AC Vitari et al. Nature 000 , 1-4 (2011) doi:10.1038/nature10005

1
AC Vitari et al. Nature 000, 1-4 (2011) doi:10.1038/nature10005 COP1 deficiency in prostatic epithelium causes hyperplasia, early MPIN, and enhances the effects of PTEN loss.

TAGS:

description

COP1 deficiency in prostatic epithelium causes hyperplasia, early MPIN, and enhances the effects of PTEN loss. AC Vitari et al. Nature 000 , 1-4 (2011) doi:10.1038/nature10005. - PowerPoint PPT Presentation

Transcript of AC Vitari et al. Nature 000 , 1-4 (2011) doi:10.1038/nature10005

Page 1: AC Vitari et al. Nature 000 , 1-4 (2011) doi:10.1038/nature10005

AC Vitari et al. Nature 000, 1-4 (2011) doi:10.1038/nature10005

COP1 deficiency in prostatic epithelium causes hyperplasia, early MPIN, and enhances the effects of PTEN loss.

GI Motility online (May 2006) | doi:10.1038/gimo46

GI Motility online (May 2006) | doi:10.1038/gimo46

doi:10.1038/nature12886 Neanderthal from the Altai ...

doi:10.1038/nature12886 Neanderthal from the Altai ...

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The ...

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The ...

GI Motility online (May 2006) | doi:10.1038/gimo31

GI Motility online (May 2006) | doi:10.1038/gimo31

GI Motility online (May 2006) | doi:10.1038/gimo6

GI Motility online (May 2006) | doi:10.1038/gimo6

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

GI Motility online (May 2006) | doi:10.1038/gimo12

GI Motility online (May 2006) | doi:10.1038/gimo12

1 November 2007 doi:10.1038/nature06221 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Claudia Virginia Vitari | Le Città Invisibili

Claudia Virginia Vitari | Le Città Invisibili

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS