Abstracts of Papers Presented at the 31 Annual Conference ...

J Mycol Pl Pathol, Vol. 39, No.3, 2009 542

Abstracts of Papers Presented at the 31stAnnual Conference and Symposium, October 23-25, 2009, Department of Botany, University of North Bengal, India

Dr. N. Prasad Memorial Lecture Challenges, Changes and Choices Before Trichoderma Based Biopesticides

A. N. Mukhopadhyay

Sangini, 151 Akanksha, Udyan II, Raibareilly Road,Lucknow-226025 Uttar Pradesh, India - During last decade, species of Trichoderma have emerged as most powerful bioprotectants for management of a wide variety of plant disease. This is truer in the context of the fact that there is considerable public pressure and pressure from environmental scientists to reduce emphasis on chemical protectants and use bioprotectants. The genus Trichoderma by virtue of its broad spectrum action against a number of plant diseases caused by fungi, bacteria, viruses and even nematodes has occupied the top position among the bioprotectants developed for plant disease management. Trichoderma based biopesticides have been proved successful in a large number of field, vegetable, fruit and flowering crops for the management of diseases. Because of its eco-friendly nature and low cost when compared with chemical protectants, the technology has been very widely adapted all over the world. The literature accumulated on the subject during last decade is quite vast. Trichoderma strains exert biocontrol against phytopathogens either indirectly by competing for nutrients and space, modifying the environmental conditions, or promoting plant growth and plant defensive mechanisms and antibiosis or directly by mechanisms such as mycoparasitism. These indirect and direct mechanisms may act coordinately and their importance in the biocontrol process depends on the Trichoderma strain, the antagonized fungus, the crop plant, and the environmental conditions, including nutrient availability, pH, temperature, moisture and iron concentrations. Trichoderma species are plant symbiotic opportunistic virulent organisms, able to colonize plant root by mechanisms similar to those of mycorrhizal fungi. Root colonization by Trichoderma species frequently enhances root growth and development, crop productivity, resistance to abioltic stress and the uptake and use of nutrients. Root-fungus associations also stimulate plant defensive mechanisms. Trichoderma added directly to rhizosphere or as seed treatment protects plants against numerous classes of pathogens, e.g. those that produce aerial infections, including fungal, bacterial, nematodes and viral pathogens. This reveals induction of resistance mechanisms similar to the hypersensitive response (HR), systemic acquired

resistance (SAR) and induced systemic resistance (ISR) in plants. The low cost technology has opened up a new vista for plant disease management and is likely to be a boon for seed industries who would like to provide protection to many seed and soil-borne diseases. While dealing with a fungus like Trichoderma, we need to critically look at the following aspects which have been hindering its successful applications as bioprotectants. The greatest limiting factor is its very short shelf life (4-6 months) under tropical and subtropical conditions. There is a strong need to increase the shelf life to make Trichoderma application practically feasible. Sensitiveness of Trichoderma to pH 7 and above and higher temperatures are also important limiting factors. Modern biotechnological tools may be applied to get rid of these factors limiting its application. Poor quality and substandard Trichoderma preparations that are marketed by some companies cause tremendous setback. Efforts must be on to work on the above issues by interdisciplinary approach involving plant pathologists, biotechnologists, physiologists, biochemists and also through strict control by government agencies. Metabolomics of Tea (Camellia sinensis (L)) Interactions With Pests and Pathogens

Luis. A.J. Mur, A. Lloyd, J. Heald and B.N. Chakraborty1

Aberystwyth University, IBERS, UK, Email: [email protected];1Immuno-Phytopathology Laboratory, Department of Botany,University of North Bengal, India email: [email protected] - Metabolomics is a functional genomic technique which assesses the metabolite constituents of a cell, tissue or organism. Measurements of cellular metabolites, whether qualitative or quantitative, reveal the biochemical status of an organism and in turn can be used to monitor and assess gene function. The Mur laboratory has pioneered the application of metabolomics to plant-pathogen interactions and uses mass spectrometry (MS) to profile metabolites. We describe collaborative projects where metabolomics was used to assess changes in tea during the early stages of tea blister disease (causal agent, Exobasidium vexans) or attack from the tea mosquito, Helopeltis theivora. Blister blight preferentially attacks the most economically important young leaves and is by far the most serious disease of cultivated tea. The tea mosquito, Helopeltis theivora is one of the most destructive pests of tea, causing up to 25% of crop losses. Nymphs and adults suck cell sap from mature


buds young leaves, and tender stems, causing characteristic necrotic lesions. Resistance to both forms of pathogen attack is very poorly defined. The changes in cell wall biochemistry chemistry or secondary metabolite changes could increase resistance to blister blight. Equally, with insect-plant insect interactions, insect herbivory can be suppressed through the production of oviposition deterrents, anti-feedants and directly toxic products. Given the importance of chemical changes during these forms of biotic stress, metabolomics could define the pathogen mediated reprogramming of host metabolism (which could be suppressed to increase resistance and/ or maintain crop quality); and identify sources of resistance within tea germplasm which could be boosted to increase effectiveness, mostly likely through improved or novel agricultural practices. In tea blister project metabolite changes were described during key stages in disease development. These were initial symptoms where the disease exists as reddish spots to stages where these develop into blisters that rupture to release spores at the completion of the life cycle. A very important aspect of this project was that samples were obtained from actual plantation crops so that the derived data were agriculturally relevant. Ten pooled samples were taken from around different points in the Margaret Hope’s Tea Garden plantation in North Bengal, India. MS measured the mass-to-charge (m/z) ratio of low molecular weight charged particles. In the analysis of the tea samples, electrospray ionization (ESI) and multivariate statistical methods were used to identify key metabolite differences in the spectra. This showed phenolic and polyphenolic changes occur during disease development. In addition, changes in salicylate and jasmonic acid defence pathways were detected. With the Helopeltis theivora project, twelve genotypes were examined representing North Indian Assam (TOCKLAI) and South Indian (UPASI) tea varieties at 4 stages of insect damage. We have discriminated chemical changes associated with each stage and also distinguished between the responses of in both healthy and infested TOCKLAI and UPASI varieties. Interestingly by the latter stages of insect attack, the chemical changes seen with each variety were chemically indistinguishable. We have demonstrated the value of metabolomics not only to describe biochemical changes in tea during biotic stress but to suggest possible sources of resistance.

Roles of Quorum Sensing Signal and RNA Regulator in Development of Bacterial Soft-Rot Disease

A. K. Chatterjee, Y. Cui and A. Chatterjee

Division of Plant Sciences, University of Missouri, Columbia, Missouri 65211 USA Email:

[email protected] - Modulation of gene expression in response to population (cell) density has been an important hallmark of bacterial behavior with significant ramifications in ecosystem compositions and industrial applications. Despite a widespread recognition of this phenomenon, the underlying physiological and molecular processes remained an enigma till the discovery of signals that trigger gene expression in response to cell density. Noteworthy among such signals, are analogs of N-acylhomoserine lactone, diffusible metabolites of bacterial origin. These molecules are now known to control diverse phenotypes including bacteria-microbe and bacteria-plant/animal interactions, bioluminescence, production of secreted proteins, extracellular polysaccharides, antibiotics, biofilm formation, pigments and other secondary metabolites. Of an array of AHL analogs, N-(3-oxohexanoyl)-L-homoserine lactone (OHHL) is the typical member produced by Vibrio fischeri and many other bacteria. Among plant pathogenic bacterial groups, AHLs are produced by Agrobacterium, Erwinia, Pantoae, Pseudomonas and Ralstonia. AHL synthases, encoded by luxI homologs, synthesize AHLs. In most bacteria, there are cognate regulatory factors, usually transcriptional activators called the LuxR homologs. LuxR homologs bind AHL, and this binding modulates their regulatory functions. During susceptible interactions culminating in disease development a series of sequential events most likely occur, i.e., entry of the pathogen, colonization, multiplication and translocation and production of toxic factors responsible for altered physiology of plant cells and plant cell death. The question is what triggers expression of genes for the so called toxic (virulence) factors once the pathogenic bacterium has reached a desired population size? We have selected Erwinia carotovora ssp carotovora (Ecc), the soft-rotting bacterium, as a model system to analyze this behavior. The following attributes of this system made it attractive for our studies. It produces symptoms in a variety of plant products and causes extensive post-harvest damage. Factors responsible for symptom production have been characterized. Regulation of their production has been elucidated. Remarkably, post-transcriptional regulators play a central regulatory role in exoprotein production, motility and virulence. This post-transcriptional regulation comprises two major components: RsmA, an RNA binding protein generally is responsible for translational repression and RNA decay, and it functions as a global negative regulator. rsmB, on the other hand, specifies an untranslatable RNA, that binds RsmA to neutralizes its negative effect and thus it functions as a positive regulator. Rsm is the regulator of secondary metabolism. AHL controls production of virulence factors, namely extracellular enzymes and proteins and bacterial motility. Having fortified with this knowledge, we focused on the


workings of the signaling system in Ecc. An important lead to this study was provided by the effects of AHL deficiency on regulators known to control exoprotein production and motility. In the absence of AHL, we noted high levels of rsmA expression, which contrasted with much reduced levels of positive regulators known to activate exoprotein production and motility. Subsequent studies with an RsmA- and AHL- double mutant disclosed that in RsmA- mutant AHL deficiency is of no consequence. On the other hand, expression of bacterial traits was inhibited in AHL- RsmA+ bacteria. It was then apparent that the primary target of AHL is rsmA. The next question was: how this regulation occurs? We should recall that AHL is a small molecule and by itself it can not affect transcription. So we postulated that there are receptors of AHL that control the transcription of rsmA. Indeed, our subsequent studies revealed the presence of two AHL receptors, designated ExpR1 and ExpR2. Both were predicted to function as DNA-binding proteins. We showed that these proteins bind the rsmA promoter in the absence of AHL; this binding is abolished in the presence of AHL. Genetic evidence demonstrated that ExpR-rsmA binding activates transcription. Based upon these observations we propose the following model. Under conditions of low cell density, AHL levels are limiting which favors RsmA production. RsmA action ensures low levels of various positive regulators and inhibits the expression of genes for exoproteins and their secretion as well as flagellum formation. As the population density increases so does the level of AHL. The elevated level of intracellular AHL pool promotes their binding to receptors and inhibits their transcriptional activity. The net result of this interaction is the reduced level of RsmA protein production. The system is then primed to initiate and sustain high levels of expression of genes for positive regulators of exoproteins and motility in response to plant signals and environmental circumstances. Present Scenario of Microbial Diversity of Coal Spoils and Prospect for Reclamation of Coal Field Areas A. K. Roy Professor of Botany & Head, P.G. Dept. of Biotechnology T.M. Bhagalpur University, Bhagalpur-812007. E-mail: [email protected] - Microorganisms represent the richest source of biological diversity inhabiting all types of ecosystem either of tropical, temperate or extreme. Of which rhizosphere and soil microbes like bacteria, fungi, mycorrhizae, yeasts, and actinomycetes have a great role in plant health as well as disease management. The

health of soil is also determined by microbial flora due to their immense potential for nutrient recycling, mobilization and plant growth promotion by the release of growth hormone and siderophore. For the development of greenery or agriculture on sustainable basis it is essential to evaluate the role of microbes on plant growth without affecting the bioresources, environmental quality and economic benefits. On account of variable microbial diversity and their efficacy, scientists pursuing different disciplines are always in search of beneficial microbes from various sources and also in modifying them genetically to meet with the specific requirement for plant health. In view of these facts the present investigation has been aimed to isolate microbes from different coal mine areas viz., Lalmatia (ECL), Singrauli (NCL), Samleshwari (MCL) and evaluate their role on plant health. Data for N2 fixing bacteria, phosphate solubilization fungi and bacteria, VAM fungi, siderophore producing bacteria were generated out of different aged OBDs of coal mine areas to develop potential biofertilizer package for plant growth promotion under reclamation program of different coal field areas. Intellectual Property Rights in Agriculture B. L. Jalali CCS-Haryana Agricultural University, Hisar, Haryana, Presently, 601 Neelkanth Apartments, Sector 21-C, Part – III, Faridabad 121 001, Haryana. e-mail: [email protected] -Intellectual Property Rights (IPR) is recognized as an asset and means of harvesting and rewarding the fruit of agricultural research and development. Recognition of IPR provides a viable mechanism of protecting and rewarding innovators. This acts as a catalyst in technological and economic development. The essence of IPR regulation by law is to balance private and public interests. The recognition of agriculture as a rule-bound enterprise of investment became quite obvious with its inclusion in the inter-governmental negotiations for the General Agreement on Tariffs and Trade (GATT) for the first time in the Uruguay Round (1986-1994). This round led to the establishment of the World Trade Organization (WTO) in January 1995. Now, the WTO has at least half a dozen inter-governmental agreements that directly affect agriculture. These include: Agreements on Agriculture (AOA), Applications of Sanitary and Phytosanitary (SPS) Measures; Technical Barriers to Trade (TBT); Anti-Dumping; and Trade Related Aspects of Intellectual Property Rights (TRIPS). Conceptual understanding of the implications and applications of these agreements, particularly the TRIPS, has become more important and pivotal than


ever before at every stage of planning, research, up-scaling and commercialization of agricultural technologies. In days to come, when applications of various forms of IPR in different areas of agriculture is put to practice, we may face serious problems unless remedial measures are taken well in time, awareness is brought out and also due emphasis is given on IPR literacy, higher education and capacity building in the country. Pragmatic implementation of IPR related legislations in place and those in the pipeline are expected to have tangible impact on the course of agricultural research and development in the country. It is, therefore, important to identify and develop various national policy options to address the emerging areas of IPR in agriculture including the access to various protected technologies to the Indian farmers, entrepreneurs and other stake-holders. With the new emerging paradigm, the agricultural situation in the years ahead is likely to lead to following shifts. Demand for food grains will grow by more than 2 per cent per year till 2020. Driven by higher growth in income, domestic demand for fruits, vegetables, edible oils, livestock and dairy products and processed food will increase. Opportunities in the world market will push demand for some products on a higher scale. Apart from traditional agricultural exports, tropical fruits and flowers, processed agricultural and livestock and marine products and selected food grains will have high export potential. Availability of agricultural land and water for irrigation will come under strain. Energy, water. labour and input costs will reduce the profit margin. Commercialization of agriculture in response to domestic and world market changes will trigger drastic shifts in cropping pattern and resource use. New institutional arrangements will evolve; several areas of production will get redefined; multinational and national companies will play an efficient role in the marketing of inputs, agri-products and trade. With this emerging scenario, it is important that developed economies to derive benefit from an organized IPR system due to their inherent capabilities to capitalize on such opportunities. Realization of the gains, principles of equity, and striking a level playing field are the real challenges. In keeping with the spirit of the inter-governmental agreements, applications of IPR and also maintenance of equity and social justice must be effectively addressed at the national level. Competitiveness coupled with increased production should be the target for various agricultural commodities having export prospects. These include high value commercial crops, animal breeds, spices, medicinal and aromatic plants, and products like milk, meat, fish, leather and wool. Reduction in the cost of production at small farms should also be aimed at so that Indian exports become more competitive. Market driven quality consciousness should be applied to lay

greater Research & Development emphasis and efforts to produce quality products that may fetch increased monetary returns per unit area, input and time. Broadly, protection of all forms of IPR may be relevant in agriculture, but its application has been limited to the relevant domestic Acts in vogue. Hybrids in plants and animals may be protected de facto by not disclosing the parents, while protection for plant varieties may be availed by a sui generis system. The provision for Plant Variety Protection (PVP) made under the TRIPs, allows countries to provide such protection either through patent, or an effective sui generis PVP system or any combination of the two. Patents in India are so far available to new processes but not to all products per se. In days to come, IPR is bound to dominate the agricultural scenario irrespective of whether the technology in question is conventional or modern as biotechnology or information technology. Time has come to fix high priority to generation, evaluation, protection and commercial utilization of tangible products of intellectual property in agriculture. Recognizing the need to capitalize on our national resources and capabilities to attain and sustain IPR advantages locally, regionally and globally with timely action, the area of IPR in agriculture need to be addressed in conjunction with traditional rights and indigenous knowledge. Rights to equitable sharing of benefits must be appropriately balanced with the rights to IPR protection wherever applicable. Recognizing that the issues of IP protection by third parties based on our indigenous traditional knowledge (ITK) are sensitive, a high priority and liberal financial support should be made to the projects that may lead to development and strengthening of traditional knowledge and resource databases to discourage such protection by third parties. Voluntary or concessional legal advice may be provided in partnership deals of strategic importance to accelerate competitiveness of Indian agriculture and to attend to the problems of uneven playing fields among the resource-rich and resource-poor partners. Besides outsourcing for legal advice on case-to-case basis to address the techno-legal areas of IPR protection in agriculture, establishment of IPR Cells in NARS set up should gain primacy, in order to strengthen their institutional mechanism for IP protection. Molecular Approaches in Diagnosis of Plant Pathogens P. K. Chakrabarty Central Institute for Cotton Research, Shankar Nagar, Nagpur 440010 Email: [email protected] - The first and the foremost important step in management of a plant disease is to correctly identify the organisms that


