tspace.library.utoronto.ca · ABSTRACT Discovery and Characterization of Three Genes Encoding G...
Transcript of tspace.library.utoronto.ca · ABSTRACT Discovery and Characterization of Three Genes Encoding G...
DISCOVERY AND CHARACTERIZATION OF' THREE GENES ENCODING G PROTEIN-COUPLED
RECEPTORS
Benjamin P. Jung
A thesis submitted in accordance with the requirements for the degree of Master of Science
Graduate Department of Pharmacology University of Toronto
OCopyright by Benjamin P. Jung 1997
National Library I*l of Canada Bibliothéque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
395 Wellington Street 395, rue Wellington Ottawa ON KI A ON4 ûttawaON K1AON4 Canada Canada
Yaur hie Voire nilemce
Our iCie Narre feterence
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of ths thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/fXm, de
reproduction sur papier ou sur fomat électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.
ABSTRACT
Discovery and Characterization of Three Genes Encoding G Protein-coupled Receptors Benjamin P. Jung, M.Sc. 1997 Department of Pharmacology
University of Toronto
The research work undertaken resulted in the d k c o v e ~ of three novel human G
protein-coupled receptor (GPCR) genes. Using a customized search procedure of a
database of expressed sequence tags (dbEST), human cDNA sequences that panially
encoded novel GPCRs were identified. These cDNA fragments were obtained and used
to screen a genomic library to isolate the full-length coding region of the genes. This
resulted in the isolation of genes GPR23 and GPR24. Gene G P R 3 was isolated by
ampIi@ing human genomic DNA with oligonucieotides based on GPR2-I and the related
somatostatin (sst) receptor genes. The receptor encoded by GPR23 e.xhibited significant
identity (60%) in the transmembrane (TM) domains to the chicken nucleotidic P?Y,
receptor. while the receptor encoded by GPR2-I shared -40% amino acid identity in the
TM regions to the five known sst receptors. The receptor encoded by GPR7j was most
closely related (4 1% in TM regions) to the GPRIS-encoded receptor. Northem blot and
in situ hybridization analyses revealed that GPRZ-I is expressed abundantly in many
discrete brain regions in human and rat, including the forebrain. hypothalamus. and
hippocampus. A repeat polymorphism of the form (CA), was discovered in the 5 ' -
untranslated region (UTR) of GPR2-I. Binding studies failed to identim the ligands for
any of the encoded receptors. Fluorescence in situ hybridization (FISH) was used to map
GPR73 to chromosome X, region q13-q21.1, GPR2-I to chromosome 22 region ql3.3.
and G P R D was mapped to chromosome 1 region q32.1.
ACKNOWLEDGMENTS
1 would like to sincerely thank Dr. Brian O'Dowd for the opportunity to pursue my
degree under his supervision and direction, and whose guidance has been invaluable to
me in the completion of my research. 1 wish to also thank Dr. Susan George. Mr.
Adnano Marchese. and Mr. Tuan Nguyen for their advice and expertise. al1 of whom
have contributed significantly to my research experience. 1 would like to mention also
Dr. Peter Wu. Dr. Antonio Lança, and Dr. Dave Hampson for their meaningful insight
and interest in my work. Finally, 1 would like to thank my family and fnends for their
continued encouragement and unending support in this endeavor.
PUBLICATIONS
The work reported has resulted in the following publications:
GPR23: O'Dowd. B.F.. Nguyen. T., J u w , Marchese. A.. Cheng, R.. Heng. H.H.Q.. Kolakowski. L.F.. Jr.. Lynch. KR., George. S.R. (1997) Cloning and chromosomal mapping of four putative novel human G-protein-coupled receptor genes. Gene 187: 75-81.
GPR24: Kolakowski. L.F.. Jr.. B.Pt, Nguyen. T., Johnson. M.P.. Lynch. KR.. Cheng, R., Heng, H.H.Q., George, S.R.. O'Dowd. B.F. (1 996) Characterization of a hurnan gene related to genes encoding somatostatin receptors. FEBS Lett. 3 98: 253 - 3 8 .
GPR25: June. B.P., Nguyen, T., Kolakowski, L.F., Lynch. KR.. Heng, H.H.Q.. George. S.R.. OIDowd. B.F. (1 997) Discovery of a novel human G protein-coupled receptor gene (GPR25) located on chromosome 1 . BBRC 230: 69-72.
GenBank Accession numbers have been obtained for each gene. They are U66578. U7 1092. U9 1939 for GPR23. GPR2.I. and GPR25. respectively.
TABLE OF CONTENTS
Page
. . ................................................................................. ABSTRACT i l
ACKNO WLEDGMENTS ................................................................. iv
PUBLICATIONS ............................................................................ v
... ..................... LIST OF TABLES ,. ..................................................... viri
................................................................................................... LIST OF FIGURES ix
LIST OF ABBREVIATIONS .............................................................. x
1 .O INTRODUCTION
....................................................................... 1.1 Overview of Introduction 1
3 1.2 The G Protein-coupled Receptor Superfamily .............................. - 1.3 Molecular Cloning of Receptors ............................................. 7
1.4 Methods of Receptor Identification .......................................... 10
1 .j Gene Databases and GPCR Gene Discovery ................................ II
1.6 Nucleotidic Receptors and the Uridine Nucleotide Receptor ............. 17
1.7 The Somatostatin Receptor Farnily ......................................... 19
1.8 Research Objective ............................................................. 2 1
2.0 METHODS
2.1 Overview of Methods .......................................................... 22
33 2.2 Cloning and Characterization of GPR23 .................................... -- 2.3 Cloning and Characterization of GPR2.I ..................................... 25
2.4 Cloning and Characterization of GPR2j .................................... 31
. . 2.5 Chromosomd Localization of GPRZ3 GPR2-I and GPRZj ............. 32
3.0 RESULTS
3.1 Overview of Results ............................................................. 34
3.2 Isolation and Characterization of GPRZ3 .................................... 34
3.3 Isolation and Characterization of GPR24 .................................... 42
3.4 Isolation and Characterization of GPRZj ................................... 53
4.0 DISCUSSION
4.1 Sumrnary of Findings .......................................................... 61
4.2 Insight into the Identity of GPR23 ........................................... 62
4.3 Insight into the Identity of GPR2-l ........................................... 66
4.4 Insight into the Identity of G P R X ........................................... 74
5.5 CONCLUSIONS ........................................................................ 76
6.6 REFERENCES ........................................................................... 77
LIST OF TABLES
.......................................... Table 3.1 Classification of PCR products 35
Table 3.2 Caiculation of TM amino acid identities ................................ 33
- - Table 3.3 Classification of GPCR genes arnplified ................................ s~
Table 4.1 Comparison of TM amino acid identities between the G P R X encoded receptor and sst subtypes ....................................... 68
Table 4.2 Surnmary of mutagenesis studies and molecular modeling ................................................................................... of sst receptors 70
LIST OF ABBREVIATIONS
ADP
ATP
BLAST
bp
CAMP
cDNA
DAPI
dbEST
DNA
EST
FlSH
G protein
GPCR
kb
mRNA
NCBI
nt
ORF
o u - 1
P2Y
PCR
sst
SST- 14
SST-28
TM
UDP
UNR
adenosine diphosphate
adenosine triphosphate
basic local alignment search tool
base pairs
cyclic adenosine monophosphate
complernentary deoxyribonucleic acid
4g,6-diamidino-2-phenylindole
expressed sequence tag database
deoxyribonucleic acid
expressed sequence tag
fluorescence in situ hy bridization
guanine nucleotide regdatory protein
G protein-coupled receptor
kilobase pairs
messenger ribonucleic acid
National Center for Biotechnology Information
nucleotides
open reading fiame
Opioid Receptor-Like- 1 receptor
nucleotidic receptor
polymerase chah reaction
somatostatin receptor subtype
somatostatin- 14
somatostatin-28
transmembrane
uridine diphosphate
uridine nucleotide receptor
UTP
UTR
uridine triphosphate
untranslated region
1.0 INTRODUCTION
1.1 Overview of Introduction
Receptors that couple to G proteins play an essential role in biological systems. They
represent. for many signalling molecules. the first step of a complex transduction cascade
in which exnacellular stimuli are converted into divene intracellular responses. In
addition to their participation in normal physiological hc t ion . G protein-coupled
receptors (GPCRs) have been investigated as potential targets for dmg therapy because
they are potent mediators of ce11 response. In the Iast fifteen years. study of G-linlied
systems has been greatly facilitated by the molecular cloning of many genes that encode
for these receptors. The benefits of identiQing GPCR-encoding genes are considerable as
their characterization can provide important information about the diversity of this family
of receptors and permit the study of the expressed receptors in vino. This thesis describes
how molecular cloning strategies have been applied successfully in the identification of
eenes encoding three novel members of this famil y. A general introduction to this famil y Cr
of receptors is first presented which is followed by a section documenting the
development of conventional methodologies used in GPCR discovery. This is followed
by a discussion of various methods of receptor identification and a brief history of
computerized gene databases, the latter being key to the discovery of these receptors.
Finally, background relevant to specific receptors of interest to Our laboratory (the
nucleotidic and somatostatin receptors) is provided.
1.2 The G Protein-coupled Receptor Superfamily
Except for lipid-soluble dnigs, which c m pemeate through the hydrophobie bilayer
and interact with intracellular receptors. the majority of dmgs act by binding to cell-
surface receptors. Cell-surface receptors can be classified into three different classes by
their participation in signal transduction systems: 1. receptor tyrosine kinase and
receptor guanylyl cyclase 2. ligand-gated ion channels 3. G protein-coupled receptors
(GPCR). WhiIe each receptor class in its own nght is fundamental to physiological
function. the farnily of GPCRs represents the largest group in terms of nurnber of unique
members and nurnber of different endogenous ligands that activate or regulate them. .4t
present, the number of unique hurnan GPCR-encoding genes that have been identified is
close to 200. This probably represents only one f i f i of the total nurnber of GPCRs
though upon the inclusion of the nurnber of predicted odorant receptors that exist. In
addition to mammalian species. GPCRs have been isolated from archebacteria. slime
mold. fungi. insects. amphibians. birds, various marine animals. and several species of
plant. Their involvement in physiological processes is best reflected in their capacity to
transduce a diverse array of extracellular stimuli: light. biogenic amines (e.g. adrenaline.
histamine, dopamine, serotonin, acetylcholine), neuropeptides (somatostatin. opioid
peptides. vasopressin, oxytocin, cholecystokinin, angiotensin). chemokines and
chemotactic factors, odorants, prostaglandins, nucleotides and nucleosides, glycoprotein
hormones (follicle stimulating hormone, lutropin-chonogonadotropic hormone,
thyrotropin), platelet activating factors, and releasing hormones (gonadotropin-releasing
honnone, thyrotropin-releasing honnone). It is estimated that over 80% of al1 known
pnmary messengea bind to this class of ce11 surface receptor. Furthemore. man?
GPCRs have been isolated for which the endogenous ligand has yet to be identified (see
section 1.4). In addition to studying receptors to understand how they function
physiologically. their participation in such a multitude of biological functions has sparked
interest into their possible involvement in diseased States. Genetic mutations and the
resultant dysfunctional receptors have been linked to nurnerous conditions including
vision impairment. a nurnber of hormonal and regulatory dysfûnctions. and metabolic
deficiencies (reviewed in Zastawny et al.. 1997; Spiegel et al.. 1997).
In G-linked systems. the GPCR is responsible for recognizing a specific extracellular
signal. In the basal state. GPCRs are bound to G proteins. Upon activation of the
appropriate agonist. the receptor undeqoes a conformational change which results in the
simultaneous dissociation and activation of the G protein into subunits (a and py) in the
cytosol. The subunits. in tum. modulate the activity of an appropriate dovmstream
effector. such as adenylyl cyclase (AC) and phospholipase C (PLC). The downstrearn
effector directly regulates levels of a second messenger (e.g. cyclic AMP (CAMP) in the
case of adenylyl cyclase. and inositol trisphosphate and diacylglycerol in the case of
phospholipase C), and in so doing, initiates a specific cascade of intracellular events that
eventually leads to the resultant cellular response.
Structural feaiures of GPCRs
Cornparison of the GPCR-encoding genes reveal that they are al1 remarkably similar
in structure and organization. Al1 GPCRs consist of a single polypeptide chain organized
into an analogous structural arrangement consisting of an extracellular amino terminus,
followed by seven a-helical transrnembrane (TM) domains intercomected by aitemating
extracellular loops and intracellular loops, and terrninating in a cytoplasmic carboxyl tail
(Figure 1.1). In vino mutagenesis studies of monoamine GPCRs indicate that the
agonist-binding determinants are located in the hydrophobie TM domains (for a review.
see Savarese et al., 1992). The extracellular segments have also been showm to be
binding determinants for peptide-activated GPCRs while the intracellular loop regions
and the carboxyl tail are essential for G protein coupling and in regulating receptor
responsiveness. Aligning the primary amino acid sequences of GPCRs reveals a
considerable conservation of sequence arnong receptors that bind the same or stmcturally
similar ligands. particularly and understandably in TM regions as they form the putative
ligand binding pocket. In fact, severai residues and motifs are almost always conserved
identically. or conservatively substituted. in the analogous position throughout members
belonging to this superfarnily, and almost exclusively within the TM regions (Figure 1.1).
It is this remarkable property of GPCRs that has been esploited to clone the majority
GPCR genes and is the basis for ongoing cloning strategies to identi- novel members.
The greatest divergence in sequence is observed in the extracellular and intracellular
portions of the receptor. The conservation of structural and/or hctional domains
suggests that GPCRs may have a comrnon ancestry. In support of this hypothesis, the
genes encoding chemokine GPCR (Murphy i 996) and those encoding certain adrenergic
receptor subtypes (Yang-Feng et al.. 1990) are found clustered in the human genome,
suggesting that receptor subwpes may have arisen through gene and/or chromosome
duplication events.
O 000000 4- SIZE OF M O TERMINUS - m OO()OO- NH,
n VARIES -
A" % CARBOXYL
SIZE OF LOOP VARIES
Figure 1.1 Diagram showing the typical 7 TM topology of a GPCR. Circles represent individual amino acid residues. Residues that are highly conserved across the GPCR superfarnily are Iabeled. Approximate sites of disulfide bond formation (S - S) and palmitoylation ( ) are indicated. Amino acid letter designations: G = glycine. N = asparagine. V = valine, L = Ieucine. A = alanine. D = aspartate. P = proline. C = cysteine. R = arginine.Y = tyrosine. W = tryptophan. F = phenylalanine.
Many receptors are subject to a host of post-translational modifications. which have
important implications for receptor function (reviewed in Strader et al.. 1994). Many of
these can be identified by pnmary sequence analysis of the GPCR. Specific asparagine
residues in the amino terminus and extracellular loops that conform to the consensus
sequence Asn-X-Serm have been found to be glycosylated. Giycosylation is believed
to be required for optimal membrane expression and trafficking. Particular cysteine
residues located in the second and third loops of most GPCRs may participate in disulfide
bond formation. The disulfide bond is believed to be important to stabilize the tertiary
protein structure. Intracellularly. senne andor threonine residues in the second and third
intracellular loop or carboxyl tail of the receptor c m be phosphorylated by various
serine/threonine protein kinases (Premont et al.. 1995). The phosphorylation of residues
by these enzymes have been shown to be involved in the phenornenon of agonist-induced
receptor desensitization. whereby a receptor's responsiveness to agonist stimulation is
attenuated because of receptor-G protein uncoupling (reviewed in Ferguson et al.. 1996).
In numerous receptors. a cysteine residue about 70 amino acids downstrearn from the
seventh TM has been shown to be palmitoylated. This post-translational modification is
believed to anchor the receptor to the plasma membrane to form a fourth intracellular
loop (see Figure 1.1 ). The function of palrnitoylation is currently being elucidated but
there is evidence supporting its involvement in effector uncoupling and agonist-induced
desensitization (Moffet et al.. 1993; O'Dowd et al.. 1989; Jensen et al. 1995) and/or
receptor intemalization, trafficking and targeting (Nussemeig et al.. 1993; Eason et al.
1994; Jin et al., 1997).
1.3 Molecular Cloning of Receptors
The first GPCR genes were cloned either by receptor protein purification or
expression cloning (Marchese et al., in press). (They are only bnefly mentioned here
with respect to their contribution to the development of cloning strategies used in the
present study). Both procedures were dependent on having pnor pharmacological
knowledge of the receptor (e.g ligand binding, specific tissue expression. sufficient
receptor expression), including the specific pharmacological response elicited upon
ligand binding in the case of expression cloning strategies. Both protein purification and
expression cloning strategies involve very resource-consurning methods: in protein
purification. a large arnount of intact receptor protein is required. while in expression
cloning, mRNA from a tissue expressing the receptor is required. In addition to these
restrictions. they are m e r complicated by other technical pitfalls as well. Despite these
limitations, the receptor gene thus isolated encodes the receptor that binds the ligand of
interest. and perhaps represent the best methods that c m ensure the isolation of a
functional receptor gene. Indeed. many important genes have been discovered using such
strategies. including rhodopsin (Nathans & Hogness. 1983). the pl-adrenergic (Dixon et
al. 1986). the P 1 -1ike adrenergic (Yarden et al.. I986), and M 1 (Kubo et al. 1986) and M2
muscarinic receptors (Peralta et al.. 1987a), neurokinin NK2 receptor (Masu et al.. 1917).
and the serotonin 5-HT2, receptor (Julius et al., 1988). More significantly. these early
discoveries revealed for the first time the remarkable structural and sequence
conservation between GPCR sequences. This cntical realization formulated the basis for
the deveiopment of other cloning approaches.
In 1987, Kobilka et al. reported the successful isolation of the gene encoding the 5-
HTIA recepior by screening a library with a radiolabeled pz, receptor cDNA probe. The
sequence similarity between the two receptor genes was suficient enough to permit
hybridization of the probe to the 5-HT,, gene. In the ensuing years. man- hnctional
GPCR genes have been isolated using this strategy or variations of this strateg?..
including the use of receptor cDNA or even short oligonucleotides as probes. and using
different hybndization conditions (e.g. temperature, washing conditions. salt
concentrations). This method of homology screening at reduced stringency has been used
to detect subtypes of a cloned receptor. The sequences encoding the M3 and M4
muscarinic receptor subtypes were obtained using previously cloned Ml and M2
muscarinic receptor cDNA as probes (Bonner et al.. 1987; Peralta et al.. 1987b). The
dopamine Dj receptor gene was isolated by screening with a dopamine D, gene fragment
(Sunahara et al.. 199 1 ). However, there are many examples of serendipitous discovery. in
which the probe cross-hybridizes with a receptor gene that is not a fùnctional subtype.
reflecting the versatility of the method and highlighting the degree of similarity between
even non-functionally related members of the superfarnily.
