supplement (Invitrogen).ASCs at passage 4 were used for all the studies. Either completegrowth medium containing a-minimal essential medium (a-MEM;Gibco Laboratories, Grand Island, NY), supplemented with10% (v/v) fetal calf serum (Gibco Laboratories), 2mM L-glutamine(Gibco Laboratories), 25mM HEPES Buffer (Gibco Laboratories),2mM sodium pyruvate, 100 units/ml penicillin, 100mg/mlstreptomycin (Gibco Laboratories), or osteogenic medium(complete growth medium supplemented with 1mM L-ascorbicacid phosphate magnesium salt (Wako Pure Chemicals, Richmond,VA) and beta-glycerophosphate (10mmol/L; Sigma, St. Louis, MO)was used in the following assays and experiments.

TNF-a preconditioning procedure was described below: ASCs(passage 4) were cultured in complete growth medium without(control) or with the addition of TNF-a (preconditioning group,1 ng/ml, human recombinant protein; Sigma) for 3 days. At Day 3,the medium was removed and the cells washed with warmphosphate-buffered saline (PBS) solution three times and culturedin complete osteogenic medium for different analysis.

ASCs proliferation and mobilization assays

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromideassay was used for assessing ASC cell proliferation after 3 and7 days of culture in complete growthmedium following TNF-a pre-conditioning.One hundredmicro liters of the reacted reagent fromeach well was transferred to a 96-well plate, and the absorbancewas recorded using a microplate reader (PathTech, Melbourne,Victoria, Australia) at a wavelength of 490 nm.

For the assay of cell mobilization, ASCs were trypsinized, andthen resuspended in serum-freea-MEMmedium (3� 106 cells/ml).The cell suspension was mixed 1:1 with the solution of Matrigelfrom Cultrex (Bio Scientific, Gaithersburg, MD). From thatsuspension, 20ml (containing 3� 104 cells) was layered onto thesurface of six-well tissue-culture dishes to form well-defineddroplets. Dishes were placed at 378C for 5min for Matrigel tosemi-solidify. Two milliliter complete growth medium was thenadded to the dishes, and plates were incubated for up to 10 h. Thenumber of cells that mobilized out of the droplet was scored byphase-contrast microscopy.

Erk1/2/p38 MAPK signaling blocking

For Erk1/2/p38MAPK signaling blocking, Erk1/2 (PD09059, 10mM;Sigma) or p38MAPK-specific inhibitor (SB203580, 10mM; CaymanChemical, Ann Arbor, MI) was added to ASCs culture mediumalong with TNF-a to test its effect on BMP-2 production andosteogenic differentiation induced by TNF-a preconditioning.

BMP-2 preconditioning or siRNA knocking-down

ASCs at passage 4 were cultured in complete growth mediumwithout (control) or with the addition of BMP-2 (50 ng/ml; Sigma)(preconditioning group) for 3 days, then the medium was replacedwith fresh osteogenic medium and the cells were harvested forosteogenic analysis at Days 4 and 14.

Transient siRNA transfection for knocking-down BMP-2expression was performed using HiPerFect (Qiagen, Valencia, CA)according to manufacturer’s instructions. Briefly, shortly beforetransfection, 1ml complete growth medium containing 1.0� 105

ASCswas seeded on a 12-well plate with or without the addition ofTNF-a (1 ng/ml), and 200ml complexes containing 5 nM scrambled(AllStar neg; Qiagen) or BMP-2-specific siRNAs: Hs_BMP2_1, A,50-GGAGGAGUUUAUCACCUCATT-30; B, 50-UGAGGUGAUAAACUCCUCCGT-30 (Qiagen) and 6mlHiPerFect Transfection Reagent were added drop-wise onto thecells. The plate was gently swirled to ensure uniform distribution ofthe transfection complexes. After 3 days culturing, themediumwasreplaced with osteogenic medium and cultured for 4 and 14 days,and the effects of BMP-2 knocking-down on osteogenicdifferentiation induced by TNF-a preconditioning was tested.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was isolated from ASCs by adding Trizol reagent(Sigma) after the medium was removed according to themanufacturer’s instructions. First strand cDNA was synthesizedfrom 0.7mg total RNA using the Omniscript RT Kit (Qiagen)according to the manufacturer’s instructions. Real-time PCR wasperformed in Rotor-Gene 6000 (Corbett Life Science, SanFrancisco, CA) by using Immomix (Bioline, London, UK) accordingto manufacturer’s instructions, and the relative gene expressionlevels for PPAR-g, Runx2, osteopontin, bone sialoprotein,osteocalcin, and BMP-2 were obtained by normalizing them to thehouse-keeping gene (18S). Primers for the selected genes are listedin Table 1.