cause it. The early and accurate diagnosis of plant disease is a crucial component of any crop-management system. Plant disease can be managed most effectively if control measures are introduced at an early stage of disease development. Biological techniques for disease diagnosis and pathogen detection are usually highly accurate but slow, often requiring skilled taxonomists to reliably identify the pathogens and not amenable to large scale application. Fastidious microorganisms, which do not grow on artificial media, are very difficult to identify and detect by conventional methods. Delays are frustrating when quick diagnosis is needed so that appropriate disease control measures may be taken to prevent plant damage, especially when high value cash crops, turf grass or ornamentals are at stake. Reliance on symptoms is often not adequate in this regard, since the disease may be well underway when symptoms first appear, and symptom expression can be highly variable. Closely related organisms, say races or biotypes of an organism, are difficult to discriminate on the basis of morphological characters. Recent advances in molecular biology and biotechnology are being applied in development of rapid, specific and sensitive tools for detection of pathogens. The greatest efforts have been on the development of diagnostics based on serological and nucleic acid technologies. Serological methods based on development and use of antibodies that recognize specific antigens associated with given plant pathogen has become very common. Nucleic acid based methods using probes and PCR have increasingly been used in recent years to develop diagnostic assays for plant pathogens. Real time PCR technologies and DNA micro-array technology are being developed to detect and quantity commercially plant pathogen. These methods are sensitive, rapid and precise and allow quick diagnosis of pathogens. We have employed these techniques to develop efficient diagnostic protocols for detection of viral, bacterial and fungal pathogens of crop plants, especially those infecting cotton. For serological detection of cotton leaf curl virus (CLCuV), coat protein gene was cloned in expression plasmid. Recombinant coat-protein was expressed in E. coli and was used as immunogen to raise virus specific antibody. Using the same, an efficient twig-imprint blot protocol platform was standardized for in situ detection of CLCuV in cotton. We have developed PCR based methods for detection and differentiation of bacteria associated with bacterial blight of cotton and guar caused by strains of Xanthomonas axonopodis pv. malvacearum and X. cyamopsidis, respectively. Strains of X. cyamopsidis were detected using a SCAR marker-based specific PCR primer, while pathogenicity gene based specific primer was developed for detection of strains of X. a. pv. malvacearum. Patent is filed for a ready-to-use PCR kit developed for detection of the latter. RFLP markers were developed for identification

of the most virulent race 18 of X. a. pv malvacearum and for characterization of aggressive biotypes within this pathogen. The ribosomal DNA (rDNA) possesses characteristics that are suitable for the detection of pathogens at genus and species level. These rDNA are highly stable and exhibit a mosaic of conserved and diverse regions within the genome. Internal transcribed spacer (ITS) regions have been successfully used to generate specific primers capable of differentiating closely related fungal species. We sequenced rDNA of number of fungi and exploited diversity within the ITS regions to develop species specific PCR primers. Using these primers we standardized PCR based protocols for identification of major pathogens of cotton including strains of Rhizoctonia solani, R. bataticola, Alternaria macrospora, Ramularia areola, Myrothecium roridum infecting cotton and also the strains of A. alternata. A. dianthicola, A. longipes, A. helianthi and Dreschlera australiensis associated with leaf spot and blight disease of sunflower. The molecular diagnostic tools and protocols developed in our lab will be presented. Apple Diseases and Their Management V. S. Thakur Dr Y.S. Parmar University of Horticulture and Forestry, Regional Horticultural Research Station, Mashobra, Shimla (HP) Email: [email protected] - With the increase in area under apple cultivation along with growing of certain susceptible varieties, the numbers of new diseases have appeared and the already existing diseases have become more destructive. Over 93 diseases have been recorded to affect the apple crop resulting in a total loss of about 30-40 per cent. Technologies have been evolved to minimize the onslaught of diseases through integrated fungicidal spray programs. The wide spread epidemic nature of the leaf and fruit spotting fungi varying from region to region is becoming serious and economically important. Studied have shown that the outbreak of these pathogens is due to changes in the winter weather conditions where under hot winters, late or less snow fall in the temperate regions encourages leaf and fruit spotting fungi and the summer diseases incidence. In orchards, the outbreaks of summer diseases affect the crop directly in terms of productivity, quality and economical returns. A total loss of about 24-28 per cent has been recorded annually from the summer diseases in last 10 years in all the apple-growing states. The new emerging leaf and fruit spotting diseases like apple scab, Marssonina apple blotch, powdery mildew, Alternaria spot, blotch and blight, Phyllosticta blotch and spot, Phytophthora leaf blight and fruit rot, Coniothyrium leaf spot, Monilia leaf spot and blight and Mycosphaerella leaf spot perpetuate in the orchards. These leaf and fruit


spotting fungi are causing a complex, which make identification of disease and its management difficult to the farmers. Soil-borne diseases like white root rot, collar rot, crown rot and seedling blight also cause heavy annual loss by dry and dying of trees. Its infection perpetuates and spread in soil. The perennial complex of cankers and die-back are increasing due to dry and hot autumn and winter months. Under field conditions, pathogen ecology, morphology, physiology, epidemiology as well as molecular behaviour are diverse and varied in the regions. Therefore, they need different management practices including application of fungicides. Control of apple diseases is still with chemical fungicides, which are farmers favorites and risk less to crop. Even though use of pesticides is decried, they are the first choice that farmers make in a given situation due to its immediate action, obvious results, ease of use and most of all it comes in a cheaper package. Amongst the fruit crops, apple utilizes about one-third of the fungicides. The magnitude of fungicides used can be gauged from the fact that in one season 9-10 sprays are required to control the diseases entailing an expenditure of Rs 25000-40000/ha. Organic (protective) fungicides continue to dominate the scene and shift towards systemic or therapeutic (EBI) fungicides for utilization in curative and monitored spray program is significant. The need in fact is to integrate information on pathogen perpetuation, weather monitoring and disease forecasting which would help for decision making in the control of apple diseases as need-based, environmentally safe and in economically judicious manner. Integrated and monitored sprays of fungicides were devised for spring and summer diseases. Over-wintering sprays of 5% urea and Bordeaux mixture @ 1% were rated very effective IDM strategy to eradicate most of the diseases on apples.

Mangement of Dry Rot of Pomegranate in Himachal Pradesh R. L. Sharma and R. K. Tegta Department of Mycology and Plant Pathology, Dr. Y.S. Parmar University of Horticulture and Forestry, Nauni, Solan 173 230 Himachal Pradesh, India.Email: [email protected] - Pomegranate is highly susceptible to dry fruit rot caused by Coniella granati (Sacc.) Petrak and Sydow, and the disease has resulted in substantial losses and threatening the upcoming pomegranate cultivation in Himachal Pradesh. The disease started on the fruits which were half grown or larger. The rot is characterized by softening of the rind and underneath pulp and seed. Ultimately the entire fruit turns brown to black after complete rotting. Extensive and comprehensive survey of various pomegranate orchards conducted revealed that incidence of dry fruit

rot varied from 0.55 to 22.77 per cent with a mean per cent incidence of 8.38 at various locations in Himachal Pradesh. The incidence was higher in Solan district where the infected fruits were often seen in the form of dark brown to black fruit mummies scattered on the orchard floor. The disease appeared maximum during the first week of August after an extended period of warm and foggy weather. Pre-harvest sprays with Bavistin and Stop among systemic fungicides gave significant control whereas, among non-systemic fungicides, Indofil M-45 against fruit rot of pomegranate showed some promise. Post-harvest efficacy of systemic fungicides was better as protectant (pre-inoculation treatment) rather than eradicant (post-inoculation). Attempts have been made to control fruit rot with eco-friendly methods such as wrappers, fumigants, coatings, antagonists and botanicals which included plant oils and plant extracts. Fumigation with sodium or potassium metabisulphite was superior in checking the disease. Bavistin wrappers and Nipro Fresh coating exhibited significant protection of pomegranate against dry fruit rot. Fungal antagonists viz, Trichoderma virens, T. harzianum, T. hamatum and T. polysporium gave maximum inhibition of mycelial growth of C. granati. Antagonist protection was higher when applied at a concentration of 108 spores/ml before inoculation. Cent per cent inhibition of mycelial growth of C. granati was obtained with citronella oil at 1000 ppm. Pre-inoculation treatment with plant extracts of darek (Melia azadirach), dedonia (Dedonia viscosa), lantana (Lantana camara) and pippermint (Mentha piperita) provided significant control of fruit rot of pomegranate. Diagnosis and Management of Peach Decline Phytoplasma Disease in India P. D. Thakur, A. Handa, K. J. and Usha Department of Mycology and Plant Pathology, Dr. Y S Parmar University of Horticulture and Forestry, Nauni, Solan 173230 Himachal Pradesh, [email protected] - Peach (Prunus persica L.) is one of the important remunerative fruit crop of Himachal Pradesh. Since 1980s plantations in famous peach valley situated in Rajgarh area of district Sirmour of the state has been severely affected by the infection of a phytoplasma causing decline disease. A number of orchards have declined and destroyed due to this disease which exhibits characteristic symptoms of yellowing and upward marginal rolling of the leaves besides bearing of small sized shriveled fruits on the affected trees predominantly having partial infection. Phytoplasma etiology of the disease has been proved based on the studies on symptomatology, transmission,


morphology of the mollicute, DAPI test, PCR detection and remission of symptoms by the application of tetracycline antibiotic. RFLP analysis of the amplicon of 16S rRNA gene obtained in nested PCR by using phytoplasma specific universal primer pairs revealed the incitant belonging to elm yellow group of phytoplasma. In order to develop a suitable management strategy for this disease, epidemiological studies were conducted to find out the reservoir hosts, leafhopper vectors besides screening of peach germplasm for resistant sources. PCR based detection was carried out to define the hosts and vector of peach phytoplasma. Two annual weed species viz, Erigeron annuus and Dryopteris sp. and two tree species viz, Toona ciliata and Acacia catechu growing in and around an infected orchard with symptoms of phytoplasma like diseases were found to be carrying phytoplasma infection as evident from PCR detection by employing peach phytoplasma specific primer pairs. Therefore, these species have been identified as alternate/reservoir hosts for peach decline phytoplasma. Leafhopper species Atkinsoniella opponens (Walker) (Tribe: Cicadellini, Subfamily: Cicadellinae) and Evacanthus repexus (Distant) (Tribe: Evacanthini, Subfamily: Cicadellinae) were found to contain phytoplasma as evident from positive detection of phytoplasma in them through nested PCR by employing universal primer pairs. These species were found to be prevalent in the orchard throughout the active growing season and were also observed feeding on weeds (Erigeron annuus and Dryopteris sp.) which carried phytoplasma. Both leafhopper species were present on almost all the plant species existing in the orchard floor, thus found to be polyphagous in nature. All the commercially grown cultivars of peach namely, July Elberta, Red Haven, Sun Haven and Giant Elberta were found to be susceptible to phytoplasma as they exhibited typical symptoms of phytoplasma infection. Additionally, 34 germplasm collections of peach and nectarine artificially inoculated with peach decline phytoplasma were also found to be susceptible to the disease. Based on these findings an integrated disease management strategy has been worked out for recommendation to the peach growers including planting of disease free nursery plants, rouging of removal of reservoir hosts, pruning of diseased plants, control of vectors and application of oxytetracycline hydrochloride antibiotic in the form of trunk injection Integrated Management of Stem and Pod Rot of Groundnut K. B. Rakholiya and K. B Jadeja Department of Plant Pathology, College of Agriculture, JAU, Junagadh 36200 Gujarat, India. Email:

[email protected] - Stem and pod rot of groundnut caused by Sclerotium rolfsii is a major disease of groundnut in Saurashtra region of Gujarat. It is difficult to manage this disease using single method of control unless an integration of different components is adopted in prone area. In two season field trials were conducted at Junagadh using susceptible cultivar GG-20, all the treatments were found significantly superior over control in reducing disease incidence. Minimum disease incidence (29%) and maximum pod yield (2176 kg/ha) was recorded in the treatment comprising pre-emergence of spray application of fluchloraline@ 1.5a.i.kg/ha, seed treatment with vitavax power (vitavax + thiram at 3.0 gm/kg seeds), furrow application of Trichoderma harzianum (@1.5 kg/ha mixed in 300 kg FYM) at the time of sowing, and three sprays of hexaconazole (0.005%) at 35, 55 and 75 DAS. Disease incidence was 54% and pod yield was 996 kg/ha in control. Three sprayings of mancozeb (0.20%) when substituted in place of hexaconazole was also equally effective. Degeneration of Potato Cultivars Due To Potato Apical Leaf Curl Virus Disease B. S. Lakra Department of Plant Pathology, CCS HAU, Hisar-125004, E-mail: [email protected] – The present day commercial potato cultivars viz., Kufri Anand, Kufri Ashoka, Kufri Badshah, Kufri Bahar, Kufri Chandramukhi, Kufri Jawahar, Kufri Khyati, Kufri Pukhraj, Kufri Pushkar and Kufri Sutlej planted during 2004-05 to 2008-09 were assessed for the rate of degeneration due to potato apical leaf curl virus disease. Fresh breeder seed stock of 2004-05 of all the cultivars was continuously used in subsequent years up to 2008-09. Produce of each year was compared with yield of protected crop raised from fresh breeder seed (control) for evaluating the depression or degeneration over the years. The incidence of potato apical leaf curl disease increased very slowly in Kufri Bahar, gradually in Kufri Jawahar, Kufri Chandramukhi and Kufri Pushkar and rapidly in Kufri Khyati, Kufri Pukhraj, Kufri Anand, Kufri Ashoka, Kufri Sutlej and Kufri Badshah. Kufri Bahar being a resistant cultivar had lowest degeneration (yield reduction 4.5%). However, Kufri Chandramukhi, Kufri Jawahar, Kufri Badshah, Kufri Sutlej and Kufri Pushkar exhibited moderate reduction (17-29%) and rest of the cultivars namely Kufri Khyati, Kufri Anand, Kufri Ashoka and Kufri Pukhraj showed maximum reduction (45-61%) in yield after five year of exposure to the disease.


Alternaria Leaf Bight Disease of Groundnut Spreads in Saurashtra Region of Gujarat V. Kumar, C. Lukose1, N. B. Bagwan, V. G. Koradia and R. D. Padavi Directorate of Groundnut Research, Junagadh, Gujarat-362001, India;1Main Oilseed Research Station, Junagadh Agricultural University, Junagadh, Gujarat-362001, India, E-mail: [email protected], [email protected] - Outbreak of a hitherto minor disease, Alternaria leaf blight was observed in farmers’ fields during April-May 2009 in the summer crop of groundnut in Saurastra region of Gujarat. Its occurrence was also observed in some of the cultivars at experimental fields. Though, this disease has been reported to occur two decades ago, this is the first report of its widespread occurrence from any state of India. Surveys were conducted to record disease severity in Rajkot and Junagadh districts during May 10-30, 2009. The characteristic symptoms of the disease are blighting of apical portions of leaflets, which later curl inward and become brittle giving the leaf a ragged appearance. The pathogen was identified as Alternaria alternata (Fr.) Keissler on the basis of its morphological and growth characteristics. The pathogenicity test confirmed the etiology. The disease severity in farmers’ field in Junagadh and Rajkot districts of Gujarat ranged from zero to 67% across depending on the cultivars and crop growth phases. The cultivars, TG-37A, TPG-41 and JL-42 were more susceptible than others. The data on estimates of losses in four cultivars revealed that reduction in pod yield was from 13 to 22% and in the haulm yield from 24 to 63%, depending on severity of the disease. The outbreak of the disease could be due to changes in cropping patterns, the cultivars and the climatic parameters. Integrated Management of Heart Rot of Pine Apple G. M. Hegde, M. G. Hegde, and H.G. Hegde Sirsi University of Agricultural Sciences, Dharwad, Karnataka,India, email : [email protected] - In Uttar Kannada district of Karnataka the fruit crop pine apple is grown on area of about 1600 ha, contributing to 50,000 t. Recently the production of pineapple has been drastically reduced due to incidence of heart rot disease caused by a fungus, Phytophthora parasitica is threatening the cultivation of crop by causing extensive yield loss to the extent of 30-80%. Pineapple growers are using several fungicides and their combinations to combat this menace; however, it is becoming difficult for them to overcome this problem.

Poor physical condition of the soil and inadequate drainage are responsible for spread of the disease. In this context, systematic efforts were made to manage this menace in the farmer’s field during rabi 2007-08. The results revealed that treatment combination of soil application with neem enriched Trichoderma @ 20g/hill and sucker treatment with metalaxyl MZ @ 0.1-0.3% followed by two sprays of aliette, a systemic fungicide at monthly interval has significantly reduced the heart rot incidence (23%) with the highest yields of 55 t/ha. However, the nutritional spray of akomine @ 0.3% also resulted in lower disease incidence with comparatively higher yields than the local practice of spray with Bordeaux mixture and drenching with copper oxychloride. Thus, an integration of organic matter, biological agent, botanicals with fungicides was found to be significantly superior over other treatments and can be practiced in endemic areas. Role of Weather in Development of Plum Rust and Its Management with Fungicides and Host Resistance I. M. Sharma and S. S. Bhardwaj Dr. Y.S. Parmar University of Horticulture & Forestry, Department of Mycology and Plant Pathology, PO. Nauni, Solan, Himachal Pradesh India. Email: [email protected] - Severity of plum rust caused by Tranzschelia discolor (Fuckel) Tranzschel & Litv. varied between 4.2-90.6% in plum orchards of Kullu and Mandi districts of Himachal Pradesh. It resulted in severe early leaf fall in the month of August, thereby affecting the growth and yield of the next year’s crop. Studies on the development of disease in relation to prevailing weather conditions carried out (2004-08) at Horticultural Research Station, Seobagh; Kullu, indicated that disease was first noticed to appear between Jun 28 – Jul 6 with the occurrence of average temp and RH ranging between 24.2-26.6C and 52.7-63.9%, respectively accompanied with rainfall of 30.4-61.7 mm in 2-5 rainy days during 2 weeks prior to the appearance of disease. Further, the disease multiplied at a faster rate with the occurrence of moderate temp ranging between 22.5-25.8C accompanied with moderate to high average RH (61.6-74.1%) and frequent rainfall (1-3 rainy days/wk) during last week of Jul to the last week of Aug. The lowering in min. temp to below 16C in Sep resulted in the formation of numerous teleutospores. Evaluation of different 10 fungicides during 2004 and 2005 indicated that 2 sprays of cyproconazole (0.02%), hexaconazole (0.04%), dithianon (0.05%), bitertanol (0.05%) or fluquinconazole (0.05%) at an interval of 4 weeks starting with the first appearance of disease were most effective and exhibited disease control of 95 to 98%.


Out of seven spray schedules evaluated during 2006-07, a schedule comprising of two consecutive sprays starting with hexaconazole (0.05%) at the first appearance of disease in Jul followed by another spray with dithianon (0.05%) after 4 wks of first spray was highly effective (99%). Monitored disease control studies (2007-08) indicated that a schedule comprising of two consecutive sprays starting with HM mixture (0.25%) in second or third week of Jul, one wk after the first appearance of disease, followed by another spray with dithianon (0.05%) or hexaconazole (0.5%) after an interval of 4 wks was highly effective (99.9%). Adoption of above schedule resulted in increase of fruit yield by 11.6, 13.5 and 10.5% in 2006, 2007 and 2008, respectively. Amongst the four commercial cultivars of plum, Meriposa (0.84 PDI) and Frontier (1.82 PDI) exhibited field resistance, whereas Red Beaut (69.8 PDI) and Santa Rosa (86.2) exhibited susceptible and highly susceptible reactions, respectively. Integrated Management of Fusarium Wilt of Pigeonpea M. Saifulla, M. Mahesh and M . B. Gowda AICRP (Pigeonpea), UAS, GKVK, Bangalore 560065 Karnataka Email: [email protected] - Pigeonpea (Cajanus cajan (L.) Millsp) is one of the major grain legume (pulse) crops of tropics and sub-tropics. It finds an important place in the farming systems adopted by small and marginal farmers in a large number of developing countries as it restores the soil fertility by fixing atmospheric nitrogen. The main constraints in boosting the yield of the crop are its susceptibility to diseases, insects and other physiological stresses. Recently, the biocontrol approaches have been initiated by using antagonistic microorganisms to combat the wilt disease in pigeonpea. The development of resistant varieties and combined application of bioagents and fungicides is considered as more practicable. However, developing resistant varieties is a tedious and time consuming procedure. In the Integrated pigeonpea wilt disease management (kharif 2006 and 2007), four effective treatments were identified as pooled analysis for the management of pigeonpea wilt. A combination of carbendazim seed treatment 2g/kg of seeds and soil application of P. fluorescens and T. viride (each 2.5 kg in FYM @ 50 kg/ha) recorded the least wilt incidence of 7% with yield of 1203 kg/ha. A combination of carbendazim seed treatment @ 2g/kg of seeds and soil application of T. viride (2.5 kg in FYM @ 50 kg/ha) led to only wilt incidence of 10% with yield of 1154 kg/ha. A combination of carbendazim seed treatment @ 2g/kg of seeds and soil application of ZnSO4 (25 kg/ha) and T.

viride seed treatment @ 5g/kg of seeds and soil application of T. viride (2.5 kg in FYM @ 50 kg/ha also showed considerable efficacy in controlling wilt incidence and increasing yield compared to untreated control with a wilt incidence of 64% and an yield of 363 kg/ha. Influence of Temperature, Relative Humidity and Rainfall on Alternaria Blight of Tomato R. S. Champawat and R. S. Sharma Department of Plant Pathology, Rajasthan Agricultural University, Agriculture Research Station, Durgapura, Jaipur 302018 Rajasthan, India. Email:[email protected] - Blight (Alternaria solani) is a most destructive and wide spread disease of tomato. Environmental factors as temp, RH, rainfall are important factors which influence the development of disease. In the present investigation meteorological data were collected at weekly interval at Durgapura, Jaipur. The disease data were also collected at weekly interval. Alternaria blight incidence percentage was considered as dependent variable and weather parameters were considered as independent variable. The significance of the estimated parameter (regression coefficient) was tested by usual t- test. The coefficient of determination was also calculated for each of the independent variable. Alternaria blight of tomato was negatively correlated with all the five parameter studied. The linear regression on the appearance of Alternaria blight of tomato with these parameters also gave significantly negative regression coefficients. The multiple regression analysis revealed that these parameters contribute 77% towards disease incidence; the effect of max temp was negatively significant. Max and min temp has positive while max RH and min RH have negative significant correlations with appearance of Alternaria blight of tomato. The linear regression coefficients for temp were positively significant while both the RH were negatively significant. In Rabi crop, the combined effect was positively significant with max temp and negatively significant with max RH. Phyllanthus amarus: A New Host for Oidium uwebraunii V. K. Yadav and N. D. Sharma Department of Plant Pathology, JNKVV, College of Agriculture, Tikamgarh, Madhya Pradesh. Email:[email protected] - Powdery mildews fungi are obligate and biotrophic parasites. The diseases they cause are commonly widespread and easily


recognizable. Infection by the fungus favored by high humidity but not by free water. Powdery mildews are polycyclic diseases that can impair photosynthesis, stunt growth and increase the rate of senescence of host tissue. The diseases they cause may be slight or in some situations, if left untreated, they may inflict severe economic losses on crops. During survey, a new powdery mildew on Phyllanthus amarus was encountered. Previously the identification of powdery mildew was based largely on the teleomorph and the morphology of the cleistothecium and its appendages. With the new taxonomy, identification of powdery mildews now also requires attributes of the anamorph. Therefore, in the present investigation a taxonomic study was conducted using characters of current taxonomic importance in defining the imperfect stages of erysiphaceae in modern sense. Based on the morphological features the present fungus was identified as Oidium uwebraunii and critical survey of the literature revealed that there is no report of O. uwebraunii on P. amarus. So far, this is the first report of its occurrence in India. The specimen has been deposited at HCIO, Herb No. 46,908. Effect of Flag Smut Caused By Urocystis Agropyri on Yield Components of Popular Wheat Cultivars in Rajasthan P. S Shekhawat, V L Majumdar and P. S. Shekhawat All India Coordinated Wheat And Barley Improvement Project, Agricultural Research Station, Durgapura, Jaipur 18 Email: [email protected] - Flag smut caused by U. agropyri is an important disease of wheat. The seed and soil borne nature of the disease leads to gradual built up of the inoculum in the soil. Further, the persistent nature of the pathogen and the cultivation of susceptible varieties, flag smut may become a serious threat of wheat cultivation particularly in northern areas of the country. Losses up to 80 per cent have been reported in some endemic areas of Rajasthan. A survey conducted during rabi, 2001-02 to 2003-04 revealed that all popular wheat cultivars were susceptible to the disease. Attempts were therefore made to determine the effect of disease on yield attributing components of popular wheat cultivars grown in Rajasthan viz, Raj 1482, Raj 3077, Raj 3765, Raj 3777, C-306, WH 147, PBW 343 and Lok-1 in sick plot under seed inoculated conditions at Durgapura, Jaipur. Significant reductions in number of tillers, plant height, length of ear-head and test weight were noted in smutted plants over healthy plants. Maximum disease was recorded in Raj 1482 (47.2%) followed by PBW 343 (45.8%), C-306 (43.9%), Raj. 3765 (41.8%), Raj 3077 (39.6%), Raj

3777 (37.3%), WH 147 (36.7%) and Lok-1 (10.8%). The highest yield reduction was in PBW 343 (49.0%), whereas, in Raj 1482, C- 306, Raj 3765, WH 147, Raj 3077 and Raj 3777 yield losses up to 46.5, 38.9, 35.7, 35.2, 28.2, and 26.7 per cent respectively were observed. In Lok-1, the least loss (6.9%) was observed. Wilt Disease (Fusarium solani) of Cucumber (Cucumis sativus) - First report from Gujarat B. N. Parasiya, K. U. Solanky, A. N. Sabalpara and J. R. Pandya Department of Plant Pathology, N.M. College of Agriculture, Navsari Agricultural University, Navsari – 396 450, Gujarat, Email: [email protected] - Cucumber is an important vegetable crop grown in India for the fruit. Among various diseases, wilt has become a major problem in recent past with a threat to successful and profitable cultivation in South Gujarat. Considering this fact, an investigation was made to find the exact cause for disease and to generate information on this serious pathological problem. The symptoms were recorded from popular cv. Navsari local grown in field during summer season. Plants of different age groups were found infected showing varying degrees of infection indicating susceptibility at all stages of crop growth stage. Isolations from infected plant tissues revealed the association of Fusarium solani (ITCC No. 6553.07). The pathogenicity of the fungus was successfully proved. This is a first report from Gujrat. Evaluation of Fungicides Against Phomopsis vexans A.N. Sabalpara, D.U. Patel, J.R. Pandya and S. K. Chawda Department of Plant Pathology, N.M. College of Agriculture, Navsari Agricultural University, Navsari – 396450, Gujarat Email: [email protected] - Fruit rot (Phomopsis vexans) is an important disease of Gujarat, inflicting heavy losses. Fungicides viz, carbendazim (Bavistin 50% WP), thiophanate methyl (Topsin-M 45 75% WP), mancozeb (Dithane-M 45 75% WP), propiconazole (Tilt 25% EC), copper oxychloride (Blitox 50% WP), copper hydroxide (Kocide 75% WP), Iprodine 25% + carbendazim 25% (Quintal 50% WP), flusilazole (Nustar 40% EC), fenamidone 10% + mancozeb 50% (Secure 60% WDG), carbendazim 12% + mancozeb 63% (Sixer 75% WP) and aureofungine (Aureofungine 46.15% SP) were tested by poisoned food technique against brinjal fruit rot pathogen (Phomopsis vexans) in PDA medium. All the fungicides


were significantly proved effective. Among them, carbendazim and thiophanate methyl at 250, 500 and 1000 ppm showed significantly high inhibitions (93-100%) of the mycelial growth of the pathogen and both were proved as a highly fungitoxicant. Epidemiology of Bitter Groud Leaf Spot K. M. Patel, A. N. Sabalpara , J. R. Pandya and S. K. Chawda Department of Plant Pathology, N.M. College of Agriculture, Navsari Agricultural University Navsari - 396450, Gujarat. Email: [email protected] - Bitter gourd (Momordica charantia L.) is grown all over Gujarat as a vegetable crop. Occurrence of leaf spot disease in this crop caused by Alternaria alternata (Fr.) Keissler was notice in serious proportion inflicting heavy losses around South Gujarat region. With this view, an epidemiological study was carried out. The observations on leaf spot intensity were recorded at weekly interval in local cultivar in field during kharif. Commencement of leaf spot was underway after 58 days of sowing and progressed to reaching up to 30% at harvest during Nov. There was a main peak of leaf spot during Sep 17-24. Among the various weather parameters, range of temp, was found to have a key role affecting disease development. Multiple correlations value and co-efficient of determination value were found 0.80 and 58.69 per cent, respectively, and with Ý = -1.2317 + 2.1378 (x1) where x1 = range temp. Status of Flag Smut Caused by Urocystis agropyri of Wheat in Rajasthan V. L. Majumdar, P. S. Shekhawat, and P. S. Shekhawat Department of Plant Pathology, Agricultural Research Station, Durgapura, Jaipur 302018 Email:[email protected] - Flag smut of wheat caused by Urocystis agropyri (Preuss) Schrot is assuming alarming situation in northern parts of the country including Rajasthan. A survey was therefore, undertaken to know the incidence of the disease in major wheat growing areas of the state and subsequently formulation of management strategies for the same. Survey was conducted during rabi 2001-02 to 2003-04 in major wheat growing districts of Rajasthan. It covered important aspects related to the disease including soil-texture, crop sequence, cultivars, and date of sowing. The disease was found to be prevalent in all the districts surveyed in traces to severe levels. The incidence of the disease was much more severe in those

pockets where the soils were light textured and mono-cropped with susceptible varieties by the farmers, particularly in eastern regions of the state i.e. Dausa, Jaipur and Tonk districts. Significantly the highest disease incidence was recorded in light textured soils than in heavy soils. Incidence was significantly low (2.65%) in two yr crop sequence of pearlmillet-musterd-guar-wheat. All the popular wheat cultivars were found susceptible to the disease except Lok-1 (0.7%). Early and very late sowing reduced the severity of the disease. Status of Rice Diseases in Punjab J. S. Brar and A. Singh1 Punjab Agricultural University, Regional Station, Faridkot; 1Department of Plant Pathology, PAU, Ludhiana. Email:[email protected] - The data regarding number of diseased samples of rice received at Plant Clinic of Punjab Agricultural University from 1998-99 to 2008-09 were analyzed. Bacterial blight has attained the status of regular disease and eight pathotypes of bacteria has been associated with it in Punjab. BLB appeared every year but, it appeared in epidemic form during 1998-99 and 1999-2000 when 62% and 79% diseased samples were received out of total diseased samples received at Plant Clinic. The number of diseased samples showed a continuous decreasing trend from 2000-01 (27.92%) to 2008-09 (10.08%). Due to the introduction of resistant varieties the disease is now in a low profile. In case of basmati rice, this disease has started appearing from 2008-09 as 15% basmati rice samples were found to be infected with BLB disease. Sheath blight started becoming serious disease with the introduction of variety PR116 in the year 2000. Nearly 54% samples received were infected with this disease during 2007-08. This disease is more severe on PR116, Pusa-44 and PAU-201. Maximum samples of false smut were received during 2000-01, 2003-04 and 2006-07 and were 38, 34 and 26% of samples, respectively. The paddy variety PR116 showed highest incidence of the disease among other recommended varieties. Brown spot disease was not so important before the introduction of susceptible varieties (PR116 and PR114). Its incidence is on the increase since 1998-99 (4%) and highest samples 16% were received during 2002-03. The incidence of kernel smut of rice was noticed in 3% samples received during 2003-04. Sheath rot was in 11%) of diseased samples received during 2001-02. Stem rot which was widespread on basmati varieties decreased due to rice-wheat rotation and mechanized farming. Foot rot disease has disappeared from Punjab, but, with the introduction of new variety (Pusa 1121) of basmati rice, the disease showed its


presence during kharif 2007-08 in 7% of samples. Rice blast appeared in low intensity in 10% of samples were diagnosed during 2004-05 on basmati varieties only. Root knot nematode was observed during 2000-01 in light soils. Scattered reports regarding damage by acid rains were also received. Grain discoloration has been observed maximum from 2005-06 (16%). Sterility in paddy has been reported almost regularly every year with maximum (21%) during 2002-03. Identification of Sugarcane Entries Against Wilt Caused by Fusarium moniliforme R.S. Singh, D. Singh and J.S. Brar Punjab Agricultural University, Regional Station, Faridkot-151 203 Email:[email protected] - Sugarcane is an important cash crop of the Punjab and has a significant impact on the agricultural economy of the state. The present cane productivity level of the 55-60 t/ha is low and can easily be increased to at least 75 t, if we can manage the soil borne malady, wilt by using resistant source. Considering the importance of wilt, an experiment was conducted in spring 2008, by planting different entries in Initial Varietal Trial (IVT) early and mid-late, at Faridkot to test against wilt under natural epiphytotic conditions. The disease incidence in entries was scored using 0-9 scale. The results showed that out of 31 entries tested against wilt in two trials, 15 entries namely CoLK 04237, CoJ 64, CoPt 84211, CoS 05231, CoH 05265, CoS 05232, CoPK 05191, Copt 05221 (in IVT early trial) and CoH 05266, Co 05011, CoPb 05211, CoH 05269, CoLK 05203, CoS 8436, UP 05233 (in IVT mid-late) were resistant to wilt. Out of these, the most promising entry CoPK 05191 was significantly superior in cane yield (74 t/ha) which was also at par in sugar yield (8.44 t/ha) to the best standard COJ 64 (65.33 t/ha and 8 t/ha) (Early). Where as in mid-late maturity, the best test entry Co 05011 was at par in cane yield (78.44 t/ha), sucrose in juice (19.15%) in Jan and sugar yield (10.53 t/ha) and was comparable to the best standard Co 1148 (76.67 t/ha and 9 t/ha) in cane and sugar yield and Cos 8436 (19.51%) in sucrose per cent in juice in Jan. It was suggested that the resistant entries can either be used in breeding for disease resistance or may be used for general cultivation. Management of Sclerotinia Stem Rot of Pea N. Singh, R. Palat, O.P. Mathuria and D.R. Chandra Oilseeds Section, C.S. Azad University of Agriculture and Technology, Kanpur 208002. Email:[email protected] - Pea (Pisum sativum (L.)) is one of the most importance pulse crops of India.

During a survey, it was been observed to suffer from diseases among which stem rot caused by Sclerotenia sclerotiorum was a serious threat to the cultivation of this crop. Intensive use of fungicides for protection of crop from diseases has several disadvantages as they are not only expensive but also toxic to the human being and pollute-environment too. Therefore, it is essential to develop and alternate effective and safe bio-agent control against the disease. Seven soil amendments like pyrite, neem cake, paddy straw, castor cake, mustard cake, wheat straw and gypsum @ 2 t/ha were used. Minimum disease intensity (9%) was observed when soil was amended with pyrite followed by neem cake and paddy straw, and soil amendment with gypsum was the least (PDI 25%) effective in managing disease in both the years. Detection of Tomato Leaf Curl Virus in Cultivated Varieties of Tomato and Other Plants of Sub-Himalayan West Bengal B. Saha, D.Saha1 and A. Saha Dept. of Botany, University of North Bengal. 1Dept. of Biotechnology, University of North Bengal. E-mail: [email protected] - Tomato leaf curl virus (ToLCV) is a whitefly (Bemisia tabici) transmitted geminivirus (family Geminiviridae, genus Begomovirus). It has been reported that ToLCV cause severe disease of tomato and other plants throughout the tomato growing areas of the world. Tomato and other plants showing severe leaf curl, shrinking of leaves, yellowing of the veins and stunted growth were collected from different regions of sub-Himalayan West Bengal. Presences of begomovirus DNA in the diseased samples were screened by PCR amplification using begomovirus specific primers (DengA and DengB). Eight samples out of 50 tomato plants collected from Coochbehar, Haldibari and Siliguri gave positive results. Samples were assumed positive when they showed bands at 530 BP after running in agarose gel. Amplified DNA samples were sequenced and a 480 base pair long partial coat protein gene was observed. The gene starts at the DNA-A origin of replication and continue to the 5’ end of the AV1 (coat protein) gene of begomovirus. Positive samples were again subjected to another PCR amplification using degenerate CP primer to amplify the coat protein gene. A 480 bp CP gene was sequenced. Sequence alignment study and phylogenetic analysis revealed the highest (95%) similarity with tomato geminivirus AV2 gene and partial AV1 gene for coat protein of isolate Y213. The viruses were also subjected to transmission electron microscopic study. Typical geminate particles were observed in TEM photographs. The presence of the virus was also


confirmed by PCR in two weeds and in six economic plants growing around tomato growing fields of sub Himalayan West Bengal.

