Acinetobacter baumannii NCIMB8209: a Rare EnvironmentalStrain Displaying Extensive Insertion Sequence-MediatedGenome Remodeling Resulting in the Loss of Exposed CellStructures and Defensive Mechanisms

Guillermo D. Repizo,a Martín Espariz,a Joana L. Seravalle,a Juan Ignacio Díaz Miloslavich,a Bruno A. Steimbrüch,a

Howard A. Shuman,b Alejandro M. Vialea

aInstituto de Biologia Molecular y Celular de Rosario (IBR, CONICET), Departamento de Microbiologia, Facultad de Ciencias Bioquimicas y Farmaceuticas, UniversidadNacional de Rosario, Rosario, Argentina

bDepartment of Microbiology, University of Chicago, Chicago, Illinois, USA

ABSTRACT Acinetobacter baumannii represents nowadays an important nosocomialpathogen of poorly defined reservoirs outside the clinical setting. Here, we con-ducted whole-genome sequencing analysis of the Acinetobacter sp. NCIMB8209 col-lection strain, isolated in 1943 from the aerobic degradation (retting) of desert gu-ayule shrubs. Strain NCIMB8209 contained a 3.75-Mb chromosome and a plasmid of134 kb. Phylogenetic analysis based on core genes indicated NCIMB8209 affiliationto A. baumannii, a result supported by the identification of a chromosomal blaOXA-

51-like gene. Seven genomic islands lacking antimicrobial resistance determinants, 5regions encompassing phage-related genes, and notably, 93 insertion sequences (IS)were found in this genome. NCIMB8209 harbors most genes linked to persistenceand virulence described in contemporary A. baumannii clinical strains, but many ofthe genes encoding components of surface structures are interrupted by IS. More-over, defense genetic islands against biological aggressors such as type 6 secretionsystems or CRISPR-cas are absent from this genome. These findings correlate with alow capacity of NCIMB8209 to form biofilm and pellicle, low motility on semisolidmedium, and low virulence toward Galleria mellonella and Caenorhabditis elegans.Searching for catabolic genes and concomitant metabolic assays revealed the abilityof NCIMB8209 to grow on a wide range of substances produced by plants, includingaromatic acids and defense compounds against external aggressors. All the abovefeatures strongly suggest that NCIMB8209 has evolved specific adaptive features toa particular environmental niche. Moreover, they also revealed that the remarkablegenetic plasticity identified in contemporary A. baumannii clinical strains representsan intrinsic characteristic of the species.

IMPORTANCE Acinetobacter baumannii is an ESKAPE (Enterococcus faecium, Staphylo-coccus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugi-nosa, and Enterobacter species) opportunistic pathogen, with poorly defined naturalhabitats/reservoirs outside the clinical setting. A. baumannii arose from the Acineto-bacter calcoaceticus-A. baumannii complex as the result of a population bottleneck,followed by a recent population expansion from a few clinically relevant clones en-dowed with an arsenal of resistance and virulence genes. Still, the identification ofvirulence traits and the evolutionary paths leading to a pathogenic lifestyle has re-mained elusive, and thus, the study of nonclinical (“environmental”) A. baumanniiisolates is necessary. We conducted here comparative genomic and virulence studieson A. baumannii NCMBI8209 isolated in 1943 from the microbiota responsible forthe decomposition of guayule, and therefore well differentiated both temporally and

Citation Repizo GD, Espariz M, Seravalle JL,Díaz Miloslavich JI, Steimbrüch BA, Shuman HA,Viale AM. 2020. Acinetobacter baumanniiNCIMB8209: a rare environmental straindisplaying extensive insertion sequence-mediated genome remodeling resulting in theloss of exposed cell structures and defensivemechanisms. mSphere 5:e00404-20. https://doi.org/10.1128/mSphere.00404-20.

Editor Ana Cristina Gales, Escola Paulista deMedicina/Universidade Federal de São Paulo

Copyright © 2020 Repizo et al. This is an open-access article distributed under the terms ofthe Creative Commons Attribution 4.0International license.

Address correspondence to Guillermo D.Repizo, repizo@ibr-conicet.gov.ar, or AlejandroM. Viale, viale@ibr-conicet.gov.ar.

Received 30 April 2020Accepted 1 July 2020Published

RESEARCH ARTICLEClinical Science and Epidemiology

crossm

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 1

29 July 2020

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

epidemiologically from the multidrug-resistant strains that are predominant nowa-days. Our work provides insights on the adaptive strategies used by A. baumannii toescape from host defenses and may help the adoption of measures aimed to limitits further dissemination.

KEYWORDS environmental Acinetobacter baumannii, preantibiotic-era Acinetobacterbaumannii, environmental reservoirs, comparative genomics, insertion sequences,virulence factors

The genus Acinetobacter, family Moraxellaceae, class Gammaproteobacteria, is char-acterized by Gram-negative aerobic coccobacilli of ubiquitous environmental dis-

tribution and large metabolic capabilities (1). In the Acinetobacter genus, the phyloge-netically closely related species composing the A. calcoaceticus-A. baumannii complexrepresent opportunistic pathogens that are important nowadays (2). Infections due toA. baumannii in particular, rarely reported in health care settings before the 1970s,rapidly increased in importance with the global spread of a limited number of epidemicclonal complexes (CCs) possessing multidrug resistance (MDR) phenotypes (2, 3).Strains composing the CCs generally contain a variety of genetic material obtained byhorizontal gene transfer such as plasmids and chromosomally located genomic islands(GIs), including resistance islands (RIs) encompassing different transposons and inte-grons which play pivotal roles in both antimicrobial and heavy metal resistances (2,4–6). CC strains also carry a large repertoire of insertion sequences (ISs) capable ofmediating gene inactivation as well as genome rearrangements, including deletionsand inversions with strong adaptive significances (2, 6–8). The combination of theabove factors, added to the intrinsic resistance of A. baumannii to desiccation andfever-associated temperatures (9), are considered main factors of persistence of thispathogen in the nosocomial environment (2, 7).

Whole-genome sequence (WGS) comparisons have become commonplace in exam-ining strain-to-strain variability and in comparing pathogenic strains with environmen-tal relatives of a given species, in efforts to identify underlying genetic determinantsand mechanisms responsible for phenotypic dissimilarities. When applied to A. bau-mannii, these approaches provided valuable information on the clinical populationstructure of this species, its potential virulence factors, and the origins and acquisitionof antimicrobial resistance determinants (2, 4, 6, 7, 10, 11). However, the identificationof virulence traits both within and between CC members has remained elusive,suggesting a complex and even multifactorial nature of mechanisms involved (2, 3, 7).The importance of a deeper genomic study of nonclinical (“environmental”) isolates hastherefore recently been emphasized to clarify both the virulence potential of theaboriginal A. baumannii population and the evolutionary paths that led toward apathogenic lifestyle (2). Nevertheless, the natural habitats and potential reservoirs of A.baumannii outside the clinical setting have remained poorly defined, and they are onlybeginning to be elucidated (2, 11–13).

We have recently traced the origins of the collection strain A. baumannii DSM30011(11) to an isolate originally classified as Achromobacter lacticum, which was obtainedprior to 1944 from the enriched microbiota responsible for the aerobic decompositionof the resinous desert shrub guayule (14, 15). WGS of this strain and subsequentcomparative analysis with 32 other complete clinical A. baumannii genomes revealedthe presence of 12 unique accessory chromosomal regions in strain DSM30011, includ-ing five regions containing phage-related genes, five regions encoding toxins related tothe type 6 secretion system, and one region encompassing a novel CRISPR-cas cluster(11). As expected from an environmental isolate obtained before the massive intro-duction of antimicrobial therapy in the 1950s (2), DSM30011 showed a general anti-microbial susceptibility phenotype and no RI in its genome (11). Notably, the genomeof DSM30011 lacked complete IS elements, although some remnants could be pre-dicted on it. Remarkably still, most genes and regulatory mechanisms linked to persis-tence and virulence in pathogenic Acinetobacter species were identified in the

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 2

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

DSM30011 genome. Moreover, several gene clusters encoding components of catabolicpathways related to the degradation of plant defenses were found, thus suggestingthat plants may provide an effective niche for A. baumannii (11), as reported for otherspecies of the genus (11). In turn, it also opens the possibility that phytophagousinsects feeding on these plants (16–22) may represent both reservoirs and vectors forthe dissemination of A. baumannii in the environment.

During the original isolation of DSM30011, two companion isolates also classified asA. lacticum displaying similar phenotypic characteristics were also described (14).Only one of the isolates was saved in collections, and we obtained a replica ofthis isolate (see Table S1; all supplemental files for this paper can be found at https://www.researchgate.net/publication/342762639_Acinetobacter_baumannii_NCIMB8209_a_rare_environmental_strain_displaying_extensive_insertion_sequence-mediated_genome_remodeling_resulting_in_the_loss_of_exposed_cell_structures_and_defensive_mechanis) which had been deposited on the National Collection of Industrial Food andMarine Bacteria, Aberdeen, Scotland under the strain designation NCIMB8209, aimingto perform WGS comparative studies with other completely sequenced Acinetobactergenomes. We report here the results of these analyses as well as some phenotypiccharacteristics of this strain, which may provide clues into the environmental reservoirs,genomic diversity, and virulence potential of the preantibiotic era A. baumannii pop-ulation.

RESULTS AND DISCUSSIONPhylogenetic analysis assigned strain NCIMB8209 to A. baumannii, albeit to

a separate clonal lineage compared to its companion strain DSM30011. (i)NCIMB8209 origins. As described in our previous work (11), strain NCIMB8209 and itscompanion strain DSM30011 were isolated prior to 1944 from the natural microbiotaenriched during the aerobic decomposition of guayule, an industrial procedure (retting)designed to reduce the resinous content of the shrub processed material for thesubsequent production of natural latex (14, 15). Our maximum likelihood (ML) phylo-genetic analyses based on core gene sequence comparisons derived from the WGSdata (see below) allowed us to confidently assign this strain to A. baumannii as aspecies. In concordance with this assignment, this strain was capable of growing at44°C (11) in what represents a typical phenotype associated with A. baumannii (1, 23).Still, random amplification PCR (11), phylogenetic, comparative genome analysis, andmetabolic studies (see below) indicated significant differences between this strain andits companion A. baumannii strain DSM30011. This evidence suggests that, eventhough these two A. baumannii strains might have similar environmental niches, theystill belong to separate clonal lineages. NCIMB8209 thus provided us with a different A.baumannii strain isolated from a nonclinical source (14) before the massive introductionof antibiotics to treat infections (2).

(ii) NCIMB8209 genomic features. Genome sequencing indicated that theNCIMB8209 chromosome consisted of 3,751,581 bp in length with a G�C content of39.1% (Table 1). These values match the average values reported for the genomes ofthe species composing the Acinetobacter genus (3,870 kbp and 39.6%, respectively) (6).It is noteworthy that 223 of the coding DNA sequences (CDSs) (i.e., around 6% of thetotal) predicted in the NCIMB8209 genome were pseudogenes. It is worth noting thata similarly high number of nonfunctional genes (272; 9% of the total genes) has beenreported for the A. baumannii strain SDF, which was isolated from a human body louseand whose genome is riddled with numerous prophages and ISs (24).

Our analysis also showed the presence of a large plasmid of 133,709 bp with a G�Ccontent of 40.1%, hereafter designated pAbNCIMB8209_134 (Table 1). Comparison ofpAbNCIMB8209_134 with other plasmids deposited in databases indicated extensivesequence identity with a group of A. baumannii plasmids with a length of more than100 kb, including pABTJ2 (25). All of these plasmids share a previously undescribedRep-3 superfamily (pfam0151) replication initiation protein gene (C4X49_18465). Thepresence of both partition (C4X49_18550) and toxin/antitoxin genes (C4X49_18715 to

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 3

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

C4X49_18720) related to plasmid stability were detected in pAbNCIMB8209_134. Incontrast, genes involved in mobilization, conjugation, antimicrobial resistance or viru-lence functions could not be identified in pAbNCIMB8209_134. Still, this plasmidencodes functions which may provide some adaptive advantages to their Acinetobacterhosts, such as a putative glutathione-dependent pathway of formaldehyde detoxifica-tion (C4X49_18640 to -18650).

(iii) Comparisons of the chromosomal architectures of A. baumannii environ-mental strains NCIMB8209 and DSM30011. Comparison of the overall chromosomestructures of the A. baumannii NCIMB8209 and DSM30011 strains showed that theformer is 198 kbp smaller than that of DSM30011 (Fig. 1). Furthermore, a number of GIsand prophages distinguished these two chromosomes as will be described in greater

TABLE 1 General features obtained from NCIMB8209 genomic sequencing

Genomic parametera Value for parameter

ChromosomeAccession no. CP028138Estimated size (bp) 3,751,581Average GC content (%) 39.1No. of CDSs 3,596No. of tRNA genes 73No. of rRNA genes 18No. of ncRNA genes 4No. of phage regions 5No. of IS copies 79

PlasmidAccession no. CP028139Estimated size (bp) 133,709Average GC content (%) 40.1No. of CDSs 156No. of tRNA genes 1No. of rRNA genesNo. of ncRNA genesNo. of phage regions 2No. of IS copies 14

aBased on NCBI Prokaryotic genomic annotation pipeline. ncRNA, noncoding RNA.