Sequence similarity is also the underlying b a i s for the success of the sequence
homoiogy-based PCR strategy. The procedure was first described by Libert et al. ( 1989).
Based upon conserved regions of 6 known GPCRs (the and a2, adrenergic, the
serotonin 5-HT,,, the muscarinic Ml, and the substance K recepton), a pair of
degenerate oligonucleotides were designed serving as pnmers to ampli@ cDNA using the
polymerase chah reaction (PCR). The underlying theory is that the degenerate pnmers
(one based on the coding m d , the other on the complementary strand) will anneaf to
cDNA sequences encoding GPCRs of significant similarity. The polymerase proceeds to
synthesize the complementary sequence in an extension reaction. This process of
denaturation. annealing of primers to template DNA, and extension is repeated for 25-30
cycles. yielding fragments encoding GPCR genes. The annealing temperature is a
variable parameter. allowing the researcher to set how stringent a match benveen the
primer and the template is required for successful annealing. and hence which GPCR
genes will be arnplified (O'Dowd et al.. 1990). Novel GPCR gene fragments can be
identified upon sequencing of these PCR products and the full length reading frarne
obtained by the subsequent screening of a library using a candidate fragment as a probe.
Libert et al., using degenerate primers derived from TM3 and TM6 were successful in
cloning four novel GPCRs. three of them subsequently identified (see section 1.4). Marty
researchers have since employed the PCR to identi@ many other genes. and the approach
has been particularly effective in cloning orthologous genes (i.e. the sarne gene in another
species). Because of the intronless nature of many GPCR genes, genomic DNA can be
used (instead of cDNA). This offers a solution to discovenng genes that rnay not be
expressed abundantly or at al1 as mRNA in the source tissue. Numerous functional
subtypes have been successfully identified using the PCR method. including the
neurokinin NK1 (Hershey & Krause. 1990), NKZ (Gerard et al., 1990), dopamine D,
(Sunahara et al., 1 WO), serotonin 5-HT, (Jin et al., 1 992) and histamine H2 (Gantz et al.,
1991) recepton. However, the PCR method is not without problems. its greatest
limitation being that the genes obtained may not encode the desired subtype, or instead,
the genes detected by PCR methods encode putative GPCRs for which the physiological
ligand is unknown-hence the coining of the term "orphan receptor". A negative
connotation has becorne attached to this term as orphan receptors appear to be of limited
irnmediate value. This viewpoint is unfortunate and undeserved as the publication of
orphan receptor gene sequences has Ied to many significant discovenes.
1.4 Methods of Receptor Identification
In protein purification and expression cloning methods. the investigator begins with
the receptor's known pharmacology: hence, the receptor gene of interest is directlp
targeted, generating genes in which the expressed receptor binds the desired ligand. In
contrast. any clones obtained using the PCR method. homology screening at reduced
stringency, (or EST searching: descnbed below) is by definition an orphan until it c m be
identified by ligand binding or functional studies. Pharmacological studies are performed
following the isolation of the clone. using ligands selected according to its homology
with other GPCRs. If an endogenous ligand is not found. the encoded receptor remains
an orphan and awaits identification.
Comparative sequence anaiysis can be used to predict the ligand for a new receptor.
and it represents the most simplistic ba i s for identification. Homology in the TM
regions and the presence of key motifs important for ligand binding in a panicular class
of receptors can strengthen the suspicion. Four orphan receptors were cloned from rat
thyroid cDNA (Libert et al., 1989). Three of these were subsequently identified as the
WT,, (Maenhaut, C. et al, 199 l ) , and the adenosine A, (Libert et al., 1991a) and A,
receptors (Maenhaut, C., et al, 1990) upon the observation that each showed 40-60%
homology with known receptors of the sarne family. This is a rather straightfonvard
method of deduction but is not applicable in the absence of significant sequence
homology (less than 40%).
Mapping the tissue distribution of the receptor has been shown to be useful in receptor
identification. An example of this is the adrenomedullin (AM) receptor. onginally
isolated as the orphan receptor GlOd (Harrison et al.. 1993). Tissue expression of the
orphan receptor was shown in lunp, liver. and adrenal gland tissue extracts. The
observation that the AM binding sites overlapped with this tissue distribution resulted in
the positive identification of Gl Od as the AM receptor (Kapas et al.. 1995). Another
example is the cannabinoid receptor. also onginally cloned as an orphan receptor gene.
SKR6 (Matsuda et al.. 1990). The identity was deduced upon noting that SKR6 mRNA
was present in ce11 lines and in brain regions that express cannabinoid sites. Knowledge
of tissue distribution of receptors was also key to determining other orphans. including
the neuropeptide Y, and the somatostatin sst, receptor (see Marchese et al.. in press).
Receptors that bind unknown ligands
The most difftcult task is to identi& orphan recepton for which the physiological
ligand itself has not been discovered. Strategies have been developed towards this
objective, which involve the rneasurement of a fûnctional response upon application of a
tissue extract. The rationale for the approach is that most GPCRs regulate adenylyl
cyclase activity or stimulate phosphoinositide metabolism, so that the application of a
tissue fraction containing the ligand will induce a meaurable response in an appropriate
ce11 line. However, this second rnessenger response method is much simpler in theory
than in practice. the major obstacle being the acquisition of sufficient tissue extract with a
high enough concentration of ligand. In mammals. only one orphan receptor has been
identified to date using this snategy. the nociceptin receptor (Meunier et al.. 1995:
Reinscheid et al.. 1995). This will be discussed in detail in a more appropriate section
(see Discussion).
;Merifs of orphan recepfor research
Despite the apparent difficulties involved with orphan receptor research. also referred
to as "reverse pharmacology" (Libert et al. 1991 b), orphan identification offers numerous
advantages. and has been surnrnarized by Mills and Duggan (1994). First. it has
succeeded in identibing receptor subtypes of known receptor classes which had not been
detected by pharmacological studies (e-g. nociceptin receptor). Second. elusive
receptors such as the cannabinoid receptor and AM receptors were identified when more
conventional approaches had failed. Finally. this technology has the potential to discover
receptors for yet undiscovered ligands. unveiling previously unknown physiological
function and new intercellular signalling pathways. The recent discovery of numerous
novel mRNA species isolated fiom rat stnatum (Usui et al. 1994) and hypothalamus
(Gautvik et al.. 1996) by directional tag PCR subtraction supports the possibility of the
existence of such ligands.
1.5 Gene Databases and GPCR Gene Discovery
The end of discovering novel GPCR genes is foreseeable within the next 10 years.
The international 15-year initiative is to sequence the entire three gigabase human
genome by the first decade of the new century. By that time, assuming objectives are
completed on schedule and that the required technological advances are developed. al1
genes including those that encode GPCRs will have been sequenced. Using any number
of available cornputer algorithms that convert genetic sequence into protein sequence. a
systematic analysis of the genome will idenlie any genes encoding putative GPCRs.
Functional identification will still have to be carried out using conventional methods and
strategies as described previously (in Introduction 1.4). -4s DNA sequences become
available and accessible through public gene databases (see below). they c m be analyzed
irnmediately. Unfominately, in its early infancy, the approach to the genome project was
to sequence genornic DNA which. to get high output, had to await the technological
innovations required for batch DNA sequencing. so that the avaiiability of sequences kvas
scarce and slow. However. an approach developed independently but in parallel wlth the
genome project has been more appropnate for cloning novel genes. including GPCR
genes. This strategy. which rapidly generates short cDNA sequences. called expressed
sequence tagged (EST) sequences. has now become adopted as an integral part of the
genome project. In this regard. EST sequences has facilitated the creation of a physical
map of the human genome. and are particularly usehl markers of expressed genes in the
genome.
Generafion of EST sequences
The seminal paper on EST sequences was published in 199 1 (Adams et al.) by a group
headed by Dr. J. Craig Venter of the National Institutes of Health (NIH) in the U S . The
authors discuss the mex-its of sequencing cDNA over genomic DNA, arguing that cDNA,
which represents expressed genes but only 3% of chromosomal DNA, comprise the vast
majority of the information content of the genome. They aiso point out that cDNA is
intronless so that o d y coding sequence is obtained in contrast to genomic DNA in which
the gene coding regions rnay be complicated by introns. These advantages prompted
them to undenake a pilot project to generate EST sequences. Briefly. selecred cDNA
libraries were converted en masse to pBluescript plasmids and transfected into a
competent bacterial strain (Escherichia coli XL 1 -Blue). Libraries containing random
primed and partial cDNA clones were ideal, as these would be more helpful in the
identification of genes and in the construction of a usefil EST database. The alternative.
sequencing the ends of full-length cDNAs (which contain 5' and 3' untranslated
sequences) would likely yield much less coding sequence. and such sequences will also
be biased toward the beginning or end of the expressed rnRNA. In the search for genes
encoding proteins where the conservation of sequence is observed M e r into the protein
(as in the TM domains of GPCRs). sequence of the ends of hl!-length cDNAs is not
revealing. Colonies were then randomly picked, and templates prepared for sequencing
either by PCR or the alkaline lysis method. Single-run sequencing of the templates was
perfomed with an automated sequencer. using prirners complementary to the plasmid
sequence. The generated cDNA (i.e. EST) sequences from the single-pass sequencing
was 150 to 400 bases in length. Indeed. the process was simple and fast. Also, the
accuracy of the automated sequencing was assessed and found to be high. averaging
97.7% for up to 400 bases. Using a number of cornputer algorithrns (see below) for
comparative sequence analysis with known genes and proteins, 230 of 609 (or 38%) EST
sequences did not match significantly, and hence represent new, previously
uncharacterized genes. Among other sirnilarities. 2 notable ESTs exhibited more than
85% identity at the nucleotide level with members of the P-tubulin or a-actinin gene
families, li kel y representing novel, previousl y unsuspected members. The extension of
EST sequencing to GPCR gene discovery was obvious: a library can be screened uith
the EST clone to obtain the Full length gene. Now five years following this first
description, we have used the EST approach for the identification of numerous GPCR-
encoding genes including GPR19 (OIDowd et al., 1996), GPRZI. GPR27. GPR73
(O'Dowd et al., 1997). and GPR2-I (Kolakowski et al.. 1996). The major impetus for
these discovenes has corne from the establishment of a database of EST sequences
accessible by any investigator.
Release of EST sequences in public databases
Following the invention of EST sequencing, Dr. Venter and the NIH tried to patent
EST sequences. However. it was argued by the scientific community that patent
protection should not be permitted for EST sequences as they are partial sequences only.
their function not as yet identified. Further to this. patents on EST sequences would deter
their M e r characterization. and thereby impede the progress of scientific investigation.
Unable to expand his research because of lack of govemmental Funding, Dr. Venter lefi
NIH in 1992 and spearheaded The Institute for Genomic Research (TIGR), a non-profit
organization financially backed by Human Genome Sciences. Inc. (HGS) and its
corporate sponsor, SrnithKline Beecham (Philadelphia). Dr. Venter became the target of
cnticism when TIGR and HGS restricted access to its EST sequence database; HGS and
SrnithKline Beecham were given first rights to exploit EST sequence discoveries and
therefore would cornmercially benefit fiom any resulting developments. The proprietary
stance of these companies was chailenged. prompting Merck & Co.. Inc. to independently
fund a separate EST sequencing operation centered amund the Genome Sequencing
Center at Washington University, accordingly called the WashU-Merck EST Project.
The EST sequences isolated by this group have been made available to the public
domain, and has been deposited into a separate EST database (dbEST) with other publicly
accessible computerized genetic databases (collectively known as GenBank) maintained
at the National Center for Biotechnology Information (NCBI). A recent survey shows
that the WashU-Merck EST Project has already deposited close to 350. 000 sequences in
the dbEST since its inception in 1994 (Hillier et al.. 1996). As new submissions to the
dbEST nurnber over 1000 sequences per day (Boguski and Schuler. 1995). it is fortunate
that a variety of' powerful cornputer algorithms have been developed to screen for
candidate EST sequences.
Screening for putative GPCR-encoding sequences
An efficient approach has been employed successfûlly to identify GPCR-encoding
genes GPR19. GPRZI. and GPRZZ by Dr. Lee Kolakowski. The strategy is a customized
search procedure that requires the use of cornputer algorithms available on the Intemet at
the NCBI site. They are al1 basic local alignment search tools (BLAST; Altschul et al..
1990) that compute identities of a query sequence with a selected database. The choice of
which BLAST search to use is dependent on whether the query is a nucleotide sequence
versus protein sequence (BLASTN and BLASTP respectively), if a conversion from
nucleotide to putative protein is required (BLASTX or TBLASTX. exclusive for EST
sequences), or if a cornparison of a protein with the m s l a t e d EST nucleotide sequence is
desired (TBLASTN). Briefly. in Dr. Kolakowski's method. the dbEST is queried with
various GPCR sequences using the TBLASTN aigorithm. The EST sequences re tmed
that have statistically significant scores are searched manually to detemine whether
highly conserved amino acid motifs found in GPCRs are present in transiated sequences.
EST sequences that are identical to known GPCR genes are determined by querying a
GPCR database with the conceptualized arnino acid sequence. and subsequently
eliminated. The EST sequences thus filtered are then used to query the SwissProt
(release 31) database using the FASTA algorithm, a more sensitive algorithm that c m
optimize protein alignments better than the BLAST farnily. Upon showing a significant
score. the clone sequenced to generate the EST sequence can be requested From the EST
sequencing institution. and subsequently used to screen a library to obtain the full length
clone. This strategy has been important in the present study in discovering and the
subsequent characterizing of genes encoding for additional members of the GPCR
superfamiIy. GPR23, GPRZ-C, and G P R X
1.6 Nucleotidic Receptors and the Uridine Nucleotide Receptor
From the large family of GPCRs, our laboratory is interested in neuropeptide
recepton. in particular those that are potentially involved in the development of drug
addictions. For this reason, we have specifically sought to identiQ novel members
belonging to the opioid and related somatostatin classes of GPCRs in hopes of
characterizing them and studying their contribution to neurobiological function. Our
cloning of a nucleotidic receptor. the uridine nucleotide receptor (IMR), has directed our
efforts to discover recepton of this type as well. As the receptors encoded by GPR23 and
GPR2-I are related to the nucleotidic and somatostatin GPCRs, respectively. the present
section and the next will present relevant background to these receptors which wiÇ1 be
further developed in the Discussion.
Nucleotidic receptors, also known as PZY receptors, bind extracellular ATP. ADP.
UTP, (or analogues with varying afinity). By acting as intercellular messengers. these
nucleotides activate P2Y receptors. thereby exerting widespread influence on numerous
physiological processes. They include endothelium-platelet ce11 function. chloride
secretion in lung epithelia, smooth muscle relaxation. metabolic function in hepatocytes.
and even neural transmission (reviewed in Boarder et al.. 1995). Five unique P2Y
subtypes have now been cloned fiom 5 different species, and several more have been
predicted based on a search of the EST database (Webb et al.. 1996). One of these. the
UNR or P?Y,. was cloned in our laboratory using a PCR-based approach (Nguyen et a!..
1995). P2Y receptors display significant homology to one another (sharing greater than
30% and up to 50% arnino acid identity) while showing low arnino acid identity (27% or
less) with any other members of the GPCR superfamily (Bumstock 1995). Furthemore.
the sequence motif LFLTCIS in the third TM domain found only in PZY receptors has
become a signature for this GPCR class. Each subtype binds nucleotides with varying
affinity and a different rank order of agonist potency. The LJNR is the only subtype
which binds UTP preferentially. but not ATP. This unique property has sparked our
interest in searching for further subtypes of UNR. Upon agonist-induced activation, P2Y
receptors can affect a number of different second messenger systems, including
phospholipases. PLC, and AC, and commonly leads to ~ a ' + mobilization from
intracellular stores. In fact, rneasuring the rnobilization of ca2' is one of two rnethods
used in the identification of P2Y receptors. The second method is not a fimctional assay.
but instead mesures binding of radiolabeled ATP. Recently. the use of this latter method
has been deemed insuficient if used as the only evidence for identification of P2Y
subtypes: NO receptors previously included in the P2Y class. the P2Y5 (Webb et al..
1996). and P2Y7 (Akbar et al.. 1996) have been shown not to be bonafide P2Y receptors
(Li et al.. 1997; Yokornizo et al., 1997). The incorrect identification of these receptors
has important implications in the analysis of GPR23, which has been lefi to be described
in the Discussion.
1.7 The Somatostatin Receptor Family
Physiotogical firnction of somatostatin
Somatostatin peptides are widely distributed in central and peripheral tissues.
participating in nurnerous and diverse physiological processes. i~icluding the regulation of
GH and TSH secretion from the p i tu i tq and the inhibition of secretion of
gastrointestinal and pancreatic hormones and enzymes (Schusdziarra 1992) Besides
being able to inhibit virtually every known endocrine and exocrine secretion. they have
anti-proliferative effects both in vitro and in vivo (Lambens et al., 199 1 ). In the brain.
they have been reported to act as neurotransrnitters and neuromodulators to regulate
neuronal firing (Ikeda et al.. 1989; Shaprio et al.. 1993: Meriney et al., 1994; Wang et al..
1990) and to modulate complex behaviors such as locomotor activity and cognition.
Chemical-induced depletion of somatostatin in rat brain ha been s h o w to affect
behavior, learning. memory and brain neurochemisûy (Haroutmian et al.. 1987: DeNoble
et al., 1989; Priestley 1992; Raynor et al.. 1993). There are two biologically active
somatostatin peptides. synthesized fiom a comrnon precursor (preprosomatostatin) that is
differentially processed to generate tissue-specific arnounts of the tetradecapeptide SST-
14 and the N-terminally extended SST-28.
:MoleclrZar cloning of the somatostatin (sst) receptors
The effects of somatostatin are mediated by GPCRs that have high affhity for both
major peptide products of somatostatin gene expression. They were cloned using various
strategies (reviewed in Patel et al., 1992), and revealed a greater genetic diversity in this
receptor family than previously predicted. Five subtypes to date have been identified.
nurnbered sst, thni sst5, al1 similar in amino acid Iength (336-391 amino acids).