Screening of Virulent Ralstonia solanacearum Isolates from Wilt Affected Tomato Plants of North Bengal by PCR amplification of fli C gene

H. Mandal, D. Saha1 and A. Saha

Department of Botany, University of North Bengal, Siliguri-734013; 1Department of Biotechnology, University of North Bengal, Siliguri-734013. Email: [email protected] Tomato is one of the widely grown vegetable crop in India and it is a source of minerals, vitamins, organic acids, essential amino acids and dietary fibres. Tomato plants suffer from several diseases caused by fungi and bacteria. Ralstonia solanacearum is a devastating, soil borne bacterial pathogen of tomato. The pathogen is nonmotile in planta but highly motile in culture. On basis of physiological and biochemical characteristics, 26 isolates have been purified and identified as R. solanacearum. The isolates were grouped into five races according to their host range and five biovars based on utilization of their carbon sources. Two genes of flagellar biosynthetic pathway are fliC and fliM. FliC gene produces flagellin and fliM gene is responsible for movement of flagella. Ralstonia specific fliC gene amplicon indicates the identity of virulent Ralstonia isolates. In the present study, two virulent isolates have been identified by PCR amplification of the fliC gene using fliC gene specific primers. Bioefficacy of Curzate M8 72 WP Against Downy Mildew of Cucumber Caused by Pseudoperonospora cubensis G. Ganeshan and B. S Chethana Vegetable Pathology laboratory, Division of Plant Pathology, Indian Institute of Horticultural Research, Hessaraghatta Lake P.O., Bangalore 560 089 Karnataka, India, Email: [email protected], [email protected] - Curzate M8 72WP, a combination product of systemic and contact fungicide, cymoxinil 8% and mancozeb 64% was evaluated against downy mildew disease of cucumber caused by Pseudoperonospora cubensis. Curzate M8 is widely being used against downy mildew of grapes, late blight of tomato and potato and other rots caused by Pythium species. The bioefficacy studies were made in the farm during the rainy season for two consecutive years at Bangalore. Curzate M8, 72 WP was evaluated at 90, 120, 810, 1080, and 1350 g a.i/ha, and compared with

most commonly used mancozeb 75 WP 1500 g a.i/ha and metalaxyl. The performance of this chemical in terms of disease control, yield enhancement, and possible phytotoxicity effects on the host is reported.

Studies on Variation Among Fusarium oxysporum f.sp. pisi Isolates, the Incitant of Wilt of Pea By Using Morphological and Molecular Markers

S. K. Gupta, S. Rana and K. Jarial

Department of Mycology and Plant Pathology, Dr. Y.S. Parmar University of Horticulture and Forestry, Nauni, Solan 173 230 E-mail: [email protected] - In all, 21 isolates of Fusarium oxysporum f.sp. pisi were collected from different pea growing areas of Himachal Pradesh and designated as I1 to I20. Studies were carried on morphological variations with respect to mycelial colour, conidial size and formation of chlamydospores and pathogenic variation in terms of disease incidence among different isolates. The mycelial colour varied from white to dull white with slightly pinkish tinge. The microconidial size varied from 3.16 × 3.16 µm (I19) to 9.13 × 5.44 µm (I7) whereas macroconidial size varied from 11.77 × 3.16 µm (I19) to 24.60 × 5.91 µm (I7). Mycelium width and chlamydospores dimensions also varied in all the isolates. All formed chlamydospores on PDA medium except I2 in which no chlamydospore formation was recorded. Isolates also varied in response to carbendazim amended media at 20 mg/l, showing mycelial growth rate variation ranging from 0 to 0.050 mm/h. Studies on pathogenic variability revealed that disease incidence varied from 0 to 87% 7 d after inoculation in potsand incubation period varied from 3 to 9 d. Genetic variation was also analyzed by using forty 10 – mer oligonucleotide RAPD primers, out of which 2 primers yielding informative, strong and reproducible DNA amplicons of F. oxysporum f.sp. pisi were selected for studying the variation among isolates. The dendrogram produced from computerized cluster analysis of the DNA fingerprints revealed 0 to 70% variation among isolates as expected after DNA banding pattern analysis of gel image. All isolates were put into three major groups each comprising of two, seven and eleven isolates, respectively. Present Status on Mushroom Diversity and Strategies for Their Conservation in State of Chhattisgarh M. P. Thakur and S. S. Chandravanshi Department of Plant Pathology, Indira Gandhi Krishi Vishwavidyalaya, Raipur 492 006, Chhattisgarh, India Email: [email protected] The diversity of


climatic conditions prevalent in India made this country a natural habitat of a number of mushrooms. There are over 5000 species of edible fungi known to man out of 10,000 species of macrofungi. Since India is richer in flowering plants than any other country of its size, the fungal wealth of India is also expected to be equally diverse. But, no concerted efforts have been made for any detailed study of natural mushroom flora in different parts of the country till today, although some sporadic attempts were made by some workers around the country. In India, some efforts have been made into the identification of the country’s mushroom flora occurring in the diverse bio-geographical regions of the country. In fact, work done since 1980 have helped to trace a much more comprehensive mushroom resource map of the country. Attempts have been made to survey the areas mostly from South India, North West Himalayas and Eastern parts. But, North India including Madhya Pradesh, Uttar Pradesh and Chhattisgarh have received lesser attention. More than 2000 species of fungi are reported to be edible throughout the world and about 283 are reported to be the available in India. Chhattisgarh is divided into 3 agroclimatic zones viz, Chhattisgarh plains, North Hilly regions and Bastar Plateau. Chhattisgarh plain has a vast forest cover including 3 wild life sanctuaries like Sitanadi, Udanti and Barnavapara. Of these, Sitanadi wild life sanctuary is a unique one which is a kind of sub-tropical forest but have all kinds of flora and fauna representing to a temperate forest. Most of the flora and fauna of this forest including mushroom flora are un-attended and u-nexplored. North hilly region including Manpatt, which is at higher altitude, has typical mushroom flora, which needs to be conserved and exploited. Bastar plateau is one, which is predominated by thick forest cover and most of the area is still un-attended and un-explored. This area is highly rich in biodiversity. Sporadic attempts have been made in the past to collect, conserve, identify and maintain the mushroom flora. These efforts were made under All India Co-ordinated Mushroom Improvement Project of ICAR operating at Indira Gandhi Agricultural University, Raipur since 1988. Survey for collection of mushroom flora was carried out in different parts of Chhattisgarh viz, Raipur, Bilaspur, Ambikapur, Raigarh and Jagdalpur districts. Some of species were collected, identified and deposited at National Research Centre for Mushroom, Solan, Himachal Pradesh. About 83 mushroom flora were collected and preserved in formalin. The mushroom flora commonly encountered during survey were: Agaricus sp., Tuber sp., Russula, Boletus, Volvariella, Lactarius, Lepiota and Termitomyces spp. Mushroom as a commodity is of highly perishable, and its collection and immediate conservation are very essential. It is conserved in fresh or dry form. Wet preservation of some hardy mushroom was done. It was

hydrated as well. Survey conducted from 1989-2007 revealed that in every village, Volvariella diplasia is growing naturally on the paddy straw stacks kept in the field. Nearly 6-7 quintals of Termitomyces spp. is being collected and sold in the Raipur market every year. Similar quantity of this mushroom is also collected and marketed from Bilaspur, Ambikapur, Jaspurnagar and Raigarh district. In Ambikapur, Pali and Katghora, appreciable quantity of wild mushrooms like Tuber sp., Russula, Boletus and Volvariella sp. are collected and sold in the local market. Mushrooms occurring naturally in their habitat may be edible, non-edible or poisonous. These may be collected during different months of rainy season from all over the State and conserved at one place. Based on the study, an advanced centre for Mushroom Diversity Conservation of Chhattisgarh needs to be established preferably with all the required modern facilities, collected mushroom may be preserved either as wet or dry. A strong need is felt to isolate, purify, identify, characterize and catalogue the collected mushroom species by molecular approaches. Awareness needs to be created to grow mycorrhizal mushroom species either by forest departments or by tribals in forest areas in order to conserve these species from deforestation or environmental degradation.

Assessment of Microbial Diversity in Different Soil Types of North Bengal Region U. Chakraborty, B. N.Chakraborty, A. Saha, P. L. Dey and K. Sunar Immuno-Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri- 734013, West Bengal, e. mail: [email protected] -A large number of microbes were isolated from soil samples of forests and river basins, as well as rhizosphere of plantation and cultivated crops of six districts of North Bengal- Darjeeling, Jalpaiguri, Cooch Bihar, Malda, Uttar and Dakshin Dinajpur. The isolates included 478 fungi, 32 Actinomycetes and 22 bacteria. Predominant fungi belonged to Aspergillus group with A. niger, A. melleus, A. clavatus, A. flavus, A. fumigatus, A. terreus and A. carneus. Other fungal isolates included species of Penicillium, Trichoderma, Rhizopus, Fusarium, Acremonium, Curvularia, Drechslera and Macrophomina. They were tested for functional diversity in terms of phosphate solubilizing, cellulose degrading and antagonistic activities against pathogenic fungi. Phosphate solubilizing activity was detected in vitro using PKVK agar medium. Among the isolates, 91 fungi, 5 bacteria and 23 actinomycetes showed positive activity. Trichoderma species produced both extra- and intra-cellular cellulose in culture. In vitro pairing of isolates with plant pathogenic fungi such as Fusarium graminearum, Sclerotium rolfsii, Colletotrichum


gloeosporoides and Macrophomina phaseolina revealed that T. harzianum and T. viride, as well as three isolates of non-streptomyces species of Actinomycetes had antifungal activity. Immunological formats were developed for screening of biocontrol agents and phosphate solubilizing fungi directly from soil. Molecular diversity analyses of selected PSFs, BCAs, as well as bacteria were carried out with different RAPD DNA markers. For identification, PCR amplified products of ITS region of genomic DNA of 19 isolates of Trichoderma sp. of 600 bp have been obtained using specific primer pairs. Partial sequences of T/ITS1-5.8S- T/ITS 2 region of all these isolates were determined and their molecular diversity analyzed by phylogenetic tree in comparison with NCBI databases. Molecular Diversity of Rhizobium Isolates from different Agro-climatic Zones of Bihar S. K.Sinha, S. Kumar, Dayaram and V. K. Shahi Microbial Diversity laboratory, Department of Agricultural Biotechnology and Molecular Biology, Faculty of Basic Sciences and Humanities, Rajendra Agricultural University, Bihar, Pusa (Samastipur) - 848 125 Email: [email protected] - Although many bio-inoculants are considered as a substitute or alternative to the chemicals fertilizers, often their validity becomes a problem. Rhizobium strains are well established bio-inoculants among symbionts. Twenty strains of Rhizobium were isolated from different legumes viz. chickpea, pigeonpea, bakla and pea crops from different agro-climatic zones of Bihar. These strains were sub-cultured on YEMA medium and identified as Rhizobium isolates. The genetic variability was studied on the basis of 16S rDNA using gene specific primer pair 5’ CAAGATTGAACGCTGGCG 3’ forward and 5’ GGTTACCTTGTTACGACTTC 3’ reverse primer. Result indicated that a single band about 1500 bp was observed in all the strains in gel electrophoresis PCR analysis. However, the size of gene varied in RFLP-PCR analysis. Effects of Methyl Mercuric Chloride on Haploid Duplication Strain of Aspergillus nidulans S. N. Jha, S. Kumar and V. K Jha Microbial genetics and Applied biotechnology laboratory, LNMU, Darbhanga 846004 Email:[email protected] – Every test-system has some unique attributes and is quite apt for the detection of a specific genetic damage or events only, e.g., Allium

cepa for micronuclei formation, Saccharomyces cerivisiae for gene conversion, Neurospora crassa for the recombinational events and Aspergillus nidulans for somatic recombination. A.nidulans is also well known for the detection of haploidisation, mitotic crossing-over and detection of spontaneous or induced mutations ranging from point-mutations to large nucleotidic anomalies. The present study has enlarged the utility of A.nidulans for the detection of deletion as well, which leads at times to mitotic instability. Mercury, one of the heavy metals in pure state presents little or no hazard but the soluble compounds of this non-essential metal, methyl mercuric chloride causes environmental pollution and health hazard. Its effects are wide ranging encompassing the inhibition of growth and development, reduction in chlorophyll pigment and photosynthetic efficiency, decrease in nitrogenise activity and above all, induction of cytological abnormalities in plants. The strain used was a gift from Prof. J. A. Roper, University of Sheffield, U.K. along with information on general techniques and terminologies to be used. The present study aimed to detect genetical effects of methyl mercuric chloride relies on the singular inherent feature of the haploid duplication strain, i.e., the strain is mitotically unstable and gives rise to normal sectors as a result of deletion of the translocated segment. The genetical studies suggested that methyl mercuric chloride enhanced mitotic instability both in the haploid as well as newly synthesized diploid duplication strain of A. nidulans. The earlier appearance of novel recombinant sectors, coupled with their higher frequencies in a dose dependent manner arising out of deletions of the translocated segments confirmed the superiority of the test-system for the detection of deletion inducing agents. In addition, the diploid duplication strain appeared to have an edge over the haploid duplication strain in respect of the detection of the deleting agents. Further studies will throw light on the use of the duplication strains for gene amplification and inter specific gene expression. Isolation and Characterization of Plant Growth Promoting Rhizobacteria From Rice Crops of Eastern Uttar Pradesh S. K. Shahi, A. K. Rai, M. B. Tyagi1, R. P. Sinha2 and A. Kumar School of Biotechnology, 1Dept. of Botany, MMV and 2CAS in Botany, Banaras Hindu University, Varanasi-221 005, U.P., India Email:[email protected] - Plant associated nitrogen-fixing bacteria have been considered as one of the possible alternatives for inorganic nitrogen fertilizer for promoting plant growth by various direct or indirect mechanisms. In the present


study we have made an attempt to isolate and characterize plant growth promoting rhizobacteria from rice fields of eastern Uttar Pradesh. Altogether 295 nitrogen-fixing bacteria were characterized based on differences in morphological characters, such as colony morphology, size, colour, elevation and mucilage formation were isolated from rhizospheric soil. On the basis of similarity index, plant growth promoting activities and molecular diversity among all the 295 isolates, 99 isolates were characterized as distinct morphotypes. Molecular characterization was made by ARDRA, DGGE and 16S-rDNA sequencing. These isolates were screened in detail for their plant growth promoting traits namely, nitrogenase activity, production of indole acetic acid (IAA), siderophore (Fe-III chelating agent), and phosphate solubilization. Results showed that 72 (72.7%) isolates are IAA producer, the value of IAA production ranged from 10 to 353 µg IAA/mg protein. Siderophore production and phosphate solubilization were exhibited by 37 (37.3%) and 22 (22.2%) isolates, respectively. ACC deaminase activity and cyanide production were also noticed in certain isolates. Level of ACC deaminase activity was observed in the range of 28.15 to 294 nmol á-ketobutyrate/mg protein/h. Seven efficient plant growth promoting isolates were identified on the basis of 16S rDNA sequencing. These isolates were identified as Pantoea agglomerans V1S7 (EU040249), Bacillus megaterium J1S9 (EU040252), B. megaterium M2S7 (EU040253), Microbacterium sp. J2S10 (EU040255), B. megaterium G1S3 (EU040256), Cronobacter turicensis M2S10 (EU040257), and Sphingomonas sp. C3S5 (FJ012066). Our findings suggest that these isolates may be exploited for developing a potential source of biofertilizer. Diversity and Relative Dominance of Hyphomycetous Fungi in Soils of Aurangabad N. Wahegaonkar, S.M. Salunkhe, P.L. Palsingankar, S.Y. Shinde Botany Research Center, Vasantrao Naik Mahavidyalaya,Aurangabad Email :[email protected] - Soil is one of the most important habitats for microorganisms like bacteria, fungi, yeasts and nematodes. The filamentous fungi are the major contributors to the soil biomass. Their activity results in the degradation of toxic substances in the soil. It has been found that more number of genera and species of fungi exist in soil than in any other environment. Twenty three soil samples of three ecosystems in and around the city of Aurangabad were investigated for total number of organisms and the specific composition of hyphomycetous fungi. The

isolation was done by serial dilution plate technique using different media. The Berger- Parker dominance index (d) was calculated at the genus level. The 45 genera were classified as dominant, general or rare according to the dominance index. The genera were distributed as per the dominance index. Genera with d > 0.1 were considered as dominant genera. Genera with d between 0.1 & 0.05 were called general genera whereas those having d < 0.05 were considered as rare. The dominant genera in all the ecosystem types were also studied. Aspergillus, Cladosporium, Alternaria, and Penicillium were dominant in all the three types of soils. Genera like Alternaria, Cladosporium, Curvularia, Drechslera, Fusarium, Gliocladium, Gleosporium, Geotrichum, Humicola, Monodyctis, Myrothecium, Penicillium, Pacelomyces, Phialomyces, Scopulariopsis, Stachybotrys, Staphilotrichum, Trichoderma, Verticillium, and Verticicladiella were the genera with general abundance. Fifteen genera in agricultural field soils were found to be rare in distribution. There were seventeen genera with rare distribution in barren land soils. No genus was under the class rare in the garden soils. Enzyme Production By Some Aspergillus species N. Wahegaonkar, P. L. Palsingankar, S. M. Salunkhe, S. Y. Shinde Botany Research Center, Vasantrao Naik Mahavidyalaya, Aurangabad, MS. Email:[email protected] - Aspergillus species are ubiquitous in existence and are known to produce a wide range of economically important extracellular enzymes that have extensive application in industries like food, starch, textile, cosmetics, animal feed, chemicals and biomedical products. It also has a role to play in spoilage of food stuff and degradation of complex organic matter in the soil. Nearly 40 Aspergillus strains were isolated from different sourcesand tested for the ability to produce extracellular enzymes namely amylase, pectinase and phosphatase. The screening was conducted on solid media, in Petri plates for amylase and in tubes for phosphatase production. Viscometric method was used to test pectinase production. The results indicate that most of the isolates were capable of producing one or the other hydrolytic exoenzyme. Aspergillus carboniferous, A. tubingensis, A. restrictus, A. flavus, A. ornatus, A.sparsus and A.ochraceus were excellent producers of pectinase. A. terreus, A. ochraceus and A. ornatus were excellent producers of amylase. A. tubingenesis, A. sparsus, A. carboniferous were excellent producers of phosphatase.


Fungicide Sensitivity and Morphological Variation of Gleosporium ampelophagum S. S Chavan, R. Ahmed, and V. C. Khilare Department of Botany, Vasantrao Naik Mahavidyalaya, Aurangabad 431003 Email: [email protected] - Anthracnose of grapes is caused by Gleosporium ampelophagum. It is a serious disease in orchards of grapes in Maharashtra State. Altogether 37 isolates were collected from different grape growing districts of Maharashtra to study the morphological variation and fungicide resistance. Carbendazim and difenoconazole were used against G.ampelophagum for the sensitivity test. It was observed that the MIC of sensitive population 0.1 µg/ml to 0.8 µg/ml against carbendazim. However, the resistant isolate were 100 to 30,000 µg/ml. The MIC of difenoconazole against G.ampelophagum was 3 to 12 µg/ml. The morphological variations amongst isolates were studied by observing the colony characters and measurements of conidia. Biochemical and Molecular Characterization of Streptomyces sp. Isolated from Agricultural Field of North Bengal

B. N. Chakraborty, U. Chakraborty, P. Ray, P. L. Dey

Immuno-Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri-734013, West Bengal, email : [email protected] - Streptomycetes are a group of Gram positive actinomycetes which are mainly found in the rhizosphere of plants in association with other beneficial microorganisms like rhizobacteria and fungi. Eighteen streptomycetes isolates were obtained from different agricultural fields of North Bengal. Their morphological attributes such as the colour of colony, production of coloured pigment in the culture media, colour of the aerial spore mass and a number of biochemical tests performed on them confirmed them as being streptomycetes. Biochemical tests which are confirmatory for streptomycetes were executed to determine whether the isolates have the ability to hydrolyze starch, produce catalase and indole ring. The results confirmed them as streptomycetes. They were also screened for phosphate solubilization activity in Pikovskaya agar medium. Among these, 15 isolates showed the ability of solubilizing phosphate by producing a transparent halo zone around the colony. Quantitative evaluation of phosphate solubilization activity of the isolates in liquid medium was performed. In vitro antagonistic activity of some of these isolates

against fungal pathogens Fusarium graminareum, F. solani and Sclerotium rolfsii were also confirmed by dual culture method. Soluble proteins prepared from the isolates were analyzed by SDS PAGE. Genomic DNA of 15 streptomycetes isolates was prepared and 16S rDNA was amplified using universal primers. PCR products were subjected to horizontal electrophoresis. The primers were used to amplify nearly full-length 16S rDNA sequences and yielded 1.5kb product. These isolates were identified as strains of Streptomyces griseus and Streptomyces griseolus. In vivo evaluation of the growth promoting activity of these isolates on Phaseolus vulgaris revealed that among the tested isolates S. griseus (ARHS-PO-26; accession no- 2578) and S. griseolus (ARHS-PO-17; accession no- 2576) showed maximum growth promotion. Characterization of Antagonistic Bacteria Isolated from Tea Rhizosphere in Sub-Himalyan West Bengal as Potential Biocontrol Agents in Tea G. Dhar Purkayastha, A. Saha1 and D. Saha 1Plant Biotechnology laboratory, Department of Biotechnology, University of North Bengal, Siliguri-734013, 2Molecular Plant Pathology and Fungal Biotechnology Laboratory, Department of Botany, University of North Bengal, Siliguri-734013. Email: [email protected] Tea (Camellia sinensis (L.) O Kuntze) is the most widely consumed beverage in the world but the plantation is largely prone to attack by several fungal pathogens. Biological control has the potential to manage crop diseases while causing no or negligible injurious impact on the environment. In the present study, 200 bacterial strains were isolated from tea garden rhizosphere soil of sub-Himalayan region of West Bengal and Assam, and were screened for in vitro antibiosis towards Lasiodiplodia theobromae, Rhizoctonia solani, Sphaerostilbe repens, Fomes lamaeonsis, Poria hypobrunae, Colletotrichum camelliae and Pestalotiopsis theae. Thirty five bacterial strains exhibited antagonistic activity against all the pathogens. Identity of two of the most potential strains was confirmed by phylogenetic analysis following PCR amplification and sequencing of 16S rRNA gene. Studies on antifungal metabolites secreted by the isolated bacterial strains confirmed the presence of several hydrolytic enzymes like chitinase, protease, lipase, amylase, cellulase etc. and growth promoting metabolites like IAA and siderophore. Antifungal metabolite from strain ETR17 was analyzed by thin layer chromatography. Bioautography with concentrated culture filtrate revealed the presence of an active compound with an Rf value of 0.3. This compound


showed a yellow-brown fluorescence under UV light source on spraying Borntrager reagent on developed TLC plates indicating the presence of anthrones. In vivo studies showed significant reduction of diplodia disease produced by L theobromae in tea plants pretreated with isolated bacteria. Studies on sensitivity of the isolated bacterial antagonists to chemical fungicides viz. thiophanate methyl, bavistin, captan and mancozeb revealed that they were highly resistant to all the tested fungicides. These activities are relevant to the integrated pest management and organic farming in India. Documentation of Mycoflora Associated With Overburden Dump Soil of Samleshwari Open Cast Project of Mahanadi Coalfields Limited A. K. Roy, A. N. Singh, N. L. Mandal and A. Rani University Department of Botany T. M. Bhagalpur University Bhagalpur-812007. Email: [email protected], [email protected] - During the open cast method of coal mining, a large quantity of soil is excavated and deposited at another place which generates heaps termed as overburden dump (OBD). The newly generated OBD has poor soil nutrients and microbial diversity, but in due course of time soil particles are settled down and allow native natural vegetation to grow. It also promotes retrieval of microflora which play an important role to enrich the soil profile of OBD. Change in microbial diversity is a natural biological event but is to be studied to develop biofertilizer package for the plantation over OBD. An investigation was aimed to document fungal isolates inhabiting in the OBD soil of Samleshwari open cast project of IB valley area of Mahanadi Coalfields Limited (MCL). Altogether 25 fungal species belonging to different taxonomic group were isolated from different aged OBD. Fungal genera viz, Aspergillus, Alternaria, Fusarium, Mucor, Penicillium, Rhizopus and Verticillium with different species were noticed as most dominant fungi and occupied most of the OBD soil of different age group. These microbes were stored under laboratory condition for further experimental work.

Dominant Rhizosphere Bacteria As A Source of Antifungal Agents and PGPR A. Ghosh, A. Saha1 and D. Saha

1Plant Biotechnology laboratory, Department of Biotechnology, University of North Bengal, Siliguri-734013, 2Molecular Plant Pathology and Fungal

Biotechnology Laboratory, Department of Botany, University of North Bengal, Siliguri-734013. Email: [email protected] Beneficial microorganisms are generally those involved to improve plant growth and to control phytopathogens by a combination of mechanisms. These beneficial microorganisms can be exploited as biocontrol agents so as to reduce extensive usage of chemical fungicides. In the current study, 104 bacterial strains were isolated from some important crop rhizosphere of sub-Himalayan region of West Bengal. These were subject to test for their antagonistic activities against plant root pathogens Fusarium equiseti and Fusarium solani, both cause wilt in a number of plants. The target pathogens were selected based on their agronomic relevance as pathogens. Twenty strains were found to be potentially antagonistic against both the pathogens. The antagonists were further tested for siderophore production and all were found positive with 14 strains producing hydroxamate and rest six producing catecholate type of siderophore. Quantification of siderophore showed strain S1 to produce the highest amount of siderophore followed by CON1 and S4. All isolates were studied for in vitro characteristics of PGPR including phosphate solubilization, IAA production, and different hydrolytic enzyme production like chitinase, pectinase, and cellulase. Many were found to possess PGPR qualities as well as produced extracellular lytic enzymes. SEM studies indicated mycelial deformities and lysis of hyphae of the pathogens when grown in presence of antagonists in dual cultures in vitro. Three isolates showed good potential to be further formulated for large scale field application.

Rhizosphere Mycoflora of Citrus reticulata and Their Diversity Analysis B. N. Chakraborty, U. Chakraborty, S. Allay, S. Khati, U. De and P. L. Dey Immuno-Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri 734013, West Bengal, India, e-mail: [email protected] - Thirty five fungal isolates were obtained from rhizosphere of mandarin (Citrus reticulata) plants grown in Darjeeling hills following serial dilution and root maceration. They were screened for phosphate solubilizing activity in Pikovskaya’s medium. Four fungal isolates showed formation of halo zone in PVK medium indicating phosphate solubilizing activity. These isolates were further taken up for evaluation of phosphate solubilization potential in the liquid medium amended with tri-calcium and rock phosphate. Screening of AM fungi from the rhizosphere of mandarin plants from various altitudes of Darjeeling hills yielded predominant association of Glomus mosseae, G. intradices, G.


fasciculetum, Gigaspora margarita, Gi. rosea, Gi. gigantea along with Acaulospora spinosa and Scutellospora. The average colonization was 75% whereas spore count per 100 m of soil was about 70-72%. It has been observed that in the winter season species of Gigaspora produce huge amount of spores where as population of Glomus thrives best in summer. PCR based molecular characterization of 15 predominant fungal isolates were done using ITS region specific primer pair keeping annealing temperature of 59 C with good product yield and min non-specific amplification. The product size was approx 620 bp – 800 bp with the size variation across the isolates. RAPD profile was also obtained using six random decamers from Operon technology. All reproducible polymorphic bands scored and analyzed following UPGMA cluster analysis protocol and computed into similarity matrix using NTSYS computer programme. A dendogram was made with similarity coefficient ranged from 0.67 – 0.95. Homology Modelling of Nif H Proteins from Frankia A. Sen, S. Sur, A. Bothra1, L. Tisa2 and U. Mondal1 NBU Bioinformatics Facility, Department of Botany, University of North Bengal, Siliguri-734013, 1Department of Chemistry, Raiganj (University) College, Raiganj -733134, India, 2Department of Microbiology, University of New Hampshire, Durham, 03824, USA. Email:[email protected] - Nitrogenase is a two component enzyme system, one consisting of iron protein and the other molybdenum-iron protein working together to fix atmospheric nitrogen. The NifH protein contains an iron-sulfur cluster performing different functions during nitrogen fixation. Frankia is an actinomycete, entering into symbiotic association with a number of dicotyledonous plants and fixing nitrogen. Ccrystal structure of nitrogenase iron protein is not available so far from Frankia owing to problems associated with its slow growth and subsequent purification of the proteins. The structure of the Frankia NifH protein was determined using homology modelling technique. Metal binding sites and functionally important regions of the protein were analyzed. Thiol ligands and active sites help in protein functioning and conformations. Clefts and cavities contain biologically important residues. Site-directed mutagenesis results reveal that mutations in functional residues hamper nitrogen fixation. The structure is rigid with an accessible surface for solvents. The postulations made in this model may be confirmed experimentally using X ray crystallography for superior understanding of the biochemistry of Frankia

nitrogenases and opening newer possibilities for exploring the molecular mechanism of nitrogenase activity in Frankia. Indexing for Production of Virus Free Planting Material of Apple A. Handa, P. D. Thakur, Usha and M. Tomar Department of Mycology and Plant Pathology, Dr. Y S Parmar University of Horticulture and Forestry, Nauni, Solan 173230 Himachal Pradesh, India. email: [email protected] - Apple is cultivated on a commercial scale in the hill states of India including Himachal Pradesh situated in the Western Himalayan region of India. Himachal Pradesh is fast emerging as the leading apple growing state of India. Economy of Himachal Pradesh is largely dependent on apple cultivation. Of late, viruses have been observed to be a major constraint in declining apple productivity in the state. Systematic work on the identification of virus and virus-like diseases have revealed that apple mosaic virus, apple chlorotic leaf spot virus, apple stem grooving virus, apple stem pitting virus and apple scar skin viroid are invariably associated with commercial apple plantations in Himachal Pradesh with an incidence as high as 30%. Biological indexing using woody indicators (Golden Delicious and R 12740 A clone) and serological indexing using ELISA have been employed for detecting virus infections and selection of true to type good quality trees of commercial cultivars and rootstocks. The technique for the production of virus tested plants of some commercial cultivars and rootstocks of apple using meristem tip culture has also been standardized. Virus tested plants of apple cvs. Vance Delicious, Golden Delicious, Starkrimson, Well Spur, Starking Delicious, Tydeman’s Early Worcester, Oregon Spur, Royal Delicious, Red Chief, Silver Spur, Red Spur, Top Red and Golden Spur Delicious and some clonal rootstocks (M 7, M 9, M 26, MM 106 and MM 111 and M 793) have been planted and maintained in isolation at different research stations of Dr. Y S Parmar University of Horticulture and Forestry situated in apple growing districts of the state. The elite foundation stock is serving as a source of disease free budwood for raising virus tested nurseries. Studies on Pathogenic Variation and Management of Fusarium Head Blight (Fusarium graminearum) of Wheat M. S. Saharan, A. K. Sharma, B. S. Tyagi, K. Pal and S. S. Singh Directorate of Wheat Research, Karnal, Haryana, 132001. Email: [email protected] -


Fusarium head blight or head scab of wheat caused by Fusarium spp. is a devastating disease that causes significant yield and quality losses in humid and sub-humid regions of the world. Currently head scab is of minor importance to India but due to global climate change, there are chances of having more rainy days and high precipitation during the time of anthesis which will make wheat vulnerable to head scab. During 2005, due to continuous rain in Mar in Punjab, head scab appeared in severe form on durum variety in Gurdaspur area of Punjab. Growing of resistant varieties is one of the most effective measures to control the disease. Unfortunately, wheat cultivars in India are susceptible to FHB. For applying efficient strategies in the breeding process, knowledge about the pathogenic diversity is indispensable. For studying the pathogenic variability in head scab pathogen of wheat, 11 varieties viz, WH 542, PDW 291, PBW 550, DBW 17, HS 420, DBW 16, VL 829, PDW 233, RAJ 3765, Sonalika and MACS 1967 were artificially inoculated with 11 F. graminearum isolates (Wellington isolates) with cotton web technique in crop season 2007-08. Spike and spikelet infection on wheat varieties were recorded 14 d after inoculation. There were significant variations in spike and spikelet infections on wheat varieties. During 2007-08 crop season, seed treated with bioagents along with control (un-treated seed) of varieties DBW 16 and PDW 291 were sown in three replications in pots in a polyhouse. F. graminearum was inoculated in the wheat spikes at mid-anthesis. There was a significant reduction in spikelet infection with all the bioagents as compared to control in variety DBW 16. There was also reduction in spikelet infection with seed treatment of bioagents in PDW 291 but disease control was less as compared to that in DBW 16. The variation in suppression of disease with bioagents on two wheat varieties may be due to the genetic background of host variety, although differences in disease severities were very low. Studies on Polygalacturanase Production by Fusarium oxysporum f.sp lycopersisci Isolated from Tomato (Lycopersicon esculentum) N. Devi. D and C. Srinivas Department of studies in Microbiology & Biotechnology, Jnanabarathi Campus, Bangalore University, Bangalore 560056 Email:[email protected] Twenty five isolates of Fusarium oxysporum f. sp lycopersisci (Fo-1 to 25) isolated from tomato fields in Karnataka were screened for polygalacturanase enzyme production by agar plate screening method. Most of the isolates were positive for polygalacturanase production as evidenced

by the formation of clear zones around the colonies. Ten strains were selected and grown in synthetic medium supplemented with pectin for 5d. Polygalacturanase activity was determined in the culture filtrates by measuring the release of reducing sugars from pectin by dinitro salicylic acid method using galacturonic acid standard. Moderate to very high extracellular polygalacturanase activities were detected in most of the cultures except in Fo-13 which showed a very low activity. The protein content of the filtrates was determined by Lowry’s method. To visualize the protein and to determine its molecular weight, filtrates were concentrated by acetone precipitation and subjected to SDS PAGE.