FIG 1 Linear comparison of the genomes of A. baumannii strains NCIMB8209 and DSM30011 inferred using Mauve. Each block corresponds to a DNA fragmentof the chromosome distinctively colored for clarity. The degree of conservation is indicated by the vertical bars inside the blocks. Their position relative to thegenome line denotes colinear and inverted regions. For a better appreciation of genome synteny, DSM30011 chromosomal DNA shown corresponds to thereverse complementary strand. Putative prophage (PhX-N for NCIMB8209 and PhX-D for DSM30011) and genomic island (GI) insertion sites are indicated (seeTables 2 and 3 for details). Two out of the six rRNA-encoding operons in strain NCIMB8209 are also represented (rRNA1 and rRNA6). Regions encodinginterbacterial competition islands (T6-1 to T6-5 and Tps), heavy metals (dusA-GI and Tn6018-like) and antimicrobial (ade-GI) resistance islands and a CRISPR-cascluster are indicated for DSM30011 genome.

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 4

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

detail below. Despite these differences, a general shared synteny was observed be-tween the two chromosomes, with the notable exception of an inversion of a 53.1-kbregion located between the first and sixth rRNA operons (Fig. 1). A similar situation wasfound in the community-acquired strain A. baumannii D1279779 (26), in which thesame region was inverted compared to DSM30011 and to most other clinical strains,including the type strain ATCC 17978 (see Fig. S1 at the URL given above). Thisrearrangement was probably mediated by homologous recombination between twooppositely oriented rRNA operons bordering this region (26). Still, and although thisinversion reverses the orientation of a number of critical housekeeping genes as wellas the origin of chromosomal replication (oriC), it has no substantial effects on thegrowth rate of NCIMB8209 compared to DSM30011 in either rich or minimal medium(data not shown).

(iv) Phylogenomic and MLST analyses. A phylogenetic study based on the com-parisons of the concatenated sequences of 383 core genes of the environmental strainsNCIMB8209 and DSM30011 and a number of Acinetobacter genomes that encompassed99 other A. baumannii strains as well as 26 non-A. baumannii representatives (26 strains;Table S1) reinforced the affiliation of NCIMB8209 to A. baumannii as a species (Fig. 2 andFig. S2). Different authors have noted the lack of a defined phylogenetic structure forthe general A. baumannii population on phylogenetic trees based on core genecomparisons, with the exception of different terminal clusters each corresponding to anepidemic CC (2, 3, 11, 27). The incorporation of NCIMB8209 core genome sequences tothis phylogenetic study did not change this general picture (Fig. 2), but some obser-vations derived from this analysis are worth noting. First, strains NCIMB8209 andDSM30011, which were isolated more than 70 years ago, neither emerged close to theroot nor formed a separate “environmental” cluster in the A. baumannii subtree. In

FIG 2 Maximum likelihood phylogenetic analysis of A. baumannii strains. (A) The ML phylogeny wascomputed based on 383 concatenated core gene sequences (the full tree is shown in Fig. S2). Numbersat nodes correspond to bootstrap values (BV) (100 replicates of the original data set). For simplicity,subnodes for which internal branches showed BV � 100 were collapsed. The scale bar below corre-sponds to evolutionary distance (average number of the substitutions per site). CC1 and CC2 correspondto subclusters formed by A. baumannii species assigned to epidemic clonal complexes CC1 and CC2,respectively.

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 5

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

contrast, they appeared intermixed between more contemporary clinical strains (Fig. 2).Second, NCIMB8209 emerged in a compact cluster (100% bootstrap support) with anumber of recently isolated A. baumannii strains that included PR07 (isolated in 2012in Malaysia from the blood of a hospitalized patient; NCBI BioProject accession no.PRJNA185400, direct submission) and ABNIH28, a MDR strain isolated in 2016 in theUnited States from a hospital closet drain (28). Further analyses aiming to comparestrain NCIMB8209 with the phylogenetically closest strains ABNIH28 and PR07 (TableS1, ABNIH28-PR07) were performed. We additionally included representative strains ofthe CCI (ACICU), CCII (AYE), and the NCIMB8209 environmental companion strainDSM30011. Different calculations reflecting evolutionary distance, such as averagenucleotide identity (ANI) values, genomic distance, and core-genomic distance shownin this table, reinforced the inferred phylogenetic proximity among the strains includedin the subclade under study (Fig. 2). In silico DNA-DNA hybridization values were also inline with the calculated values obtained for evolutionary distances. Regarding commongene families, the observed percentages ranged from 76 to 84% for all strains includedin the analysis, whereas for additional and absent gene families, these values rangedbetween 16 and 24% and 18 and 21%, respectively. These nonshared genes, which arepart of the accessory genome in each strain, may contribute to the adaption of eachparticular strain to a particular niche.

Strain NCIMB8209 was assigned to a novel sequence type (ST) (1197 [Table S1]) inthe Pasteur scheme of A. baumannii multilocus sequence type (MLST) classification (3).Notably, and in sharp contrast to strain DSM30011, which shared only four of the sevenalleles with its closest matching isolate (11), NCIMB8209 shared six of the seven alleleswith its closest matching isolates with all differences being restricted to the rplB allele(Table S1). Of note, the gdhB gene used in the A. baumannii MLST Oxford classificationscheme (29) is missing from the NCIMB8209 genome (Table S1), an observationexperimentally corroborated by a specific PCR assay (see Materials and Methodsfor details). A deeper comparative analysis with other A. baumannii genomesindicated that NCIMB8209 lacks a 4.8-kbp region between genes C4X49_10220 andC4X49_10225 which, in other genomes (DSM30011 included), harbors the gdhB gene.In the DSM30011 genome, the gdhB gene is flanked by a hypothetical gene(DSM30011_07590) and a gene encoding a universal stress protein (DSM30011_07600),and a similar situation occurs in other A. baumannii genomes. This observation indi-cated that gdhB is nonessential for A. baumannii, and in this context, its interruption byIS elements has been previously noted in a number of A. baumannii isolates of clinicalorigin (30). Moreover, a recent analysis performed with 730 Acinetobacter genomesrevealed in 76% of them a paralogous gdhB gene (gdhB2) in a different locus, theoverall observations indicating that the Pasteur MLST scheme presents some advan-tages for the characterization of epidemiologically related A. baumannii isolates (31).

(v) NCIM8209 comparative genomics. A comparative genomic analysis that in-cluded the previously mentioned 127 different Acinetobacter sp. strains (Table S1)indicated that 510 representatives of the protein families detected in the NCIMB8209genome (see Materials and Methods) are present in all of these genomes (Acinetobactercore genome), and 1,149 of them are present in all 101 A. baumannii genomes analyzed(A. baumannii core genome). These numbers differ from estimations obtained by otherauthors (6) of the core genome content of the Acinetobacter genus (950 genes; 133genomes analyzed) and A. baumannii in particular (1,590 genes; 34 genomes analyzed).It is worth remarking that even when similar numbers of total genomes were used inboth studies, Touchon and collaborators (6) used mostly non-baumannii strains,whereas in our study most of the strains corresponded to A. baumannii. This differenceand the inclusion of two bona fide A. baumannii environmental strains in our calcula-tions might explain why the A. baumannii core genome estimation was reduced by27.7% in our study. In this context, recent estimations conducted by other authors (32)with 78 A. baumannii genomes, which included the environmental strain DS002,inferred a core genome of 1,344 genes for this species. The inclusion of more environ-

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 6

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

mental strains in these calculations will certainly contribute to obtain a more accuratevalue for the core genes repertoire of the species.

NCIMB8209 antimicrobial resistance. Conventional antimicrobial susceptibilityassays indicated that strain NCIMB8209 showed susceptibility to most clinically em-ployed antimicrobials tested except nitrofurantoin and, among �-lactams, to ampicillinat MIC values just above the CLSI recommended breakpoints (Table S2). In fullconcordance (Table 2 and Table S2), this strain lacks AbaR resistance islands. Themarginal ampicillin resistance of this strain (see above) most likely reflects thepresence of a number of �-lactamase genes (Table S2). Of these genes, it is worthmentioning C4X49_08235 (blaOXA-78) encoding an OXA-51-type carbapenemasewith 100% identity to the class D �-lactamase OXA-78 (NCBI WP_005139262.1), andC4X49_12575 (blaADC-154) encoding an enzyme identical to the class C ADC-154�-lactamase (WP_005138362). The presence of these genes in the chromosome ofNCIMB8209 reinforces proposals that they provided for the intrinsic �-lactamase generepertoire of A. baumannii (7, 33–35). NCIMB8209 also contains a carO gene(C4X49_13345) encoding a carO variant II allele described so far only among the A.baumannii clinical population (36), and also an oprD/occAB1 homolog (C4X49_01130).These genes encode different outer membrane proteins proposed to participate in thepermeation of carbapenems into the periplasm (37). NCIMB8209 also carries genesencoding enzymes providing resistance to aminoglycosides and chloramphenicol in-cluding ant(3”)-II and catB, respectively (Table S2). This indicates both the potentialityto evolve such resistances under selective pressure and an environmental reservoir ofthese resistance genes.

Strain NCIMB8209 shares with DSM30011 (11) susceptibility to folate pathwayinhibitors such as sulfamethoxazole-trimethoprim (Table S2). These susceptibilitiescorrelate with the absence of sul or dfrA resistance genes in the genome (Table S2) andrepresent a notable exception compared to most clinical strains of A. baumannii,including strains more contemporary to NCIMB8209 such as ATCC 19606 and ATCC17978 (4, 7, 38–41). This characteristic is compatible with the original isolation of thesetwo strains in an environment still free of the selection pressure derived from the useof sulfonamides common to the clinical setting at that time (11).

Genes encoding components of the RND (resistance-nodulation-cell division), DMT(drug/metabolite transporter), MATE (multidrug and toxic efflux), MFS (major facilitatorsuperfamily), and SMR (small multidrug resistance) efflux systems involved in clinicalAcinetobacter strains in the extrusion of toxic compounds, including some antimicro-bials (7) were also found in the NCIMB8209 genome (Table S2). Remarkably, a regionpresent in most A. baumannii genomes encoding phage-related proteins and the

TABLE 2 Genomic islands identified in the chromosome of strain NCIMB8209a

Region Length (kbp) Location Integrase gene Flanking genes (accession no.) Description

GI1 39.7 116596–156278 C4X49_00725 LysR-family transcriptional regulator(C4X49_00535)/tRNA-Gly-GCC(C4X49_00740)

Type III restriction modificationsystem. TA systems (HypBA,YefM-YoeB). ISs

GI2 30.5 569359–599853 C4X49_02720 Hypothetical protein (C4X49_02715)/peptide chain release factor 3(C4X49_02900)

Phage proteins. Type I restrictionmodification system

GI3 19.1 613054–632163 C4X49_02950 dusA (C4X49_02945)/MFS transporter(C4X49_03050)

Arsenic and heavy metal resistanceisland

GI4 12.6 1165713–1178263 C4X49_05820 tRNA-Ser-TGA (C4X49_05765)/hypothetical protein (C4X49_05860)

Hypothetical proteins of unknownfunction

GI5 19.1 1927268–1946350 C4X49_09525 Hypothetical protein (C4X49_09520)/TetR-AcrR family transcriptionalregulator (C4X49_09610)

Fatty acid catabolic pathway

GI6 29.3 2818151–2847423 C4X49_13865 Peptide synthetase (C4X49_13745)/tRNA-Ser-TGA (C4X49_13870)

Heavy metal resistance island

GI7 13.3 3133811–3147160 C4X49_15320 Sensor histidine kinase (C4X49_15265)/tRNA-Leu-CAA (C4X49_15325)

Type I restriction modificationsystem

aAccording to NCBI and RAST annotations.

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 7

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

AdeRS two-component regulatory system and associated AdeABC efflux components(Fig. 2) was missing in the NCIMB8209 genome. A genomic island (GI5) was insteadfound in an equivalent genomic location (Table 2). The loss of this gene cluster has alsobeen documented in a number of other A. baumannii strains, irrespective of theirclinical or environmental origins (10, 31).

A. baumannii NCIMB8209 shows reduced virulence toward Galleria mellonellaand Caenorhabditis elegans. G. mellonella moth larvae and the nematode C. elegansprovide reliable models to study the virulence of numerous human pathogens, amongthem Acinetobacter genus species (42, 43). We thus decided to use these two modelsto evaluate the virulence of strain NCIMB8209 compared to those of strain DSM30011and the soil organism Acinetobacter baylyi ADP1 (44). In the G. mellonella model,DSM30011 showed high virulence (45, 46), whereas a low-virulence capacity has beendemonstrated for strain ADP1 (47). In contrast, virulence in the C. elegans model has notbeen assessed before for this group of strains. As observed in Fig. 3, NCIMB8209 wasless virulent than DSM30011 in either of these models, with the latter environmentalstrain showing in particular much higher capacity to kill C. elegans. In contrast,NCIMB8209 killing capacity was close to that observed for A. baylyi ADP1 in either assay(Fig. 3). The observed differences in virulence between NCIMB8209 and DSM30011indicate relevant phenotypic differences between them (see also following sections),regardless of their isolation as companion strains from a similar environmental originfollowing similar enrichment and culture protocols (14).