Alkaline phosphatase (ALP) enzyme activity

For ALP activity, ASC cell layers were washed gently by PBSsolution, and lysed in Tris buffer containing 0.2% NP-40 solution,sonicated, and centrifuged. Two microliter of the lysate was addedto 100ml of 16.3mm/L p-nitrophenol phosphate (ThermoFisher,Waltham, MA) in 96-well plate and incubated for 30min at 378C.

TABLE 1. Primers used for RT-PCR

Gene Sequence (50–30)

Meltingtemperature

(8C)

18s F GTAACCCGTTGAACCCCATT 60R CCATCCAATCGGTAGTAGCG

Runx2 F ATGCTTCATTCGCCTCAC 60R ACTGCTTGCAGCCTTAAAT

Osteopontin F TTCCAAGTAAGTCCAACGAAAG 60R GTGACCAGTTCATCAGATTCAT

Osteocalcin F ATGAGAGCCCTCACACTCCTCG 60R GTCAGCCAACTCGTCACAGTCC

Collagen Type I F GGTCCCAACGAGATCGAGATCCG 60R TACAGGAAGCAGACAGGGCCAACGTCG

PPAR-g F AGTTGCGGCTGCTCAGCATGTT 60R CCGGGTTGTTTTCCCACT

JOURNAL OF CELLULAR PHYSIOLOGY

1738 L U E T A L .

The reaction was stopped using 100ml of 0.1N NaOH and theabsorbance read at 405 nm using a microplate reader (PathTech).ALP activity was calculated from a standard curve after normalizingto the total protein content, which was measured using BCAprotein assay kit (Pierce, Rockford, lL). Results were expressed inmillimoles of p-nitrophenol produced per hour per milligram ofprotein.

Western blotting

ASCs were washed with ice-cold PBS, lysed for 30min in ice-coldRIPA lysis buffer [20mM Tris–HCl, pH 7.5, 1mM EDTA, 1mMEGTA, 150mM NaCl, and 1% Triton X-100, protease inhibitorcocktail (Sigma) and phosphatase inhibitor cocktail 2 (Roche,Penzberg, Germany)]. Protein concentration was measured usingthe BCAprotein assay kit (Pierce). Equal aliquots of protein (10mg)were heated at 708C for 10min in 4� sample buffer(WesternBreeze, Invitrogen) and 10� reducing buffer, andseparated on 8–12% SDS–PAGE gels (WesternBreeze, Invitrogen,Carlsbad, CA). Proteins were transferred to PVDF membranes,washed with 1� TBS-T (20mM Tris–HCl pH 7.6, 137mM NaCl,containing 0.1% Tween 20), and blocked for 1 h at roomtemperature in 1� TBS-T with 1% BSA. The membranes werewashed three times followed by incubation with primary antibodyof anti-BMP-2 (1:1000; Cell Signaling, Beverly, MA), or anti-p38MAPK1/2 (1:1,000, Cell Signaling), or anti-Erk1/2(1:1,000, CellSignaling), or anti-Smad1 (1:1,000, Cell Signaling), or anti-phospho-p38 MAPK1/2 (1:500, Cell Signaling), or anti-phospho-Erk1/2(1:500, Cell Signaling), or anti-phospho-Smad1/5(1:500, CellSignaling), in TBS-T containing 1% BSA overnight at 48C. Afterthree washes, the membranes were incubated with secondaryantibody (WesternBreeze, Invitrogen) for 60min, followed byanother three washes before protein bands were visualized withchemiluminescent reagents (WesternBreeze, Invitrogen) inChemiDoc MP Imaging System (Bio-Rad Life Sciences, Hercules,CA).

Assessment of mineralization

The ASCs pre-conditioned for 3 days with TNF-a weresubsequently cultured for 30 days in osteogenic medium, andAlizarin Red staining was carried out to assess calcium deposit byASCs. In brief, after 30 days of culturing, themedium fromeachwellwas carefully aspirated and cells were fixed by incubating in icedcold 70% ethanol for 1 h at room temperature followed by rinsingthe cells twice (5–10min each) with water. The water was thenaspirated and 1ml Alizarin Red Solution was added to cover each

well of the 24-well plate and incubated at room temperature for30min. After 30min, the Alizarin Red solution was removed andthe cells were washed four times with 1ml water. One to 1.5mlwater was added to each well prior to visual inspection and/orimage acquisition. Image J was used to analyze the staining area.