Defining Key Metabolite Changes in Pathogenic Interactions With Tea B.N.Chakraborty and Luis AJ Mur1

Immuno-Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri 734 013, West Bengal, INDIA email:[email protected]; 1Institute of Biological, Environmental and Rural Sciences, Aberystwyth University, Aberystwyth, Ceredigion SY23 3DA, UK email:[email protected]. Exobasidium vexans one of the most destructive fungal pathogens of tea causing blister blight disease leads to enormous crop loss. There is a considerable interest in developing approaches that would lead to the generation of resistant or more tolerant varieties as well as in methods for the early detection of pathogen. Metabolomics is a developing post-genomic technology which focuses on small metabolites from organelle, cell, tissue, organ and organism. Metabolite fingerprinting provides a specific chemical signature employing nuclear magnetic resonance (NMR) or mass spectroscopy (MS) which may be used in breeding programs and early detection. Using Fourier Transform Infra Red (FT-IR) spectroscopy, a metabolite fingerprinting was obtained from tea plants grown in various plantation sites of Darjeeling hills challenged with E.vexans. Three variable infection stages viz, early stage 1 (S1, purple spot), blister stage 2 (S2, showing hyperplasia and blisters), necrotic stage 3 (S3, necrosis) along with health leaf samples (H) were assessed. The derived spectra were analyzed using multivariate analyses, mainly discriminant function analyses (DFA). The DFA model demonstrated that irrespective of the original plantation from which samples were obtained, clustering was based on infection stage. All infection stages separated from healthy controls, but necrosis stage formed a discrete separate cluster, this was not the case for early and blister stages indicating that the algorithm was unable to discriminate between metabolite signatures for those two stages. There was


also some evidence of discrimination according to some plantations sites. Examination of the axes along which clustering occurred showed that DF1 mainly described variation due to infection stage, whilst DF2 described changes which were common to each infection stage. DF1 appears to indicate a greater contribution from aromatic and polysaccharides metabolites as a common response in infection at all stages. General and stage specific responses to infection appear to involve changes in fatty acids and amide groups. Brachypodium distachyon: A Model Species to Study Cereal-Pathogen Interactions L. A. J. Mur, Andrew P M Routledge, J. William Allwood1, Joel V. Smith, Royston Goodacre1 and David F. Garvin2. IBERS, University of Aberystwyth, 1Manchester Interdisciplinary Biocentre, University of Manchester, 2USDA-ARS Plant Science Research Unit, University of Minnesota, St. Paul, MN, USA, Email :[email protected] - Brachypodium distachyon is rapidly emerging as model grass species for temperate cereal crops. Due to its undemanding growth requirements, small stature, inbreeding reproductive strategy and particularly its small genome (~ 320 Mbp; 2x = 2n = 10), this species is being adopted by a large number of researchers. Since it was first proposed as a model species in 2001, genetic stocks have been derived from single seeds, and a high throughput transformation system based on Agrobacterium has been developed, which will eventually lead to a considerable collection of T-DNA tagged lines. Most importantly, the US Department of Energy Joint Genome Institute has completed a checkpoint assembly of the Brachypodium genome sequence. This is complemented by a deep EST-mining initiative which will generate 180,000 ESTs to facilitate the annotation of the Brachypodium genome. Further, in the near future recombinant inbred lines will be available to community. Thus, there is now a clear imperative to exploit these emerging Brachypodium resources to answer biological questions. Losses in cereal crops from diseases are estimated at 13.3%, and so Brachypodium holds great promise as a surrogate for understanding resistance to a variety of major cereal diseases. Brachypodium-pathogen interactions where different levels of resistance have been described include rice blast (Magnaporthe grisea) and the rusts. This includes brown rust (Puccinia recondita) and yellow rust (P. striiformis). More recently, compatible interactions between Brachypodium and crown rust (P. coronata) and stem rust (P. graminis) have been reported. We have yet to isolate a powdery mildew fungus which is virulent on B. distachyon, though

susceptibility to this pathogen has been reported in the literature. Therefore, Brachypodium can be used by the community of cereal pathologists to study multiple pathosystems. An example of the potential of Brachypodium to reveal key aspects of responses to pathogens is its interaction with M. grisea, which has been extensively characterised. Metabolomic approaches have revealed key non-polar changes linked to resistance to M. grisea in Brachypodium, and implicated octadecanoid products as key mediators of resistance. Screening of subtractive cDNA libraries identified early changes in host gene expression which suggested a rapid induction of phenylpropanoid biosynthetic genes. The expression of some of these genes proved to be influenced by the octadecanoid product jasmonic acid. These initial successes suggest that Brachypodium is poised to serve as a powerful system for exploring resistance to many other cereal diseases as well. Biochemical Characterization of Defence Proteins (PR-2 and PR-3) of Tea Plants Triggered By Exobasidium Vexans, Their Immunogold Localization and Induction for Systemic Acquired Resistance B. N. Chakraborty and M. Sharma Immuno-Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri-734013, West Bengal, email: [email protected] - Blister blight disease of tea caused by Exobasidium vexans, represent a major source of loss in the yield of tea in Darjeeling hills. The defense strategy of tea plants against E. vexans are multifold and include accumulation of pathogenesis related (PR) proteins. Association of defense enzymes with resistance in tea plants triggered by E. vexans revealed significant changes in the level of β-1-3-glucanase (PR-2) and chitinase (PR-3) exhibiting antimicrobial activity. Accumulation of defense proteins differed in time and magnitude. Time course studies pointed towards accumulation of PR-2 and PR-3 in early hours and finally the antifungal metabolites that confer resistance to the plants. Treatment with salicylic acid (SA) stimulated a multi-component defense response in plants which was confirmed by immuno-localization of PR-2 and PR-3 in tea leaf tissues following induction of resistance. Induction of PR-3 in suspension-cultured tea cells following SA treatment was confirmed immunologically using antibody probes (PAb-chitinase). Subcellular localization of PR-3 and PR-2 in tea leaves were also confirmed by indirect immunogold labeling. Hexaconazole, a promising fungicide for control of blister and tridemorph (Calixin)


an anti-sporulant was applied in recommended doses and their effects were analyzed for induction of resistance associated with synthesis of PR-2 and PR-3. Aqueous leaf extracts of Catharanthus roseus, a bioresource was also found to be effective in management of blister blight disease in field. Treatment of tea plants with hexaconazole, calixin or phytoextract of C. roseus induced accumulation of the defence enzymes chitinase and β-1-3-glucanase, which reduced the disease incidence significantly. Induction of PR-2 and PR-3 in treatment with hexaconazole, Calixin and C. roseus were characterized biochemically and immunologically using antibody probes (PAb-chitinase and PAb-β-1, 3-glucanase). The PR-proteins were induced and chitinase activity was rapid in all interactions. Ultra thin sections from induced tea plants embedded in LR-white resin separately treated with PAb-chitinase and PAb- β-1, 3-glucanase followed by gold labeling revealed increased number of gold particles showing a higher frequency with the PAb-chitinase probe. Tea varieties that are apt to intensively induce such proteins are ought to be agriculturally important and can greatly draw attention of plant breeders. Molecular Dynamics Simulation Of PR-1 Protein from Solanum Tuberosum Provides An In-Depth View on Its Structural Features S. Thakur, A. Bothra1 A . Sen 1Department of Botany, University of North Bengal, Siliguri-734013, 2Department of Chemistry, Raiganj (University) College, Raiganj 733134, India, Email: [email protected] - The resistance response to a variety of pathogenic invasions in plants is often accompanied by production of several host protein referred to as pathogenesis related protein. These proteins are a major defense strategy of plants in major pathological situations. Among the various PR proteins, PR-1 is the most abundant and widely found protein but its functionality still raises many questions. The PR-1protein of Solanum tuberosum form an integral part of the host defense system. The unavailability of the crystal structure of the PR protein of S. tuberosum further prompted us to undertake molecular modeling technique to look into the active sites and infer upon the structure function relationship. The model was built using 1CFE as template. The constructed refined model was then subjected to molecular dynamics simulation using the software GROMACS to understand the motional properties and mode of action of the protein. The trajectory of the simulation was further analyzed

using the tools root mean square deviation (RMSD), root mean-square fluctuation (RMSF) and radius of gyration to reveal the flexibility of the protein. The fluctuation of the functionally important residues His72, Ser73 and His117 was monitored during the whole simulation run. Changes in the secondary structure of the protein during the simulation were also noted. All these studies help us to highlight the mechanism of working of the PR-1 proteins. Current Disease Scenario of Bt. Cotton Hybrids in Haryana J. Beniwal Department of Plant Pathology, CCS Haryana Agricultural University, Hisar125 004 Email: [email protected] - Among the various field crops, cotton is one of the most important fibre and cash crop of India. In Haryana, total area under cotton cultivation has been estimated to be 4,78,000 and 5,20,000 ha during kharif 2008-09 and 2009-10 crop seasons. The area under Bt. cotton hybrids has also been increasing year after year since the release of Bt cotton hybrids. During the two crop seasons, the Bt cotton occupied about 85 to 92% of the area. Like other field crops, cotton is also known to be attacked by several plant pathogens viz, fungi, bacteria and viruses. These pathogens cause heavy losses in seed cotton yield of Bt hybrids. An attempt was made to record the incidence of various diseases of Bt. cotton in Haryana. The survey was conducted during kharif 2008 and 2009 crop seasons to record time of occurrence, time of appearance and progress of various cotton diseases in traditional and non-traditional cotton growing regions of Haryana state. Most of the commercially released Bt cotton hybrids were found susceptible to bacterial leaf blight, cotton leaf curl virus, leaf spots, root rot, sudden wilt and boll rot. Seedling diseases due to species of Rhizoctonia, Colletotrichum, Fusarium and Xanthomonas were widely prevalent during the early periods i.e. May to Jul. Bacterial leaf blight was at first recorded on Bt cotton in the first week of Jun in Hisar, Fatehabad and Sirsa districts. Fungal foliar diseases namely Myrothecium leaf spot, Cercospora leaf spot, anthracnose and Alternaria leaf spot were prevalent during the month of Jul-Oct in cotton growing traditional and non-traditional districts of Haryana. Cotton leaf curl virus disease did not appear throughout kharif 2008 but observed during kharif 2009. Root rot disease was recorded in all the districts surveyed during both crop seasons. The problem of sudden wilt in Bt cotton hybrid was also observed throughout the state during both the crop seasons.


Impact of Flag Smut of Wheat Caused By Urocystis agropyri on Physiological Parameters, Yield and Its Components in Wheat Varieties Dharamvir and M. S. Panwar Department of Plant Pathology, CCS Haryana Agricultural University, Hisar-125 003, India. Email:[email protected] - Twenty one commercially grown wheat varieties in northern India, were evaluated against flag smut (Urocystis agropyri Preuss) Schroet) of wheat for different yield reducing characters under artificially inoculated conditions in field. Reductions were high in WH-147 (64%) and WH-416 (56%) whereas low in UP-2435 (0.40) and WH 291 (0.41%). The reductions in tillers/plant (44%) were high in WH-147 and PBW-343 (44%) low in WH 291 (0.5%) and WH 896 (0.54%); it was 1.06% in UP-2425. In all resistant cvs, it ranged between 0.50-1.06%. Plant height was not significantly reduced in resistant cvs. whereas it reduced significantly in susceptible and highly susceptible cvs. (by 0.35 to 59.7%). Ear length in resistant cvs. did not reduce significantly but reduced significantly in susceptible cvs. Reduction in height, due to flag smut, ranged between 0.09 to 44%. Test weight (1000 grain wt) was also adversely affected and it reduced significantly in susceptible cvs. This reduction in resistant cvs. ranged from 0.21 to 0.43% but was between 19 to 38% in susceptible cvs. Respiration rate of inoculated seeds of highly susceptible and susceptible varieties increased around 6% as compared to control. In resistant varieties, respiration increased by around one per cent compared to 14-25% in susceptible varieties. Leaf area reduced significantly (i.e. more than 55 and 45%) in susceptible varieties and no reduction was noticed in resistant varieties. Heavy Metal Tolerance and Accumulation By Bacterial Strain from Waste Water S. N. Sinha and M. Biswas Environmental Microbiology Research Laboratory, Department of Botany ,University of Kalyani, Kalyani, Nadia, West Bengal Email: [email protected] - The exploitation of microorganisms to remove heavy metals from polluted waters is now an area of extensive research and development. High concentrations of such heavy metals often pose a serious threat to biota and the environment of any ecosystem. In the present study attempts have been made to isolate and characterize metal resistant bacteria from a metal factory effluent discharged into the river Ganga. The sensitivity pattern of the selected bacteria against three heavy metals( lead,

chromium and cadmium) were studied and their in vitro intracellular metal accumulating ability was determined. Strain GM1 exhibited best tolerant response to 20 ppm lead and to 15 ppm chromium. This strain also accumulated significant amount of lead in the cell. Such strain would be of good as a biomediator microbe for lead pollution in aquatic environment. On the other hand, GM2 and GM3 accumulated significant amount of cadmium and chromium, respectively and exhibited better degree of tolerance to respective metal. Suggesting their use as bioaccumulator Isolation, Biochemical and Molecular Characterization of Salt-Tolerant Bacteria from Rhizosphere ff A Facultative Halophyte U. Chakraborty, B. N. Chakraborty, S. Roy, P. L. Dey and A. P. Chakraborty Immuno-Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri- 734 013, West Bengal, India Email: [email protected] - Nine salt-tolerant bacteria were isolated from rhizosphere soil of a facultative halophyte Cynodon dactylon, using soil dilution as well as direct plating method in nutrient agar medium, supplemented with 10% NaCl. Salt-tolerance characteristics of the bacterial isolates were further confirmed in mannitol salt agar. Based on their morphology and biochemical tests like starch hydrolysis, catalase, indole production, urease and gelatinase test, one isolate out of the nine could be identified as Staphylococcus group of bacteria. All the isolates could produce catalase, but showed negative results in urease tests. However, intensity of production of O2 by catalase differed among the isolates. Only two isolates could hydrolyze starch, five isolates liquefied gelatin while four had the ability to produce indole. All the isolates were also screened for phosphate solubilizing activity in vitro, but none of the isolates showed transparent halo zone on PVK medium. Soluble proteins prepared from these isolates were analyzed by SDS-PAGE. The bacteria showed distinct protein patterns, with molecular masses ranging from 12 to 106 KDa. For molecular characterization DNA was isolated from all the bacteria, checked for their purity by 260/280 ratio and also by agarose gel electrophoresis. RAPD profiles were also obtained using six random decamers from operon technology. All reproducible polymorphic bands were scored and analyzed following UPGMA cluster analysis protocol and computed in to similarity matrix using NTSYS computer program. A dendrogram was prepared with similarity co-efficient ranging from 0.55 to 0.75.


Microbial Recourses of North Bengal and Their Utilization in Agricultural Biotechnology B. N. Chakraborty and U. Chakraborty Immuno-Phytoapthology Laboartory, Department of Botany, University of North Bengal, Siliguri 734013, West Bengal email: [email protected] - Microorganisms are ubiquitous in nature and form vital components of all known ecosystems on earth. One of the fascinating aspects of microorganism in that some of them have evolved to thrive under conditions that are too harsh for animals as well as plants. Bacteria, actinomycetes and fungi are three major groups of soil inhabiting microorganisms. Human influences such as pollution and chemical application could adversely affect microbial diversity and perhaps above and below ground ecosystem functioning. Hence, there is now great interest to search for microorganisms which have potential to be used for sustainable crop production by promoting plant growth and suppressing soil borne plant diseases. Besides, there has been growing appreciation of the importance of plant and fungal interaction especially arbuscular mycorrhizal fungi (AMF) on terrestrial ecosystem which form critical link between the plant and soil by influencing plant nutrient cycling specially phosphorous and soil structure and make a large direct contribution to soil fertility and soil quality through contribution of soil organic matter. Root colonization by soil AMF is a dynamic process, which is influenced by several edaphic factors such as nutrient status of soil, seasons and VAM stains, soil temperature, soil pH, host susceptibility to VAM colonization and feeder root condition. Diversity of VAM in various plant root systems has been analyzed using molecular techniques. Penetration into the root and intercellular growth of the AM fungi involves a complex sequence of biochemical and cytological events and intercellular modifications, which imply that the fungus must be clearly recognized by the host plant. The response of plants to AMF involves temporal and spatial activation of different defense mechanisms. The activation and regulation of these defenses have been proposed to play a role in the maintenance in the mutualistic status of the association, however, how these defenses affect the functioning and development of AMF remains unclear. A number of regulatory mechanisms of plant defense response have been described during the establishment of the arbuscular mycorrhizal symbiosis, including elicitor degradation, modulation of second messenger concentration, nutritional and hormonal plant defense regulation and activation of regulatory symbiotic gene expression. AM fungi can play a major role in the quest for sustained plant productivity in all segments of