ISs and prophages have extensively modified the NCIMB8209 genome. Thelower virulence displayed by strain NCIMB8209 compared to that of DSM30011 (seeabove) led us to analyze in more detail their genomes, aiming to find genetic differ-ences that might explain these distinct phenotypes. When comparing the accessorygenomes of DSM30011 and NCIMB8209, some differences worth noting were observed

FIG 3 G. mellonella (top) and C. elegans (bottom) lethality curves. Comparative survival analysis betweenA. baumannii DSM30011 and NCIMB8209 and A. baylyi ADP1 strains. PBS was used as control. (Top) 108

CFU were used. (Bottom) 107 CFU were used. Data are representative of three separate survivalexperiments, each performed with 20 larvae/worms. Survival curves were constructed by the Kaplan-Meier method and compared by log rank analysis. ns, not significant. **, P � 0.01; ***, P � 0.005.

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 8

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

in the latter (Fig. 1) such as: (i) the presence of seven GIs (Table 2), which will bedescribed throughout the text; (ii) the presence of five regions harboring putativeprophages (Table 1 and Table S3), which will also be described in detail below; (iii) thenotorious absence of a CRISPR-cas gene cluster common to DSM30011 and other A.baumannii strains (11, 48); (iv) the lack of interbacterial competition islands (ICI), suchas those encoding the type 6 secretion system components and/or its associated toxins(45); (v) significant differences regarding the number of ISs and composition betweenthese two strains (see below).

(i) Prophage content. Recent bioinformatic analyses uncovered a wide distributionand diversity of prophage contents in A. baumannii (49), with some of the prophagescontributing to horizontal gene transfer between strains by generalized transduction(50). Our bioinformatic analysis of phage sequences in the NCIMB8209 genome indi-cated five regions (Ph1-N to Ph5-N) encompassing phage-related genes (Table 3).According to PHASTER integrity predictions, two “questionable” prophages (Ph1-N andPh2-N) and three “incomplete” prophages (Ph3-5-N; Table S3) were identified amongthem. The integration sites for Ph4-N and Ph5-N in the NCIMB8209 genome were thesame hot spots found in other A. baumannii genomes (10), whereas those of Ph1-N toPh3-N represent novel integration sites (Table 3). Of note, both Ph1-N and Ph5-Nsequences share significant identity with the podoviral lytic bacteriophage YMC/09/02/B1251 ABA BP (GenBank NC_019541.1) (51), while Ph2-N, Ph3-N, and Ph4-N showedhomology with the Acinetobacter phage vB_AbasS_TRS1 (NC_031098) (52). It is alsoworth noting that the prophages found in NCBIM8209 shared only limited homologywith those predicted for DSM30011 (11).

(ii) IS content. IS elements are important drivers of genome evolution in A.baumannii and other pathogens, modulating antibiotic resistance gene expression,mediating genome rearrangements, including deletions of substantial chromosomalregions, promoting insertional gene inactivation, etc. (53). Notably, and in sharpcontrast to A. baumannii DSM30011 (11), a high representation of transposable geneticelements such as ISs or transposons was found in the genome of strain NCIMB8209.ISSaga predictions (54) (Table S3) followed by manual examination corroborated thepresence of 12 different ISs (a total of 79 IS copies) in the NCIMB8209 chromosome and9 different ISs (a total of 14 IS copies) in the plasmid that this strain harbors (Table 4).These values are significantly higher than the estimated average of 33 IS copies per A.baumannii genome determined by Adams and collaborators (8). Moreover, the diversityof IS families (16 total) found in the NCIMB8209 genome is also remarkable whenconsidering that only 7 out of 976 A. baumannii genomes were found to carry 10or more different IS elements (8). Although most of the IS elements identified inNCIMB8209 were previously reported in different species of the Acinetobacter genus,this strain contains a very particular IS profile for an A. baumannii strain, with two of themost frequent IS elements (ISAha2 and ISAha3) originally detected in A. haemolyticus(Table 4). Furthermore, as also seen in Table 4, NCIMB8209 harbors two of the five mostrepresented ISs in A. baumannii (8), namely, ISAba26 (15 copies) and ISAba13 (14

TABLE 3 Prophages inserted into the chromosome of strain NCIMB8209a

RegionLength(kbp)

No. of predictedproteins Genome position GC (%) Flanking genes (accession no.)

Ph1-N 25.8 35 860213–886091 40.3 smpB (C4X49_04195)/phosphopantetheineadenylyltransferase (C4X49_04375)

Ph2-N 28.4 41 955316– 983747 37.7 ssrA (tmRNA; C4X49_04705)/DUF927 domain-containing protein (C4X49_04925)

Ph3-N 25.2 29 1240267–1265538 41.5 Aspartate kinase (C4X49_06155)/alanine-tRNAligase (C4X49_06310)

Ph4-N 39.1 32 2140199–2179329 40.5 MFS transporter (C4X49_10600)/hypotheticalprotein (C4X49_10635)

Ph5-N 13.9 11 2414964–2428883 37.7 gspL (C4X49_11920)/phosphohistidine phosphataseSixA (C4X49_12010)

aAccording to PHASTER predictions. tmRNA, transfer-messenger RNA.

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 9

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

copies). The absence of ISAba1 copies in NCIMB8209 is also remarkable, considering thelarge impact of this IS among clinical A. baumannii genomes (8). Of note, the three mostrepresented chromosomal ISs (ISAha3, ISAba26, and ISAba13) are also carried byplasmid pAbNCIMB8209, suggesting that this plasmid was the vehicle enabling theiracquisition.

From the detected ISs in the NCIMB8209 genome, three represented novel elementsthat were deposited in the ISSaga database (54) under the names ISAba44 (IS630family), ISAba45 (IS3 family), and ISAba46 (IS66 family). From these elements, ISAba44 ispresent in 11 copies in the NCIMB8209 chromosome (Table 4). This particular mobileelement was also found in the chromosomes of three other A. baumannii strains(ABNIH28, B8300, and B8342) and in A. johnsonnii XBB1 (75% identity, query cover-age of 100%). No homologs to this IS were found in other organisms outside theAcinetobacter genus. ISAba45 (three copies) was also detected in four other A. bauman-nii strains (PR07, ABNIH28, A1296, and IOMTU433, the former two strains closely linkedto NCIMB8209, Fig. 2) and in A. soli GFJ2 (87% identity, query coverage of 99%).Moreover, ISAba45 displays significant nucleotide identity with similar ISs present inother Acinetobacter strains (76%) and in Moraxella osloensis plasmids (70%). TheISAba46-only copy is carried by plasmid pAbNCIMB8209, and it was also found in thechromosomes and plasmids of numerous strains of A. pittii, A. baumannii, A. lwoffii, A.junii, A. johnsonnii, and A. haemolyticus (�86% identity, query coverage of 100%).Concerning the locations of the above IS elements, we found that 17 of them areinterrupting an equivalent number of CDSs, very likely precluding their expression(Table S3). Seven of these 17 CDSs are interrupted by ISAba13 copies (Table 4).Remarkably, a similar situation was reported previously for strain D1279779, whichharbors 18 ISAba13 copies (26). We also detected that some IS elements were posi-tioned on one of the borders of several genomic islands (GIs), including GI1, GI2, GI4,and GI6 (Table 2). It is tempting to speculate that these insertions probably interferewith the excision mechanism of the corresponding GIs and that they were thus selecteddue to the subsequent retention of these GIs in the chromosome (55).

In summary, the plethora of IS elements found in strain NCIMB8209 have signifi-cantly helped remodel the genome of this strain.

A genome devoid of interbacterial competition islands. As mentioned above,the genome of NCIMB8209 carries neither a type 6 secretion system (T6SS) main genecluster nor any T6SS-associated locus encoding VgrG-like proteins or their cognatetoxins (45, 56). Searching for other competition mechanisms such as the two-partnersystems (Tps) already identified in strain DSM30011 (Fig. 2) related to contact-

TABLE 4 IS contenta

IS name Origin

No. of DNA molecules

Chromosomeb pAbNCIMB8209

ISAha3 A. haemolyticus 18 (2) 1ISAba26 A. baumannii 15 (4) 2ISAba13 A. baumannii 14 (7) 3ISAba44 A. baumannii 11 (2)ISAha2 A. haemolyticus 7 (2)IS1006 A. junnii 4ISAba45 A. baumannii 3IS17 A. haemolyticus 2 (1)IS1008 A. calcoaceticus 2 (1)ISAba22 A. baumannii 1 (1) 2ISAba4 A. baumannii 1ISAba31 A. baumannii 1 2ISAba2 A. baumannii 1ISAba46 A. baumannii 1IS1007 Acinetobacter sp. 1ISAcsp3 Acinetobacter sp. 1aAccording to ISSaga and ISFinder predictions.bThe numbers of gene-interrupting IS copies are indicated in parentheses.

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 10

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

dependent inhibition (CDI) (57) also resulted in negative results. These observations ledus to hypothesize that the ability of strain NCIMB8209 to outcompete other bacteriawas severely compromised. To test this prediction, bacterial competition assays wereperformed essentially following previously described procedures (45). Results shown inFig. S3 demonstrate that strain NCIMB8209 was not capable of outcompeting Esche-richia coli when the former strain was used as the attacker and E. coli DH5� was theprey. In contrast, the DSM30011 strain was clearly capable of outcompeting E. coli DH5�

in a similar assay, an effect that specifically depended on the T6SS system as shown bythe lack of effect observed in a DSM30011 ΔtssM mutant (Fig. S3A). In correlation withthese results, NCIMB8209, similarly to DSM30011 ΔtssM, did not secrete detectableamounts of Hcp (a marker of a functional T6SS) into the growth medium (Fig. S3B). Weadditionally tested the capacity of NCIMB8209 and DSM30011 to outcompete eachother. While DSM30011 completely eliminated NCIMB8209 (Fig. S3C) when coincu-bated in a 10:1 attacker/prey ratio, the latter strain was not capable of outcompetingthe former under similar experimental conditions (Fig. S3D).

Persistence and virulence. To analyze the presence of genes potentially involvedin persistence and virulence in strain NCIMB8209, we performed a BLASTN homologysearch using as the query a list of potential candidates described in Acinetobacterstrains (11). This list included genes coding for the synthesis of the capsule and otherexopolysaccharides, appendages, outer membrane (OM) proteins, and the T2SS, genesencoding phospholipases and proteases, and genes involved in traits such as motilityand iron scavenging. Our searching indicated that 131 out of the 146 genes (sequenceidentity of �76%) encoding potential virulence factors analyzed were present inNCIMB8209 (Table S2). Among the 15 putative virulence factors included in the searchand not detected in the NCIMB8209 genome, most of them encode or are involved inthe synthesis of surface-exposed molecules (Table S2). These included the Prp pilus (58),the MFS transporter Pmt (probably involved in DNA transport necessary for biofilmformation [59]), and a surface motility-associated molecule (60). Moreover, the geneencoding the pilus 3 fimbrial adhesion precursor (C4X49_08175), and the pilus 3fimbria-anchoring protein (C4X49_08180) are both incomplete, and a gene coding fora polymorphic toxin of the RTX family (61) was interrupted by an ISAba44 copy(C4X49_17180 to C4X49_17185). We also noticed that several genes whose productsare directly or indirectly involved in functions related to adhesion or biofilm formationin clinical strains were absent or interrupted by ISs. For instance, the gene encoding theBap protein (62) could not be detected (Table S2), and instead an ISAba13 copy wasidentified in the locus encompassing the bap gene in other A. baumannii strains. Otherexamples are the gene coding for the Ata adhesin (63) which was interrupted by anISAba26 copy, and a gene encoding the O-antigen ligase TfpO normally involved inglycan decoration of capsule and proteins, which was interrupted by an ISAba13 copyin NCIMB8209 (64, 65). We then hypothesized that the lack of this group of genes couldhave impacted traits such as biofilm and pellicle formation as well as motility. Toevaluate this hypothesis, the capacity of NCIMB8209 to form pellicle and biofilm whengrown overnight in rich medium was compared to that of DSM30011, which was foundto represent a high-biofilm/biopellicle producer (45). This assay indicated thatNCIMB8209 was neither capable of forming pellicle (Fig. S4A) nor attaching to glasssurfaces (Fig. S4B), supporting the above prediction that the ability to form biofilm/biopellicles is severely compromised in this strain. Furthermore, motility assays onsemisolid medium showed that the ability of NCIMB8209 to perform surface-associatedmotility was highly reduced (Fig. S4B), again in sharp contrast to DSM30011 (46).

Another gene absent in strain NCIMB8209 is cpaA (Table S2), which encodes thesurface-exposed metallopeptidase Cpa endowed with the ability to cleave fibrinogenand coagulation factor XII, and thus proposed to deregulate blood coagulation (66, 67).CpaA represents a substrate of the type II secretion system (68), and it has beenproposed as a bona fide A. baumannii virulence factor (69). Therefore, its conspicuousabsence in NCIMB8209 (Table S2) and also in its companion DSM30011, as well as in the

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 11

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

clinical strains ATCC 17978 and ATCC 19606 isolated by the middle of last century (11)supports previous proposals that this gene was recently acquired by A. baumannii byhorizontal gene transfer (68).