Statistical analysis

Data in this study were obtained from at least four independentexperiments and represented with mean� SE. For statisticalanalysis, first Levene’s test was performed to determine thehomogeneity of variance for all the data, and then independent t-test was used for analyzing the data between two groups whileTukey HSD post hoc test was used for the data among threegroups. SPSS 17.0 program was employed for all statistical analysisand differences were considered significant if P< 0.05.

ResultsTNF-a preconditioning promoted the proliferation andmobilization of ASCs

After ASCs were exposed to TNF-a (1 ng/ml) for 3 days, themedium was refreshed with complete growth medium withoutTNF-a. It was shown that the proliferation was significantlyincreased for the ASCs preconditioned with TNF-a, comparedto the control (without TNF-a pre-conditioning) after 3 and7 days culturing (Fig. 1A); and more ASCs were mobilized fromthe Matrigel in the group with TNF-a preconditioning than thecontrol at 3, 6, and 10 h (Fig. 1B).We did not continue to countthe migrated cells after 10 h as ASCs have a short doubling timeof 24 h which will not enable us to accurately distinguish themigrated cell and from the proliferated cells.

TNF-a preconditioning induced osteogenicdifferentiation of ASCs

Real-time PCR assays revealed that pre-conditioning ASCswithTNF-a for 3 days led to significant up-regulation of Runx-2,osteopontin, type I collagen, and osteocalcin gene expression aswell as ALP enzyme activity atDay 4 and/or 14, compared to theASCs without TNF-a pre-conditioning (Fig. 2A–D). There wasno significant difference in PPAR-g gene expression betweenthese two groups (Fig. 2F). In addition, after 30 days of culturing,the ASCs with TNF-a pre-conditioning showed morepronounced mineralized matrix formation as indicated byincreased Alizarin red staining relative to those without TNF-apre-conditioning (Fig. 2G).

Fig. 1. TNF-a preconditioning increased ASCs proliferation and mobilization of ASCs. A: Three days of TNF-a pre-conditioning significantlyincreased theproliferation ofASCs atDays 3 and7.B:MoreASCsmobilized fromtheMatrigel in thegroupwithTNF-apreconditioning after 3, 6,and 10 h of preconditioning. MCompared with the control, P<0.05.

JOURNAL OF CELLULAR PHYSIOLOGY

T N F - a P R E C O N D I T I O N I N G F O R B O N E R E G E N E R A T I O N 1739

BMP-2 signaling was involved in TNF-a preconditioninginduced osteogenic differentiation of ASCs

To investigate whether TNF-a preconditioning inducedosteogenic differentiation of ASCs through the changes in BMP-2 expression, we analyzed BMP-2 protein expression in ASCsafter 4, 8, 24, and 72 h exposure to TNF-a. It was found thatBMP-2 protein expression in TNF-a preconditioned ASCs wassignificantly increased at 4, 8, and 24 h; while there was nosignificant change at 72 h (Fig. 3A).

We then performed the inhibitory studies on BMP-2signaling by specifically knocking down BMP-2 expression inASCs via transfecting specific BMP-2 siRNA, to investigate howBMP-2 inhibition effected osteogenic differentiation of ASCsinduced by TNF-a pre-conditioning. Studies were performedto achieve optimal inhibitory effects by optimizing the amountsof siRNA sequence and transfection reagent. The inhibitoryrate for BMP-2 gene expression for current study was found tobe around 70% (data not shown).WhenASCswere transfectedwith BMP-2 siRNA sequences, TNF-a pre-conditioning did notsignificantly increase collagen I and osteocalcin geneexpression, or ALP activity of ASCs (previously observed inFig. 2), but there was still a significant increase when ASCsweretransfected with AllStar siRNA sequences (scrambled/non-specific siRNA) followed by TNF-a pre-conditioning (Fig. 3B–C). In addition, Runx2 and osteopontin gene expression levelsin ASCs transfected with BMP-2 siRNA sequences weresignificantly lower than those for ASCs transfected withscrambled siRNA (Fig. 3B–C).

To further investigate the role of BMP-2 signaling inosteogenic differentiation of ASCs induced by TNF-a pre-conditioning, we examined whether the effects of BMP-2preconditioning on ASCs are similar to those seen as TNF-apreconditioning. By comparing to the control, BMP-2preconditioning for 3 days resulted in significant inductions ofcollagen I, Runx-2, osteopontin and osteocalcin geneexpression levels, and in ALP activity at Day 14. However,compared to the ASCs with TNF-a pre-conditioning, the ASCswith BMP-2 preconditioning had significantly lower collagen I,Runx-2, osteopontin, and osteocalcin gene expression levels(Fig. 3D–E).