Comparative sequence analysis reveals a significant degree of conservation in structure
across sst subtypes as compared to other GPCR. Overali there is 3937% amino acid
identity arnong the five subtypes. In the putative TM domains, the homology increases to
5570%. The closest related GPCR class. the opioid receptors, exhibit approximately
30% sequence identity.
The ability of al1 sst subtypes to bind both peptides has prompted numerous
investigations to determine which residues are cntical for binding. Certainly. amino acid
residues that are conserved in the TM regions across the subtypes would be obvious
candidates as they are implicated in the formation of the ligand binding pocket. Detailed
molecular modeling and site-directed mutagenesis studies have identified a number of
key residues believed to be required for specific interaction with SST-14 and SST-38.
n i e specifics of these studies have been lefi for the Discussion.
1.8 Research Objective
The present research attempted to take advantage of the EST sequencing project to
discover and characterize human genes encoding for GPCRs. particularly those related to
genes previously isolated in o u iaboratory, and those involved in neurobiological
function. The identification of novel GPCRs will M e r our understanding of ce11
signalling systems and may potentially identiQ as yet undiscovered receptor systems.
2.0 METHODS
2.1 Ovewiew of Methods
Only the specific methods used in the discovery and characterimion of GPCR genes
GPR23, GPR2.I. and GPRZj are descnbed in this section. They may aiso be found in
several reports (see Publications. page v). Standard techniques for preparation.
subcloning, transformation. sequencing, and radiolabeling of DNA. as well as protocols
for genomic library screenir~g and Southem blotting were employed as previously
reported (Marchese et al.. 1994), and are not detailed here.
Procedures for Northern blot and in situ hybndization were performed by Ms. Regina
Cheng of our laboratory. or Dr. Frank Kolakowski. FIuorescence in situ hybridization
was carried out by Dr. Henry Heng of SeeDNA Biotech Inc. These methods are only
briefly summarized be1ow.
2.2 Cloning and Ctiaracterization of GPR23
(a) PCR of human genomic DNA
One of the overall objectives of Our group has been to search for novel opioid or
peptide-binding receptors by employing a sequence homology-based PCR approach.
Two degenerate oligonucleotides (synthesized by the Biotechnology Service Centre.
University of Toronto) were designed based on conserved regions of opioid and
somatostatin receptors, a 5' primer and a 3' primer, and used to ampli@ human genomic
DNA by PCR. Different pairs were designed to ampli@ different populations of gene
fragments. PCR products were subcloned into Bluescript SK-, sequenced, and the
sequence anaiyzed. One of these pairs was designed on TM2 (OLIGO 966: 5'-TGGGA
HHSTGGCCVTTYGG; H =A.CorT, S = C or G, V = A , C.orG, Y = C orT; N.B. the
OLIGO nurnber is according to the numbering system of the biotechnology service) and
TM3 (OLIGO 1320: 5'-AATGTAGCGGTCSRCRCTCAT; R = A or G). To a sterile
PCR tube were added 33 pl sterile ddH20. 5 pl dimethylsulfoxide. 5 pL of a mixture
containing the four deoxynucleotides dATP. dCTP, dGTP, and dTTP (each at a 10 mM
each). 5 pl of 10X one-phor-al1 buffer, 1 pl of each primer (1 pg), and 1 pl of template
human pnomic DNA (1 pg/pL). The tube was heated in the PCR machine (Perkin-
Elmer Cetus Thermal Cycler) at 94°C for 5 minutes before removing and letting sir at
room temperature for 2 minutes. 1 pL of Pfu DNA polymerase (2.5 U) was added before
overlaying with sterilized nujol mineral oil and placed into the PCR machine. A preset
program was run using the following conditions: denaturation at 94OC for 2 minutes.
annealing at 50°C for 1 minute. and extension at 72°C for 2.5 minutes for 30 cycles.
followed by a 7 minute fnal extension at 72°C. The 50°C annealing temperature was
used as this temperature allows the pnmers to anneal with relatively high specificity to
complementary sequences of the template DNA. 10 pL of the reaction was
electrophoresed on a 0.5% low-melt agarose gel and a band of the appropriate size (-1 00
bp) was subcloned into Bluescnpt SK-. Samples were sequenced using a
T7SequencingTM kit (Pharrnacia) in accordance to the included protocol with minor
modifications. The sarnples were electrophoresed on an 8% polyacrylamide gel and
exposed on a sheet of Kodak-X-OMAT film to produce an autoradiograph.
fi) Cornputer analysis of sequenced fragments and database searching
The DNA sequence of f'ragments was translated into a six phase amino acid translation
and manually compared with our own GPCR database. Sequences that appeared to
partially encode novel receptors were used to query the Genbank database using the
BLASTN algorithm. One sequence. clone #7. was quened in this manner and found to be
identical to R12 (GenBank Acc. No.: U33447), a previously cloned gene encoding an
orphan GPCR (Raport et al.. 1996). In addition. the isolated clone also shared high
identity to an EST cDNA sequence (ID: 51646, 1.8 kb) that partially encoded a novel
GPCR tnincated in the putative T M2 domain.
fc) Genomic library screening and sequencing of the coding region
This EST cDNA was requested form the 1.MA.G.E. Consortium (Lennon et al.. 1996).
radiolabeled with [ a - 3 ' ~ ] d ~ ~ ~ by nick translation and used to screen a bacteriophage À
EMBL-3 T7/SP6 human genomic iibrary (Clontech). Previousl y. this 1 ibrary has been
used by our laboratory to successfully isolate many phage clones containing GPCR
genes. including the genes encoding the dopamine Dl (Sunahara et al., 1990). D,
(Sunahara et al.. 199 1). and serotonin 5-FITlB (Jin et al., 1992) receptors. Positive phage
clones were plaque purified and DNA was prepared. This was followed by restriction
endonuclease digestion and southem blot analysis using the same probe used to screen
the library. A fragment was isolated. containing the coding region of the GPCR gene.
called GPR23. subcloned into Bluescript SK- plasmid for sequencing and other
manipulations. To insure the accuracy of the sequencing, both coding and non-coding
DNA strands were sequenced.
(d) Northern bZot onalysis of GPR23
Northern blot analysis was performed using rnRNAs from various human tissues to
determine the tissue expression of GPRt3. Human rnRNAs fiom liver. thalamus.
putamen. caudate. frontal cortex. pons. hypothalamus. and hippocampus were extracted
as described (Marchese et al.. 1994). The tissues were purchased fiom The Canadian
Brain Tissue Bank (The Clarke Institute of Psychiatry, Toronto). The post mortem
interval for the tissues did not exceed 48 hours. Tissues were stored at -80°C. Briefly.
total RNA was extracted by the method of Chomczynski and Sacchi (1 987). and p o l y ( ~ ) *
RNA was isolated using oligo-dT cellulose spin columns (Pharmacia). RNA w s
denatured and size fractionated on a 1 % formaldehyde agarose gel. transferred ont0 nylon
membrane and imrnobilized by W irradiation. The biots were hybridized with a [.''PI-
labeled DNA probe. washed with 2X SSPE (SSPE contains 3M sodium chloride. 0.2 M
sodium hypophosphate. and 0.02 M EDTA. pH 7.4) and 0.1% SDS at 50°C for 20
minutes and with O. 1 X SSPE and 0.1% SDS at 50°C for 7 hr and exposed to X-ray film at
-70°C in the presence of an intensi&ing screen for at least one week. The probe was the
same as that used to screen the library.
2.3 Cloning and Characterization o f GPR24
(a) dbEST searching and analysis
dbEST searching was performed by Dr. Lee Kolakowski ro identiQ EST fragments
encoding novel GPCR, and is bnefly described here with references to other sources. We
queried the dbEST maintained by the NCBI on the Intemet with the complete arnino acid
sequence of GPCRs, such as the a-adrenoceptor, using the TBLASTN algorithrn
(Altschul et al., 1 990). EST sequences that were returned having statistically significant
scores were exarnined M e r . The concepnialized amino acid sequences of the EST
sequences were used to query (Pearson et al., 1988: Pearson 1995) our GPCR database
using the FASTA algorithm to determine whether the EST cDNAs represented known
GPCRs (Kolakowski 1994). The amino acid sequences thus filtered were used to que-
the Swiss Prot (release 3 l ) database using the FastA algorithm (BLOSSOM 50 matrix.
h p - 1 ) (Pearson et al.. 1988; Pearson 1993). The sequence of one EST (cloneID: c-
IzflO; GenBank Acc. No.: F07228) that met these criteria was used for further
investigation.
(61 Making a radiolabeied probe from EST sequence
As the EST fragment identified fiom the cornputerized database searches was
unavailable fiom the I.M.A.G.E. consortium. human genomic DNA was amplified using
PCR (similarly described in 2.2) using a set of specific oligonucleotides designed based
on the EST cDNA sequence (P 1 : 5'-CGGAATTCCTGGGCATCATCGGGAACTCCL4
CG; P2: 5'-CGT CTAGACAGGAGGCAGATCACCAGGGTGGC). Each primer
contained a self-inserted restriction enzyme recognition sequence (EcoRI for PI and daal
for P2) to facilitate subcloning. The PCR conditions were as follows: denaturation at
94°C for 1 minute, annealing at 55°C for 2 minutes and extension at 72°C for 2 minutes
for 30 cycles. followed by a 7 minute extension at 72OC. The resultant PCR products
were subcloned in Bluescript SK- plasmid. Colonies were selected. plasmid DNA was
purified. and the inserts sequenced. An insert identical in overlapping sequence with the
EST cDNA was successfi.xlly isolated.
/cl lsoIation of GPR21 and sequencing
The PCR-generated fiagrnent was radiolabeled with [ C Z - ~ ~ P I ~ C T P by nick translation.
used to screen the sarne human genomic library used to isolate GPR73. and a fragment
containing the gene, GPRZ4. was isolated and subcloned into Bluescript SK- plasmid for
sequencing as descnbed for GPR23 (section 2.2).
fd) Abrtbern blot analysis of human fissues
Northern blot of RNA isolated from severai human tissues was performed as described
for GPR-73 (section 2.2), except that the blots were hybridized with a 855 bp ["PI-labeled
fragment of the coding region of GPR2-I that was obtained from a Pst1 digestion. Central
and peripherai tissues were used: human Frontal cortex. basal forebrain. hippocampus.
substantia nigra. corpus callosum. caudate-putamen, hypothalamus. midbrain. arnygdala
subthalamus. thalamus. liver. heart. pancreas. kidney. muscle, lung, and placenta.
(e) PCR amplification ofrat orthologue of GPR24
To obtain more specific information about the tissue expression. we searched for a rat
orthologue of GPR2-i in order to perform northem blot analysis of RNA from rat tissues
and in situ hybridization of rat b r in slices. Rat genomic DNA was PCR-amplified (as
described in section 2.2) using degenerate oligonucleotides designed based on the
sequence encoding putative TM3 (OLIGO 1430: Y-CTGACCGYCATGRSCATTGACS
GCTAC; Y = C or T, R = A or G, S = C or G) and TM7 (OLIGO 1429: 5'-GGGGTTG
RSGCAGCTGTTGGCRTA) of the receptor encoded by GPR2-I and somatostatin
receptors. The PCR conditions were as foIlows: denaturation at 95°C for I minute,
annealing at 5j°C for 1 minute and extension at 72°C for 2.5 minutes for 30 cycles,
followed by a 7 minute extension at 7 2 T . The resultant PCR products were subcloned
and sequenced as described in previous sections. and the rat orthologue obtained.
~ Norrhern blot analysis of rar rissues
The rat orthologue PCR fragment (-500 bp) was radiolabeled by nick translation and
used to probe a blot prepared as descnbed for northem blot analysis for human tissues
(section 2.2) except that RNA was extracted from rat tissues. Central tissues were from
whole brain. frontal cortex, striatum. cortex. thalamus, pons, and cerebellum. Penpheral
tissues included liver, kidney, ovarv, fetus, neonate and hem.
(a in situ hybridization
The sarne rat orthologue PCR fragment was radiolabeled and used as a probe for in
situ hybridization of rat brain sections. Preparation of rat brain sections and in sitir
hybndization procedures were performed by Regina Cheng. and a briefly descnbed
protocol is uanscribed for the most part from a recent report fiom our laboratory
(O'Dowd et al.. 1996).
Male rats (Charles River. -200-500g) were killed by decapitation and brains removed
in 30 seconds and fiozen in crushed dry ice. Frozen brains were sectioned at 14 Fm
thickness on a Reichert-Jung cryostat at -20°C and thaw-mounted onto microscope slides.
Sections were fixed in fieshly prepared 4% pdormaldehyde in 0.02% DEPC water for
20 minutes at 4OC in an ice bath and then washed for 5 minutes in cold phosphate-
buffered saline, pH 7.4 before dehydration in an alcohol series. Fixed sections were
stored at -70°C until use.
The PCR-derived rat orthologue of GPR24 was labeled by random priming using
[)'s]~cTP. Rat brain sections were prehybridized for 2 hours in buffer containing 50%
deionized formamide. 0.6 M sodium chioride. 10 m M Tris-HCl. pH 7.5. 10% dextran
sulfate. 1% polyvinyl pyrrolidone, 2% SDS. 100 mM dithiothreitol. 200 p@ml hemng
sperm DNA. and hybridized with the labeled probe (106 cpm/slice) for 16 hours. and
washed in conditions of increasing temperature and decreasing ionic strength. The
hybridized sections were dehydrated in a graded alcohol senes and were esposed to X-ray
film (Dupont MW-34) for 4 weeks at -70°C and developed. For use as controls. adjacent
sections were hybridized following treatment with RNase. to confirm the specificity of
hybridization.
(h) Receptor expression and function
As the putative arnino acid sequence of the receptor encoded by GPR2.I shared
significant amino acid identity to the somatostatin farnily of receptors, an entire coding
region was inserted into the expression vector pcDNA3. Two different constmcts rvere
subcloned in pcDNA3: the first was a 1.6 kb Sad fragment containing -400 bp 5'
untranslated region (UTR) which contained a (CA), tandem repeat sequence upstrearn of
the start codon: the second construct was produced from a SmoI digest of the construct in
Bluescript SK- plasmid with a reduced YUTR (67 bp) and the CA repeat sequence
eliminated. Transient expression of both constructs was perfomed in Cos-7 cells using a
calcium phosphate transfection system according to the protocol included and is not
reiterated here. Ce11 culture. membrane preparation and radioligand binding studies were
adapted as descnbed in Zastawny et al., 1994.
Bnefly, Cos-7 cells were grown as monolayers in a Minimum Essential Medium witb
10% fetai bovine s e m in an atmosphere of 5% CO2 at 37°C. The membranes were
prepared at 4°C 48 hours post-transfection and when the cells had been g r o w to apparent
confluency. The cells were first washed in 10 ml of ice-cold phosphate buffered saline
before scraping off with a rubber policeman in 2 ml of phosphate buffered saline. Cells
were pelleted by spinning at 100 x g at 4OC for 10 minutes before Iysing in hypotonic
binding buffer pypotonic binding buffer contains 5 mM Tris-HCI. pH 7.8. 0.5 mEii
magnesium chioride, 0.1 rnM EGTA containing protease inhibitors (1 0 p g h l
b e r n i d i n e , 5 pgml leupeptin and 5 &ml soybean trypsin inhibitor)] and using a
Polytron homogenizer (Brinkman Instruments. Westbury, New York) twice for 30
seconds each at the 5.5 setting. The lysate was spun at 100 x g at 4OC for 10 minutes. the
supematant collected before spinning at 30.000 x g at 4°C for 30 minutes to pellet the
membrane fraction. The supematant was decanted. the pellet washed once with
hypotonic binding buffer. before spinning again at 30.000 x g at 4°C for 10 minutes. The
supematant was decanted. and the pellet was resuspended in 1 ml of binding buffer
(binding buffer contains 50 rnM Tris-HC1. pH 7.8. 5 mM MgClZ. 1 mM EGTA and
protease inhibitors as the hypotonic binding buffer). Protein concentration was
determined using the Bradford assay (1 976).
For saturation experiments, cell membranes (50 pg protein) were incubated with
increasing concentrations of ligand in a total volume of 1 ml for 2 hours before being
rapidly filtered through a 48-well ce11 harvester (Brandel. Montreai. Canada) ont0 0.5%
polyethylenimine presoaked GFK Wlatman filters (Clifion) and washed twice with 5 ml
of ice-cold 50 mM Tris-HC1. pH 7.4 bufTer. The ligands screened, using a range of
concentrations, were [125~]-~yr'-somatos~tin-14. ['HI-naloxone. [3~]-brernazocine. ['HI-
DTG. and ['Hl-haloperidol. Bindinp was rneasured using a Beckman LS6500 liquid
scintillation counter. Specific binding was determined by subtracting the amount of
binding in the presence of an antagonist from the amount of binding in its absence. The
antagonist used for [125~]-~yr1-somatostatin- 14 was ~~r ' - somatos~a t in - 14. naloxone for
['HI-naloxone and [3~]-brernazocine, and PPP for ['HI-DTG and [3~]-haloperido~. Cos-
7 cells were transfected with carrier DNA to serve as a control.
(i) Lhucleotide repeat analysis
Upon the discovery of a dinucleotide repeat sequence of the form (CA), in the YUTR.
genomic DNA fiom 10 different human individuals was amplified using oligonucleotides
flanking the repeat sequence (OLIGO 1355 Y-ACACTCAGGGCTACACATAGG-3':
OLIGO 1354 5'-TTCACTGTTGCTAATCTTGTC-3'). The resultant PCR products
were subcloned and sequenced to analyze for intenndividual differences in the length of
this repeat sequence.