Genetic features contributing to NCIMB8209 environmental adaptation. (i)Gene acquisition by lateral gene transfer. Our genomic comparative analysis andsubsequent BLASTN-based homology search (see Materials and Methods) indicatedthat 77 CDSs (59 CDSs located in the chromosome and the extra 18 in the plasmid) areunique to strain NCIMB8209 (Table S4). From the 59 unique chromosomal genes, 38were located within different prophage and GI regions and showed no significant hitsin databases. A BLAST search against the NCBI Protein database using as the query theamino acid sequences of the remaining 21 chromosomal CDSs revealed that 20 of themhad significant best hits with proteins found in the database, 16 of them (i.e., 80%)located in species of the Acinetobacter genus (12 of them in A. baumannii) withpotential roles in transport, motility, transcriptional regulation, and lipopolysaccharidesynthesis (see Table S4 for details). Notably, four CDSs related to capsule synthesis (seebelow) were best affiliated with homologs located either in species of different ordersamong the class Gammaproteobacteria to which Acinetobacter belongs, including theAlteromonodales (Alteromonas sp.) and the Enterobacteriales (Yersinia sp.), and also to adifferent class (Azoarcus sp., Betaproteobacteria) or even to a different phylum (Vitelli-bacter sp., Bacteroidetes/Chlorobi) (Table S4). This indicated a remarkable ability of A.baumannii NCIMB8209 to co-opt genes from both phylogenetically related and distantspecies as the result of horizontal gene transfer.

(ii) NCIMB8209 carries a novel K locus. Among idiosyncratic features of strainNCIMB8209 worth noting, we found differences in content and organization of the geneslinked to the production of the K capsule. The K locus identified in the NCIMB8209 genome(Table S2) displayed a gene organization that resembles the polysaccharide gene clusterPSgc6 reported for other clinical A. baumannii strains (70), with the exception of thewafQRST cluster which is missing in NCIMB8209. Furthermore, three extra genes werefound in this novel K locus, namely, C4X49_00290 encoding an O-acetylase (absent inother members of the Acinetobacter genus), C4X49_00300 encoding a glycosyltrans-ferase, and C4X49_00305 encoding a pyruvyl transferase (Table S2). Pyruvyl-cappedN-acetyl-D-galactosamine (D-GalpNAcA) branches constitute rare structures describedso far only in A. baumannii D78, a strain assigned to CC1 (71). The K-locus arrangementdescribed above for strain NCIMB8209 was not found in other Acinetobacter strains bydatabase searching, therefore revealing a previously unreported PSgc locus in A.baumannii. Of note, the weeK gene coding for an UDP-N-acetylglucosamine 4,6-dehydratase (involved in the biosynthesis of UDP-linked sugar precursors used forcapsule synthesis) is also interrupted by an ISAba44 copy in NCIMB8209 (C4X49_00335-C4X49_00350, Table S2).

Strain NCIMB8209 shares with DSM30011 a similar gene locus involved in thesynthesis of outer core polysaccharides (OC) of the lipid A core moiety, with theexception of an additional gene encoding a glycosyltransferase (C4X49_15205). How-ever, this gene is annotated as a pseudogene and is probably nonfunctional (Table S2).As previously described for strain DSM30011 (11), this cluster includes the rmlBDACgenes (Table S2) responsible for the biosynthesis of dTDP-L-rhamnose (70, 72). Theobserved genetic organization of the OC locus in NCIMB8209 corresponds to OCL6according to the classification proposed by Kenyon and collaborators (73).

(iii) Mechanisms of resistance to toxic compounds. Strain NCIMB8209 also con-tains many gene clusters encoding systems involved in the resistance to toxic com-pounds. Some of these clusters are scattered throughout the genome, while others areconcentrated in three regions. One of these regions is constituted by GI3 (Table 2)integrated next to the dusA gene (C4X49_02945). The dusA locus has been found torepresent a common integration site for this kind of genetic island in A. baumannii (74,75). Although GI3 (19.1 kb long) is shorter than homologous GIs carried by other A.baumannii strains (for instance, in strain DSM30011, this GI is 33 kb long), this island still

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 12

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

includes genes for putative arsenate and heavy metal ion detoxification systems (arsand czc genes) and other genes involved in Fe ion transport (feoAB). Another case is GI6,which carries a cluster of genes encoding a putative copper ion detoxification system(C4X49_13800 to C4X49_13840, Table 2). More interestingly, GI6 also harbors a mobAgene (C4X49_13855) encoding a protein with a relaxase domain which might beresponsible for its mobilization after excision from the genome (Table 2). This maysuggest a plasmid origin for this GI, and it also opens the possibility that this gene couldeven mediate its mobilization by horizontal gene transfer after excision from thegenome. The third cluster (C4X49_16225 to C4X49_16400) contains a merR-merTPCADgene cluster (C4X49_16305 to C4X49_16300 to C4X49_16280) coding for a completeHg ion detoxification system (76). Since there is no gene coding for an integrase nearby,this region was not considered a GI. Remarkably, however, it is flanked by several IScopies which might have contributed to its mobilization and integration in this locus.

Inspection of the NCIMB8209 genome also evidenced the presence of three putativecatalase genes (C4X49_07525, C4X49_02120, and C4X49_17825). Catalases representone of the main strategies evolved by cells to cope with the accumulation of reactiveoxygen species (77). It is then noteworthy that the number of putative catalase proteinsencoded by this strain is higher than that of the environmental strains DSM30011 (twoproteins, NCBI:protein PNH13446.1 and PNH14300.1) and A. baylyi ADP1 (one protein,CAG67388.1), and similar to that found in the A. baumannii clinical strain ATCC 17978(three proteins, ABO11814.2, ABO10867.2, and ABO13771.2). Moreover, a comparativeanalysis of the tolerance of the above strains to strong oxidants, as judged by theirsurvival when exposed to H2O2 (77), indicated a strong correlation between theircatalase gene content and oxidative stress resistances (Fig. S6).

(iv) Catabolic abilities. Previous WGS analysis of the environmental A. baumannii

DSM30011 strain predicted the presence in its genome of 28 gene clusters encodingmany metabolic pathways involved in the utilization of a large variety of plant sub-stances (11). The presence and organization of similar catabolic genes were alsoinvestigated in strain NCIMB8209, and despite some differences in the organization ofcatabolic loci between these two strains, 27 out of the 28 catabolic loci found inDSM30011 (11) were also present in this strain. The only exception was the salicylate/gentisate (sal2/gen) cluster, which was totally missing in NCIMB8209. In addition, thebetABI locus present in both strains (previously thought to be a catabolic gene cluster[11, 44]) has been shown in A. baylyi to be involved in the synthesis rather than in thedegradation of glycine betaine (78). In agreement, none of the A. baumannii strainstested including DSM30011, NCIMB8209, and ATCC 17978, nor A. baylyi, were capableof utilizing glycine betaine as the only carbon source for growth (Table S5).

From the 27 predicted catabolic loci shared between strains NCIMB8209 andDSM30011 mentioned above, 17 equivalent clusters are also found in the genome ofA. baylyi and are involved in the degradation of plant substances and the recycling ofplant material (44). These include loci such as pca, qui, pob, hca, van, and ben, involvedin the degradation of aromatic acids and hydroxylated aromatic acids such as hydroxy-cinnamic acids constituting the building blocks of plant protective heteropolymerssuch as suberin (44, 79–81). These aromatic compounds are ultimately catabolizedthrough the beta-ketoadipate pathway yielding Krebs cycle intermediary substrates,therefore allowing bacterial growth when used as the substrates (44). Our analysis ofthe ability of A. baumannii strains NCIMB8209 and DSM30011 to employ differentcompounds as the substrates for growth (Table S5) indicated that these two strainsshare with A. baylyi the ability to utilize many aromatic acids found in plants, includingbenzoate, 4-hydroxy-benzoate, 4-hydroxy-cinnamate, and shikimate, as the sole carbonsources. Moreover, the activity of the mdc pathway involved in the catabolism ofdicarboxylic malonic acid, another plant-synthesized compound (44), was inferred fromthe growth observed by all A. baumannii strains tested in malonate as the only carbonsource (Table S5). These observations are compatible with the isolation of A. baumanniistrains NCIMB8209 and DSM30011 from an enriched consortium specialized in recy-

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 13

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

cling resinous plant material (14). Remarkably still, all of the above-mentioned cataboliccapabilities are also shared by A. baumannii clinical strains such as ATCC 17978 (TableS5 and data not shown).

Besides the above-described similarities with A. baylyi, strains NCIMB8209 andDSM30011 are endowed with some idiosyncratic catabolic clusters also related to thedegradation of particular plant compounds. Among them we could mention the paa(phenylacetic acid [PAA]) and liu (leucine/isovalerate) clusters (11). The presence of apaa cluster in both NCIMB8209 and DSM30011, but not in A. baylyi, correlates with thecapability of these A. baumannii strains to grow on PAA as the sole carbon source (TableS5). PAA is a plant auxin derived from the catabolism of phenylalanine (82, 83)endowed with substantial antimicrobial activity (84). PAA degradation by A. baumanniiclinical strains has already been noted (82) (see also Table S5) and found to play animportant role during A. baumannii infection by reducing the levels of this powerfulphagocyte chemoattractant (83). Concerning the liu (leucine/isovalerate) cataboliccluster, evidence of its activity was obtained by the growth observed for NCIMB8209and DSM30011 on L-leucine or isovalerate as the sole carbon sources (Table S5). In P.aeruginosa, the liu pathway complements the atu pathway responsible for the degra-dation of acyclic terpenes produced by plants in response to phytopathogens (85), anda similar situation may also occur in NCIMB8209 and DSM30011 (11). It follows thatthese A. baumannii strains have the capability not only to participate in the degradationof many plant aromatic compounds, but they are also endowed with the additionalability to degrade compounds produced by plants in response to stress situations,including the attack of phytopathogens and phytophagous insects (79–81).

Besides the above-described similarities at both the genomic level and metaboliccapabilities between strains DSM30011 and NCIMB8209, a differential capacity for theutilization of the basic amino acids arginine and ornithine was observed between thesetwo strains (Table S5). This may be explained by the differential presence in DSM30011of a 10.5-kb fragment containing a gdh-ascC-astA-astD-astB-astE gene cluster encodinga complete arginine succinyltransferase (AST) pathway responsible for the catabolismof these basic amino acids (86), which was missing in NCIMB8209 (Fig. 1). Instead, aregion of 27.6 kb bordered by IS1008/ISOur remnants and encompassing putative ionmercury detoxification genes was found in NCIMB8209, which has in turn been heavilyimpacted by several ISs of different types (Table S3). It is worth noting in the abovecontext that the chromosomal region adjacent to astA in A. baumannii CC2 strains isalso an integration site for different mobile elements such as AbGRI2-type resistanceislands among others, which have provoked different rearrangements in their vicinityincluding various deletions (10, 53). This has resulted in some CC2 strains in which aAbGRI2-type element is found adjacent to a complete ast gene cluster, and otherstrains in which the ast genes have been completely deleted (10, 53; also data notshown). It has been shown in P. aeruginosa that the N-succinyl transferase AstA,the first enzyme of the AST pathway, is able to use both L-arginine and L-ornithine asthe substrates (87), and a similar substrate specificity may also occur for A. baumanniiAstA. Furthermore, genes coding for a putrescine importer (puuP) and a gamma-aminobutyraldehyde dehydrogenase (patD), the latter part of the transaminase path-way of putrescine degradation (86), were identified in DSM30011 (51% and 48%identity with the corresponding proteins from Escherichia coli strain K-12 substrainMG1655; accession numbers AAC74378.2 and AAC74526.1, respectively) but not inNCIMB8209. The latter observations might also explain the inability of NCIMB8209 togrow on putrescine, compared to the other A. baumannii strains tested (Table S12). Inany case, the observed phenotypic profiles suggest a narrowing of NCIMB8209 sub-strate utilization capabilities when basic amino acids and polyamines in particular areconsidered, which suggests an adaptation of this strain to a specific niche.

Conclusions. A. baumannii NCIMB8209 represents to our knowledge the secondreported environmental A. baumannii strain, isolated from a desert plant source at theonset (or even before) the massive introduction of antimicrobials to treat infections

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 14

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

(11). In concordance, and similarly to its companion strain DSM30011, NCIMB8209showed general susceptibility to most clinically employed antimicrobials, includingfolate pathway inhibitors (this work and reference 11). As expected from their commonplant source and retting enrichment before isolation in media containing guayuleresins as the substrates for growth (14), both A. baumannii strains share the ability todegrade a number of substances produced by plants, including many hydroxylatedaromatic acids constituting the building blocks of plant protective hydrophobic het-eropolymers and also repellents against predators (Table S5). However, WGS andsubsequent phylogenetic and comparative genome analysis, as well as different bio-chemical studies conducted in this work, indicated significant differences betweenthese two environmental strains. First, compared to DSM30011, NCIMB8209 has un-dergone a significant genome reduction and lacks many genetic clusters encodingcomponents involved in defense mechanisms against other biological competitorssuch as the CRISPR-cas complex, T6SS, and two-partner systems. Moreover, and al-though NCIMB8209 contains most genes associated with persistence and virulence inA. baumannii clinical strains, many genes encoding components of surface structuresare interrupted by IS elements whose relatively high number and variability impactedheavily on the NCIMB8209 genome. Among IS-interrupted genes, we found thoseencoding pili components, the O-antigen ligase TfpO, a biosynthetic route for surfac-tants compounds, Bap and Ata adhesins, a RTX-toxin, etc. (Table S3). Comparativebiofilm and pellicle production, as well as motility assays, yielded evidence for the factthat NCIM8209 is severely compromised in these pathogenicity-associated traits (Fig.S4). Altogether, these observations can explain the low relative virulence potentialobserved for NCIM8209 on the G. mellonella and C. elegans infection models (Fig. S3).