agriculture. Soil degradation involves disturbance of the balance by cultivation, monoculture, excessive inputs of agrochemicals and fertilizers, removal of organic matter from the soil by crop removal and accelerated decomposition without replacement and erosion. To maintain economic levels of productivity, farmers are being forced to increase inputs. Our goals should be to reduce chemical inputs for environmental and health reasons. VAM fungi need to be reestablished to a high level of effectiveness to offset the reduced inputs. The development of microbial consortia is a complex procedure that involves for companies not only the development of the necessary biotechnological know-how, but also the ability to respond to the specifically related legal, ethical, educational and commercial requirements. At present different formulated commercial products of AMF, PSF, PGPR, BCA are available in the market, which creates the need for the establishment of standards for widely accepted quality control. Biotechnology science linked to this industrial activity needs to be reinforced, particularly for development of molecular probes for monitoring microbial inocula in the field; for increasing knowledge on ecophysiology of AMF, PSF, PGPR and BCA in anthropogenically disturbed ecosystems; and for selection of new plant varieties with enhanced mycorrhizal traits and of AM fungi with new symbiotic traits. However, one of the main tasks for both producers and researchers is to raise awareness in the public about potentials of microbial technology for sustainable plant production and soil conservation. Dual Application of Glomus mosseae and Bacillus pumilus to Enhance Growth of Tea and Suppress Sclerotial Blight Disease B. N.Chakraborty, U. Chakraborty, U. De, A. P. Chakraborty and K . Rai Immuno-Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri – 734 013, India email: [email protected] - Among several AM fungi isolated from tea soil, Glomus mosseae was selected for dual application with Bacillus pumilus, a plant growth promoting rhizobacterium. Rhizosphere of five different tea varieties (TV-29, TV-25, TV-23, TV-26 and UP-2) was inoculated with the spores of G. mosseae at 40-45 spores in each pot. B. pumilus was applied as a soil drench @ 50 ml/pot (1.28×109c.f.u/ml) to the soil of tea plants 15 d after transplantation. In case of combined inoculation of G. mosseae and B. pumilus, spores of G. mosseae were inoculated prior to the application of B. pumilus. Application was done twice at an interval of one month. Inoculation with any of the


two microorganisms increased growth of plants but a significant increase was obtained in case of dual application. Growth of plants was measured in terms of increase in height, number of leaves and branches. In vivo phosphate solubilizing activities were assayed from inoculated potted soil in comparison to control. B. pumilus also showed antagonistic activity to Sclerotium rolfsii causing root rot of tea plants in vitro. Similarly, sclerotial blight of tea, caused by S. rolfsii, was suppressed to certain extent by B. pumilus or G. mosseae, but a significant suppression observed when G. mosseae was co-inoculated with B. pumilus. A sharp increase was found in polyphenolic activities which play a key role in disease suppression. All the four defense enzymes, phenyl alanine ammonia lyase, chitinase, β-1, 3 glucanase and peroxidase showed enhanced activities in treated plants. Western blot of the enzyme extracts from control and all treated plants using PAb raised against chitinase revealed distinct reaction in presence of pathogen. Immunological techniques were adopted to determine the population of S. rolfsii in soil using PAb raised against the pathogen and it was significantly reduced owing to application of G. mosseae and B. pumilus. Management of Microbial Inoculants for Reclamation of OBD in Eastern Coalfields, Lalmatia, Jharkhand A. N. Singh and A. K. Roy University Department of Botany, TM Bhagalpur University, Bhagalpur 812007 E-mail:- [email protected] - It is a matter of great challenge for Indian researchers to establish self sustaining soil plant system on overburdened dumps (OBD) soil. Their biological, chemical and physical profile are drastically altered due to open cast mining and deposition of coal spoils. It has been observed that one tonne of coal generates about 1.5-3 tonnes of OBD, which are generally known to be nutrient poor, water deficient and often lacking in the necessary organic matters essential for the establishment of micro- and macro-flora. Eco-restoration of such sites requires understanding of biological activity of soil important in facilitating uptake, storage and cycling of nutrients and water for the re-introduced plant species. The present communication reveals that the composition of microbial inoculants viz, mycorrhiza and nitrogen fixing bacteria depend on OBD soil profile and plant species growing over there. Four genera of AM fungi viz, Glomus, Gigaspora, Sclerocystis and Scutellospora and strains of asymbiotic (Azospirillum) and symbiotic (Rhizobium) nitrogen fixing bacteria were taken into

account to establish microbial inoculants with selected plant species viz, Dalbergia sissoo, Dendrocalamus strictus, Pterocarpus santalinus, Gliricidia sepium, Acacia mangium, Acacia cracicarpa, Stylo hamata, Stylo scabra, Sesbania grandiflora and Cassia siamea. Amongst the AM fungi, Glomus was the most predominant genus found in the mining area particularly associated with pioneer plants growing over there. The intensity of root infection with VAM fungi for all 10 introduced plants on OBD soil was also studied. Maximum infection was recorded in Sesbania grandiflora (98%) followed by Gliricidia sepium (94%) and the least infection was observed in case of Acacia mangium and Stylo scabra. During the reclamation program, it was also observed that the leguminous plants were found to develop a large number of nodules containing symbiotic nitrogen fixing bacteria along with AMF and as such it is established that this combination of microbial inoculants along with vermicompost was proved to be a suitable microbial inoculants package for the reclamation of open cast coal mined OBD soils with some leguminous and non-leguminous plants. Selection of Bioantagonistic Pseudomonas flourescens for Biological Control of Fusarium oxysporum f. sp. lycopersici Causing Wilt of Tomato C. Srinivas & N. Devi. D Department of Microbiology & Biotechnology, Bangalore University, Janna Bharathi Campus, Bangalore-560 056, Karnataka, India Ph: 080-22961461. E- mail: srinivas_uom @rediffmail.com - Twenty different isolates of Pseudomonas flourescens were obtained from rhizoplane and rhizosphere soil of healthy and wilt diseased tomato plants grown in various cultivated areas of Karnataka. Three isolates, BS.1; BS.5; BS.18, of P. flourescens showed effective antagonistic activity against F.oxysporum in vitro and in vivo. Experimental studies revealed that the control mechanisms used by these P. flourescens isolates against the pathogen did not involve the secretion of fungal cell wall hydrolytic enzymes. On the other hand, these isolates showed good growth in various environmental conditions tested, such as pH, salinity, temp and Fe3+ conc, similar to that found at the field level. Effect of diffusible and volatile antibiotics produced by the P. flourescens isolates against the pathogen was also studied. The results obtained in our present study suggest that the three isolates of P. flourescens could be used as an effective biocontrol agent for F.oxysporum causing wilt of tomato in greenhouses studies and also at the field level.


Bioprospecting of Botanicals Against Phomopsis azadirachtae on Neem M. K. Sateesh Department of Microbiology & Biotechnology, Bangalore University, Bangalore-560 056. E mail: srinivas_uom @rediffmail.com - Neem or Margosa (Azadirachta indica A. Juss.) is an attractive broad-leaved, evergreen legendary medicinal tree. A. indica is derived from the Persian means: The Free Tree of India. It is grown from the southern tip of Kerala to the Himalayan hills, in tropical to subtropical regions, in semiarid to wet tropical regions, and from sea level to about 700 m elevation. A. indica has attracted worldwide prominence in recent years, owing to its wide range of medicinal properties. Neem has been extensively used in Ayurveda, Unani and Homoeopathic medicine and has become a cynosure of modern medicine. Neem elaborates a vast array of biologically active compounds that are chemically diverse and structurally complex. Neem contains several active ingredients, and they act in different ways under different circumstances. Neem products are unique in that they are not outright killers. The main feature is that most of neem compounds are chemically similar and biogenetically derivable from tetracyclic terpenes. They affect about 350 insect species, 25 spp. of bacteria, 15 spp. of fungi, 12 spp. of nematodes, 3 viruses, 2 spp. of snails and is reported as non-toxic to humans. Phomopsis azadirachtae Sateesh et al causes die-back disease of neem. At present die-back disease of neem is spreading alarmingly in different parts of India. The continued field survey revealed that neem trees well known for their ever green canopy now showing destructive nature of die-back disease. Presently, it is considered as a major crippling disease of neem and almost always causing 100% loss of fruit production in severely infected individual trees. This disease can be controlled by using carbendazim, but fungicides have hazardous effect on different components of the environment. Hence, efforts are made to screen botanical pesticides and only Lawsonia inermis gave promising results out of 25 plants tested. Effect of Biopriming with Biological Control Agents on Wilt and Growth of Cumin Y. K. Sharma, M. M. Anwer, S. K. Lodha1, S. Sriram2 and B. Ramanujam2 National Research Centre on Seed Spices, Beawer Road, Tabiji, Ajmer-305 206, Rajasthan, 1Central Arid

Zone Research Institute, Jodhpur, Rajasthan, 2Project Directorate Biological Control, Bangalore, Karnataka E- mail: srinivas_uom @rediffmail.com - Cumin (Cuminum cyminum) is an important seed spices crop mainly grown in Rajasthan and Gujarat states of the country. The crop is affected with many diseases during the growing season. Wilt caused by Fusarium oxysporum f.sp. cumini is one of the destructive disease which causes severe yield losses. The disease is mainly soil borne in nature and difficult to control after its appearance. Control measures i.e. seed treatment with fungicides and biological agents like Trichoderma spp. has been recommended, but is less effective under field conditions. In the present study, we primed the seeds with talc based formulations of biological agents viz, T. hazianum, T. viride, Pseudomonas flurescence and Aspergillus versicolar to increase the efficacy of bioagents providing the conditions to establish on seed before planting. The results revealed that bioprimed seeds hasten the germination of seeds (65-95%) within 5 d of incubation in blotter test as compared to control (15%) and also increased the shoot root ratio and seedling weight. When the bioprimed seeds were planted in pots containing soil inoculated with F. oxysporum f. sp. cumini, seed germination was 40-46% as compared to 11% in un-treated control 10 d after of sowing and also enhanced the growth of plant. The biopriming with bioagents also reduced the pre- and post-emergence mortality as compared to un-treated control. However, the treatments are at par for the reduction in mortality. Application of Bioformulations of PGPRs for Plant Growth Promotion in Tea Seedlings U. Chakraborty, B. N. Chakraborty and A. P. Chakraborty Immuno-Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri- 734 013, West Bengal, India. Email: [email protected] - Carrier-based preparations of two plant growth-promoting rhizobacteria (PGPR) viz. Bacillus megaterium (TRS 4) and Serratia marcescens (TRS 1), developed in three formulations were evaluated for their growth promotion and rhizosphere colonization in tea seedlings varieties, TV-18, TV-23, TV-25, TV-26 and T-17 in glass house conditions and viability under storage. Three bioformulations- saw dust, rice husk and tea waste of the two bacterial isolates were prepared separately using standard protocolsm 100 ml of aqueous bacterial suspensions at 109-1010 cfu/ml were added to sterilized


250 g of saw dust, rice husk or tea waste along with 2.5 g of carboxy methyl cellulose as a carrier and calcium carbonate under sterile condition. These were initially tested for their survivability in vitro, by direct plating method in nutrient agar medium. B. megaterium and S. marcescens could survive in formulations of saw dust (6.1×log10 cfu/ml), rice husk (8.0×log10 cfu/ml), and in tea waste (6.98 to 7.2×log10 cfu./ml) up to nine months, after which the decline was rapid. To test in vivo efficacy of the three bioformulations for plant growth promotion, 2-mo-old formulations were applied in potted soil at the rate of 100 g/pot. The bacterial inoculants in all three bioformulations were found to enhance the growth parameters of the test plants. The growth was measured in terms of increment in height and number of leaves of seedlings 2-mo after application. The observed increase was similar to that observed by application of aqueous suspension of the bacterium. Statistical analysis (ANOVA) revealed that there was no significant difference among the aqueous suspension or different bioformulations though all of them were significantly higher than control. Suppression of Sclerotinia sclerotiorum Rot of Orchid By Bacillus megaterium and Induction of Defense Mechanisms M. Basnet, C. Tongden, U. Chakraborty and B. N. Chakraborty Immuno-Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri- 734013, West Bengal.Email: [email protected] - Greenhouse experiments were conducted to determine the effect of Bacillus megaterium on white rot of Vanda caused by Sclerotinia sclerotiorum. Results revealed that the PGPR could reduce disease intensity significantly. In order to determine whether disease reduction was due to induction of resistance, accumulation of defense enzymes- phenyl alanine ammonia lyase, chitinase, peroxidase and β 1,3 glucanase was analysed in the plant. Treatment with Bacillus megaterium increased the activity of chitinase, β-1,3-glucanase, peroxidase and phenyl alanine ammonia lyase, but max increase in activity was obtained when the plants were challenge inoculated with the pathogen following application of the PGPR. Accumulation of phenolics also showed a similar trend, with a max increase when both the PGPR and the pathogen were inoculated in the rhizosphere. A significant reduction in chlorophyll and protein contents was obtained due to infection by the pathogen. This was, however, reversed by pre-treatment with the PGPR.

Performance of Plant Extracts and Chemicals Against Alternaria leaf blight of Mustard Caused By Alternaria brassicae M. K. Biswas, A. Ghosh and S. Biswas1 Department of Plant Protection,P.S.B., Visva-Bharati, Sriniketan, West Bengal 731236; 1Department of EES,P.S.B., Visva-Bharati ,Sriniketan, West Bengal 731236 - One of the major constraint of mustard (Brassica campestris, B. juncea, and B. napus ) is that the crop is infected by of diseases of which Alternaria leaf blight is very common and destructive in West Bengal causing considerable damages to the crop . An attempt was made to explore the possibility of controlling the disease with the help of plant-extracts and other eco-friendly chemicals. The experiment was conducted at Visva-Bharati , Srinekatan, West Bengal during winter of 2005 and 2006. Variety Binoy was sown in field and four replications (plot size 3 x 5m2) were set up with randomized block design. Nine treatments i.e. leaf materials of Lantana camera and Eucalyptus hybrida, bulb of garlic (Alium sativum) and onion (Allium cepa), rhizome of ginger(Zingiber officinale) - all @ 10%; neem seed oil(Azadirachta indica) @ 0.05%; salicylic acid (SAR compound) @ 2 ppm; and mancozeb @ 0.2%, un-treated control were tested in vivo and in vitro. Fungicidal treatment with Mancozeb 75% WP @ 0.2% was proved its superiority among all the treatments and proved most effective in reducing 81% disease severity and increasing yield up to 52% over un-treated control. Plant depravities have been shown considerable promise as effective alternatives. A range of 22 to 72% reduction in disease severity and 6 to 44% increases in yield were observed with different plant extracts. Min infection of Alternaria blight in leaf (15%) and max yield (1658 kg/ha) were recorded in field treated with L. camera followed by A. sativum (24% infection and yield 1482 kg/ha) and E. hybrid (32% and 1305 kg/ha) which were significantly superior to control. Extract of Z. officinale was found less effective in comparison to other extracts. Resistance of plant against Alternaria blight of mustard was reported with the application of salicylic acid (SAR compound) and 48% reduction in disease severity, and 27% increase in yield have been noticed under field condition. In vitro evaluation of fungicide, phyto-extracts and salicylic acid showed the inhibitory effect of these products on mycelium growth of the fungi (A. brassicae). Mycelium growth inhibition (96%) was observed with mancozeb. Among the phyto-extracts, L. camera exhibited less radial growth (18 mm) followed by Alium sativum. Salicylic acid, which exhibited moderate effect in vivo, performed well in inhibiting the mycelium growth of fungi (A. brassicae) in vitro.


Evaluation of Talaromyces Flavus for Phosphate Solubilization and Biocontrol Activity and Its Molecular Analysis B. N. Chakraborty, U. Chakraborty, K. Sunar and P. L. Dey Immuno –Phytopathology Laboratory, Department of Botany, University of North Bengal, Siliguri 734013, Darjeeling West Bengal, India Email: [email protected] - Talaromyces flavus (ITCC 7069) obtained from paddy growing areas of Darjeeling hills were examined for their ability to solublilize phosphate both in vitro and in vivo conditions. Formation of halos around the colonies in PVK agar indicated the activity. In liquid medium amended with tricalcium phosphate and rock phosphate, T. flavus could solubilize phosphate more efficiently than other tested isolates of Aspergillus niger, A. melleus, and A. clavatus. Application of T. flavus to the soils of potted plants also led to solubilization of insoluble phosphate as indicated by lower soil phosphate content and higher root phosphate. The fungus further showed antifungal activities of 70-80% inhibition against Sclerotium rolfsii in dual cultures. Amendments of T. flavus could also suppress stem rot disease of soybean plants caused by S. rolfsii. Genomic DNA of T. flavus was isolated, purified and quantitative analysis was done spectrophotometrically and PCR amplification was done using ITS specific primer ITS 1 and ITS 4 where PCR amplicons of size 600 bp were obtained on 2% agarose gels. Several reproducible polymorphic bands ranging from size 400-700bp were obtained in case of RAPD analysis. Similarity coefficient ranged from 0.1 -0.9 when compared with other phosphate solubilizing fungal species using NTSYS PC software Efficacy of Soil Amendments With Trichoderma harzianum on Stem and Pod Rot Incidence and Yield of Groundnut K. B. Jadeja and K. B. Rakholiya Department of Plant Pathology, College of Agriculture, JAU, Junagadh 362001, Gujarat, India Email:[email protected] - Field trials were conducted during kharif 2006 and 2007 at Junagadh using groundnut cv GG-20. Testing of five soil amendments viz, castor cake, neem cake, groundnut cake, FYM and gypsum @ 500 kg/ha were used as carrier for Trichoderma [email protected] kg/ha given at the time of sowing. All the treatments were found significantly superior over control to improve groundnut pod yield and reduced disease incidence. Stem rot incidence was low (27%) and pod yield was high (2153 kg/ha) in the

application of castor cake @ 500 kg/ha followed by FYM @ 500kg/ha (30% and 2122 kg/ha) with T. harzianum @ 1.5 kg/ha. In control the disease incidence and pod yield (kg/ha) were 51% and 865 kg/ha, respectively. Castor cake and FYM were found as the best carriers of T. harzianum against stem and pod rot diseases of groundnut. Biological Control of Soybean Anthracnose B. Animon, K. U. Solanky, A. N. Sabalpara and J. R. Pandya Department of Plant Pathology, N.M. College of Agriculture, Navsari Agricultural University, Navsari – 396 450, Gujarat Email: [email protected] - The hazardous effect of chemicals used in plant disease management has diverted plant pathologists to find an alternative method with little or no adverse effect on environment. A study was made to identify suitable antagonists and botanicals to control soybean anthracnose. Eight known antagonists viz, Trichoderma viride, T. harzianum, T. longibrachyatum, Aspergillus flavus, A. niger, Gliocladium virens, Chaetomium globosum and Bacillus subtilis were tested in vitro for their antagonism to Colletotrichum dematium an incitant of soybean anthracnose by three different methods viz, dual culture, pathogen at periphery and pathogen at centre. In all three methods, T. viride and T. harzianum appeared as strong and potent antagonist, while the rest were poor. The phytoextracts of commonly available nine plant species were evaluated in vitro by poison food technique against C. dematium. The leaf extract of Lantana proved most effective in inhibiting the growth of this fungus. Leaf extracts of Eucalyptus and neem were moderately inhibitory, while the leaf extract of Occimum, Datura, finger (rhizome extract) and onion (bulb extract) were slightly inhibitory. Antagonism of Bio-agents Against Castor Anthracnose Pathogen (Colletotrichum gloeosporioides) S. K. Chawda, B. P. Mehta, A. N. Sabalpara and J. R. Pandya Department of Plant Pathology, N.M. College of Agriculture, Navsari Agricultural University, Navsari – 396 450, Gujarat, India Email: [email protected] - Castor (Ricinus communis) is one of the most important oil seed crop grown extensively in Gujarat. The occurrence of anthracnose disease in castor caused by Colletotrichum gloeosporioides was observed in serious proportion. Considering the seriousness of the problem, an


investigation was carried out to pinpoint suitable bio-agents. Seven known antagonists viz, Trichoderma viride, T. harzianum, T. longibrachyatum, T. virens, Chaetomium globosum, Aspergillus niger, and A.flavus were tested in vitro by three methods viz, dual culture, pathogen at centre and pathogen at periphery against C. gloeosporioides. The results of this study revealed that Trichoderma viride, T. harzianum and A. niger showed strong antagonistic effect on C. gloeosporioides. Screening of Botanical Against Damping-off (Pythium aphanidermatum) of Tobacco S. Dutta, K. R. Joshi, D. L. Yadav Deparment of Plant Pathology, Bidi Tobacco Research Station, Anand Agricultural University, Anand-388110, Gujarat. Email:[email protected]. Hexane extracts of some locally available higher plants, medicinal plants and some obnoxious weeds belonging to different families were tested in vitro by poison food technique to assess the fungitoxicity against Pythium apahnidermatum. During the screening it was revealed that leaf extracts of Aegle marmelos and flower extracts of Parthenium hysterophorus were at par with each other and significantly superior in reducing the mycelial growth while the rest of the botanicals were not effective. Fungitoxicity of the botanicals evaluated in this study offers a scope for non-chemical management of damping-off disease of tobacco