2.1 Cloning and Characterization of GPR25
(a) PCR amplification of genomic DXA
The isolation of GPR2-I prompted us to perform a search for reiated receptor genes
employing a sequence homology-based PCR approach. Human genomic DNA was
arnplified by PCR using degenerate oligonucleotides designed based on the sequences
encoding TM regions TM3 (OLIGO 1430: 5'-CTGACCGYCATGRSCATTGACSGCT
AC; Y = C or T, R = A or G. S = C or G) and TM7 (OLIGO 1429: 5'-GGGGTTGRSGC
AGCTGTTGGCRTA) of somatostatin receptors and the receptor encoded by the
somatostatin-related gene. GPRZ-I. The PCR conditions were as follows: denaturation at
9j°C for 1 minute, anneding at either %OC, 4j°C, or 38OC for 1 minute and extension at
72°C for 2.5 minutes for 30 cycles. followed by a 7 minute extension at 72OC. The
resultant PCR products were subcloned into Bluescnpt SK- plasmid and sequenced as
described for GPR23 (section 7.3). One of these products, clone #37. when translated to
its amino acid sequence. exhibited sequence motifs consistent with a GPCR receptor.
f i) Isolation of GPR2j and sequencing
Clone #37 in Bluescript SK- plasmid was restriction endonuclease digested with
B m H I and XhoI to generate a DNA fragment (-500 bp) and radiolabeled with [''PI~CTP
by nick translation. The probe was used to screen the same human genomic library used
to isolate GPR23 and GPR2-I. and a Fragment containing the gene. GPRZj. was isolated
and subcloned into Bluescript SK- plasmid for sequencing as described for GPR23
(section 2.2).
(c) Northern blot analysis of hurnan tissues
Nonhem blot of RNA isolated fiom several human tissues was performed as described
for GPR23 (section 2.2), except that the blots were hybridized with the same radiolabeled
probe used to screen the library.
2.5 Chromosomal Localization of GPR23, GPR24, and GPR2S
Fluorescence in sifu hybridization ( F I S H ) analysis of human metaphase spread
chromosomes was used to identi@ the specific chromosomal localization of the three
novel genes. The method for FISH was performed by Dr. Henry Heng fiom SeeDNA
Biotech Inc. and was performed according to Heng et al. (1991) and Heng and Tsui
(1 9933. A brief surnmary of the protocol authored by Dr. Heng is transcribed here. The
first step was to prepare chromosomal slides for probing. Lymphocytes isolated from
human blood were cultured in a minimal essential medium supplemented with 10% fetal
calf serum and phytohemagglutinin at 37OC for 68-72 hours. The lymphocyte cultures
were treated with BrdU (0.18 mg/ml Sigma) to synchronize the ce11 population. The
synchronized cells were washed 3 times with serum-fiee medium to release the block and
recultured at 37°C for 6 hours in a minimal essential medium with thymidine (2.5 &nl:
Sigma). Cells were harvested and the slides were made by using standard procedures
including hypotonic treatment, fixing and air-drying. The slides were baked at 55°C for 1
hour. After m a s e treatment, the slides were denatured in 70% formamide in 2X SSC at
70°C for 2 minutes followed by dehydration with ethanoI. Biotinylated phages
containing either GPR73. GPR24, GPRZj were used as probes for FISH mapping.
Probes were denatured at 75OC for 5 minutes in a hybridization mix consisting of 50%
formamide and 10% dextran sulphate and human cot 1 DNA. Probes were loacied on the
denatured chromosomal slides afier incubation at 37°C for 15 minutes to reduce
interference by repetitive sequences. After hybridization overnight. the slides were
washed and detected as well as arnplified. FISH signals and the DAPI banding pattern
were recorded separately by taking photographs, and the assignment of the FISH
mapping data with chromosomal bands was achieved by superimposing FISH signal with
DAPI banded chromosomes.
3.0 RESULTS
3.1 Overview of Results
Several meihodologies were utilized in the cloning of the three hurnan GPCR genes
reported in this thesis. Each encoded receptor shared greatest sequence homology to a
separate class of the GPCR family. and this determined the type of characterization
subsequently performed. Thus, the cloning of each gene and its partial charactenzation is
presented in separate sections. and in chronological order. The GPR nomenclature used
(i.e. GPR23. GPRZ-I, GPR25) is in accordance to the scheme developed by our laboratory
with Dr. Phylis McAlpine (The Genome Database: htip://gdbwvw.gdb.org/ gdb) to
provide a spstem that would have each orphan receptor gene known under a single name.
3.2 Isolation and Characterization of GPR23
(a) CZoning of GPRZ3
From the large family of GPCRs. our group has a specific interest in opioid and
peptide-binding receptor genes. We have sought to identiQ novel opioid receptor genes.
with a particular interest in those involved in the acquisition of addictive behavion.
Initially based on the sequence encoding the 6-opioid receptor (Evans et al.. 1992) and
the somatostatin receptors. we have ernployed a sequence homology-based PCR
approach, in which degenerate oiigonucleotides together with human genomic DNA is
used to amplie GPCR genes of similar primary sequence. In one of these ongoing
experiments. degenerate oligonucleotides were designed based on opioid receptor
sequences following TMZ, and TM3, as described (see Methods 2.2). (TM domains 2.3,
6. and 7 are comrnoniy chosen because of the high sequence conservation in these regions
between subtypes). PCR of human genornic DNA with these oligonucleotides resulted in
nurnerous DNA fragments, mostly encoding previously cloned GPCRs (see Table 3.1 ).
] Nociceptin 85 1
( Non-GPCR encoding fragments 1 1
1 I
1 p-opioid SSTR2
( Total
13 1
Table 3.1 Classification of PCR products. GPCR genes amplified fiom hurnan genomic DNA by PCR using primers OLIGO 966 and OLIGO 1320 (see Methods 2.2).
Identification of fragments was perfomed by analyzing the DNA sequence. translating
the nucleotide into amino acid sequence using the StriderT" DNA analysis program. and
then manually cornparing the protein sequence to our own database of GPCRs.
Fragments that were not identical to any known GPCR but exhibited conserved sequence
motifs of GPCRs were used to query GenBank; using the BLASTN and BLASTP
algorithm (Altschul et al.. 1990), fnements were searched against al1 published GPCR
genes. One of the fragments thus generated, narned clone 7 (approximately 100 bp in
length) was found to be 100% identical to the previously cloned orphan R l 2 receptor
gene (Raport et al., 1 995). However, the GenBank search results also revealed that clone
7 shared high identity to a deposited sequence (480 bp) of an 1.8 kb EST cDNA
(Accession no.: H20663). This EST sequence was translated to its putative amino acid
sequence using StriderTM and manually analyzed and found to pariially encode a GPCR
encompassing TM2 to intracellular loop 3. The nucleotide sequence was used to query
the Genbank databases and the results indicated that this partial sequence encoded a novel
GPCR related to the genes encoding the nucleotidic P2Y receptors. At the time of this
observation, our laboratory had published a report on the cioning of the uridine nucleotide
receptor (UNR) gene (Nguyen et al.. 1996), a mernber of this farnily. As we were
interested in identiQing subtypes of the LNX receptor. we proceeded to isolate the full-
length coding region.
The EST cDNA kvas requested and subsequently obtained from the I.M.A.G.E.
Consortium, an organization that distributes publicly available EST cDNAs. The 1.8 kb
EST cDNA was found to oniy partially encode a GPCR. truncated upstrearn of the
putative TM2 domain. A human genomic library was screened with the radiolabeled
fiagment to obtain the full-length open reading f k n e (ORF). Five positive phage clones
were isolated, plaque purifîed and DNA was prepared. This was followed by restriction
endonuclease digestion and Southern blot analysis. A 4.5-kb Sac1 fragment. appearing in
2 of the phage clones (results not shown). was isolated and subcloned into the Bluescript
SK- plasmid. and sequenced. The Sac1 fragment was found to contain identical
overlapping sequence to the EST cDNA. This genomic clone was named GPR23. its
sequence recorded, and translated into its putative amino acid sequence using StriderTM.
GPR23 contained an intronless ORF of 1 1 10 bp encoding for a putative GPCR protein of
370 amino acids (Figure 3.1). The ORF was established by sequencing upstrearn and in-
frarne from TM1 and examining codons that encoded methionine residues that matched
with the Kozak consensus sequence (Kozak 1987). Only methionine residues that were
downstrearn from the fint in-frarne stop codon found were considered. Although none of
:le ':iI .:sc .;s~ Le: ?ke Lys y?: .a: Le-; .%T. ;lj K a ':dl - j r Ser V a l V a l Pht I h : l --- --- -. - --- --- -a,- ;-;& ...- . .- -mm .-.. J . . ICI. JA- ..- .A. .M- - - - ..? ;s2T ;c7 --F -. - .-- --- --- --- - - - - c : Ji.. .S- .-.ch 3 . . 3 - n -.- .-.-r - - -
Leu P r o P h e 1.1.2 :Ir 2P.e Yyr .b: --. -+- --- . . .-. ..-- ..-- ?ke .LA: .L-z 3 ~ 2 y : ~ ;:: ;ke il.; . G F 7:: Le: :y: ::: --- . ..-. - - . . . . . - -. .-.. .-. . . . ..-A- .=AC TTC .G-C I X 1.;; 72; Y:: -TT 1: f.::: XCZ :TC T:C ?
b b
Ile Ser V a l .:5~ .;=a ?fie Lc.: A;., :Le -;il :yr ;r: ?kt A:': Jer A:: 2: :le . k 3 Ykr ::l .-- - .- --.- -.* --"I --- --- --- .-- --- - r i --- --- -.-. -- --- . +* .-- .--- . -- , i , .-.. . .-.i- 2 . -. >A-.- j. . - - - - 2 >L - n. . :. - .;r. .-. . . . . 2-7 . -. -u. .-.-. -.. . .-.a.: .-L. + .-
t lU4 .k:: .=..=: .br. :e: .il3 E l e Vaï Cya Ala G l y V a l Txp Lle Leu V a l Leu Ser G l y G l y Ile : - : . -,. . .- " -- +-- . -- .-,- --- -- --- ; ----- --- --- --- --+ .-- -a- -+- .-- = . : .-.'a.~ .-au .-a. . -. i ~ c . .%- . > - i . J - JL IU. . - . iu n, - . .n 3 . - - .i nu. au^ 2". .-.- - . -.
- . Sly Fhe Ile Iie Pro L e u T l e Leu Asn V a l Ser Cys Sar 2c.r -:31 ':a: Le; .=..=: Y?,= L e s -:- .-- --- .-- .-- --- --- --- *-- ..t -+- --.. - - - --- -^- --- --_ _-- - _. . .- --- - - IUU . . . .-. . . -7 . -- - - i .-, .-. - .-, - . J .a-- -1. - . - . - 2'- - + - . - . 2. J 2. ., - .4 .-.a'-. .Tc - - . * c - :
- . . . .. , . - . :- .-.-A -e,: , 1 - .=.:: Ce: ;lr. .=-:A :le :y.: .a: ::;s ?.+ le.: i-: .:.:s ??.e .=.:A L ~ Z Ile : -: -- - --- --- --- - - - --- .--.- ,<- ..a 3. > -.,L --- -- ;La: -TT .;c: .-: --- ..-- --- -. - .JL ... ..J >.-,-. x z ,TT ;:.=. K.; .;y: ; - =
ln7 !!et T y r Pro I le T h r Leu Cys Leu Rla Thr Leu Asn Cys Cys Phe Rsp Pro Phe Ile Tyr J :i --- -. - --. .-- . +I -.,. * -- - --- --. .-1 --- - . - -,-- --- --- -. - -+- -- - . - - -. - - - - .-. . .J . .-.,- --.-. .Y. - .-.- L . . J . JL . . . 2- .-.- . - . J .---.L . J . . 2 - . . . I-TL - - . . . - .-.. . . .-. - + : 2
Figure 3.1 Nucleotide and translated arnino acid sequence of gene GPR73. Nucleotides and amino acids are numbered on the right relative to their position From the first amino acid of the protein. The putative TM domains are labeled and shaded (TM1 -TM7). Putative sites for N-linked glycosylation (*). and phosphorylation by PKA (V) and PKC ( + ) are indicated above the corresponding arnino acid residue.
the sequence conformed absolutely to the Kozak consensus sequence. there was a stop
codon intempting the sequence and the first methionine downstream of it was accepted
as the start codon.
6) Anclysis of the amino acid sequence of the receptor encoded by GPR23
Hydropathy analysis of the amino acid sequence encoded by GPR23 demonstrated
the seven putative TM regions characteristic of GPCRs. Prim- amino acid sequence
analysis revealed amino acids that are found almost invariably or conservatively in the
analogous position across members of the GPCR superfamily. In addition. the encoded
receptor has four N-linked glycosylation consensus sites (Asn 15. Asn24. Asn.28. Asn 183)
and several consensus sites for phosphorylation (see Figure 3.1): Serl55 by protein
kinase A (PKA); Thrl48, TnrlSl, Thr230. Thr242, and Thr341 by protein kinase C
(PKC).
An amino acid cornparison of the receptor encoded by GPR73 with other functional
GPCRs revealed that it shared highest identity (58% overall. 66% in TM domains) with
the chicken P2Y5 receptor (Webb et al.. 1996) and the human LJNR receptor (28%
overall. 40% in TM domains). The encoded receptor also e.xhibited significant identity to
the receptor encoded in intron 17 of the retinoblastoma susceptibility gene (Toguchida et
al., 1993) and the R12 orphan receptor gene (Raport et al., 1995); 68% and 41%
respectively in TM domains (Figure 3.2). The significant hornology with rnembers of the
P2Y group of GPCRs prompted us to check for binding with various nucleotide ligands.
A 4.5 kb fragment encoding GPR23 was inserted into the expression vector pLXSN. and
the constmct was sent ta Dr. John T. Tumer (University of Missouri). The construct was
g E R G % r r r r r
- -
- œ x x o la a auai ( I I . . . .
used to infect human 1321Nl astrocytoma ce11 lines. To assay for receptor activity.
intracellular calcium flux was measured after the addition of various nucleotides (ATP.
UTP, ADP, or UDP). However, no calcium flux was detected in response to any of the
nucleotides (results not shown). As a positive control. the UNR gene was aiso expressed
and found to respond norrnally (results not shown).
/c) Northern blor analysis of human tissues
Tissue distribution for the expression of GPRt3 was examined by northem blot
analysis using ~oI~(A)-RNA isolated from several adult human brain regions and human
liver and probing with the sarne radiolabeled fragment used to screen the library.
Transcripts for GPR2.3 were not detected in the brain regions examined: thalamus.
putarnen, caudate. frontal cortex. pons, hypothalamus, or hippocarnpus.
fd) Chromosomal localization of GPR-73
FISH of hurnan metaphase spread chromosomes was used to identify the specific
chromosomal localization of GPR23. Biotinylated phage containing GPR-3 was used as
a probe for FISH mapping. Of 100 mitotic figures checked, a signal appeared on only
one chromosome 94% of the time, indicating a very high hybridization efficiency. DAPI-
binding patterns on the mitotic chromosomes were used to identify the specific
chromosomes to which the phage hybndized. For higher resolution. a s u m a r y from ten
photographs was taken in order to identi@ the specific region on the chromosome to
which each phage hybridized. No additional loci were detected by FISH analysis under
the conditions used. GPR23 was assigned to the sex-linked chromosome X, region q13-
q2 1.1 (Figure 3.3). LJNR is located nearby at q 1 3.
Figure 3 3 FISH analysis of GPR23. (A) Results of metaphase spread chromosomes probed with a phage clone encoding GPR.23. Arrows point to the FISH signals on a pair of chromosomes. (B) A summary of the FISH anaiysis; each dot represents the location of a fluorescent signal on the chromosome using phage GPR23 as a probe.
3.3 Isolation and Characterization of GPR24
ta) CZming of GPR2-l
In contrat to the cloning of GPR23. the discovery of GPR24 began with a deliberate
search of the GenBank EST database (dbEST) for GPCR-encoding sequences. .As stated.
our laboratory has been searching for novel genes that belong to the GPCR gene
superfamily. EST cDNA sequence generation and the creation of a publicly available
EST database prompted us to search the dbEST for the presence of GPCR-encoding
sequences. A customized search of the dbEST (Kolakowski 1994) renimed a nurnber of
interesting sequences. Some of these represented GPCRs described and published
previously. while others partially encoded novel receptors. One of these EST cDNA
clones was of interest as it partially encoded a receptor protein from TM1 and TM3
which shared significant homology to the opioid and somatostatin family of receptors.
As the EST cDNA was not available from the I.M.A.G.E. consortium. we proceeded to
clone a 350 bp genomic DNA fragment amplified from PCR using specific
oligonucleotides encompassing the published EST cDNA sequence. This fragment was
radiolabeled and used to screen a human genomic library to obtain the full-length ORF.
Eight positive phage clones were isolated, purified and DNA prepared. Following
restriction enzyme digestion and Southem blot analysis, a 1.6 kb Sac1 fragment from one
phage was isolated (results not shown). subcloned into Bluescript SK- plasmid, and
sequenced. StriderrM was used to record the nucleotide sequence and to translate it into
its putative arnino acid sequence. The fragment was found to contain identical
overlapping sequence to the EST cDNA. This genomic clone, GPR24, contained a full-
length intronless ORF of 1206 bp encoding for a protein of 402 amino acids (Figure 3 A).
The start methionine was identified as the methionine residue downstrearn ffom the first
in-fiame stop codon upstrearn from the putative TM1 domain. Also. approxirnately 80 bp
upstream of this start codon was discovered a (CA), tandem repeat sequence.
[b) AnaZysis of the amino acid sequence of the receptor encoded by GPR24
The translated amino acid sequence revealed the typical 7 TM topology. and
displayed arnino acids that are charactenstically conserved across members of the GPCR
family. No putative N-linked glycosylation sites were present. Numerous consensus sites
for phosphorylation were observed: Ser207 and Th304 by PKA; Ser200. Ser297. Ser295.
Thr300. Thr366. and Ser374 by PKC (Figure 3.4).
Using BLAST search. highest identity was observed with the somatostatin receptor
eene farnily (Figure 3.5). The receptor encoded by GPRZ4 shares -40% identity with the C
five sst subtypes in the putative TM domains (Table 3.2).
Table 3.2 Cdculation of TM amino acid identities. Per cent arnino acid identities in the putative TM domains of the protein encoded by GPR2-I with the five sst subtypes.
Significantly, an aspartic acid residue, Asp172, is present in TM3 that aligns with the
sornatostatin receptors. It has been demonstrated in other GPCRs that this residue in the
analogous position is important for receptor-ligand interaction (Strader et al., 1987:
Fraser et al.. 1989; Surran et al., 1994). The receptor encoded by GPR24 has other
----.-,.---.-.-----.-.-.--.... ..... .- . I.--Z--.-lii - --.AC a*. .-.--.--. - --.'dCI%-----.U~-- 2- ,-- ---. ---eV --^- __....- --?-.L . -CI . . .... 2. ' ..... .-- ---.-- ---- ..-- --+ ---- . ---. - . r ; ; :-- . - ------- - - -. . -- --- - --*-- - ---.- . - =ui-.-.. i---i.-.- :.-.-ri - - - - .. - ;J. z----.:.--- JiJV<:- --.-------. -.~~.?i--.-i.n~- 2 - i.2.. - - .; . . -
rys Leu Leu - - - . . . . . .