TNF-a exerted dual effects on Smad1/5 signalingpathway in ASCs

We also determined the effects of TNF-a on BMP-2downstream Smad1/5 signaling pathway in ASCs. Surprisingly,phosphorylated Smad1/5 protein in ASCs was significantlydecreased after 24 h of TNF-a treatment (Fig. 4A) despite thepresence of the elevated BMP-2 protein levels (Fig. 3A). After 3and 14 days upon TNF-a withdrawal, however, there was adramatic increase (1.7- and 2.2-folds, respectively) inphosphorylated Smad1/5 protein levels by ASCs, compared tothe ASCs without TNF-a preconditioning (Fig. 4B), although itremained significantly lower after 1 day upon TNF-awithdrawal.

TNF-a induced BMP2 production and osteogenicdifferentiation of ASCs via Erk1/2 MAPK signalingpathway

To reveal how TNF-a up-regulated endogenous BMP-2production and subsequent osteogenic induction in ASCs, weinvestigated the roles of p38 and Erk1/2 MAPK signalingpathways. It was found that TNF-a significantly induced thephosphorylated p38 and Erk1/2 proteins of ASCs after 4, 8, and24 h of exposure (Fig. 5A). When Erk1/2 or p38 signalinginhibitor was added together with TNF-a for preconditioning,the presence of Erk1/2 signaling inhibitor but not p38 signalinginhibitor significantly attenuated the inductionof BMP-2 proteinexpression at 24 h by TNF-a (Fig. 5B). The presence of theErk1/2 inhibitor in the preconditioning regime with TNF-a alsosignificantly alleviated the Runx2, osteopontin, and osteocalcingene expression levels induced by TNF-a preconditioning,while it did not significantly change ALP activity (P¼ 0.09) inASCs after 14 days of culturing (Fig. 5C).

Discussion

In recent years there have been several phase I and phase IIMSCs cell-based clinical trials designed to treat various humanconditions, such as bone defects, wound repair, myocardialinfarction, stroke, and diabetes (Trounson et al., 2011).However, the lack of the simple, safe, and effective strategies for

Fig. 2. TNF-a preconditioning induced osteogenic differentiation of ASCs. A–F: Three days of TNF-a preconditioning significantly inducedcollagen type I, Runx-2, osteopontin, and osteocalcin gene expression, and ALP activity, but not PPAR-g gene expression in ASCs after 4 and/or14 days of culturing. G: Three days of TNF-a pre-conditioning promoted themineralization of ASCs atDay 30 visualized byAlizarin red staining.MCompared with the control, P<0.05.

JOURNAL OF CELLULAR PHYSIOLOGY

1740 L U E T A L .

recruiting or directing MSCs into a specific lineage remains amajor hurdle, and as such approaches for successful MSCs-based tissue engineering would be beneficial.

In the current study, we demonstrated that 3 days pre-conditioning TNF-a on ASCs significantly directly promotedosteogenic differentiation of ASCs, and increased theirproliferation and mobilization. These data explain how atransient boost in inflammatory cytokines after bone injury/fracture contributes to bone repair and/or regeneration. Ourdata also suggest that TNF-a preconditioning can serve as afeasible chemical approach to manipulate stem cell fates(increasing proliferation, mobilization, and osteogenicdifferentiation) for bone regeneration, and such a chemicalapproach for manipulating stem cell fates has significant

advantages in comparison to other means such as by geneticmanipulation (Xu et al., 2008; Li et al., 2012). The positive effectof TNF-a on osteogenic differentiation of stem cell has alsobeen reported in other studies (Mountziaris et al., 2010; Huanget al., 2011; Yang et al., 2012), such that Yang et al. (2012)recently demonstrated that short-term TNF-a exposureinduces odontogenic differentiation of dental pulp-derivedstem cells. Compared to these studies, the current studyinvestigated the effects of TNF-a on human ASCs, which aresimilar to bone marrow-derived MSCs, but with superioradvantages including their potential to differentiate intomultiple lineages; harvesting procedure techniques are lessinvasive with a larger quantity of yield of ASCs cells (Levi andLongaker, 2011).