Management of Alternaria Blight of Sunflower Through Induced Systemic Resistance

R. K. Mesta, V.I. Benagi1, G. M. Hegde1 and S. A. Jahagirdar1

Horticultural Research Station, Devihosur, Haveri 581 110 India; 1University of Agricultural sciences, Dharwad 580 005 India Email:[email protected] - Alternaria blight caused by Alternaria helianthi (Hansf.) Tubaki and Nishihara is one of the major diseases of sunflower in Karnataka. Certain chemicals like salicylic acid, jasmonic acid and bioagents like Pseudomonas sp. are known to induce systemic resistance in many plants when applied exogenously in small quantities. In the present study the ISR agents organics viz., vermiwash (10%), P. fluorescence (0.5%), salicylic acid (5 mM), captan and control were seed treated and tested against Alternaria blight of sunflower in natural field conditions. At 60 DAS, salicylic acid @ 5 mM (39) recorded the least PDI which was on par with captan @ 0.3% (40). Control recorded the highest PDI (58). At 75 DAS salicylic acid @ 5 mM (58) recorded significantly the least PDI than all other treatments. Captan @ 0.3% (62) was next best.

However, with respect to sunflower yield, the highest yield was noticed in plot with seed treated with Pseudomonas fluorescens @ 0.5% (9.9 q/ha). Control recorded yield of 9.0 q/ha. Salicylic acid @ 5 mM (6.25 q/ha) recorded the least yield because of poor germination percentage resulting in poor plant stand. The oil content did not differ significantly in treatments. Oil yield was the highest in Pseudomonas fluorescens @ 0.5% (3.25 q/ha) which was on par with all the treatments except salicylic acid @ 5 mM (2.05 q/ha). Pseudomonas fluorescens A Potential Biocontrol Agent for Management of Damping Off, Fruit Rot and Powdery Mildew in Chilli R. K. Mesta, H. D. Mohankumar, M. Shivaprasad, M. H. Tatagar and P. More Horticultural Research Station, Devihosur, Haveri 581 110, India Email:[email protected] - Chilli is one of the important commercial crops of India and suffers mainly due to damping off in seed bed, fruit rot and powdery mildew in main field. An experiment was conducted at Devihosur, India, to manage these diseases by seed treatment and soil application of Psuedomonas fluorescens (SUDOCEL) for damping off, and by seedling dip and spray in various combinations with chemicals viz. carbendazim (0.1%) and hexaconazole (0.1%) for fruit rot and powdery mildew. Seed treatment with P. fluorescens @10 g/kg of chilli seeds is very effective in managing the damping off, which recorded significantly the highest germination (96.8%), shoot length (7 cm), vigour index (1084) and the least disease than the control. In the transplanted field, seedling dip with P.fluorescens (10g/l) followed by two sprays at 45, 60 DAT and then two spray hexaconazole at 75 and 90 DAT showed the least disease incidence for fruit rot (21 PDI) and powdery mildew (29 PDI) , and gave the highest yield (8 q/ha) and higher net returns. P. fluorescens showed no phytotoxic effect on chilli plant and no harmful effect on beneficial micoflora in soil. Antimycotic, anti-biodeteriorative and anti-aflatoxigenic potency of 2-Hydroxy-4-methoxybenzaldehyde Isolated from Decalepis hamiltonii on Fungi Causing Biodeterioration of Maize and Sorghum grains Mohana, D. C.1 & 2 and Raveesha, K. A1 1Agricultural Microbiology Laboratory, Department of Microbiology, Bangalore University, Jnana Bharathi,


Bangalore. India. Email:[email protected]; 1Agricultural Microbiology Laboratory, Department of Studies in Botany, University of Mysore, Manasagangotri, Mysore. India - The study characterized the antimycotic, antibiodeteriorative and antiaflatoxigenic efficacy of 2-hydroxy-4-methoxybenzaldehyde isolated from Decalepis hamiltonii Wight & Arn. against 21 fungal isolates that causes biodeterioration of maize and sorghum grains. Fungal species that cause biodeterioration were isolated from maize and sorghum by agar plating method on Czapek’s Dox Agar and standard blotter method. A poisoned food technique was adapted to assess inhibitory concentration 50 (IC50), minimal inhibitory conc (MIC) and minimal fungicidal conc (MFC) of the bioactive compound against fungal isolates. The IC50 value varied 80 µg/ml and 350 µg/ml, MIC value varied 400 µg/ml and 800 µg/ml and MFC value also varied 800 µg/ ml and 950 µg/ml depending on the fungal species. Among the test fungi Fusarium oxysporum shows the highest inhibitory activity, whereas Aspergillus niger showed the least inhibitory activity. Comparative evaluation of the active compound with the synthetic fungicides viz, blitox and thiram, at their respective recommended dosage revealed that the antifungal activity of the active compound obtained from the plant was better than that of synthetic fungicide. In vivo evaluation of the active compound at 0.5g/kg and 1g/kg treatments on maize and sorghum seeds revealed that carbohydrate, protein, lipids, dry matter losses and aflatoxin elaboration were not observed in the treated seeds up to 120 d. This edible plant can be exploited in the management of seed-borne pathogenic fungi and in the prevention of biodeterioration of grains and mycotoxin production during storage in an eco-friendly way. Antagonistic Effect of Bioagents on Alternaria Fruit Rot (Alternaria alternata) of Aonla R. R. Waghunde, R. K. Patil and A. N. Sabalpara Department of Plant Pathology, Anand Agricultural University, Anand .Gujarat. Email:[email protected] - Aonla or Indian gooseberry (Emblica officinalis Gaertn. Syn. Phyllanthus emblica L.) is one of the most important indigenous fruit of Indian sub-continent. It is native of tropical South-East Asia. About 15 to 20% of harvested aonla fruits are deteriorated particularly due to the fruit rots caused by different pathogens before reaching to consumers. An application of fungicides is the most versatile method to control the post-harvest diseases of fruits, but causes harmful effect on human health and

environment. The use of bioagents to control post harvest diseases is safer method to reduce the losses. Hence, five antagonists viz, Trichoderma viride, T. harzianum, T. virens, Bacillus subtilis and Pseudomonas fluorescens were evaluated for antagonism against A. alternata in vitro and in vivo. Significantly the highest growth inhibition of A. alternata was recorded in T. viride (68%) followed by T. harzianum (55%) in vitro. T. viride was found most potent antagonist in reducing the Alternaria fruit rot both in pre- and post-inoculation (6-7%) methods after 7 d of incubation. Management of Stem Blight Disease of Cowpea Induced By M. phaseolina Through Bioagent and Plant Product K.Bhatnagar, S.K.TaK, R.B.S.Gurger and V.L.Majumdar Deptt. of Plant Pathology, Agril. Research Station, Durgapura, Jaipur 302018 Email: [email protected] - Cowpea (Vigna ungiculata (L) Walp) is one of the most important kharif crop of Rajasthan. The cultivation of cowpea is mainly hampered by stem blight disease induced by Macrophomina phaseolina. Chemicals are inadequate to provide long term solution for disease control and crop health. Therefore, biological control will be quite helpful in management of stem blight disease of cowpea. An investigation was carried out for three years (2005-07) as field experiment to see the effect of different plant product and bio-agent. The data revealed that garlic extract (1:1) reduced the severity (24%) of stem blight disease and increased the yield (7.32q/ha). In control the severity was 42% and yield was 2.55 q/ha. Biological Control of Stem Rot of Pea R. Palat, N. Singh, O. P. Mathuria and D. R. Chandra Krishi Vigyan Kendra Thariaon, Fatehpur, C.S. Azad University of Agriculture and Technology, Kanpur-208 002 Email:[email protected] - Pea (Pisum sativum (L.)) is one of the most importance pulse crops of India. During a survey, it was been observed to suffer from stem rot caused by Sclerotenia sclerotiorum. Intensive use of fungicides for protection of crop from diseases has several disadvantages as they are not only expensive but also toxic to the human being and pollute-environment. Therefore, an effective and safe method is to use bio-agent control against the disease. Four bio-agents Contithyrum minitanse, Trichoderma viride, Glicoladium virens and Bacillus subtilis were used.


Minimum disease intensity (13.2%) was observed when the bio-agent C. minitanse was used followed by T. viride and G. virens (16.4%). The bio-agent B. subtilis was the least (34%) effective in managing the disease. Fungal Competitors and Their Effect on Yield of Oyster Mushroom (Pleurotus spp.) L.K.Chhata1, and B.B.L. Thakore2 1Dry land Farming Research Station, Arjia Bhilwara; and 2Department of Plant Pathology, RCA, Maharana Pratap University of agriculture and Technology, Udaipur Email:[email protected] - Losses in yield of Pleurotus florida have been investigated by inoculating chemically sterilized wheat straw substrate with different competitor moulds by two different methods. Loss in yield of P. florida was observed as high as 50% when the straw substrate was inoculated with A. niger @ 30 g/bags. The least yield loss of P. florida (18%) was recorded when inoculated with Rhizopus spp. @ 1 x 105 spores/ml/bag. Association of six fungal competitors with oyster mushroom was recorded during its cultivation. Effect of different competitor moulds or weed fungi on the yield of P. florida under artificial inoculation conditions, was studied. In general, loss in yield of P. florida was higher at 1 x 105 spores/ml than at 1 x 103 spores/ml. The range of loss in yield of P. florida at 1 x 105 spores/ml was between 18 to 49% while it was 19 to 36% at 1 x 103 spores/ml. By another method, weed fungi were multiplied on wheat grains and were used to inoculate at 30 g and 15 g/bag. Maximum yield loss (40%) of P. florida was recorded when straw bags were inoculated with Aspergillus niger @ 15g/bag while loss was more (50%) when the bags were inoculated with 30g/grain/bag of inoculum. Minimum loss 26% was found when C. lunata was inoculated with 30g infected grain/bag. Antifungal Activity of Plant Extracts Against Post Harvest Pathogen Fusarium moniliforme of citrus S. Ghosh and A. Saha Department of Botany, University of North Bengal, Siliguri 73401. Email: [email protected] - Citrus is one of the important fruits of North Bengal. The fruits are exported to different countries. Hence the fruits need to be protected from post harvest diseases because they cause substantial economic loss. Aqueous extract of 40 plants from different families, collected from eastern Himalayas were tested for the potential

against important post harvest pathogen, Fusarium moniliforme isolated from citrus fruit of Darjeeling. Selected plant extracts were finally taken into different solvents and were developed in thin layer chromatography (TLC) plates. The TLC plate bioassay guided fraction was identified on the plate by terpenoid-specific spray reagent. The antifungal zone was identified by the characteristic terpenoid-specific colour on the TLC plates. This terpenoid fraction may be used for controlling post harvest disease of citrus. Impact of Fungal Metabolites on the Germination Status of Oilseed R. B. Kakde, D. P. Gadgile and A. M. Chavan Seed Pathology and Fungal Biotechnology Laboratory, Dept. of Botany, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004. Email: [email protected] - Healthy looking seeds of soybean (Glycin max) and safflower (Carthamus tinctorius) pre-soaked in 10 d old cell-free culture filtrate of seed-borne storage fungi i.e. Aspergillus niger, Aspergillus flavus, Penicillum notatum, Macrophomina phaseolina, Fusarium oxysporum and Rhizopus stolonifer for 1, 2, 3, 4 and 5 h soaking period and effects of various conc of culture filtrate were studied on storage fungi. It is clear from the result that, seed germination was hampered irrespective of the conc. of culture filtrates, and pre-soaking period. All the fungal filtrates showed decreased seed germination which increased with increasing in soaking time and conc of filtrates. Autoclaved filtrate of A. niger, A. flavus, P. notatum, M. phaseolina, F. oxysporum and R. stolonifer lost toxicity partially. Studies on Effect of Storage on Virulence of Xanthomonas axonopodis pv. punicae C. Gopalakrishnan, A. K. Saxena and S. P. Kirthishree Division of Plant Pathology, Indian Institute of Horticultural Research, Hessaraghatta Lake Post, Bangalore 560 089 Email:[email protected] - Bacterial blight disease caused by Xanthomonas axonopodis pv. punicae (Hingorani and Singh 1959) Vauterin, Hoste, Kersters & Swings 1995 is a cause of concern in pomegranate (Punica granatum) orchards in Maharashtra, Karnataka and Andhra Pradesh, as the crop is highly remunerative and has lot of export potential. Though the bacterium can be sub-cultured several times on nutrient agar (NA) medium after storage in the refrigerator at 5C, the retention of virulence is a big question mark. Hence, to address the


virulence factor after a long storage, systematic study was carried out in the laboratory. The bacterium was isolated in to pure culture from the diseased pomegranate leaf using NA medium. The culture slants after incubation at 28C for 7 d were kept at 5C. The slants were retrieved every 7d starting from 0 day and tested for virulence. Bacterial suspension was made with sterile distilled water and the conc was adjusted to 0.3 OD using spectrophotometer at the absorption 600 nm, approximately equivalent to1.0 x 108 cfu/ml. The suspension was then inoculated to the pomegranate leaves by pin prick method, where the sterile needle was dipped in suspension and pricked on to the leaf. In each leaf, 6 spots were chosen and in each area about 10 pricks were given in a circular fashion. Five numbers of such inoculated leaves were kept in Petri plate with moist Whatman filter paper at the bottom to provide adequate humidity for the bacterial pathogen to inflict disease in the leaves. The Petri plate was then kept in the incubator at 28 C. Water soaked symptom development was noticed at 18 h after inoculation, which become circular brown spot of 0.3 to 0.4 mm diam at 24 h and this confirmed the virulence of the pathogen. Results indicated that the stored culture inflicted typical bacterial blight symptom till 91 d of storage. Further testing for virulence from 98 to 119 d did not give any symptom development and the inoculated leaves remained symptom less along with the control check. Thus, it is very clear that X. axonopodis pv. punicae culture on NA slants can be stored at 5C for 3 mo with virulence remaining intact.

Aflatoxin Contamination in Mustard Seeds Collected from Bhagalpur Market M. S. Ahmad University Department of Botany,T.M.Bhagalpur University, Bhagalpur 812007. E-mail: [email protected] - Mustard (Brassica juncea L.) is an important oil-seed crop of Bihar and has earlier been shown to be naturally contaminated with aflatoxins at various stages of its development. In this investigation an attempt has been made to record the level of aflatoxin contamination in market samples of mustard seeds because these seeds are directly consumed by the people of Bhagalpur region. Altogether 50 samples of mustard seeds were collected on random basis from different markets located at Bhagalpur and adjoining areas during 2006-2007. Species of Alternaria, Aspergillus, Curvularia, Fusarium and Penicillium were found to be associated with the seeds of those samples. Incidence of these fungi varied in between 6 to 30%. Out of 36 isolates of Aspergillus flavus screened, 14 were found to be toxigenic which produced aflatoxins in SMKY culture media in the range of 0.2 to 8 µg/ml. However, out of 50 samples analyzed, only 7 samples were found to be naturally contaminated with aflatoxins in the range of 160-240 µg/kg.

Abstracts of Papers Presented at the 31 Annual Conference ...

Documents

Transcript of Abstracts of Papers Presented at the 31 Annual Conference ...