.. - -- : < =,.* - , . - . . & - . - - ........ :-. i - . - - - -- - --- - - - -. . . . . . . . . . . . . . . . . . . .li .. . . . . . . . .
iM3 Phe T h r Ser T h r Tyr Ile --- - -- - - - - -- --- ....-...... s L .v- . . .TL ..... - - . . - - - - - . .-- -?r .'-: Y?.: L.z
-+- - - - - - - . * . - . - - . - - - ..- - . . - . - - .-.- m 4
T r p Aia Leu Ser Phe Ile A.- .+- +- . --- - - - . . . . . . . . . . - . . . . . . .
. - . . . . . - .. - - - - : - - - - . - * . - . . - - * - ... . - - . . . . . - : - ! : - z A- : .::: ::,. y , : ; - , 1: - . - A - - - - . - - .--.. . - .=2p ?.: .=.:: . . . . . - - + --.- - - - .-* -.. .-- --. -... . . - - --- - - - ...a - - + .-- - - - - - - - - - . A -- -. - " -. - . . ::*-. :.,- :..A-- I . : ::_ .:_ :2_.-.-.-- ._. - 2 - A - . - . - ----. :.-.- .-.-* :.-.- . - - T2.E --; .;-: .:- F r - Ti: Le-; 7 : : ;Ir. :=.- Phe Leu Ala Phe EUa Leu P r o Phe Val Val I l e --- -. -. - . . . --TL- --. . - . -- - - - - - - - --- --- --- . - - --- -.- -4- --- --- --- --. - - - - . .- .. -.2 ..-.L -.-.a . . . . . . -. . :. ... :'-- - - I . - . - - . . . . . . . . . .
' - - -.- : ..-.: :K.: ::- :: r 17. ::.r .k:. Ald a d . . . . . . . . . . . . . - - - ..- --.- - - - --- .-- -- - --- - - - ..- . . - - - - - - - - " . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
* Z y s Leu hsn P r r Phe V a l T y r Ile Val Leu Cys - - - --- - - A A.. --- --- -- - - - - --- a-- . - - - - . 4 - . . . . . . . . . . . . :.; . ; y . . -... :-: . . . . > - ;--.a
- . _r . - - . : - -':Z F:: .=.i~ .:.ii ;-F. :::. 1::. 1:: .'-.:: .=.- 3 - - - - - . . . -..- ............... . . . . .- . . . . - . - . . . . . . . . . . - - . . .---. i . . . . . . . . . . . - . - . .
Thr Ala fle X a f l e t y s Leu 'fa1 - -. - - - - - - - - . , - + ,.-- --. .-. ,-.-A. 2 . - - .-.m. : .-... - 1 . . . . .
Figure 3.1 Nucleotide and translated arnino acid sequence of gene GPR24. Nucleotides and arnino acids are nurnbered on the right relative to their position from the first amino acid of the protein. The putative TM domains are labeled and shaded (TM 1 -TM7). Putative sites for phosphorylation by PIC4 (V) and PKC ( 4 ) are indicated above the corresponding amino acid residue. The dinucleotide repeat sequence in the 5' UTR is bolded and underlined.
GPR24 M L C P S K T D G S G H S G R I H Q E T H G E G K R D K I SOMATOSTATIN RECEPTOR 1 (sst,) SOMATOSTATIN RECEPTOR 2 (sstl) SOMATOSTATIN RECEPTOR 3 (ss~,) SOMATOSTATIN RECEPTOR 4 (ss~,) M S A P S T L P P G G E E G I . G T A W P S A A N A S ~ A P A E A E E A 35 SOMATOSTATIN RECEPTOR 5 (ss~,) M ~ P L F P A S T P S W N ~ S S P G A A S G G G D N R T 2s
I T RANSMEMBRANE 1 l I TRANSMEMBRANE 2 I
1 1
1 TRANSMEMBRANE 3 1
O P R ~ ~ ~ S P ~ R T G S I ~ Y I N I sstl C I N G T L S E G Q G S A I L ~ - S F I Y S ~ ~ ~ ~ ~ ~ ~ ~ ~ SS~, E I Q T E P Y Y D L T S N A V L - T F I Y F V
SSti ~ P S P A G L A V ~ G V L I . B L M Y L V S S ~ ' J A G P G O A R A A G M V A I - Q C I Y A L O O 1 s t ~ L V G P A P S A G A R A V L V . ~ V L Y L L V C A A
OPR24 @ sst, L V sstl OT S S ~ , R A sst, S A ssts G A
# Y L A V V
I ~ @ s ~ F G T ~ C L L I
I I L G N T L V I Y V I VV L L & N S L V I Y V ~ L R H T A S P S V T N -
C L V L G N A L V I F V I
L G N T L V I
j+":'yf P L R A A T Y R R
I TRANSMEMBRANE 5 I
I G N S T V I F A ~ V K K S K L H W C N N V P D I F I L R Y A i K T A T I - . - ~ ~ L [ A i ~ ~ ~ V [ L V T o T L L R H - [ ] L ~ R 1 3 1 I N L s ~ v D L L F L L G M P F M I
L R Y A K M K T I J N . - - I Y I L N L A I A D E L F
- - V Y I L N L A L A D E L L R Y A K M K T A T N - . . I Y L L N L A V A D E L F
Y V M L R F A K M K T V T N - - I Y ~ L N L A V A D V L Y
1 TRANSMMBRANE 4 1
H ~ L M G N G V H F E T M T t 6 6
L G L P F L A M Q V A L V H - P F U A 1 R I 1 6
L G L P f L A A O N A L s Y - P F S L M R I 1 7 L S V P F V A S S A A L R H - P F S V L R i 2 0
L G L P F C A T ~ N A A S F . P F P V L R M
I C L N L G T M A
S A A N L G
S A A
A P A - - -OQRS L K A - - - G W Q Q O I R V . . - G S S K R R V W A P ~ c Q R LRIA~. - . G W Q Q
U
V R V - - - G C V R
I @ L R R K H S R K K S
A I ~ I V M M V V S l V v v@v V L M V
V L V V
T D L 2M Q R W 219 GAW204
A AVV 202 A W 207
G L W 197
SSt, T S G Q E R P P S R V A S K E Q Q L L P Q E A S T G E K S S T M R i S V 1
s s t R I P L T R T T T F
Figure 3.5 Amiiio acid coiriparisoii of the Gl'H2J-eiicoded receptor witli nlated soniatostatiii (sst) receptors. Aiiiino ucids identical to the GPR2.I-encoded receptor are boxed aiid sliaded. 'I'he predicted seveii TM doiiiains are indicated. G a p (-) have beeii introduced to
P niax iiiiize the al ignnients aiiioiig the seqiiciiccs.
residues considered to form the ligand binding pocket of sst receptors. being important
for binding of SST-14 and SST-28 (Kaupmann et al.. 1995). narnely: Tyr23O. Phe766.
Trp3 18, Tyr322. and GW25. Unlike other sst receptors. however. the encoded receptor
has a relativeiy large amino terminus and a short cpoplasmic tail.
fc) Cornparison with rat orrhologue rGPR2-I
Using PCR with oligonucleotides based on the sequence encoding TM3 and TM7 of
the receptor encoded by GPR2-I. we isolated the rat orthoiogue sequence. The protein
sequence is highly conserved with only three amino acid differences (from 357) or 98%
conservation in the compared region between the human and rat (results not shown).
which indicates little evolutionary divergence for this gene. at least in mamrnals.
Id) Northern blot analysis of human and rat tissues
Northem blot andysis was used to detect expression of GPR2-I in a number of human
and rat tissues of both central and peripheral origin. For human blots. the same probe
used to screen the genomic library was used. For rat blots. the radiolabeled rat
onhologue was used. Before probing, the ethidium bromide-stained agarose gel indicated
equai and abundant arnounts of mRNA in each lane. A single 2.4 kb mRNA species for
GPR2.I (in order of decreasing abundance) was detected in hurnan frontal cortex.
hypothalamus, basal forebrain, midbrain, amygdala, hippocarnpus. subthalarnus.
substantia nigra, thalamus, corpus calIosum. liver and heart. while no signals were
detected in the caudate-putamen, pancreas, kidney, muscle, h g , or placenta (selected
regions s h o w in Figure 3.6A). Northem blot analysis of rat brain tissues showed
transcripts expressed in order of decreasing abundance) in frontal cortex. striatum. cortex.
% pl.
-3
Figure 3.6 Northern blot analyses of the brain distribution of GPR2-I mRNA. In (A) human. and (B) rat. The hurnan blot was probed with a fragment isolated fiom the coding region of GPRZ4 and the rat blot probed with the rat orthologue (rGPR2-I). Each lane contained 5 pg of PO~~(A)+RNA.
thalamus, and pons (Figure 3.68). while no hybndizing signais were detected in the
cerebellurn. Analysis of rat penpherai tissues revealed that GPR2.I is expressed (in order
of decreasing abundance) in kidney, ovaq, fetus. and heart (Figure 3.7).
fe) in situ hybridization of rat brain sections
To determine more precisely where G P R B is expressed in brain structures. in sitic
hybndization of coronal rat brain sections was performed with the rat orthologue as a
probe. The distribution of GPR24 was found to be discretely localized to rnany areas
(Figure 3.8A. B). In cerebral cortex. signal was present in the anterior cingulate. frontal.
piriform. and somatosensory areas. Dense labeling was present in the septohippocarnpal
nucleus. which rnay be a component of the primordial hippocampus. Very dense labeling
was detected in the olfactory tubercle. islands of Calleja. media1 nucleus accurnbens. the
dentate gyms and the hippocampal areas CA 1. CM. and CA3. mRNA was also detected
in moderate abundance in the lateral marnrnillary and tuberomarnrnillary nuclei.
arnygdaloid nuclei and the entorhinal area. Lesser amounts of G P R X mRNA were
visualized in claustrurn. substantia nigra pars compacta central grey. laterai geniculate
nucleus. subparafascicular nucleus of thalamus. caudate putamen and nucleus accurnbens.
fl Pharmacological characrerimion ofthe receptor encoded by GPR2-I
The significant amino acid identity observed with the five sst receptors (particularly
within the TM domains). together with the presence of key residues that form the putative
ligand-binding pocket, prompted radioligand binding studies with the expressed receptor
using ['25~]-~yr'-sornatostatin-14. Opioid ligands. [3~]-naloxone and [3~]-brernazocine,
as well as sigma ligands, ['HI-DTG. and SHI-haloperidol, were also assayed for binding.
Figure 3.7 Northern blot analysis of peripheral distribution of GPR2-l mRNA in rat. The rat orthologue was used to as a probe. Each lane contained 5 pg of p o l y ( ~ ) ' ~ ~ .
Figure 3.8 Darktield autoradioyrarns of coronal sections of rat brain showing the localization of GPRX miL".-\. Rrpresentative sections arc s h o w at levcls relatiw to bregma ai (-4 J -0.7 mm and ( B i -4.8 mm. xcording to the stercotactic coordinates (Pasino & Li-atson, 1983). Fr =
irontopnrictal cortex: Cg = anterior cingulatc cones: Shi = scptohippoçampai nucleus: Cpu cliudotr putamen: Acb = nucleus nccumbens: Tu = olfactop tubercle: PO = prima-- olhctor? cones: C N . C X . C.43 = ficlds of Amnon's horn: DG = dcntate gynis: SN = substaniia nigra. pars sompacra: PMCo = posreromedial cortical amygdaloid nucleus: I.hl = latrral mammillary nuc leus: . \hi = mygdalohippocarnpal area: Ent = cntorhinal cortex.
Two different constructs. both pcDNA3 recombinants. were transiently expressed in Cos-
7 mammalian cells; one contained the CA repeat sequence. while the second one did not.
No specific binding was observed with either construct with any of the ligands listed
(results not show) . To ensure that this result was a truc negative result. as opposed to a
methodoiogy problem. the human p-opioid receptor was also transiently expressed in
Cos-7 cells. Specific binding to ?HI-naloxone was observed (data not shoun). indicating
that the protocols used were carried out correctly.
(a CA repeaf analysis
Eighty base pairs upstream of the start codon is a repeat sequence of the form (CA),.
This is the first time a dinucleotide repeat has been found so close to the initiation codon
in any GPCR-encoding gene. To determine the variability in the length of this sequence.
DNA sarnples frorn 10 individuals were amplified by PCR using oligonucleotides
flanking the repeat sequence. The products were subcloned into Bluescript SI(- plasmid
and sequenced (exemplary sequences shown in Figure 3.9). Five ifidividuals had
homoqgous repeat sequences of n= 12. three individuals n= 10, one n=l 1. and one
individual was heterozygous with n=13 and 1 1. The fùnctional significance of this repeat
polymorphism or its close proximity to the transcriptional start site requires further
investigation. Interestingly, (CA), tandem repeat polymorphisms have been reported for
both sst, and sstz (Yamada et al., 1993). which bear high arnino acid identity to the
GPR2-l-encoded receptor. The observed variations will certain1 y facilitate linkage studies
of the respective chromosomes and help investigate the potential contribution of these
genes to human disease.
f i) Chromosomal localization of GPR24
FISH anaiysis of human metaphase chromosomes in combination with DAPI bandine
patterns was used to map GPR2-I to its chromosome (Figure 3.10A. B). Thehybridization
eficiency was approximately 93% (or 93 of 100 rnitotic figures checked) using the
biotinylated phage encoding GPR24 as a probe. The detailed position was determined
using a surnmary of 1 O photos. Since no additional loci were detected. GPR7-I is located
at human chromosome 22. region q 13.3. It is noteworthy that the closest related receptor.
sst,. is located nearby at q 13.1 (Yamada et al.. 1993).
3.4 Isolation and Characterization of GPR25
(ai CIoning of GPRZS
Following the discovery of the somatostatin-Iike gene GPRZ-I. a search for related
receptor genes was performed using a sequence homology-based PCR approach.
Degenerate oligonucleotides were designed based on TM3 and TM7 of the receptors
encoded by GPR7-I and the 5 sst genes. as these regions are highly conserved arnong
them. Using these primers. human genomic DNA was amplified by PCR at various
annealing temperatures to search for GPCR-encoding fragments. The PCR products of
the appropriate size (results not shown) were subcloned into Bluescript SK- plasmid. The
DNA fragments were sequenced and analyzed for homology with known GPCRs by
rnanual searching of our GPCR databases and searching the Genbank databases
(summarized in Table 3.3). The overall population of clones yielded suggested that the
~Iigonucleotides were not optimal. since not al1 the sst genes were arnplified. Two
fragments. clone 37 and clone 42. partially encoded two novel members of the GPCR
Figure 3.10 FISH analysis of GPR24. (A) Results of metaphase spread chromosomes probed with a phage clone encoding GPRt4. Arrows point to the FISH signals on a pair of chromosomes. (B) A sllmmary of the FISH andysis; each dot represents the location of a fluorescent signal on the chromosome using phage GPR24 as a probe.
family. Each fragment was radiolabeled and used to screen a hurnan genomic library to
obtain the full-length ORE Initial atternpts at screening using the clone 42 probe failed
while strong hybndizing simals were obtained using the clone 37 probe. Hence. the gene
Receptors 55°C 45°C 38°C
Clone 37 GPR2-I SSTR2 s s m SSTR4 SSTRS GPR 7 GPRll Bradykinin B2 Olfactory 17 Clone 42 Non-GPCR encoding fragments To ta1
Table 3.3 Classification of GPCR genes amplified. Products obtained from a search for eenes encoding for novel GPCRs related to GPR2-I. Human genomic D N A was C
amplified using PCR with OLIGO 1429 and OLIGO 1430 (Methods 2.4).
containing clone 37 was pursued first. (The pene containing of clone 42 was later
isolated and characterized as a human galanin receptor by other individuals in our
laboratory and is not discussed here). Six positive phage clones were plaque purified,
restriction endonuclease digested and analyzed by Southern blot (results not show). A 4
kb Pst1 fragment detected in two of the phage clones was subsequently isolated and found
to contain the full length ORF of the gene upon sequencing. The genomic clone. narned
GPR75. with overlapping sequence with clone 37. contains an intronless ORF of 1080
bp. and encodes a protein of 360 amino acids (Figure 3.1 1). The putative initiation codon
conforms to the Kozak consensus sequence and was also preceded bp an in-frarne stop
codon.
fb) Analysis of the omino acid sequence of the receptor encoded by GPRZj
Hydropathy analysis indicated the characteristic seven putative TM regions and
arnino acids conserved across members of the GPCR superfarnily were obsenTed. The
receptor protein contains no N-linked glycosylation consensus sites in the amino terminus
or in any of the extracellular loops. Cysteine residues found in the extracellular loops
(Cys 130. Cys 179 or Cys275) may participate in disulphide bond formation. Numerous
consensus sites for phosphorylation were observed: Ser241 and Ser333 by PKA: T h 1 5 1.
Ser225. Ser241. Ser3 12. and Th325 by PKC. Cys322 was found in the carboxyl tail in
an analogous position to other GPCRs that have been demonstrated to be palrnitoylated.
BLAST analysis showed the receptor encoded by GPR2.5 was related to the receptor
encoded by GPRI 5 (30% overall. 41% in TM domains; Heiber et al.. 1996). followed by
angiotensin II type 1 receptor (27% overall, 38% in TM domains: Funira et al.. 1992) and
sst, (33% overall, 34% in TM domains; Panetta et al.. 1994) (Figure 3.12). The identity
to the other sst receptors and the GPRZJ-encoded receptor is lower. The weak homology
to sst receptors and GPR24 suggests that the receptor encoded by GPR2S is not likely a
somatostatin-binding receptor.