Fig. 3. TNF-a preconditioning induced osteogenic differentiation of ASCs partially via modulating the BMP-2 pathway. A: BMP-2 proteinexpression inASCswassignificantly increasedat4,8,and24hinthepresenceofTNF-a; thefoldschangedwereobtainedbynormalizingthedensityvolumes of BMP-2 to those of b-actin, nU 4. MCompared with the control, P<0.05. B–C: BMP-2 gene silencing in ASCs abrogated the osteogenicinduction by TNF-a pre-conditioning, as only Runx2 and osteopontin gene expression was significantly induced by TNF-a pre-conditioning at14 days when BMP-2 gene expression was silenced in ASCs, and under TNF-a preconditioning, Runx-2 and osteopontin gene expression in ASCswithBMP-2 knock-downwere significantly reduced in comparison to theASCswith non-specific silencing (scrambles/negative control) atDay 14following TNF-a preconditioning. MCompared with control (dashed line, without TNF-a pre-conditioning), P<0.05; #Compared with the ASCswith non-specific knock-down, P<0.05. D–E: Three days of BMP-2 preconditioning significantly induced collagen I, Runx-2, osteopontin, andosteocalcin gene expression, and ALP activity at Day 14; while compared to the ASCs with TNF-a preconditioning, the ASCs with BMP-2preconditioninghadsignificantlylowerosteogenicgeneexpressionforcollagenI,Runx-2,osteopontin,andosteocalcin.Dashline:Control(withoutTNF-a/BMP-2). MCompared with the control, P<0.05. #Compared with TNF-a pre-conditioning, P<0.05.

JOURNAL OF CELLULAR PHYSIOLOGY

T N F - a P R E C O N D I T I O N I N G F O R B O N E R E G E N E R A T I O N 1741

Fig. 4. TNF-ahadthedualeffectsonSmad1/5signalingpathwayinASCs.A:PhosphorylatedSmad1/5protein inASCswassignificantlydecreasedafter 24 hofTNF-a treatmentdespite of theelevatedBMP-2 protein levels as describedabove.B:After thewithdrawal ofTNF-a, phosphorylatedSmad1/5protein level inASCsstill significantlydroppedatDay1,but its leveldramaticallyreboundedandwas1.7-foldand2.2-foldhigherthanthatinASCswithoutTNF-apreconditioning atDay 3 and 14, respectively. Dash line:Control (without TNF-a). MComparedwith the control, P<0.05.

Fig. 5. TNF-a modulated endogenous BMP2 production and osteogenic induction in ASCs via Erk1/2 MAPK signaling pathway. A: TNF-asignificantly inducedthephosphorylatedp38anderk1/2proteinsofASCsafter4,8,and24hofexposure,dash line:control (withoutTNF-a).B:Thepresence of Erk1/2 signaling inhibitor but not by p38 signaling inhibitor in the preconditioning regime significantly reduced BMP-2 proteinexpressionat24h,dashline:control(withoutinhibitors).C:ThepresenceofErk1/2inhibitorbutnotthep38inhibitor inthepreconditioningregimesignificantlyattenuatedRunx2,osteopontin, andosteocalcingeneexpression,butnot significantly forALPactivity (PU 0.09) inASCsafter14daysof culturing. Dash line: control (without inhibitor). MCompared with the control, P<0.05.

JOURNAL OF CELLULAR PHYSIOLOGY

1742 L U E T A L .

The current study further explored the mechanism(s) bywhich TNF-a contributes to osteogenesis. Our previous studysuggested that induction of BMP-2 might be one mechanism topromote the differentiation of osteoblasts (Lu et al., 2012b).The results obtained in the current study implies a role for BMP-2 in TNF-a-mediated osteogenic differentiation in ASCs, asdemonstrated by the induction of BMP-2 expression by TNF-aand the partial inhibition of TNF-a-induced osteogenicdifferentiation of ASCs achieved by blocking BMP-2 expressionwith siRNA.Our results are in agreementwith that of RosenV’sgroup (Tsuji et al., 2006) demonstrating the critical role of BMP-2 in the initiation of bone healing. However, the role of BMP-2 iscomplex, as SMAD 1/5 phosphorylation, an indicator of BMPsignaling, was decreased acutely by TNF-a exposure, with arebound to increased levels only occurring after the removal ofTNF-a; in addition, preconditioning of ASCs with BMP-2 for 3days, at a similar concentration to that used for TNF-a, couldonly partially reproduce the increased osteogenic geneexpression and ALP activity of ASCs induced by TNF-a. Thedoses of TNF-a or BMP-2 used may have contributed to thisdiscrepancy in these results, a more plausible reason, however,is that BMP-2 signaling pathway is only one of the mechanismsunderlying TNF-a preconditioning-induced osteogenicdifferentiation in ASCs, and multiple signaling pathways mightbe triggered by TNF-a and co-ordination in driving ASCstowards osteogenic differentiation. TheWnt signaling pathwayis one of the potential candidates to be induced by TNF-a andpositively contribute to bone formation. TNF-a is able toinduceWnt signaling pathway which co-ordinates with BMP-2-mediated signaling pathway for directing MSCs into theosteogenic lineage (Gustafson and Smith, 2006; Tang et al.,2010; Lin and Hankenson, 2011). It would be of great interestand importance to further identify the multiple signalingpathways triggered by TNF-a and their contributions toosteogenesis in order to utilize them for bone tissueengineering.