Loss of T6SS genes has been observed in a number of A. baumannii clinical strainscausing infections, suggesting that this system is not required once A. baumanniiinvades its host (53, 88, 89). Moreover, the absence of T6SS has been linked with higherchances of evasion of A. baumannii from the host immune system (90, 91). The situationdescribed above for strain NCIMB8209 therefore resembles that reported for A. bau-mannii SDF isolated from a human body louse (24), which has undergone extensivegenome reductions and rearrangements mediated by ISs (24). Also, albeit more mod-erately, loss of T6SS and IS-mediated inactivation of genes encoding surface structureswas also observed in A. baumannii D1279779, a community-acquired strain isolatedfrom the bacteremic infection of an indigenous Australian (26).

It is tempting to speculate that the changes observed in A. baumannii NCIMB8209are also related to its adaptation to a particular niche. In this context, several reportshave shown the profound associations existing between different bacterial groups,including many members of the Acinetobacter genus with a number of insects feedingon plants (16–22). Many of these bacterial species are located in the guts of their insecthosts conducting mutualistic or symbiotic associations based on nutrition/protectionrelationships (16, 18–20, 92, 93). The bacterial counterpart thus degrades toxic com-pounds for the insect of the plant diet, and the insect host in return provides a stableenvironment, supply, or resources, and a vector for the rapid spreading and inoculationinto fresh plant tissues. For those bacterial species displaying low pathogenic potential,selective pressure eventually favors more stable relationships with concomitant struc-tural and metabolic changes (93). A general trend thus observed for Gram-negativespecies with these characteristics is genome reduction with the loss or modification ofsurface-exposed molecules, thus reducing interactions with the innate immune systemof their hosts which may trigger defensive responses and elimination (92, 93). Thissituation can certainly be applied to NCIMB8209, as extensively detailed above. In thiscontext, we note the relative high tolerance of this strain to pro-oxidants such as H2O2

(Fig. S6), which correlates with the identification of three catalase genes in its genome(94). The innate immune system of insects closely resembles that of vertebrates at boththe molecular and cellular levels (92). Thus, while the cellular immune response invertebrates is mediated by professional phagocytes, in insects, this function is con-ducted by phagocytic cells known as hemocytes (92). Since phagocytic cells use

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 15

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

oxidative burst as a common strategy to counteract pathogens (92, 95), it is thenpossible that the selection of a higher antioxidant ability in NCIMB8209 led to anincreased tolerance to oxidative stress and therefore increased survival in an insectniche. Of note, recent evidence indicates that A. baumannii strains with high catalaseproduction are more resistant against intracellular killing by macrophages (96).

Our observations also provide further clues on the high genomic plasticity of A.baumannii as a species (6), underscoring the fact that this highly advantageous featurein adaptive terms is not exclusive to A. baumannii strains of clinical origin only. Insummary, WGS analysis and complementary phenotypic characterization of A. bauman-nii strains of environmental origin such as DSM30011 and NCIMB8209 provided impor-tant clues on the genomic content and diversity of this species before the strongselection pressure associated with the current antibiotic era, and suggested potentialniches of this species outside the clinical setting.

MATERIALS AND METHODSBacterial strains and growth conditions. Acinetobacter sp. strain NCIMB8209 was obtained from the

National Collection of Industrial Food and Marine Bacteria, Aberdeen, Scotland. For details on the originalisolation and different denominations assigned to this strain by various collections, see our previouspublication (11) under “Tracing DSM30011 origins.”

The use of carbon or carbon and nitrogen sources by the A. baumannii strain NCIMB8209, DSM30011,or ATCC 17978 was conducted on solid BM2 minimal medium [62 mM potassium phosphate (pH 7.0),7 mM (NH4)2SO4, 0.5 mM MgSO4, 10 �M FeSO4] supplemented with 1.5% Difco bacteriological agar and0.2% (wt/vol) of the tested substrates (97). The plates were incubated at 30°C for 48 to 96 h before colonygrowth was inspected. Other bacterial strains such as Acinetobacter baylyi ADP1 (44) and Pseudomonasaeruginosa PAO1 (98) were also included in these tests as controls for the utilization of particularcompounds.

Plates containing 0.3% agarose, 10 g/liter tryptone, and 5 g/liter NaCl were used as a tool to detectcell motility on a semisolid surface. The plates were inoculated on the surface with bacteria lifted fromovernight LB agar cultures using flat-ended sterile wooden sticks or depositing 10 �l of LB culturesgrown to an optical density at 600 nm (OD600) of 0.1. Plates were incubated for 30 h at 30°C in the darkbefore inspection and recording.

Tolerance to H2O2 was performed as previously described (77). Briefly, bacterial cultures werecollected when they reached an OD600 of 0.6 and subjected to serial dilutions. Aliquots of 10 �l were thenloaded onto LB agar plates, supplemented with 400 �M H2O2, and incubated for 30 h at 30°C beforeinspection.

NCIMB8209 genome sequencing and annotation. NCIMB8209 DNA was isolated using a commer-cial kit (Wizard Genomic DNA purification kit; Promega), following the manufacturer’s instructions. Thegenomic sequence was obtained using a hybrid strategy combining PacBio Sequel (MrDNALab, Shallo-water, TX, USA) and Illumina MiSeq (single-end reads, University of Chicago genomic facilities) methods.A total of 3,238,476,791 reads were generated with the PacBio Sequel approach (depth of coverage�834�), which were subjected to quality assessment prior to de novo genome assembly using Falcon(99) followed by further polishment by the Arrow algorithm. In turn, the sequence data generated by theIllumina strategy were assembled into contigs using Spades version 3.0.11 (100), and used to close thegaps left by the PacBio Sequel strategy. The replication origin (oriC) was predicted with OriFinder (101).The final assembled NCIMB8209 chromosome was annotated using the pipeline available at NCBI anddeposited in DDBJ/ENA/GenBank under accession number CP028138. In turn, the plasmid sequencesderived from the above sequencing data were deposited in the GenBank nucleotide sequence databaseunder accession number CP028139.

The presence of IS elements in the NCIMB8209 genome was determined using IS Finder version 2.0(102) (https://www-is.biotoul.fr/). Novel ISs were deposited into the ISSaga database (54). Putativeprophage sequences were identified by PHASTER (103, 104). Antimicrobial resistance genes weredetected with ResFinder 3.2 (https://cge.cbs.dtu.dk/services/ResFinder/) (105). Catabolic clusters presentin the NCIMB8209 genome were searched by a BLASTN approach (106) using as queries the catabolicgenes previously described for the DSM30011 strain (11).

Protein family analyses and phylogenomic calculations. The proteomes of the 126 Acinetobacterstrains analyzed in this work, which included 99 A. baumannii strains other than NCIMB8209 andDSM30011, were first retrieved from the NCBI ftp database and gathered into a local database togetherwith the NCIMB8209 proteome. Families of homologous proteins were clustered with PGAP version 1.2.1by using the gene family (GF) method (107). Briefly, the BLASTALL tool was executed among all mixedprotein sequences, and the filtered BLAST result was clustered by the MCL algorithm. For each proteinpair of the same cluster, the global match region and identity were set to be equal or higher than 70%of the longer sequence. This analysis allowed us to assemble 27,367 protein families among thesegenomes, from which 6,383 corresponded to protein families presenting a single representative in allAcinetobacter genomes analyzed. Regarding strain NCIMB8209 (3,596 predicted total CDSs), 3,551 proteinfamilies contained at least one representative sequence in this strain, including 79 families that containedmore than one.

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 16

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

Maximum likelihood (ML) phylogenetic trees were then constructed using these data. For eachprotein family, the corresponding nucleotide sequences were retrieved, individually aligned usingClustalW2 (108), and trimmed using GBlock 0.91b (109). The resulting alignments were combined to builda large supermatrix (362,285 nucleotide positions) using the Python3 package AMAS 0.98 (110). Finally,the evolutionary history of the strains was inferred as implemented by Espariz et al. (111) using theRAxML software (112) and the general tree reversible (GTR) substitution model with gamma distribution.The individual parameters for the model were estimated and optimized for each concatenated gene asindicated by Stamatakis (112). Reliability of the inferred tree was tested by bootstrapping with 100repetitions.

In order to depurate the list of protein families specific for strain NCIMB8209 according to PGAPpredictions, their coding genes were used as queries in a BLASTN sequence similarity-based comparison(106) against all 126 Acinetobacter genomes present in our local database. Coverage and identitythresholds of 70% and an E-value cutoff of 1E�30 were used for these calculations. Those CDSs for whicha significant hit was found were then deleted from the list.

Sequence typing. Assignment of sequence types (ST) for strain NCIMB8209 was done using thehousekeeping genes cpn60, gltA, gpi, gyrB, recA, and rpoD (Oxford scheme) (29) or cpn60, fusA, gltA, pyrG,recA, rplB, and rpoD (Pasteur scheme) (3). For details, see the A. baumannii MLST Databases website(http://pubmlst.org/abaumannii/) (113).

gdhB gene detection by PCR. PCRs were carried out following standard protocols, using the primerpair GHDB_1F (GCTACTTTTATGCAACAGAGC)/GHDB775R (GTTGAGTTGGCGTATGTTGTGC) for ghdB detec-tion and the degenerate primer pair 16S RDNAF (AGAGTTTGATCHTGGYTYAGA)/16S_RDNAR (ACGGYTACCTTGTTACGACTTC) for 16S rRNA gene detection.

Antimicrobial susceptibility testing. The general antimicrobial susceptibility of strain NCIMB8209was evaluated using the Vitek 2 System (bioMérieux) following criteria recommended by the Clinical andLaboratory Standards Institute (CLSI) (114). Susceptibility tests to tetracycline, chloramphenicol, andmacrolides such as azithromycin and erythromycin were done separately by disk assays on Mueller-Hinton agar (MHA) following CLSI protocols. In short, NCIMB8209 cells were grown overnight at 37°C,resuspended in LB broth to a turbidity of 0.5 McFarland units, and spread on the surfaces of MHA-containing petri plates. Antibiotic disks were then carefully deposited at the center of the agar surface,and the plates were incubated at 37°C for 16 h before measuring the diameter of the correspondinggrowth inhibition zones.

Bacterial competition assays. The different A. baumannii and E. coli strains used in competitionassays were grown overnight in 2 ml of L-broth (10 g/liter tryptone, 5 g/liter yeast extract, and 0.5 g/literNaCl) medium. Cultures were then diluted in L-broth medium to an absorbance at 600 nm (Abs600) of0.1. The cells were mixed in a 10:1 ratio (predator/prey). Aliquots of 20 �l of these cell mixtures were laidon the surface of L-broth medium supplemented with 1.5% agar and incubated at 37°C for 4 h. Thebacterial spot on the agar surface was subsequently removed and vigorously resuspended in anEppendorf tube with 500 �l of PBS. The mixtures were serially diluted 1:10 in PBS using a 96-wellpolystyrene microtiter plate and then plated onto solid selective media for colony counting. For E. coliDH5�, selective medium containing 20 �g/ml nalidixic acid was used. For Acinetobacter strains, selectivemedia contained either 30 �g/ml gentamicin or 75 �g/ml rifampicin were employed as indicated. For allbacterial competition experiments, one representative image of the growth results obtained in selectivemedium is shown.

Hcp secretion analysis. Experiments were performed by the method of Repizo et al. (45). Briefly, theA. baumannii strains analyzed for Hcp secretion were inoculated in 50 ml L-broth at an Abs600 of 0.08,and incubated at 37°C until the Abs600 reached a value of �1.0. Culture supernatants were obtained bycentrifugation at 4,000 � g, followed by filtration using 0.22-�m filters. Secreted proteins present in thesupernatants were then concentrated 50-fold using Amicon Ultracel 3K centrifuge filters following theinstructions of the manufacturer and subjected to a wash step with 40 mM Tris (pH 8), 200 mM NaCl, and5% glycerol before being analyzed by 18% sodium dodecyl sulfate-polyacrylamide gel electrophoresis(SDS-PAGE).

Biofilm assays. Biofilm formation was qualitatively determined by measuring the adhesion ofbacteria to the surfaces of glass tubes. A. baumannii strains were statically grown overnight in 2 ml ofL-broth medium. The spent liquid medium was discarded, and the tubes were rinsed twice with waterbefore adding a solution of 1% crystal violet. After 15 min, the dye solution was discarded, and the tubeswere rinsed twice with water before inspection. All assays were done at least three times using freshsamples each time.

A. baumannii virulence assays using Caenorhabditis elegans nematode and Galleria mellonellalarvae model systems. Virulence assays of the different A. baumannii strains tested here were evaluatedby using two different model systems: G. mellonella moth larvae (42) and the nematode C. elegans (43).G. mellonella larvae were purchased from Knutson’s Live Bait (Brooklyn, MI) and were used the day afterarrival. Groups of 20 randomly picked larvae were used for each assay condition. The different A.baumannii strains tested were grown overnight in LB and then diluted with phosphate-buffered saline(PBS) to obtain the CFU titers indicated in the corresponding figure legends, which were verified bycolony counts on L-broth agar (LBA) for all inocula. A Hamilton microliter syringe was used to inject 10 �lof the bacterial suspensions into the hemolymph of each larva via the second to the last left proleg. Fora control, one group of G. mellonella larvae was injected with 10 �l of PBS. After injection, the larvae wereincubated in plastic plates at 37°C, and the numbers of dead individuals were scored regularly.