:TL 2-2 y:;: ;.i :?r ',-ri: :y: :Le ir3 .:.:A LC y:;= Leu Ala M a Phe Ala Val Gly Leu --- _-- -.- _ ^ _ -. _ -...- -.- --,- --- --- --- -.r --r --- --- --r --C -. J --- _.-.i s-L 3 - - .-.- -Lr ~ C J - r L - .c: JLJ 2 ~ - . . - JL- ;Y2 ZGC Y 7 T m
Leu Gly mn Ala Phe Val Val T w Leu Leu Ala Gly Arg Arg ;:y ? : z .ire .izz les ;.dl --- --- ..- --- --- _-- --,- --- --.- --- --^ - - - -?- --- - - - --- --- - - - -Cr - - A - - J I ' J L .---.- J , - - - - - J . 3 2 - J - 4 - - - 2 - - 2 1.L- JUU -JU --1U JUL - -J --'U -4" - - 4 i i 3
T w R j c Phf Phe Val Leu Bis Leu Ala Ala Ala i4sp Leu Gfy Pha Val Leu T h r Leu Pro Leu ..- --- --+ --- --' -.- --' --- --. -- -'? --- --- --r --- --- ."< --r --- -..- .- - - . .. .- ..-- . - - 1 . i -.i ---.,- _ - 1 2 L . 2 2.- 2,- - :--*- - - 2 f'2L . - - - - - - - - .-.-- - . i --i -. f
ler Trp Leu Pr3 Fhe Ser M a Leu mg Ala V a l ?kz L::s Lc.: .:.:A Ar; Le': :;, .:.1-i Le.; - - - - - . -...- -,-- --- . - . . r : a a : --. - * - i:c :.:z :? 2 :;ç ::.: :- : ::y 3: :Y': :Yi :Y ï.x :.:; :Y :
= - - - - Le,; 2 : ; y . , ; L-2 L e - 2 :-si .:-'a A r ? --- r - . . L e , :fi- - - - --- - - - - - - --. --- --- - - y --:
. . . .. & - --3 -2,- -%- - - J - ;Cs <Y; :x :x :G< ::: .:.<z m
.Ua Phe Val Asn Se: Cys k l a Asn Pro Leu Ile Tyr Leu Leu Leu .-- --- _-- .. - - -- --- --- -. - -.-- --- .-- - - A --,- --- --- : - - - + :. - .%.- .-.V- - ;L 2L- .--TC --b- .. - n. - ..-.- -. - -. 2 - . >
.:.id .:.zz .:-Li Le- .&? .?La J:.; .A:: Tk: A Z Z leq: .:.LA --- .-- --- --- - - - --- - - - - - - --- --- --- --- --- --- -'. - 1 Z : i _ - 2 W.- 2'2U :C - . 3C >UV - J ' - .-.L.. : 11- . >'- - . J J L J
Figure 3.11 Nucleotide and translated arnino acid sequence of gene GPR2j. Nucleotides and arnino acids are numbered on the right relative to their position from the first arnino acid of the protein. The putative TM domains are labeled and shaded (TMI- TM7). Putative sites for phosphorylation by PKA (V) and PKC ( + ) are indicated above the corresponding amino acid residue. The putative site for palmitoylation is indicated also (O).
8 Z b S r r r r
1 I o m - a
(c) Northern blor analysis of human tissues
The same probe used to screen the genomic library was used to detect the expression
of GPR2j in hurnan tissues. Northem biot analysis of p o l y ( ~ ) * mRNA revealed no
expression of GPRZj in liver. or in the 12 brain regions examined: basal forebrain.
frontal cortex. thalamus, hypothalamus. arnygdala caudate. putamen. hippocampus.
midbrain. medulla cerebellum and pituitary (data not shown). Many of these tissues had
been analyzed using GPRl j as a probe and also found not to express this related receptor
(Heiber et al.. 1996).
fd) Chromosornai localizarion of GP R23
FISH of human metaphase spread chromosomes were used to identib the specific
chromosomal localization of GPR2j. The phage clone was biotinylated and used as a
probe for FISH mapping, and the analysis performed as described for GPR23 and
GPR7-I. GPRZS was assigned to human chromosome 1. region q32.l (Figure 3.13~4. B.
C) , in close proximity to other GPCR genes. adenosine Al receptor (Townsend-
Nicholson et al., 1995) at q32.l. and rnuscarinic 3 cholinergic receptor (Bonner et al..
1991) at q41-q4-4.
Figure 3.13 FISH andysis of GPRZS. In: (A) Results of metaphase spread chromosomes probed with a phage clone encoding GPR.25. Arrows point to the FISH signals on a pair of chromosomes. (B) The same mitotic chromosomes stained with DAPI to iden@ chromosome 1. (C) A su~llfnary of the FISH analysis; each dot represents the location of a fluorescent signal on the chromosome using phage GPR25 as a probe.
4.0 DISCUSSION
1.1 Surnrnary of Findings
Isolating and characterizing novel members of the GPCR superfmily are ongoing
objectives of our laboratory. To this end, we have employed strategies centered on PCR
and genomic library screening. However, with the advent of EST sequence generation
and the Human Genome Project. we have now incorporated searching the public EST
database as another powerfixl approach in identifying such genes.
During the course of my research work. three novel genes. GPR23. GPR74. and
G P R X encoding for previously unknown members of the GPCR superfamil- were
discovered. Their isolation was, in part, dependent on the establishment of the public
EST database. Both GPR23 and GPR21 were obtained by screening a human genomic
DNA library with a radiolabeled EST fragment generated from a customized GPCR
search of the database. GPR25 \vas discovered using a sequence homology-based PCR
strategy with the intent of discoverhg genes related to G P R B and the related genes
encoding sst receptors. Following the complete sequencing of the coding region of each
receptor gene. fürther characterization was attempted. Northern blot analysis was
performed to examine expression in several human and rat tissues, and each gene was
mapped to its respective chromosome. As the receptors encoded by GPR23 and GPR2-I
displayed significant homology (Le. as measured by per cent amino acid identity) with
other functional GPCRs, preliminary binding studies were carried out. However. these
initial attempts failed to identify a ligand for these receptors. Hence, they remain orphan
receptors. In total our laboratory has previously isolated 17 such genes: APJ (O'Dowd et
al., 1993). GPRI. GPR2, GPR3 (Marchese et al., 1994), GPR4, GPRj. GPR6 (Heiber et
al., 1995). GPR7, GPR8 (O'Dowd et al.. 19959, GPR9, GPRIO, GPRN (Marchese et al..
1995). GPRIj (Heiber et al., 1996), GPRI9 (O'Dowd et al., 1 W 6 ) , GPR-O. G P R X and
GPR2Z (O'Dowd et al., 1996). The cloning and characterizaion of GPR73. GPRZ-I. and
G P R Z described in this thesis follow in this series of discoveries. and are the latest
additions to a growing nurnber of genes that encode GPCRs for which the endogenous
ligand is unknown. Thus, the discovery of orphan receptors predicts that there are many
signalling molecules that have yet to be discovered that participate in G-linked processes.
The following discussion will examine each of the newly discovered genes funher. in
attempts to identi- the encoded receptor's native ligand. The findings from rnutagenesis
studies of closely related recepton will be discussed to provide insight into the potential
characteristics and properties of these ligands. Also, the successfûl isolation of the
endogenous agonist of the orphan GPCR gene. ORL-1. will be described as it may
represent a precedent in the identification of novel GPCR systems. The application of
such strategies may become a viable rnethod for the identification of orphan GPCRs and
may facilitate the discovery of novel signalling systems in the brain and the elucidation of
their physiological function.
4.2 Does GPR23 Eocode a Nucleotide-binding GPCR?
The GPR23-encoded receptor bears signi ficant amino acid identity to the chicken
PZYS receptor (58% overall, 66% TM domains). greater than to any other member of the
GPCR family (Figure 4.1). In fact. this high degree of similarity was sufficient to predict
that GPR23 was the hurnan orthologue of PZY,. However, the results of searching
Genbank indicated that the gene contained in the RB-intronsusceptibility gene
(Toguchida et al., 1993) was the human orthologue of P2Yj. Hence. the GPR73-encoded
receptor is not the orthologue. but a highly related receptor to P2Y5. The next closest
related receptor was the UNR with 28% overail amino acid identity. Various members of
the P2Y famiIy also exhibited lower than 30% identity. From this analysis. the identity
of GPR23 depended on the pharmacology of the chicken P X 5 receptor.
The P2Y5 receptor was originally descnbed as an orphan GPCR named 6H1. cloned
in 1993 by Kaplan et al. from a chicken activated T ce11 cDNA library. In 1996. Webb et
al. reported specific binding of the expressed receptor with ligands defining nucleotidic
receptors; membranes prepared fiom transfected Cos-7 ce11 membranes displayed
specific. high afinity. and saturable binding to [ ' 'SI~ATP~S. This pharmacology was
fürther supported with displacement expenments that established a rank order affinity
with various nucleotides (ADP, 2-MeSATP. a$-meATP. and UTP). The researchers
concluded on the basis of this observed pharmacology and the amino acid identity
(around 30%) with other PZY receptors. that 6H1 encoded a novel P2Y subtype. the P X 5
receptor.
The publication of those findings together with the cloning of UNR by our laboratory
prompted an investigation of GPR23 as a gene that encoded a P2Y receptor. As
mentioned in Results (section 3.2), we failed to achieve a functional response with
various nucleotide ligands when expressing GPR23 in human 1 32 1 N 1 astrocytoma cell
lines. Another group has since reported data consistent with our results (Janssens et al.,
1997). Using a more extensive array of nucleotides and nucleosides. they were unable to
elicit a response in four functional assays. Thus. the evidence indicates that the GPR-3-
encoded receptor is not a nucleotidic receptor. ln support of this hypothesis. key residues
found to be important for agonist-stimulated receptor activation in P I Y receptors are
absent in the GPRZ3-encoded receptor. Mutagenesis studies on the P3Y2 receptor
revealed the significance of His262. Arg265, Lys289. and Arg292 in agonist-induced
receptor activation (Erb et ai.. 1995). Neutralization or consemative substitution of these
residues by site-directed mutagenesis dramatically decreased receptor activity as detected
by intracellular ca2+ flux assays. Hence, these four residues appear to be crucial binding
determinants for the P2Y receptor ciass, and they are preserved airnost identically in al1
P2Y subtypes. These residues in the GPRZ3-encoded receptor are replaced by Asn for
His262. Leu for Arg765. Pro for Lys289. and Leu for Arg292. Strikingly. these same
substituted residues are found in the P2Yj receptor too. This observation has led to the
contention that P2Y5 is not a nucleotidic receptor (J.T. Turner. personal communication).
In fact. a recent report demonstrated that P2Y5 is not a P2Y receptor (Li et al.. 1997).
Drawing fiom their finding that [ 3 ' ~ ] d ~ ~ ~ a ~ is not a general ligand for PZY receptors
(Schachter & Harden, 1997). and the observation that the P2Yj receptor was
characterized solely on the basis of binding assays with that same radioligand. Li et al.
sought to determine unarnbiguousIy if P3Y5 is a PZY receptor. The nirkey orthologue
was cloned, stably expressed in human 1321N1 astrocytoma cells, and tested for second
messenger responses using a series of nucleotides. No effect was obsemed with any of
the functional assays used. PZY, does not mediate nucleotide-promoted second
messenger responses and. hence. is not a P2Y receptor. The true native ligand for PZY,
is thus unknown.
GPR23 is therefore most closely related to the orphan receptor P2Y5. The P2Y5 and
the GPRZ3-encoded receptors most likely form a distinct subgroup close to the P?Y
family that do not bind classical nucleotides. The significant sequence identity. including
the sarne substituted residues at critical positions for binding for P2Y receptors. predicts
that both receptors will bind the sarne endogenous ligand. perhaps an uncharactenzed
nucleotide.
4.3 Insight into the Identity of GPR24
Cornparison with somatostatin (sst) receprors
An alignment of the receptor encoded by GPR2.I with the five sst subtypes is
compelling evidence that GPR2-I is closely related to the genes encoding sst receptors
(see Figure 3.5). This relationship is better illustrated with a tw-O-dimensional
representation. showing the conservation of identical residues throughout the protein
sequence (Figure 4.2). Several features can be observed from this schematic
representation. First, high homology with sst receptors occun throughout most of the
receptor, except in the arnino terminus. Second. significant amino acid identity is found
in al1 7 TM regions. particularly in TM2, TM3. and TM7. Findings from in vitro
mutagenesis studies of GPCRs support the participation of al1 TM domains in forming
the ligand-binding site (Savarese et al., 1992). Interestingly, the sequence in the second
intracellular loop exhibits a degree of conservation not observed in the other loop regions
or the amino or carboxyl termini. This sequence, begiming with the hailmark Asp-Arg-
Tyr motif. is well conserved among sst receptos. and has been implicated in G protein
coupling.
Calcuiation of TM identities M e r highlights the degree of relatedness of the
GPRtCencoded receptor with the sst receptor farnily (Table 4.1).
Table 1.1 Cornparison of TM amino acid identities between the GPR2-l-encoded receptor and sst subtypes.
Identities in individual TM regions (TM2, TM3, and TM7) between the GPR2-l-encoded
receptor and certain sst subtypes exceed 50% (see Table 3.2). GPCRs which exhibit
greater than 50% TM homology ofien comprise receptor subfamilies (Sibley and
Monsma, 1992). Cornparisons with other rnembers of the GPCR family show that the
GPR2Cencoded receptor is also related to the opioid receptors and the opiate-related
nociceptin receptor (although less so than with sst receptors). The relatedness to these
peptidergic receptors predicts a peptide ligand for the GPRX-encoded receptor.
Empirical cornparisons, however. can only provide a useful starting point in elucidating a
receptor's identity.
Mutagenesis studies of ssf receprors
Detailed molecular modeling together with results of several site-directed mutagenesis
studies on the five sst subtypes have begun to elucidate the amino acids that are
determinants of somatostatin binding. The presence of an aspartic residue in TM3
(Asp172) provides an important ciue to the receptor's identity. Mutation of the
corresponding residue to the conserved glutamic residue in sst receptors has been
reported to effect a drastic reduction in SST-14 binding (Kaupmann et al.. 1995). In
addition to sst receptors. the aspartic acid appears in the analogous position of the
closely-related opiate receptors. and the nociceptin receptor. but is absent in most other
peptide-binding GPCRs. The results of other studies have been sumrnarized in Table 4.2.
The residues that have been shown to be important for binding SST-14 are located in the
TM domains. and are believed to form a ligand binding pocket by interacting specifically
with particular moieties of the peptide ligand. Using a cornputer-generated 3D receptor
mode1 based on the formation of favorable Iipophilic interactions of sst, with SST-14.
Kaupmann et al. (1995) proposed a ligand binding pocket forrned by these residues: (in
sst,) Phel95. Phe232, Trp284. Phe287. Tyr288. Gln.291, and Ser305. In the GPR2-I-
encoded receptor. residues located in the corresponding positions are found identically in
at least one sst subtype (see Figure 4.2), except for a conserved Tyr for Phe in TM6
(Tyr32 1 ). This remarkable conservation of residues lining the putative binding pocket
predicts a somatostatin-related ligand.
sstz Asp89 in Mutation to Asn abolished ~ a + mediated Kong et al.. TM2 inhibition of agonist binding 1993
sst, & Sst j Phe265 Substitution with Tyr shifted binding Ozenberger & characteristics of sst5 close to that of other Hadcock. 1994 subtypes
-- -- - - -- - - -
sst, & sst- Gln29 1 in Substitution of these residues in sst5 with Kaupmann et al.. TM6 and residues of sst, conferred subtype- 1995 Ser305 in selective binding of agonists. 3D TM7 of sst, cornputer mode1 predicts ligand binding
pocket of (using sst, as reference): Phe 195. Phe232, Trp284, Phe287. Tyr288. Gln291. and Ser305
Table 1.2 Sumrnary of mutagenesis studies and molecular modeling of sst receptors.
In addition to the participation of TM region residues. other studies have underscored the
importance of extracellular regions of sst receptors in ligand binding (Fitzpatnck &
Vandlen. 1994: Liapakis et al.. 1 996). Involvement o f extracellular regions of receptors
have been previously reported for other peptide-binding GPCRs. (Xue et al.. 1994: Wang
et al.. 1994a; Kong et al., 1994). The sequence homology and the length of the
extracellular loups in the sst subtypes as well as in the GPR24-encoded receptor show the
greatest variation, and it is possible that if GPR24-encoded receptor binds a somatostatin-
related peptide. the determinants of binding may partially be defined by these regions.
Conclusions fiom binding studies
Binding assays performed on Cos-7 membranes expressing GPR2-I with typical
ligands that define sornatostatin. opioid. and the predicted sigma GPCRs have failed (as
reported in Results 3.3). GPR2-I had also been sent to Sandoz PharmaceuticaI. and Dr.
Te. Reisine of the University of Pemsylvania. Binding studies with somatostatin. or
adenylyi cyclase assays, failed to produce promising results. A gene identical to GPR7-I
(except for one nt) had been cloned by Dr. Derk Bergsma of SrnithKline Beecham
Corporation (unpublished). Expression of this gene also failed to bind somatostatin
(Bergsma, persona1 communication). Thus. the encoded receptor is not a somatostatin or
opioid subtype or a sigma receptor. and there exists an uncharacterized somatostatin-like
neuropeptide for this receptor.
Searching for other peptides
We are currently searching for the endogenous ligand of the GPRUencoded receptor.
A novel neuropeptide, preprocortistatin isolated from rat shares profound structural
organizational similarity with preprosomatostatin. the precursor of SST-14 and SST-28
(de Lecea et al.. 1996). Cortistatin- 14, the mature tetradecapeptide. exhibits significant
primary sequence identity (1 1 of 14 amino acids) to SST-14 (Figure 4.3). We are
currenrly investigating cortistatin- l 4 and its human orthologue as possible ligands of the
GPR2-l-encoded receptor. We are also searching the dbEST for other somatostatin- or
cortistatin-related sequences. Numerous unidentified rnRNA species from rat striatum
(Usui et al., 1994) and hypothalamus (Gautvik et al.. 1996) have been isolated by other
researchers by directional tag PCR subtraction; their characterization may lead to the
SST-14 Rat Cortistatin-14 Human Cortistatin-17
C K N F F W K T F ~ S C C K N F F W K T F S S C
Figure 4.3 .&no acid cornparison of peptides somatostatin (SST-14) and human and rat cortistatin. Amino acids identicai between any two peptides are boxed and shaded.
discovery of unknown neuropeptides and perhaps the native ligand for the receptor
encoded by GPR2-I as well. Altematively. employing the method of identification used
in the discovery of die nociceptin peptide may prove successful. as descnbed below.