Despite the elevated BMP-2 protein expression in ASCsinduced byTNF-a, we showed that BMP-2 downstreamSmad1/5 signaling pathway was directly inhibited by TNF-a, suggestingthat TNF-a affects Smad1/5 signaling pathway through othermechanisms rather than bymodulating BMP-2 expression level.One possible mechanism for the inhibition of the Smad1/5signaling pathway by TNF-a is that TNF-a directly inhibits theexpression of BMP-2 receptors and disconnects the BMP-2 andSmad1/5 signaling pathway. Singhatanadgit et al. (2006)demonstrated that TNF-a is able to directly induce theshedding of the BMPR-IB antigen in association with asignificantly diminished response to BMP-2. The separateactions of TNF-a of inhibiting the Smad1/5 signaling pathwaybut promoting BMP-2 production may also partly explain thedual effects of TNF-a on bone formation. The long-termpresence of TNF-a is detrimental to bone formation, perhapsby diminishing BMPR-IB antigen expression and Smad1/5signaling pathway despite elevated BMP-2 expression, whileshort-term presence of TNF-a is beneficial for bone formationthrough the elevated BMP-2 levels and the rebound in Smad1/5signaling activity after the elimination of TNF-a.

Themechanisms bywhichTNF-a induced BMP-2 expressionin ASCs were also investigated in this study, and it was foundthat TNF-a promoted Erk1/2 and p38MAPK signaling pathwaysalong with the induction of BMP-2. However, only inhibition ofthe Erk1/2 signaling pathway in ASCs reduced both BMP-2induction and the osteogenic differentiation induced by TNF-apre-conditioning, indicating that Erk1/2 signaling pathway wasinvolved in BMP-2 induction osteogenic differentiation in ASCsinduced by TNF-a. Various mechanisms and signaling pathwayshave been reported to be involved in BMP-2 gene regulationduring limb morphogenesis and osteogenic differentiation(Garrett et al., 2003; Huang et al., 2010), and our previous study

showed that p38 MAPK signaling pathway is involved in theBMP-2 induction and osteoblastic differentiation of osteoblasts(Lu et al., 2012b). Discrepancy between different signalingpathways identified to contribute to BMP-2 production mightbe due to the different cell sources and/or differentiation stageof cells, as the bioactive factors secreted by MSCs aredependent on the differentiation state of the cells (Rothenberget al., 2011); during the differentiation of stem cells into somaticcells, their maturational stages decide the expression pattern oftranscription factors and extra/intracellular signaling pathways(D’Amour et al., 2006). Besides the role of Erk1/2 signalingpathway in TNF-a induced BMP-2 expression and subsequentosteogenic differentiation in ASCs, the NF kappa B pathway isalso likely to be a potential candidate contributing to the BMP-2and osteogenic induction by TNF-a pre-conditioning, as NFkappa B pathway has been shown to be onemechanism of TNF-a induced osteogenesis in MSCs (Hess et al., 2009).

In summary, there remains the need to improve our ability tomanipulate or control stem cells differentiation into osteogeniclineage for the repair of non-union, critical-sized bone defects,and/or other bone regeneration-related morbidities. Thecurrent study demonstrates that 3 days TNF-a pre-conditioning of ASCs is able to promote their proliferation andmobilization and to direct them into osteogenic lineage, at leastin part by modulating BMP-2 signaling. We furtherdemonstrated that TNF-a preconditioning might serve as asimple but effective strategy to enhance ASCs commitment tothe osteogenic lineage for bone tissue engineering, though invivo study is mandatory to confirm the efficacy of this approach.

Acknowledgments

The authors acknowledge the Australia National Health andMedical Research Council (NHMRC) and NHMRC EarlyCareer Fellowships (ECFs; Dr. ZuFu Lu, APP1036370). Theauthors also acknowledge Rebecca Cooper Foundation.

Literature Cited

BishopGB, EinhornTA. 2007.Current and future clinical applicationsof bonemorphogeneticproteins in orthopaedic trauma surgery. Int Orthop 31:721–727.

Cooper PR, Takahashi Y, Graham LW, Simon S, Imazato S, Smith AJ. 2010. Inflammation-regeneration interplay in the dentine-pulp complex. J Dent 38:687–697.