For C. elegans survival experiments, the N2 Bristol (wild type) was used. Gravid hermaphrodites werebleached, and the resulting eggs were washed using standard protocols (115). Nematodes arrested in

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 17

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

larval stage 1 (L1) were then transferred onto NGM plates seeded with fresh E. coli OP50 and grown at20°C until nematodes reached larval stage 4 (L4). For virulence assays, A. baumannii and E. coli OP50(control) were grown overnight at 37°C in L-broth medium. The stationary culture was then diluted to 107

total CFU, and 50-�l portions were seeded onto 60-mm nematode growth medium (NGM) plates. Groupsof L4 worms were then transferred to the plates seeded with A. baumannii and deposited on the centerof the bacterial spot. Assays were performed in duplicates. The nematodes were maintained at 20°C,transferred to fresh plates every 48 h, and monitored daily. Worms that did not respond to stimulationby touch were scored as dead.

Survival curves were plotted using PRISM software, and comparisons in survival were calculated usingthe log rank Mantel-Cox test and Gehan-Breslow-Wilcoxon test.

Data availability. The final assembled NCIMB8209 chromosome was annotated using the pipelineavailable at NCBI and deposited in DDBJ/ENA/GenBank under accession number CP028138. In turn, theplasmid sequences derived from the above sequencing data were deposited in the GenBank nucleotidesequence database under accession number CP028139.

ACKNOWLEDGMENTSThis work was supported by a grant awarded to A.M.V. from the Agencia Nacional

de Promocion Cientifica y Tecnologica (ANPCyT grant PICT-2015-1072), by a grantawarded to H.A.S. (NIH grant AI-115203), and by a Fulbright fellowship awarded toG.D.R.

We are indebted to the curator teams of both the Institut Pasteur MLST system(Paris, France) and Oxford University (Oxford, UK) for their help in incorporatingNCIMB8209 MLST alleles and profiles at http://pubmlst.org/abaumannii/. We are in-debted to D. de Mendoza (IBR-CONICET, Rosario, Argentina) for the kind gift of the C.elegans N2 strain. We also thank V. Müller (Goethe University Frankfurt, Frankfurt amMain, Germany) for calling our attention to the biosynthetic characteristics of theAcinetobacter bet locus. M.E., A.M.V., and G.D.R. are staff members of CONICET. H.A.S. isa member of the Department of Microbiology at the University of Chicago.

G.D.R., A.M.V., and H.A.S. conceived and designed the work. G.D.R. and M.E. con-ducted the bioinformatic analysis. G.D.R., J.L.S., J.I.D.M., B.A.S., and A.M.V. performed theexperimental part. G.D.R., M.E., and A.M.V. analyzed the data. All authors contributed tothe writing of the manuscript and read and approved the final version.

We declare that the research was conducted in the absence of any commercial orfinancial relationships that could be construed as a potential conflict of interest.

REFERENCES1. Bouvet PJM, Grimont P. 1986. Taxonomy of the genus Acinetobacter

with the recognition of Acinetobacter baumannii sp. nov., Acinetobacterhaemolyticus sp. nov., Acinetobacter johnsonii sp. nov., and Acinetobac-ter junii sp. nov. and emended descriptions of Acinetobacter calcoace-ticus and Acinetobacter lwoffii. Int J Syst Bacteriol 36:228 –240. https://doi.org/10.1099/00207713-36-2-228.

2. Antunes LCS, Visca P, Towner KJ. 2014. Acinetobacter baumannii: evo-lution of a global pathogen. Pathog Dis 71:292–301. https://doi.org/10.1111/2049-632X.12125.

3. Diancourt L, Passet V, Nemec A, Dijkshoorn L, Brisse S. 2010. Thepopulation structure of Acinetobacter baumannii: expanding multire-sistant clones from an ancestral susceptible genetic pool. PLoS One5:e10034. https://doi.org/10.1371/journal.pone.0010034.

4. Di Nocera PP, Rocco F, Giannouli M, Triassi M, Zarrilli R. 2011. Genomeorganization of epidemic Acinetobacter baumannii strains. BMC Micro-biol 11:224. https://doi.org/10.1186/1471-2180-11-224.

5. Nigro SJ, Post V, Hall RM. 2011. Aminoglycoside resistance in multiplyantibiotic-resistant Acinetobacter baumannii belonging to global clone2 from Australian hospitals. J Antimicrob Chemother 66:1504 –1509.https://doi.org/10.1093/jac/dkr163.

6. Touchon M, Cury J, Yoon E-J, Krizova L, Cerqueira GC, Murphy C,Feldgarden M, Wortman J, Clermont D, Lambert T, Grillot-Courvalin C,Nemec A, Courvalin P, Rocha EPC. 2014. The genomic diversification ofthe whole Acinetobacter genus: origins, mechanisms, and conse-quences. Genome Biol Evol 6:2866 –2882. https://doi.org/10.1093/gbe/evu225.

7. Roca I, Espinal P, Vila-Farrés X, Vila J. 2012. The Acinetobacterbaumannii oxymoron: commensal hospital dweller turned pan-

drug-resistant menace. Front Microbiol 3:148. https://doi.org/10.3389/fmicb.2012.00148.

8. Adams MD, Bishop B, Wright MS. 2016. Quantitative assessment ofinsertion sequence impact on bacterial genome architecture. MicrobGenom 2:e000062. https://doi.org/10.1099/mgen.0.000062.

9. Zeidler S, Müller V. 2019. Coping with low water activities and osmoticstress in Acinetobacter baumannii: significance, current status andperspectives. Environ Microbiol 21:2212–2230. https://doi.org/10.1111/1462-2920.14565.

10. Chan AP, Sutton G, DePew J, Krishnakumar R, Choi Y, Huang XZ, BeckE, Harkins DM, Kim M, Lesho EP, Nikolich MP, Fouts DE. 2015. A novelmethod of consensus pan-chromosome assembly and large-scale com-parative analysis reveal the highly flexible pan-genome of Acinetobac-ter baumannii. Genome Biol 16:143. https://doi.org/10.1186/s13059-015-0701-6.

11. Repizo GD, Viale AM, Borges V, Cameranesi MM, Taib N, Espariz M,Brochier-Armanet C, Gomes JP, Salcedo SP. 2017. The environmentalAcinetobacter baumannii isolate DSM30011 reveals clues into the pre-antibiotic era genome diversity, virulence potential, and niche range ofa predominant nosocomial pathogen. Genome Biol Evol 9:2292–2307.https://doi.org/10.1093/gbe/evx162.

12. Eveillard M, Kempf M, Belmonte O, Pailhoriès H, Joly-Guillou ML. 2013.Reservoirs of Acinetobacter baumannii outside the hospital and poten-tial involvement in emerging human community-acquired infections.Int J Infect Dis 17:e802– e805. https://doi.org/10.1016/j.ijid.2013.03.021.

13. Wilharm G, Skiebe E, Higgins PG, Poppel MT, Blaschke U, Leser S, Heider C,Heindorf M, Brauner P, Jäckel U, Böhland K, Cuny C, Łopinska A, KaminskiP, Kasprzak M, Bochenski M, Ciebiera O, Tobółka M, Zołnierowicz KM,Siekiera J, Seifert H, Gagné S, Salcedo SP, Kaatz M, Layer F, Bender JK, Fuchs

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 18

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

S, Semmler T, Pfeifer Y, Jerzak L. 2017. Relatedness of wildlife and livestockavian isolates of the nosocomial pathogen Acinetobacter baumannii tolineages spread in hospitals worldwide. Environ Microbiol 19:4349–4364.https://doi.org/10.1111/1462-2920.13931.

14. Allen PJ, Naghski J, Hoover SR. 1944. Decomposition of guayule resinsby microorganisms. J Bacteriol 47:559 –572. https://doi.org/10.1128/JB.47.6.559-572.1944.

15. Naghski J, White JW, Hoover SR. 1944. Aerobic decomposition ofguayule shrub (Parthenium argentatum Gray). J Bacteriol 48:159 –178.https://doi.org/10.1128/JB.48.2.159-178.1944.

16. Morales-Jiménez J, Zúñiga G, Villa-Tanaca L, Hernández-Rodríguez C.2009. Bacterial community and nitrogen fixation in the red turpentinebeetle, Dendroctonus valens LeConte (Coleoptera: Curculionidae: Sco-lytinae). Microb Ecol 58:879 – 891. https://doi.org/10.1007/s00248-009-9548-2.

17. Keeling CI, Yuen MM, Liao NY, Docking TR, Chan SK, Taylor GA, PalmquistDL, Jackman SD, Nguyen A, Li M, Henderson H, Janes JK, Zhao Y, PandohP, Moore R, Sperling FA, Huber DP, Birol I, Jones SJ, Bohlmann J. 2013. Draftgenome of the mountain pine beetle, Dendroctonus ponderosae Hopkins,a major forest pest. Genome Biol 14:R27. https://doi.org/10.1186/gb-2013-14-3-r27.

18. Kim PS, Shin NR, Kim JY, Yun JH, Hyun DW, Bae JW. 2014. Acinetobacterapis sp. nov., isolated from the intestinal tract of a honey bee, Apismellifera. J Microbiol 52:639 – 645. https://doi.org/10.1007/s12275-014-4078-0.

19. Vilanova C, Marín M, Baixeras J, Latorre A, Porcar M. 2014. Selectingmicrobial strains from pine tree resin: biotechnological applicationsfrom a terpene world. PLoS One 9:e100740. https://doi.org/10.1371/journal.pone.0100740.

20. Xu L, Lu M, Xu D, Chen L, Sun J. 2016. Sexual variation of bacterialmicrobiota of Dendroctonus valens guts and frass in relation to ver-benone production. J Insect Physiol 95:110 –117. https://doi.org/10.1016/j.jinsphys.2016.09.014.

21. Liu S, Wang Y, Ruan Z, Ma K, Wu B, Xu Y, Wang J, You Y, He M, Hu G.2017. Acinetobacter larvae sp. nov., isolated from the larval gut ofOmphisa fuscidentalis. Int J Syst Evol Microbiol 67:806 – 811. https://doi.org/10.1099/ijsem.0.001644.

22. Blankenchip CL, Michels DE, Braker HE, Goffredi SK. 2018. Diet breadthand exploitation of exotic plants shift the core microbiome of Cepha-loleia, a group of tropical herbivorous beetles. PeerJ 6:e4793. https://doi.org/10.7717/peerj.4793.

23. Nemec A, Krizova L, Maixnerova M, van der Reijden TJ, Deschaght P,Passet V, Vaneechoutte M, Brisse S, Dijkshoorn L. 2011. Genotypic andphenotypic characterization of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex with the proposal of Acinetobacterpittii sp. nov. (formerly Acinetobacter genomic species 3) and Acineto-bacter nosocomialis sp. nov. (formerly Acinetobacter genomic species13TU). Res Microbiol 162:393– 404. https://doi.org/10.1016/j.resmic.2011.02.006.

24. Vallenet D, Nordmann P, Barbe V, Poirel L, Mangenot S, Bataille E,Dossat C, Gas S, Kreimeyer A, Lenoble P, Oztas S, Poulain J, Segurens B,Robert C, Abergel C, Claverie J-M, Raoult D, Médigue C, Weissenbach J,Cruveiller S. 2008. Comparative analysis of Acinetobacters: three ge-nomes for three lifestyles. PLoS One 3:e1805. https://doi.org/10.1371/journal.pone.0001805.

25. Huang H, Dong Y, Yang ZL, Luo H, Zhang X, Gao F. 2014. Completesequence of pABTJ2, a plasmid from Acinetobacter baumannii MDR-TJ,carrying many phage-like elements. Genomics Proteomics Bioinformat-ics 12:172–177. https://doi.org/10.1016/j.gpb.2014.05.001.

26. Farrugia DN, Elbourne LD, Hassan KA, Eijkelkamp BA, Tetu SG, Brown MH,Shah BS, Peleg AY, Mabbutt BC, Paulsen IT. 2013. The complete genomeand phenome of a community-acquired Acinetobacter baumannii. PLoSOne 8:e58628. https://doi.org/10.1371/journal.pone.0058628.

27. Holt K, Kenyon JJ, Hamidian M, Schultz MB, Pickard DJ, Dougan G, HallR. 2016. Five decades of genome evolution in the globally distributed,extensively antibiotic-resistant Acinetobacter baumannii global clone 1.Microb Genom 2:e000052. https://doi.org/10.1099/mgen.0.000052.

28. Weingarten RA, Johnson RC, Conlan S, Ramsburg AM, Dekker JP, LauAF, Khil P, Odom RT, Deming C, Park M, Thomas PJ, Henderson DK,Palmore TN, Segre JA, Frank KM. 2018. Genomic analysis of hospitalplumbing reveals diverse reservoir of bacterial plasmids conferringcarbapenem resistance. mBio 9:e02011-17. https://doi.org/10.1128/mBio.02011-17.