Idenrification of the nociceptin receptor - drming porallels
In 1994. several groups reponed the isolation of a receptor with remarkable sequence
h o r n o l o ~ (52-54% overall identity) to the three opioid subtypes. 6. p. and K (Moilereau
et al.: Lachowicz et al.; Wang et al.. Wick et al.. Bunzow et al.. Fukuda et al.).
Expression of receptor rnRNA was abundant in brain. including regions involved in pain
perception (Bunzow et al.. 1994). Surprisingly, no binding could be achieved with any
classical opiate ligands. The orphan receptor became known as ORL- 1 (Opioid Receptor-
Like-1).
The identity of ORL-1 was resolved by the independent discovery of the receptor's
endogenous ligand by two groups using very similar fhctional approaches but in
different species: rat (Meunier et al.. 1995) and pig (Reinscheid et al.. 1995). The method
of Meunier et al. is briefly described here. A crude estract was freshly dissected from rat
brains and divided into 10 fractions by size exclusion chromatography. Each fraction was
assayed for its ability to affect second rnessenger response in CHO ce11 lines stably
expressing ORL-I . Active fractions were fùrther fractionated. and used to assay for
activity as before. until a single active compound was obtained. A heptadecapeptide with
remarkable structural resemblance to the classical opioid peptides was thus isolated.
However. in contrast to the analgesic effects associated with activating opioid receptors,
binding of this neuropeptide to ORL-1 elicited hyperalgesia. Because of its observed pro-
nociceptive properties, the authors named the peptide nociceptin. The exarnple of ORL-
lhociceptin is an exarnple of a receptor bearing significant homology to one particular
GPCR class that does not bind ligands of that class, but binds a reiated ligand. The
approaches described may also prove to be a viable method for identiSing GPRZ4.
Many studies have begun to characterize nociceptin M e r . its binding properties. its
distribution in central and penpheral tissues. and its role in physiological hnction. Its
isolation has identified an entireiy novel peptidergic newonansmitter signalling system in
the brain that, based upon its remarkable relationship to the opioid system. likely evolved
in parallel with the opiate receptors. A s w e y of the number of articles published since
the nociceptin discovery (over 60 repons) reflects the scientific benefit that can be
obtained from identiSing the native ligand for an orphan receptor. The eventual isolation
of the endogenous Ligand of the GPRWencoded receptor holds equal potential. The
abundance of GPR24 mRNA expression in brain with regional localization to discrete
areas involved in functions such as emotion. memory and sensory perception make the
isolation of its endogenous ligand an important priority.
4.4 Insight into the Identity of GPR25
Applying the same kind of analyses used for GPR23 and GPRB to provide insight to
their identities is more difficult for GPR2j because the encoded receptor is related closest
to a receptor which is also an orphan receptor, namely GPRlj . Sequence identity to the
GPRlj-encoded receptor is highest in the TM regions (41%). The closest functionally
characterized receptor is the angiotensin II type 1 receptor (38% TM) and sst5. suggesting
a peptide ligand. GPR25 was not found to express in liver or in 12 brain regions
exarnined using Northem blot analysis, mirronng the absence of GPRl j mRNA in the
sarne tissues. GPR25 rnay be discretely localized to specific brain tissues not examined
or it may be involved in physioiogicai functions in peripheral tissues. Interestingly. it has
been shown recently that the receptor encoded by GPR I J c m be used as an en- cofactor
in primate imunodeficiency vims infection (Deng et al.. 1997; Farzan et al.. 1997).
Also, GPRI.5 expression was demonstrated in various human peripheral organs (spleen.
thymus. small intestine, colon), and also in peripheral blood leukocytes and alveolar
macrophages. Nevertheless, its nanual ligand remains unidentified. The significant
amino acid identity to the receptor encoded by G P R I j suggests that the receptor encoded
by GPR25 may bind a similar endogenous ligand. These two related receptors likely
represent the first of a subfarnily of receptors predicted to bind an endogenous peptide
ligand.
5.0 CONCLUSIONS
In summary, three novel genes encoding for G protein-coupled receptors were
discovered and characterized in the present snidy. GPR24 is paxticularly interesting
because of its abundant expression in many discrete b r i n regions. Although none of the
encoded receptors were functionally identified, their remarkable relationships to other
GPCR subclasses have provided insight that may lead to the isolation of their respective
native ligands. Significantly, the findings herald the exciting potential of identifjing
novel signalling systems in the body.
The study also demonstrates the success of utilizing the public genetic databases to
search for new GPCR-encoding genes. GenBank database searching has emerged as a
powerfûl rneans of gene discovery. In addition to GPR23, GPR24. and GPR-5. we have
employed similar methods to obtain GPRI9 (O'Dowd et al.. 1996). GPRZO. GPRZI.
GPR22 (O'Dowd et al. 1997). and a human galanin GALZ receptor subtype (Nguyen et
al.. in preparation). Some of these genes too rnay represent novel subclasses of the GPCR
superfamily. Also. these genes may not have been isoiated. or isolated as quickly, using
traditional cloning strategies. The isolation and characteriùng of novel GPCR genes will
certainly advance our understanding of G-linked receptor systems and their contribution
to diseased States. Furthemore. there exists the promise of discovering novel ligands and
M e r subtypes which will facilitate the development of highly specific drugs and drug
therapies.
6.0 REFERENCES
Adams, M.D., Kelley, J.M., Gocayne, J.D.. Dubnick. M.. Polymeropoulos. M.H.. Xiao. H., Merril, CR., WU, A., Olde, B., Moreno, R.F.. Kerlavage. A.R.. McCombie. W.R.. Venter, J-C. ( 1 99 1 ) Cornplementary DNA sequencing: expressed sequence tags and human genome project. Science 252: 165 1 - 1656.
Akbar. M.G.K.. Dasari. V.R.. Webb, T., Ayyanaihan. K.. Pillarisetti. K.. Sandhu. A.K.. Athwal. R.S.. Daniel, J.L., Ashby, B.. Barnard. E.A.. Kunapuli. S.P. (1996) Molecular Cloning of a Novel P3 Purinoceptor from Human Erythroleukemia Cells. J. Biol. Chem. 271 : 18363-1 8367.
Altschul, S.F.. Gish, W., Miller, W., Myers, E.W., Lipman, D.J. (1990) Basic local alignrnent search tool. J. Mol. Biol. 2 15: 403-4 10.
Boarder, M.R., Weisman. G.A., Turner, J.T., Wilkinson. G.F. G protein-coupled P:! purinoceptors: fiom molecular biology to functionai responses. Trends Pharmacol. Sci. 16: 133-9.
Boguski. M.S.. Schuler. G.D. (1995) ESTabIishing a Human Transcnpt Map. Nature Genetics 10: 369-3 7 1.
Bonner, T.I.. Modi, W.S.. Sevanet H.N.. O'Bnen. S.J. (1991) Localization of the muscarinic 3 cholinergic receptor to chromosome 1 q3Z. 1. Cytogenet. Ce11 Genet. 58: 1850-1851.
Bunzow, J.R.. Saez. C.. Mortrud. M., Bouvier. C.. Williams. J.T.. Low. M., Grandy. D.K. (1994) Molecular cloning and tissue distribution of a putative member of the opioid receptor gene family that is not a p.& or K opioid receptor type. FEBS Lea. 347: 284- 288.
Burnstock, G. (1 995) Current state of purinoceptor research. Phannaceutica Acta Helvetiae 69: 33 1-242.
Chomczynski. P.. Sacchi, N. (1987) Single-step rnethod of RNA isolation by acid guanidiniurn thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156- 159.
Deng, H., Unutmaz, D., KewalRamani, V.N., Littman. D.R. (1997) Expression cloning of new receptors used by simian and human immunodeficiency vimes. Nature 388: 296-300.
DeNoble. V., Hepler, D.. Barto, R. (1989) Cysteamine-induced depletion of SRlF produces differential cognitive deficits in rats. Brain Res. 482: 42-48.
Dixon. R.A., Kobilka, B.K., Smder, D.J., Benovic, J.L., Dohlman. H.G.. Frielle. T.. Bolanowski. M.A., Bennett, C.D., Rands, E., Diehi, R.E.. Murnford. RA.. Slater. E.E.. Sigal, I.S., Caron, M.G.. Lefkowitz R.J., Strader, C.D. (1 986) Cloning of the gene and cDNA for marnmalian beta-adrenergic receptor and homology with rhodopsin. Nature 321: 75-79.
Eason, M.G.. Jacinto, M.T.. Theiss. C.T., Liggett. S.B. (1994) The palmitoylated cysteine of the cytoplasmic tail of alpha ?A-adrenergic receptors confers subtype-specific agonist-prornoted downregulation. Proc. Natl. Acad. Sci. USA 9 1 : 1 1 1 78-82.
Erb, L.. G m d , R., Wang, Y.. Quinn. T., Turner, J.T.. Weisman. G.A. (1995) Site- directed mutagenesis of P2U purinoceptors. Positively charged arnino acids in transmembrane helices 6 and 7 affect agonist potency and specificity. J. Biol. Chem. 270: 4 185-4 188.
Evans. C.J.. Keith, D.E.. Jr., Momson, H., Magendzo, K.. Edwards. R.H. ( 1 992) Cloning of a delta opioid receptor by functional expression. Science 258: 1952- 1955.
Fargin, A.. Raymond, J.R.. Lohse, M.J.. Kobilka B.K.. Caron. M.G.. Lefkowitz. R.J. (1 988) The clone G-2 1 which resembles a beta-adreneqic receptor sequence encodes the 5-HT 1 A receptor. Nature 358-360.
Farzan. M.. Choe. H.. Martin. K.. Marcon, L., Hohann. W.. Karlsson. G.. Sun. Y.. Barrett, P.. Marchand, N., Sullivan. N.! Gerard. N., Gerard. C., Sodroski. J. (1997) Two orphan seven-transmembrane segment recepton which are expressed in CDCpositive cells suppon sirnian irnmunodeficiency virus infection. J. Exp. Med. 186: 405-4 1 1 .
Ferguson. S.S.G.. Barak. L.S.. Zhang, J., Caron. M.G. (1996) G-protein-coupled receptor regulation: role of G-protein-coupled receptor kinases and arrestins. Cm. J. Physiol. Pharmacol. 74: 1095-1110.
Fields. H.L. ( 1987) Pain. McGraw-Hill, New York.
Fitzpatrick, V.D.. Vandlen. R.L. (1 994) Agonist selectivity determinants in somatostatin receptor subtypes 1 and II. J. Biol. Chem. 269: 5462 1-24626.
Fraser, CM., Wang, C.D.. Robinson. D.A., Gocayne, J.D., Venter. J.C. (1 989) Site- directed mutagenesis of m 1 muscarinic acetylcholine receptors: conserved aspartic acids play important roles in receptor function. Mol. Pharmacol. 36: 840-847.
Fukuda K., Kato, S., Mori, K., Nishi, M., Takeshima, H.. Iwabe, N.. Miyata, T., Houtani, T., Sugimoto, T. (1 994) cDNA cloning and regional distribution of a novel member of the opioid receptor family. FEBS Lett. 343: 42-46.
Fun~ta, H., Guo, D.R., Inagarni, T. (1992) Molecular cloning, sequence analysis and expression of a cDNA encoding hurnan type4 angiotensin II receptor. Biochem. Biophys. Res. Commun. 183: 8-13.
Gantz. I., Schaffer, M.. DelValle. J.. Logsdon, C., Campbell, V.. Uhler. M.. Yamada. T. (199 1) Molecular cloning of a gene encoding the histamine H2 receptor. Proc. Natl. Acad. Sci. USA 88: 429-433.
Gautvik, K.M., de Lecea, L., Gautvik. V.T.. Danielson, P.E.. Tranque. P.. Dopazo. A. Bloom, F.E.. Sutcliffe. J.G. ( 1996) Overview of the most prevalent hypothalarnus- specific mRNAs. as identified by directional tag PCR subtraction. Proc. Natl. Acad. Sci. USA 93: 8733-8738.
Gerard, NP.. Eddy, R.L.. Jr., Shows, T.B., Gerard. C. (1990) The hurnan neurokinin A (substance K) receptor. Molecular cloning of the gene, chromosome localization. and isolation of cDNA from tracheal and gastric tissues. J. Biol. Chem. 265: 20455-62.
Haroutunian. V., Mantin, G., Carnpell. G.. Tsuboyarna G., Davis. K. (1987) Cysteamine-induced depletion of central SEUF-like irnmunoreactivity: effects on behavior. leaniing, mernos, and brain neurochemistry. Brain Res. 403: 234-242.
Heiber, M.. Marchese. A.. Nguyen, T.. Heng, H.H.Q.. George. SR.. O'Dowd. B.F. (1996) A novel human gene encoding a G-protein-coupled receptor (GPRL 5) is located on chromosome 3. Genomics 32: 462-465.
Heiber. M.. Docherty, J.M., Shah. G., Nguyen. T.. Cheng, R.. Heng. H.H.Q.. Marchese. A.. Tsui, L.-C.. Shi, X.. George. S.R.. O'Dowd. B.F. (1995) Isolation of three novle human p n e s encoding G protein-coupled receptors. DNA Ce11 Biol. 14: 25-35.
Heng, H.H.Q., Squire, J., Tsui. L.-C. ( 1992) High-resolution mapping of marnmalian genes by in situ hybridization to fiee chromatin. Proc. Natl. Acad. Sci. U.S.A 89: 9509- 95 13.
Heng. H.H.Q., Tsui, L.-C. (1993) Modes of DAPI banding and simultaneous in situ hybridization. Chromosoma 102: 325-332.
Hershey, A.D., Krause J.E. (1 990) Molecular characterization of a functional cDNA encoding the rat substance P receptor. Science 247: 958-62.
Herzog, H., Darby, K., Hort, Y.J.. Shine, J. (1996) Intron 17 of the Human Retinoblastoma Susceptibility Gene Encodes an Actively Transcnbed G Protein-coupled Receptor. Genome Research 6:858-861.
Hillier. L.. Lennon. G., Becker, M., Bonaldo, M.F., Chiapelli, B., Chissoe, S.. Dietrich, N., DuBuque, T., Favello, A., Gish, W., Hawkins, M., Hultrnan, M.. Kucaba, T.. Lacy,
M., Le, Maithao, Le, N., Mardis, E., Moore, B.. Moms, M.. Parsons. J., Prange. C.. Ri£kin, L., Rohlfiing, T., Schellenberg, K., Soares. M.B.. Tan, F., Thierry-Meg. J.. Trevaskis, E.. Underwood, K., Wohldrnan, P., Waterston. R., Wilson. R.. Marra. M. (1 996) Generation and analysis of 280,000 human expressed sequence tags. Genome Research 6: 807-828.
Houtani, T., Nishi. M., Takeshima, H., Nukada. T.. Sugimoto. T. (1996) Structure and regionai distribution of nociceptidorphanin FQ precursor. Biochem. Biophys. Res. Commun. 219: 714-719.
Ikeda, S.. Schofield. G. (1 989) SRIF blocks a ~ a * curent in rat sympathetic ganglion neurons. J. Physiol. 409: 22 1 -240.
Janssens, R.. Boeynaems. L M . , G o d a M.. Cornmuni, D. (1997) CIoning of a human heptahelical receptor closely related to the P2Y5 receptor. Biochem. Biophys. Res. Commun. 236: 106-1 12.
Jensen. A.A., Pedersen. U.B.. Kiemer, A.. Din, N.. Andersen. P.H. (1 995) Functional importance of the carboxyl tail cysteine residues in the human D, dopamine receptor. Journal of Neurochemistry 65: 1325-3 1.
Jin. H., Zastawny, R., George, S.R.. O'Dowd, B.F. (1997) Elimination of palmitoylation sites in the human dopamine D, receptor does not affect receptor-G protein interaction. Eur. J. Pharmacol. 324: 109- 1 16.
Julius. D.. MacDermott. A.B.. Axel. R.. Jessell, T.M. (1988) Molecular characterization of a functional cDNA encoding the serotonin Ic receptor. Science 241 : 558-564.
Kapas, S.. Catt, K.J.. Clark. A.J. (1995) Cloning and expression of cDNA encoding a rat adrenomedullin receptor. J. Biol. Chem. 270: 25344-25347.
Kaplan, M.H., Smith, D.I.. Sundick. R.S. (1993) Identification of a G protein coupled receptor induced in activated T cells. J. Irnmunol. 1 5 1 : 628-636.
Kaupmann, K., Bruns, C., Raulf, F., Weber, H.P., Mattes, H., Lübbrrt, H. (1995) Two amino acids, located in trammembrane domains VI and VII, determine the selectivity of the peptide agonist SMS 20 1-995 for the SSTW somatostatin receptor. EMBO J. 14: 727-735.
Kobilka, B.K.. Frielle, T., Collins, S.. Yang-Feng, T., Kobilka, T.S., Francke, U., Lefkowitz. R.J., Caron. M.G. (1987) An intronless gene encoding a potential member of the farnily of recepton coupled to guanine nucleotide regulatory proteins. Nature 329: 75-79.
Kolakowski. L.F., Jr., Jung, B.P., Nguyen, T., Johnson, M.P.. Lynch. KR.. Cheng. R.. Heng, H.H.Q., George. S.R., O'Dowd, B.F. (1996) Chamcterization of a human gene related to genes encoding somatostatin receptors. FEBS Len. 3 98: 233 -258.
Kolakowski. L.F., Jr. (1 994) GCRDb: a G-protein-coupled receptor database. Receptors & Channels 2: 1-7.
Kong, H.. Raynor. K., Yasuda, K.. Bell. G.I., Reisine. T. (1993) Mutation of an aspartate at residue 89 in somatostatin rcceptor subtype 2 prevents Na* regulation of agonist binding but does not alter receptor-G protein association. Mol. Pharmacol. 41: 3 80-3 84.
Kong, H.. Raynor. K., Yano. H.. Takeda J.. Bell, G.I.. Reisine. T. (1994) Agonists and antagonists bind to different domains of the cloned kappa opioid receptor. Proc. Natl. Acad. Sci. USA 9 1 : 8042-8046.
Kozak. M. (1987) An analysis of Y-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Research 15: 8 125-8 13 1.