D’Amour KA, Bang AG, Eliazer S, Kelly OG, Agulnick AD, Smart NG, Moorman MA, KroonE, Carpenter MK, Baetge EE. 2006. Production of pancreatic hormone-expressingendocrine cells from human embryonic stem cells. Nat Biotechnol 24:1392–1401.

Frith JE, Mills RJ, Hudson JE, Cooper-White JJ. 2012. Tailored integrin-extracellular matrixinteractions to direct human mesenchymal stem cell differentiation. Stem Cells Dev21:2442–2456.

Garrett IR,ChenD,GutierrezG, ZhaoM, EscobedoA, Rossini G,Harris SE,GallwitzW,KimKB, Hu S, Crews CM, Mundy GR. 2003. Selective inhibitors of the osteoblast proteasomestimulate bone formation in vivo and in vitro. J Clin Invest 111:1771–1782.

Garrison KR, Donell S, Ryder J, Shemilt I, Mugford M, Harvey I, Song F. 2007. Clinicaleffectiveness and cost-effectiveness of bone morphogenetic proteins in the non-healing offractures and spinal fusion: A systematic review. Health Technol Assess 11:1–150, iii–iv.

Gerstenfeld LC, Cho TJ, Kon T, Aizawa T, Tsay A, Fitch J, Barnes GL, Graves DT, EinhornTA. 2003. Impaired fracture healing in the absence of TNF-alpha signaling: The role ofTNF-alpha in endochondral cartilage resorption. J Bone Miner Res 18:1584–1592.

Glass GE, Chan JK, Freidin A, Feldmann M, Horwood NJ, Nanchahal J. 2011. TNF-alphapromotes fracture repair by augmenting the recruitment and differentiation of muscle-derived stromal cells. Proc Natl Acad Sci USA 108:1585–1590.

GriffinM, Iqbal SA, BayatA. 2011. Exploring the application ofmesenchymal stemcells in bonerepair and regeneration. J Bone Joint Surg Br 93:427–434.

Gustafson B, Smith U. 2006. Cytokines promote Wnt signaling and inflammation and impairthe normal differentiation and lipid accumulation in 3T3-L1 preadipocytes. J Biol Chem281:9507–9516.

Hess K, Ushmorov A, Fiedler J, Brenner RE, Wirth T. 2009. TNFalpha promotes osteogenicdifferentiation of human mesenchymal stem cells by triggering the NF-kappaB signalingpathway. Bone 45:367–376.

Huang CY, Lee CY, Chen MY, Tsai HC, Hsu HC, Tang CH. 2010. Adiponectin increasesBMP-2 expression in osteoblasts via AdipoR receptor signaling pathway. J Cell Physiol224:475–483.

Huang H, Zhao N, Xu X, Xu Y, Li S, Zhang J, Yang P. 2011. Dose-specific effects of tumornecrosis factor alpha on osteogenic differentiation of mesenchymal stem cells. Cell Prolif44:420–427.

Kanakaris NK, Giannoudis PV. 2008. Clinical applications of bone morphogenetic proteins:Current evidence. J Surg Orthop Adv 17:133–146.

KonT,ChoTJ, AizawaT, YamazakiM,NoohN,GravesD,Gerstenfeld LC, EinhornTA. 2001.Expression of osteoprotegerin, receptor activator of NF-kappaB ligand (osteoprotegerinligand) and related proinflammatory cytokines during fracture healing. J Bone Miner Res16:1004–1014.

JOURNAL OF CELLULAR PHYSIOLOGY

T N F - a P R E C O N D I T I O N I N G F O R B O N E R E G E N E R A T I O N 1743

Laurie SW, Kaban LB, Mulliken JB, Murray JE. 1984. Donor-site morbidity after harvesting riband iliac bone. Plast Reconstr Surg 73:933–938.

Levi B, Longaker MT. 2011. Concise review: Adipose-derived stromal cells for skeletalregenerative medicine. Stem Cells 29:576–582.

Li W, Jiang K, Ding S. 2012. Concise review: A chemical approach to control cell fate andfunction. Stem Cells 30:61–68.

Lin GL, Hankenson KD. 2011. Integration of BMP, Wnt, and notch signaling pathways inosteoblast differentiation. J Cell Biochem 112:3491–3501.

Liu Y, Wang L, Kikuiri T, Akiyama K, Chen C, Xu X, Yang R, Chen W, Wang S, Shi S. 2011.Mesenchymal stem cell-based tissue regeneration is governed by recipient T lymphocytesvia IFN-gamma and TNF-alpha. Nat Med 17:1594–1601.