29. Bartual SG, Seifert H, Hippler C, Luzon MAD, Wisplinghoff H, Rodríguez-

Valera F. 2005. Development of a multilocus sequence typing schemefor characterization of clinical isolates of Acinetobacter baumannii. J ClinMicrobiol 43:4382– 4390. https://doi.org/10.1128/JCM.43.9.4382-4390.2005.

30. Tomaschek F, Higgins PG, Stefanik D, Wisplinghoff H, Seifert H. 2016.Head-to-head comparison of two multi-locus sequence typing (MLST)schemes for characterization of Acinetobacter baumannii outbreak andsporadic isolates. PLoS One 11:e0153014. https://doi.org/10.1371/journal.pone.0153014.

31. Gaiarsa S, Batisti Biffignandi G, Esposito EP, Castelli M, Jolley KA, BrisseS, Sassera D, Zarrilli R. 2019. Comparative analysis of the two Acineto-bacter baumannii multilocus sequence typing (MLST) schemes. FrontMicrobiol 10:930. https://doi.org/10.3389/fmicb.2019.00930.

32. Yakkala H, Samantarrai D, Gribskov M, Siddavattam D. 2019. Compar-ative genome analysis reveals niche-specific genome expansion inAcinetobacter baumannii strains. PLoS One 14:e0218204. https://doi.org/10.1371/journal.pone.0218204.

33. Turton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL. 2006.Identification of Acinetobacter baumannii by detection of the blaOXA-51-like carbapenemase gene intrinsic to this species. J Clin Microbiol44:2974 –2976. https://doi.org/10.1128/JCM.01021-06.

34. Hamouda A, Evans BA, Towner KJ, Amyes SGB. 2010. Characterizationof epidemiologically unrelated Acinetobacter baumannii isolates fromfour continents by use of multilocus sequence typing, pulsed-field gelelectrophoresis, and sequence-based typing of blaOXA-51-like genes. JClin Microbiol 48:2476 –2483. https://doi.org/10.1128/JCM.02431-09.

35. Evans BA, Amyes SJ. 2014. OXA �-lactamases. Clin Microbiol Rev 27:241–263. https://doi.org/10.1128/CMR.00117-13.

36. Mussi MA, Limansky AS, Relling V, Ravasi P, Arakaki A, Actis LA, VialeAM. 2011. Horizontal gene transfer and assortative recombinationwithin the Acinetobacter baumannii clinical population provide geneticdiversity at the single carO gene, encoding a major outer membraneprotein channel. J Bacteriol 193:4736 – 4648. https://doi.org/10.1128/JB.01533-10.

37. Morán-Barrio J, Cameranesi MM, Relling V, Limansky AS, Brambilla L,Viale AM. 2017. The Acinetobacter outer membrane contains multiplespecific channels for carbapenem �-lactams as revealed by kineticcharacterization analyses of imipenem permeation into Acinetobacterbaylyi cells. Antimicrob Agents Chemother 61:e01737-16. https://doi.org/10.1128/AAC.01737-16.

38. Post V, White PA, Hall RM. 2010. Evolution of AbaR-type genomicresistance islands in multiply antibiotic-resistant Acinetobacter bauman-nii. J Antimicrob Chemother 65:1162–1170. https://doi.org/10.1093/jac/dkq095.

39. Nigro SJ, Hall RM. 2011. GIsul2, a genomic island carrying the sul2sulphonamide resistance gene and the small mobile element CR2found in the Enterobacter cloacae subspecies cloacae type strain ATCC13047 from 1890, Shigella flexneri ATCC 700930 from 1954 and Acin-etobacter baumannii ATCC 17978 from 1951. J Antimicrob Chemother66:2175–2176. https://doi.org/10.1093/jac/dkr230.

40. Loewen PC, Alsaadi Y, Fernando D, Kumar A. 2014. Genome sequenceof a tigecycline-resistant clinical isolate of Acinetobacter baumanniistrain AB031 obtained from a bloodstream infection. Genome Announc2:e01036-14. https://doi.org/10.1128/genomeA.01036-14.

41. Hamidian M, Hall RM. 2017. Acinetobacter baumannii ATCC 19606carries GIsul2 in a genomic island located in the chromosome. Antimi-crob Agents Chemother 61:e01991-16. https://doi.org/10.1128/AAC.01991-16.

42. Peleg AY, Jara S, Monga D, Eliopoulos GM, Moellering RC, Jr, MylonakisE. 2009. Galleria mellonella as a model system to study Acinetobacterbaumannii pathogenesis and therapeutics. Antimicrob Agents Che-mother 53:2605–2609. https://doi.org/10.1128/AAC.01533-08.

43. Vallejo JA, Beceiro A, Rumbo-Feal S, Rodríguez-Palero MJ, Russo TA,Bou G. 2015. Optimisation of the Caenorhabditis elegans model forstudying the pathogenesis of opportunistic Acinetobacter baumannii.Int J Antimicrob Agents 2015:S0924-8579(15)00241-1. https://doi.org/10.1016/j.ijantimicag.2015.05.021.

44. Barbe V, Vallenet D, Fonknechten N, Kreimeyer A, Oztas S, Labarre L,Cruveiller S, Robert C, Duprat S, Wincker P, Ornston LN, Weissenbach J,Marliere P, Cohen GN, Medigue C. 2004. Unique features revealed bythe genome sequence of Acinetobacter sp. ADP1, a versatile and nat-urally transformation competent bacterium. Nucleic Acids Res 32:5766 –5779. https://doi.org/10.1093/nar/gkh910.

45. Repizo GD, Gagné S, Foucault-Grunenwald M-L, Borges V, Charpentier

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 19

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

X, Limansky AS, Gomes JP, Viale AM, Salcedo SP. 2015. Differential roleof the T6SS in Acinetobacter baumannii virulence. PLoS One 10:e0138265. https://doi.org/10.1371/journal.pone.0138265.

46. Wilharm G, Piesker J, Laue M, Skiebe E. 2013. DNA uptake by thenosocomial pathogen Acinetobacter baumannii occurs during move-ment along wet surfaces. J Bacteriol 195:4146 – 4153. https://doi.org/10.1128/JB.00754-13.

47. Gebhardt MJ, Gallagher LA, Jacobson RK, Usacheva EA, Peterson LR,Zurawski DV, Shuman HA. 2015. Joint transcriptional control of viru-lence and resistance to antibiotic and environmental stress in Acineto-bacter baumannii. mBio 6:e01660-15. https://doi.org/10.1128/mBio.01660-15.

48. Karah N, Samuelsen Ø, Zarrilli R, Sahl JW, Wai SN, Uhlin BE. 2015.CRISPR-cas subtype I-Fb in Acinetobacter baumannii: evolution andutilization for strain subtyping. PLoS One 10:e0118205. https://doi.org/10.1371/journal.pone.0118205.

49. Costa AR, Monteiro R, Azeredo J. 2018. Genomic analysis of Acineto-bacter baumannii prophages reveals remarkable diversity and suggestsprofound impact on bacterial virulence and fitness. Sci Rep 8:15346.https://doi.org/10.1038/s41598-018-33800-5.

50. Wachino J, Jin W, Kimura K, Arakawa Y. 2019. Intercellular transfer ofchromosomal antimicrobial resistance genes between Acinetobacterbaumannii mediated by prophages. Antimicrob Agents Chemother63:e00334-19. https://doi.org/10.1128/AAC.00334-19.

51. Jeon J, Kim J, Yong D, Lee K, Chong Y. 2012. Complete genomesequence of the podoviral bacteriophage YMC/09/02/B1251 ABA BP,which causes the lysis of an OXA-23-producing carbapenem-resistantAcinetobacter baumannii isolate from a septic patient. J Virol 86:12437–12438. https://doi.org/10.1128/JVI.02132-12.

52. Turner D, Wand ME, Sutton JM, Centron D, Kropinski AM, Reynolds DM.2016. Genome sequence of vB_AbaS_TRS1, a viable prophage isolatedfrom Acinetobacter baumannii strain A118. Genome Announc4:e01051-16. https://doi.org/10.1128/genomeA.01051-16.

53. Wright MS, Haft DH, Harkins DM, Perez F, Hujer KM, Bajaksouzian S,Benard MF, Jacobs MR, Bonomo RA, Adams MD. 2014. New insightsinto dissemination and variation of the health care-associatedpathogen Acinetobacter baumannii from genomic analysis. mBio5:e00963-13. https://doi.org/10.1128/mBio.00963-13.

54. Varani AM, Siguier P, Gourbeyre E, Charneau V, Chandler M. 2011.ISsaga is an ensemble of web-based methods for high throughputidentification and semi-automatic annotation of insertion sequences inprokaryotic genomes. Genome Biol 12:R30. https://doi.org/10.1186/gb-2011-12-3-r30.

55. Osborn AM, Böltner D. 2002. When phage, plasmids, and transposonscollide: genomic islands, and conjugative- and mobilizable-transposonsas a mosaic continuum. Plasmid 48:202–212. https://doi.org/10.1016/s0147-619x(02)00117-8.

56. Repizo GD, Espariz M, Seravalle JL, Salcedo SP. 2019. Bioinformaticanalysis of the type VI secretion system and its potential toxins in theAcinetobacter genus. Front Microbiol 10:2519. https://doi.org/10.3389/fmicb.2019.02519.

57. Roussin M, Rabarioelina S, Cluzeau L, Cayron J, Lesterlin C, Salcedo SP,Bigot S. 2019. Identification of a contact-dependent growth inhibition(CDI) system that reduces biofilm formation and host cell adhesion ofAcinetobacter baumannii DSM30011 strain. Front Microbiol 10:2450.https://doi.org/10.3389/fmicb.2019.02450.

58. Wood CR, Ohneck EJ, Edelmann RE, Actis LA. 2018. A light-regulatedtype I pilus contributes to Acinetobacter baumannii biofilm, motility,and virulence functions. Infect Immun 86:e00442-18. https://doi.org/10.1128/IAI.00442-18.

59. Sahu PK, Iyer PS, Gaikwad MB, Talreja SC, Pardesi KR, Chopade BA. 2012.An MFS transporter-like ORF from MDR Acinetobacter baumannii AIIMS7 is associated with adherence and biofilm formation on biotic/abioticsurface. Int J Microbiol 2012:490647. https://doi.org/10.1155/2012/490647.

60. Clemmer KM, Bonomo RA, Rather PN. 2011. Genetic analysis of surfacemotility in Acinetobacter baumannii. Microbiology 157:2534 –2544.https://doi.org/10.1099/mic.0.049791-0.

61. Harding CM, Pulido MR, Di Venanzio G, Kinsella RL, Webb AI, Scott NE,Pachón J, Feldman MF. 2017. Pathogenic Acinetobacter species have afunctional type I secretion system and contact-dependent inhibitionsystems. J Biol Chem 292:9075–9087. https://doi.org/10.1074/jbc.M117.781575.

62. De Gregorio E, Del Franco M, Martinucci M, Roscetto E, Zarrilli R, Di

Nocera PP. 2015. Biofilm-associated proteins: news from Acinetobacter.BMC Genomics 16:933. https://doi.org/10.1186/s12864-015-2136-6.

63. Weidensdorfer M, Ishikawa M, Hori K, Linke D, Djahanschiri B, Iruegas R,Ebersberger I, Riedel-Christ S, Enders G, Leukert L, Kraiczy P, RothweilerF, Cinatl J, Berger J, Hipp K, Kempf VAJ, Göttig S. 2019. The Acineto-bacter trimeric autotransporter adhesin Ata controls key virulence traitsof Acinetobacter baumannii. Virulence 10:68 – 81. https://doi.org/10.1080/21505594.2018.1558693.

64. Eijkelkamp BA, Stroeher UH, Hassan KA, Paulsen IT, Brown MH. 2014.Comparative analysis of surface-exposed virulence factors of Acineto-bacter baumannii. BMC Genomics 15:1020. https://doi.org/10.1186/1471-2164-15-1020.

65. Scott NE, Kinsella RL, Edwards AV, Larsen MR, Dutta S, Saba J, Foster LJ,Feldman MF. 2014. Diversity within the O-linked protein glycosylationsystems of Acinetobacter species. Mol Cell Proteomics 13:2354 –2370.https://doi.org/10.1074/mcp.M114.038315.

66. Tilley D, Law R, Warren S, Samis JA, Kumar A. 2014. CpaA a novelprotease from Acinetobacter baumannii clinical isolates deregulatesblood coagulation. FEMS Microbiol Lett 356:53– 61. https://doi.org/10.1111/1574-6968.12496.

67. Waack U, Warnock M, Yee A, Huttinger Z, Smith S, Kumar A, Deroux A,Ginsburg D, Mobley HLT, Lawrence DA, Sandkvist M. 2018. CpaA is aglycan-specific adamalysin-like protease secreted by Acinetobacterbaumannii that inactivates coagulation factor XII. mBio 9:e01606-18.https://doi.org/10.1128/mBio.01606-18.

68. Harding CM, Kinsella RL, Palmer LD, Skaar EP, Feldman MF. 2016.Medically relevant Acinetobacter species require a type II secretionsystem and specific membrane-associated chaperones for the export ofmultiple substrates and full virulence. PLoS Pathog 12:e1005391.https://doi.org/10.1371/journal.ppat.1005391.

69. Harding CM, Hennon SW, Feldman MF. 2018. Uncovering the mecha-nisms of Acinetobacter baumannii virulence. Nat Rev Microbiol 16:91–102. https://doi.org/10.1038/nrmicro.2017.148.

70. Hu D, Liu B, Dijkshoorn L, Wang L, Reeves PR. 2013. Diversity in themajor polysaccharide antigen of Acinetobacter baumannii assessed byDNA sequencing, and development of a molecular serotyping scheme.PLoS One 8:e70329. https://doi.org/10.1371/journal.pone.0070329.

71. Kenyon JJ, Speciale I, Hall RM, De Castro C. 2016. Structure of repeatingunit of the capsular polysaccharide from Acinetobacter baumannii D78and assignment of the K4 gene cluster. Carbohydr Res 434:12–17.https://doi.org/10.1016/j.carres.2016.07.016.

72. Russo TA, Luke NR, Beanan JM, Olson R, Sauberan SL, MacDonald U,Schultz LW, Umland TC, Campagnari AA. 2010. The K1 capsular poly-saccharide of Acinetobacter baumannii strain 307-0294 is a major viru-lence factor. Infect Immun 78:3993– 4000. https://doi.org/10.1128/IAI.00366-10.

73. Kenyon JJ, Nigro SJ, Hall RM. 2014. Variation in the OC locus ofAcinetobacter baumannii genomes predicts extensive structural diver-sity in the lipooligosaccharide. PLoS One 9:e107833. https://doi.org/10.1371/journal.pone.0107833.

74. Farrugia DN, Elbourne LD, Mabbutt BC, Paulsen IT. 2015. A novel familyof integrases associated with prophages and genomic islands inte-grated within the tRNA-dihydrouridine synthase A (dusA) gene. NucleicAcids Res 43:4547– 4557. https://doi.org/10.1093/nar/gkv337.

75. Al-Jabri Z, Zamudio R, Horvath-Papp E, Ralph J, Al-Muharrami Z, Raja-kumar K, Oggioni M. 2018. Integrase-controlled excision of metal-resistance genomic islands in Acinetobacter baumannii. Genes (Basel)9:366. https://doi.org/10.3390/genes9070366.

76. Boyd E, Barkay T. 2012. The mercury resistance operon: from an originin a geothermal environment to an efficient detoxification machine.Front Microbiol 3:349. https://doi.org/10.3389/fmicb.2012.00349.

77. Di Capua C, Bortolotti A, Farías ME, Cortez N. 2011. UV-resistant Acin-etobacter sp. isolates from Andean wetlands display high catalaseactivity. FEMS Microbiol Lett 317:181–189. https://doi.org/10.1111/j.1574-6968.2011.02231.x.

78. Scholz A, Stahl J, de Berardinis V, Müller V, Averhoff B. 2016. Osmoticstress response in Acinetobacter baylyi: identification of a glycine-betaine biosynthesis pathway and regulation of osmoadaptive cholineuptake and glycine-betaine synthesis through a choline-responsive BetIrepressor. Environ Microbiol Rep 8:316 –322. https://doi.org/10.1111/1758-2229.12382.

79. Franceschi VR, Krokene P, Christiansen E, Krekling T. 2005. Anatomicaland chemical defenses of conifer bark against bark beetles and other

Repizo et al.

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 20

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from

pests. New Phytol 167:353–375. https://doi.org/10.1111/j.1469-8137.2005.01436.x.

80. Graça J. 2015. Suberin: the biopolyester at the frontier of plants. FrontChem 3:62. https://doi.org/10.3389/fchem.2015.00062.

81. Widhalm JR, Dudareva N. 2015. A familiar ring to it: biosynthesis ofplant benzoic acids. Mol Plant 8:83–97. https://doi.org/10.1016/j.molp.2014.12.001.

82. Cerqueira GM, Kostoulias X, Khoo C, Aibinu I, Qu Y, Traven A, Peleg AY.2014. A global virulence regulator in Acinetobacter baumannii and itscontrol of the phenylacetic acid catabolic pathway. J Infect Dis 210:46 –55. https://doi.org/10.1093/infdis/jiu024.

83. Bhuiyan MS, Ellett F, Murray GL, Kostoulias X, Cerqueira GM, Schulze KE,Mahamad Maifiah MH, Li J, Creek DJ, Lieschke GJ, Peleg AY. 2016.Acinetobacter baumannii phenylacetic acid metabolism influences in-fection outcome through a direct effect on neutrophil chemotaxis. ProcNatl Acad Sci U S A 113:9599 –9604. https://doi.org/10.1073/pnas.1523116113.

84. Somers E, Ptacek D, Gysegom P, Srinivasan M, Vanderleyden J. 2005.Azospirillum brasilense produces the auxin-like phenylacetic acid byusing the key enzyme for indole-3-acetic acid biosynthesis. Appl Envi-ron Microbiol 71:1803–1810. https://doi.org/10.1128/AEM.71.4.1803-1810.2005.

85. Förster-Fromme K, Höschle B, Mack C, Bott M, Armbruster W, Jen-drossek D. 2006. Identification of genes and proteins necessary forcatabolism of acyclic terpenes and leucine/isovalerate in Pseudomonasaeruginosa. Appl Environ Microbiol 72:4819 – 4828. https://doi.org/10.1128/AEM.00853-06.

86. Schneider BL, Kiupakis AK, Reitzer LJ. 1998. Arginine catabolism and thearginine succinyltransferase pathway in Escherichia coli. J Bacteriol180:4278 – 4286. https://doi.org/10.1128/JB.180.16.4278-4286.1998.

87. Vander Wauven C, Jann A, Haas D, Leisinger T, Stalon V. 1988. N2-succinylornithine in ornithine catabolism of Pseudomonas aeruginosa.Arch Microbiol 150:400 – 404. https://doi.org/10.1007/BF00408314.

88. Jones CL, Clancy M, Honnold C, Singh S, Snesrud E, Onmus-Leone F,McGann P, Ong AC, Kwak Y, Waterman P, Zurawski DV, Clifford RJ,Lesho E. 2015. Fatal outbreak of an emerging clone of extensivelydrug-resistant Acinetobacter baumannii with enhanced virulence. ClinInfect Dis 61:145–154. https://doi.org/10.1093/cid/civ225.

89. Kim J, Lee J-Y, Lee H, Choi JY, Kim DH, Wi YM, Peck KR, Ko KS. 2017.Microbiological features and clinical impact of the type VI secretion system(T6SS) in Acinetobacter baumannii isolates causing bacteremia. Virulence8:1378–1389. https://doi.org/10.1080/21505594.2017.1323164.

90. Snitkin ES, Zelazny AM, Montero CI, Stock F, Mijares L, NISC Compara-tive Sequence Program, Murray PR, Segre JA. 2011. Genome-widerecombination drives diversification of epidemic strains of Acinetobac-ter baumannii. Proc Natl Acad Sci U S A 108:13758 –13763. https://doi.org/10.1073/pnas.1104404108.

91. Repizo GD. 2017. Prevalence of Acinetobacter baumannii strains expressingthe Type 6 secretion system in patients with bacteremia. Virulence8:1099–1101. https://doi.org/10.1080/21505594.2017.1346768.

92. Waterfield NR, Wren BW, French-Constant RH. 2004. Invertebrates as asource of emerging human pathogens. Nat Rev Microbiol 2:833– 841.https://doi.org/10.1038/nrmicro1008.

93. Latorre A, Manzano-Marín A. 2017. Dissecting genome reduction andtrait loss in insect endosymbionts. Ann N Y Acad Sci 1389:52–75.https://doi.org/10.1111/nyas.13222.

94. Sartorio MG, Repizo GD, Cortez N. 2020. Catalases of the polyextremo-phylic Andean isolate Acinetobacter sp. Ver 3 confer adaptive responseto H2O2 and UV radiation. FEBS J https://doi.org/10.1111/febs.15244.

95. Qiu H, KuoLee R, Harris G, Van Rooijen N, Patel GB, Chen W. 2012. Roleof macrophages in early host resistance to respiratory Acinetobacterbaumannii infection. PLoS One 7:e40019. https://doi.org/10.1371/journal.pone.0040019.

96. Sato Y, Unno Y, Miyazaki C, Ubagai T, Ono Y. 2019. Multidrug-resistantAcinetobacter baumannii resists reactive oxygen species and survivesin macrophages. Sci Rep 9:17462. https://doi.org/10.1038/s41598-019-53846-3.

97. Mussi MA, Relling VM, Limansky AS, Viale AM. 2007. CarO, an Acineto-

bacter baumannii outer membrane protein involved in carbapenemresistance, is essential for l-ornithine uptake. FEBS Lett 581:5573–5578.https://doi.org/10.1016/j.febslet.2007.10.063.

98. Holloway BW. 1969. Genetics of Pseudomonas. Bacteriol Rev 33:419 – 443. https://doi.org/10.1128/MMBR.33.3.419-443.1969.

99. Chin C-S, Peluso P, Sedlazeck FJ, Nattestad M, Concepcion GT, Clum A,Dunn C, O’Malley R, Figueroa-Balderas R, Morales-Cruz A, Cramer GR,Delledonne M, Luo C, Ecker JR, Cantu D, Rank DR, Schatz MC. 2016.Phased diploid genome assembly with single-molecule real-time se-quencing. Nat Methods 13:1050 –1054. https://doi.org/10.1038/nmeth.4035.

100. Nurk S, Bankevich A, Antipov D, Gurevich AA, Korobeynikov A, LapidusA, Prjibelski AD, Pyshkin A, Sirotkin A, Sirotkin Y, Stepanauskas R,Clingenpeel SR, Woyke T, McLean JS, Lasken R, Tesler G, Alekseyev MA,Pevzner PA. 2013. Assembling single-cell genomes and mini-metagenomes from chimeric MDA products. J Comput Biol 20:714 –737. https://doi.org/10.1089/cmb.2013.0084.

101. Gao F, Zhang C-T. 2008. Ori-Finder: a web-based system for findingoriCs in unannotated bacterial genomes. BMC Bioinformatics 9:79.https://doi.org/10.1186/1471-2105-9-79.

102. Siguier P, Perochon J, Lestrade L, Mahillon J, Chandler M. 2006. ISfinder:the reference centre for bacterial insertion sequences. Nucleic AcidsRes 34:D32–D36. https://doi.org/10.1093/nar/gkj014.

103. Zhou Y, Liang Y, Lynch KH, Dennis JJ, Wishart DS. 2011. PHAST: a fastphage search tool. Nucleic Acids Res 39:W347–W352. https://doi.org/10.1093/nar/gkr485.

104. Arndt D, Grant J, Marcu A, Sajed T, Pon A, Liang Y, Wishart DS. 2016.PHASTER: a better, faster version of the PHAST phage search tool.Nucleic Acids Res 44:W16 –W21. https://doi.org/10.1093/nar/gkw387.

105. Zankari E, Hasman H, Cosentino S, Vestergaard M, Rasmussen S, LundO, Aarestrup FM, Larsen MV. 2012. Identification of acquired antimicro-bial resistance genes. J Antimicrob Chemother 67:2640 –2644. https://doi.org/10.1093/jac/dks261.

106. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W,Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation ofprotein database search programs. Nucleic Acids Res 25:3389 –3402.https://doi.org/10.1093/nar/25.17.3389.

107. Zhao Y, Wu J, Yang J, Sun S, Xiao J, Yu J. 2012. PGAP: pan-genomesanalysis pipeline. Bioinformatics 28:416 – 418. https://doi.org/10.1093/bioinformatics/btr655.

108. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, Mc-William H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD,Gibson TJ, Higgins DG. 2007. ClustalW and ClustalX version 2. Bioinfor-matics 23:2947–2948. https://doi.org/10.1093/bioinformatics/btm404.

109. Talavera G, Castresana J. 2007. Improvement of phylogenies afterremoving divergent and ambiguously aligned blocks from proteinsequence alignments. Syst Biol 56:564 –577. https://doi.org/10.1080/10635150701472164.

110. Borowiec ML. 2016. AMAS: a fast tool for alignment manipulation andcomputing of summary statistics. PeerJ 4:e1660. https://doi.org/10.7717/peerj.1660.

111. Espariz M, Zuljan FA, Esteban L, Magni C. 2016. Taxonomic identityresolution of highly phylogenetically related strains and selection ofphylogenetic markers by using genome-scale methods: the Bacilluspumilus group case. PLoS One 11:e0163098. https://doi.org/10.1371/journal.pone.0163098.

112. Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysisand post-analysis of large phylogenies. Bioinformatics 30:1312–1313.https://doi.org/10.1093/bioinformatics/btu033.

113. Jolley KA, Maiden MC. 2010. BIGSdb: scalable analysis of bacterialgenome variation at the population level. BMC Bioinformatics 11:595.https://doi.org/10.1186/1471-2105-11-595.

114. Clinical and Laboratory Standards Institute. 2016. Performance stan-dards for antimicrobial susceptibility testing. Document M100S, 26thed. Clinical and Laboratory Standards Institute, Wayne, PA.

115. Stiernagle T. 11 February 2006. Maintenance of C. elegans. In The C.elegans Research Community, WormBook (ed), WormBook.

A. baumannii NCIMB8209 Genomic Analysis

July/August 2020 Volume 5 Issue 4 e00404-20 msphere.asm.org 21

on April 19, 2021 by guest

http://msphere.asm

.org/D

ownloaded from