Lord CF, Gebhardt MC, Tomford WW, Mankin HJ. 1988. Infection in bone allografts.Incidence, nature, and treatment. J Bone Joint Surg Am 70:369–376.

Lu Z, Roohani-Esfahani SI, Wang G, Zreiqat H. 2012a. Bone biomimetic microenvironmentinduces osteogenic differentiation of adipose tissue-derived mesenchymal stem cells.Nanomedicine 8:507–515.

Lu Z, Wang G, Dunstan CR, Zreiqat H. 2012b. Short-term exposure to tumor necrosisfactor-alpha enables human osteoblasts to direct adipose tissue-derived mesenchymalstem cells into osteogenic differentiation. Stem Cells Dev 21:2420–2429.

Mankin HJ, Gebhardt MC, Jennings LC, Springfield DS, Tomford WW. 1996. Long-termresults of allograft replacement in themanagement of bone tumors. Clin Orthop Relat Res324:86–97.

Mountziaris PM, Tzouanas SN, Mikos AG. 2010. Dose effect of tumor necrosis factor-alphaon in vitro osteogenic differentiation of mesenchymal stem cells on biodegradablepolymeric microfiber scaffolds. Biomaterials 31:1666–1675.

Mountziaris PM, Spicer PP, Kasper FK, Mikos AG. 2011. Harnessing and modulatinginflammation in strategies for bone regeneration. Tissue Eng Part B Rev 17:393–402.

NirmalanandhanVS, Juncosa-MelvinN, Shearn JT, BoivinGP,GallowayMT,GoochC, BradicaG, Butler DL. 2009. Combined effects of scaffold stiffening andmechanical preconditioningcycles on construct biomechanics, gene expression, and tendon repair biomechanics.Tissue Eng Part A 15:2103–2111.

Perez-Amodio S, Tra WM, Rakhorst HA, Hovius SE, van Neck JW. 2011. Hypoxiapreconditioning of tissue-engineered mucosa enhances its angiogenic capacity in vitro.Tissue Eng Part A 17:1583–1593.

Phipps MC, Xu Y, Bellis SL. 2012. Delivery of platelet-derived growth factor as a chemotacticfactor for mesenchymal stem cells by bone-mimetic electrospun scaffolds. PLoS ONE7:e40831.

Quarto R, MastrogiacomoM, Cancedda R, Kutepov SM, Mukhachev V, Lavroukov A, Kon E,Marcacci M. 2001. Repair of large bone defects with the use of autologous bone marrowstromal cells. N Engl J Med 344:385–386.

Rothenberg AR, Ouyang L, Elisseeff JH. 2011. Mesenchymal stem cell stimulation of tissuegrowth depends on differentiation state. Stem Cells Dev 20:405–414.

Singhatanadgit W, Salih V, Olsen I. 2006. Bone morphogenetic protein receptors and bonemorphogenetic protein signaling are controlled by tumor necrosis factor-alpha in humanbone cells. Int J Biochem Cell Biol 38:1794–1807.

TangDZ, HouW, ZhouQ, ZhangM, Holz J, Sheu TJ, Li TF, Cheng SD, Shi Q, Harris SE, ChenD, Wang YJ. 2010. Osthole stimulates osteoblast differentiation and bone formation byactivation of beta-catenin-BMP signaling. J Bone Miner Res 25:1234–1245.

Trounson A, Thakar RG, Lomax G, Gibbons D. 2011. Clinical trials for stem cell therapies.BMC Med 9:52.

Tsuji K, Bandyopadhyay A, Harfe BD, Cox K, Kakar S, Gerstenfeld L, Einhorn T, Tabin CJ,Rosen V. 2006. BMP2 activity, although dispensable for bone formation, is required for theinitiation of fracture healing. Nat Genet 38:1424–1429.

Wang S, Qu X, Zhao RC. 2011. Mesenchymal stem cells hold promise for regenerativemedicine. Front Med 5:372–378.

Xu Y, Shi Y, Ding S. 2008. A chemical approach to stem-cell biology and regenerativemedicine. Nature 453:338–344.

Yang X, Zhang S, Pang X, Fan M. 2012. Pro-inflammatory cytokines induce odontogenicdifferentiation of dental pulp-derived stem cells. J Cell Biochem 113:669–677.

Yuan L, Sakamoto N, Song G, Sato M. 2012. Migration of human mesenchymal stem cellsunder low shear stress mediated by mitogen-activated protein kinase signaling. Stem CellsDev 21:2520–2530.

JOURNAL OF CELLULAR PHYSIOLOGY

1744 L U E T A L .