Lachowicr LE.. Shen. Y.. Monsma. F.J.. Jr.. Sibley. D.R. (1 995) Molecular cloning of a novel G protein-coupled receptor related to the opiate receptor fmily. I. Neurochem. 64: 34-40,
Larnberts, S.. Krenning. E.. and Reubi. J.-C. (1 99 1) The role of SRIF and its analogs in the diagnosis and treatment of tumors. Endocrine Rev. 12: 450-482.
Lennon. G.. Auffray. C.. Polymeropoulos. M.. Soares. M.B. (1996) The I.M.A.G.E. consortium: an integrated molecular analysis of genomes and their expression. Genomics 33: 151-152.
Li. Q., Schachter. J.B., Harden, K.. Nicholas, R.A. (1997) The 6H1 orphan receptor. claimed to be the p2y5 receptor. does not mediate nucleotide-prornoted second messenger responses. Biochem. Biophys. Res. Commun. 236:455-460.
Liapakis, G., Fitzpatrick. D., Hoeger, C.. Rivier. J., Vandlen. R., Reisine. T. (1996) Identification of ligand binding determinants in the somatostatin rcceptor subtypes 1 and 2. J. Biol. Chem. 27 1 : 2033 1-20339.
Libert. F., Parmentier, M.. Lefort. A., Dinsart, C.. Van Sande. J., Maenhaut. C.. Simons. M.J., Dumont. J.E., Vassart. G. (1989) Selective amplification and cloning of four new members of the G protein-coupled receptor farnily. Science 244: 569-572.
Libert. F., Schifiann, SN., Lefort. A., Parmentier, M., Gerard, C., Dumont, J.E., Vanderhaeghen, J.I., Vassart, G. (1 991 a) The orphan receptor cDNA RDC7 encodes an A 1 adenosine receptor. EMBO J. 10: 1677- 1682.
Liben. F.. Vassart, G., Parmentier, M. ( 1 99 1 b) Current developments in G-protein- coupled receptors. Curr. Opin. Ce11 Biol. 3: 218-223.
Maenhaut. C., Van Sande, J-, Massart, C., Dinsart, C.. Libert. F.. Moderini. E., Giraldo. E.. Ladinsky. H., Vassart, G., Dumont, J.E. (1991) The orphan receptor cDNA W C 4 encodes a 5-HTI D serotonin receptor. Biochem. Biophys. Res. Commun. 180: 1460- 1468.
Maenhaut. C.. Van Sande, J.. Libert. F., Abramowicz. M.. Parmentier. M.. Vanderhaegen. J., Dumont. J.E., Vassart. G., Schiffinann, S. (1990) RDC8 codes for an adenosine A2 receptor with physiological constitutive activity. Biochem. Biophys. Res. Commun. 173 : I 169-78.
Marchese, A.. George, S.R., O'Dowd, B.F. (1997) Cloning of G protein-coupled receptor genes: the use of homology screening and the polymerase chain reaction. In Lynch. K.R. (ed): "Identification and Expression of G Protein-coupled Receptors." New York, Wiley-Liss, Inc. (in press).
Marchese. A.. Docherty, J.M.. Nguyen, T.. Heiber. M.. Cheng, R.. Heng. H.H.Q.. Tsui. L X . . Shi. X.. George, S.R.. O'Dowd, B.F. ( 1 994) Cloning of human genes encoding novel G protein-coupled receptors. Grnomics 23: 609-6 18.
Marchese. A.. Heiber. M.. Nguyen. T., Heng. H.H.Q.. Saldivia V.R.. Cheng. R.. Murphy. P.M.. Tsui, L X . , Shi. X.. Gregor, P.. George. S.R.. O'Dowd. B.F, Dochertv, J.M. (1 995) Cloning and chromosomal mapping of three novel genes. GPR9. GPRI O. and GPR14. encoding receptors related to interieukin 8. neuropeptide Y. and somatostatin receptors. Genomics 29: 3 3 5-344.
Masu. Y.. Nakayama, K., Tamaki. H.. Harada, Y.. Kuno, M.. Nakanishi. S. (1987) cDNA cloning of bovine substance-K receptor through oocyte expression system. Nature 339: 836-838.
Matsuda. L.A.. Lolait, S.J.. Brownstein. M.J.. Young. A.C., Bonner T.I. (1990) Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature 346: 56 1-564.
Meriney, S., Gray, D., Pilar. G. (1 994) SRIF-induced inhibition of neuronal ~ a " current modulated by cGMP-dependent protein kinase. Nature 3 69: 336-3 39.
Meunier. J.-C., Mollereau, C., Toll, L., Suaudeau, C.. Moisand. C., Alvinerle, P.. Butour. J.-L.. Guillemot, J.-C.. Ferrara, P.. Monsarrat, B., Mazargull, H.. Vassart. G.. Parmentier, M., Costentin, J. (1995) Isolation and structure of the endogenous agonist of opioid receptor-like ORL , receptor. Nature 377: 532-535.
Mills, A., Duggan, M.J. (1994) Orphan seven transmembrane domain receptors: reversing pharmacology TIBTECH 12: 47-49.
Moffet. S., Mouilac, B., Bonin, H., Bouvier. M. (1993) Altered phosphorylation and desensitization patterns of a human PZ-adrenergic receptor lacking the palmitoylated Cys341. EMBO J 12: 349-356.
Mollereau, C.. Parmentier, M.. Mailleu. P.. Butour, J.-L.. Moisand. C.. Chalon. P.. Caput. D., Vassart, G.. Meunier, J.-C. (1994) ORLI. a novel member of the opioid receptor family. FEBS Lett. M l : 33-38.
Mollereau, C.. Simons. M A , Soularue, P.. Liners. F.. Vassart. G.. Meunier. J.-C.. Parmentier. M. (1 996) Structure, tissue distribution, and chromosomal localization of the prepronociceptin gene. Proc. Natl. Acad. Sci. USA 93: 8666-8670.
Murphy, P.M. ( 1 996) C hemokine receptors: cloning strategies. Methods: a cornpanion to Methods in Enzymology. 10: 104- 1 18.
Murphv, T.J.. Alexander. R. W.. Gnendling, K.K., Runge. M.S.. Bernstein. K.E. ( 199 1 ) Isolation of a cDNA encoding the vascular type- 1 angiotensin II receptor. Nature 35 1 : 233-236.
Nathans, J.. Hogness. D.S. ( 1983) Isolation. sequence analysis. and intron-exon arrangement of the gene encoding bovine rhodopsin. Cell 34: 807-8 14.
Nguyen, T.. Erb, L.. Weisman. G.A.. Marchese. A., Heng, H.H.Q.. Garrad. R.C.. George. S .R., Turner, J.T.. O' Dowd. B.F. ( 1 995) Cloning. expression. and chromosomal localization of the human uridine nucleotide receptor gene. J. Biol. Chem. 270: 30845- 30848.
Nothacker. H.-P.. Reinscheid. R.K., Mansour, A.. Henningsen. R.A.. Ardati, A.. Monsrna, F.J.. Jr.. Watson, S.J.. Civelli. 0. (1996) Pnmary structure and tissue distribution of the orphanin FQ precursor. Proc. Natl. Acad. Sci. USA 93: 8677-8682.
Nussenzveig. D.R., Heinflink, M.. Gershengom. M.C. ( 1993) Agonist-stirnulated intemalization of the thyrotropin-releasing hormone receptor is dependent on two domains in the receptor carboxyl terminus. J. Biol. Chem. 268: 2389-2392.
O'Dowd, B.F., Hnatowich, M., Caron, M.G., Lefkowitz, R.J., Bouvier, M. (1989) Palmitoylation of the human p2-adrenergic receptor. Mutation of Cys341 in the carboxyl tail leads to an uncoupled non-palmitoylated form of the receptor. J. Biol. Chem. 264: 7564-7569.
O'Dowd, B.F.. Nguyen, T.. Tirpak, A.. Jarvie, KR.. Israel, Y.. Seeman. P.. Nimik. H. (1990) Cloning of two additional catecholamine receptors f?om rat brain. FEBS Len. 262: 8-12.
O'Dowd, B.F., Heiber. M.. Chan, A.. Heng, H.H.Q., Tsui. L.-C.. Kennedy. J.L.. Shi. X.. Petronis, A., George. SR., Nguyen, T. (1993) A human gene that shows identity with the gene encoding the angiotensin receptor is located on chromosome 1 1. Gene 136: 355-360.
O'Dowd. B.F.. Scheideler. MA.. Nguyen, T.. Cheng, R.. Rasmussen. J.S.. Marchese. A.. Zastawny, R.. Heng, H.H.Q., Tsui, L.-C., Shi, X., Asa, S., Puy, L., George, S.R. ( 1993) The cloning and chromosomal mapping of two novel human opioid-somatostatin-Iike receptor genes. GPR7 and GPR8. expressed in discrete areas of the brain. Genomics 28: 84-9 1.
O'Dowd. B.F.. Nguyen, T.. Lynch. K.R., Kolakowski, L.F., Jr.. Thompson. M.. Cheng. R.. Marchese. A.. Ng, G.. Heng, H.H.Q., George. S.R. (1 996) A novel gene codes for a putative G protein-coupled receptor with abundant expression in brain. FEBS Lett. 394: 325-329.
O'Dowd, B.F., Nguyen, T., Jung, B.P.. Marchese, A.. Cheng. R.. Heng. H.H.Q.. Kolakowski. L.F.. Jr.. Lynch. K.R., George, S.R. (1997) Cloning and chromosomal mapping of four putative novel human G-protein-coupled receptor genes. Gene 187: 75- 81.
Owji, A.A.. Smith. D.M., Coppock. H.A., Morgan. D.G.. Bhogal. R.. Ghatei. MA.. Bloom, S.R. (1995) An abundant and specific binding site for the novel vasodilator adrenomedullin in the rat. Endocrinology. 136: 2 127-2 131.
Panetta, R.. Greenwood, MT.. Warszynska. A., Demchyshyn. L.L.. Day, R.. Niznik. H.B., Srikant. C.B., Patel, Y .C. (1 994) Molecular cloning, functional characterization and chromosomal localization of a human SRIF receptor (SRIF receptor type 5) with preferentid affinity for SRIF 28. Molec. Pharmac. 45: 41 7-427.
Patel. Y.C.. Greenwood. M.T.. Panetta. R., Demchyshyn. L., Nimik. H.. Snkant. C.B. (1 995) The somatostatin receptor family. Life Sciences 57: 1249- 1265.
Paxinos, G., Watson. C. (1 982) The Rat Brain, Academic Press. New York.
Pearson, W.R. (1 995) Cornparison of methods for searching protein sequence databases. Protein Sci. 4: 1 145- 1 160.
Pearson, W.R., Lipman, D.J. (1 988) Improved tools for biologicai sequence cornparison. Proc. Natl. Acad. Sci. USA 85: 2444-2448.
Perdta, E.G.. Winslow. LW.. Petenon, G.L.. Smith. DM.. Ashkenazi. A.. Ramachandran, J., Schimerlik, M.I., Capon, D.J. (1 987a): Primary structure and biochemical properties of an MZ muscarinic receptor. Science 236: 600-605.
Peralta, E.G.. Ashkenazi. Winslow. J.W.. Smith. D.H.. Rarnachmdran J.. Capon. D.J. ( 1 98 7b) Distinct primary structures. ligand-binding properties and tissue-speci fic expression of four human muscarinic acetylcholine receptors. EMBO 6: 3923-3929.
Premont. R.T.. Koch. W.J.. Inglese. J.. And Lefkowitz, R.J. (1995) Protein kinases that phospho~late a-tisaied G protein-coupled receptors. FASEB. J. 9: 175-1 81.
Priestley, T. (1992) The effect of baclofen and somatostatin on neuronal activity in the rat ventromedial hypothalamic nucleus in vitro. Neuropharmacology 3 1 : 103-1 09.
Raport. C.J.. Schweickart. V.L., Eddy, R.J.. Jr., Shows, T.B.. Gray, P.W. (1995) The orphan G protein-coupled receptor-encoding gene V28 is closely related to genes for chemokine receptors and is expressed in Iymphoid and neural tissues. Gene 163: 195- 299.
Raynor, K.. Lucki, 1.. Reisine. T. (1993) SRIF, receptors in nucleus accurnbens selectively mediate the stimulatory effect of SRIF on locomotor activity in rats. J. Pharmac. Exp. Ther. 265: 67-73.
Reinscheid. R.K.. Nothacker, H.P., Bourson. A.. Ardati. A., Hemingsen. RA.. Bunzow. J.R.. Grandy. D.K.. Langen. H., Monsma. F.J.. Civelli. 0. (1 995) Orphanin FQ: a novel neuropeptide which is a nanird ligand of an opioid-like G protein-coupled receptor. Science 270:792-794.
Savarese. T.M.. Fraser. C.M. (1992) In vitro mutagenesis and the search for structure- hinction relationships among G protein-coupled receptors. Biochem. J. 283: 1-1 9.
Schachter. J.B.. Harden, T.K. (1997) An examination of deoxyadenosine jq(alpha thio)triphosphate as a ligand to define P2Y receptors and its selectivity as a low potency partial agonist of the P î Y (1) receptor. Br. J. Pharmacol. 12 1 : 338-344.
Schusdziarra. V. (1 992) in: Basic and Clinical Aspects of Neuroscience (Weil. C.. Muller. E.E.. and Thorner, M.O. eds), Somatostatin. Vol 4 pp. 43-54. Springer, Heidelberg.
Shapno M.. Hille, B. (1993) Substance P and somatostatin inhibit calcium channels in rat sympathetic neurons via different G protein pathways. Neuron 10: 1 1-20.
Sibley. D.R.. Monsma. F.J., Jr. (1992) Molecular biology of dopamine receptors. Trends Pharmacol. Sci. f 3: 6 1-69.
Snyder. S.H. (1 986) Dmgs and the Brain. Freeman New York.
Spiegel, A.M. (1997) Inbom errors of signal transduction: Mutations in G proteins and G protein-coupled receptors as a cause of disease. I. M e r . Metab. Dis. 20: 1 1 3- 1 1 1.
Strader. CD., Fong, T.M.. Tota M.R.. Underwood. D.. Dixon. R.A.F. (1994) Structure and function of G-protein-coupled receptors. Annu. Rev. Biochem. 63 : 10 1 - 137.
Strader. CD., Sigal. I.S.. Register. RB.. Candelore. M.R.. Rands. E.. Dixon. R.A.F. (1987) Identification of residues required for ligand binding to the beta-adrenergic receptor. Proc. Natl. Acad. Sci. USA 84: 43844388.
Sunahara R.K., Nimik. H.B.. Winer, D.M.. Stormann. T.M.. Brann. M.R.. Kennedy. J.L.. Gelernter. J.E., Romahel. R.. Yang, Y.. Israel. Y.. Seeman. P.. O'Dowd. B.F. (1990) Human dopamine Dl recepor encoded by an intronless gene on chromosome 5. Nature 347: 80-83.
Sunahara. R.K.. Guan. H.-C.. O'Dowd, B.F.. Seeman. P.. Laurier. L.G.. Ng. G.. George. S.R.. Torcha. Joeseph. Van Toi. H.H.M.. Nimik. H.B. (1991) Cloning of the gene for a human dopamine Dj receptor with higher affinity for dopamine than D,. Nature 350: 613-619.
Surratt. C.K.. Johnson. P.S.. Mori~vaki. A.. Sidleck. B.K.. Blaschak. C.J.. Wang. J.B.. Uhl. G.R. (1994) Mu opiate receptor. Charged transmembrane domain arnino acids are cntical for agonist recognition and intrinsic activity. J.Biol. Chem. 269: 20548-20553.
Toguchida. J.. McGee. T.L.. Paterson. J.C.. Eagle. J.R.. Tucker. S.. Yandell. D.W.. Dryja. T.P. (1993) Complete genomic sequence of the human retinobiastoma susceptibilitg gene. Genornics 1 7: 535-543.
Townsend-Nicholson, A.. Baker. E.. Schofield. P.R.. Sutherland. G. R. ( 1 995) Localization of the adenosine A l receptor subtype gene (ADORAI) to chromosome 1 q32.l. Genomics 26: 423425.
Usui, H., Jefiey, D.F.. Dopazo. A.. de Lecea. L., Erlander. M.G.. Sutcliffe. J.G. (1 994) Isolation of clones of rat stria--specific mRNAs by directional tag PCR subtraction. Journal of Neuroscience. 14: 49 15-4926.
Wang, H.. Reisine, T., Dichter, M. (1990) SRIF-14 and SRIF-28 inhibit calcium currents in rat neocortical neurons. Neuroscience 38: 335-342.
Wang, J.B.. Johnson, P.. Wu. J.M., Wang, F.W., Uhl. G. (1994a) Human kappa opiate receptor second extracellular loop elevates dynorphin's afinity for human mukappa chimeras. J. Biol. Chem. 269: 25966-25969.
Wang, J.B., Johnson, P.S., Imai. Y., Persico, A.M., Ozenberger, B.A., Eppler. C.M.. Uhl. G.R. (1994b) cDNA cloning of an orphan opiate receptor gene family rnember and its splice variant. FEBS Lett. 348: 75-79.
Webb, T.E.. Kaplan, M.G., Barnard. E.A. (1996) Identification of 6H1 as a purinoceptor: P X , . Biochem. Biophys. Res. Commun. 7 19: 105- 1 10.
Wick, M.J.. Mimerath. S.R.. Lin. X.. Elde. R., Law. P.-Y.. Loh. H.H. (1 991) Isolation of a novel cDNA encoding a putative membrane receptor with high homology ro the cloned p.6. and IC opioid receptors. Molec. Brain Res. 27: 37-44.
Xue, J.. Chen, C., Zhu. J.. Kunapuli, S., DeRiel, K., Yu. L., Liu-Chem. L. (1994) Differential binding domains of peptide and non-peptide ligands in the cloned rat kappa opioid receptor. J. Biol. Chem. 269: 30 195-30 199.
Yamada Y., Stoffel. M., Espinosa III. R., Kun-san, X.. Seino. M.. Seino, S.. Le Beau. M.M., Bell. G.I. (1 993) Human somatostatin receptor genes: localization to human chromosomes 14, 17. and 22 and identification of simple tandem repeat polymorphisms. Genomics 1 5: 449-452.
Yang-Feng. T.L.. Xue. F.Y.. Zhong. W.W.. Cotecchia, S., Frielle, T.. Caron. M.G.. Lefkowitz, R.J.. Francke, U. (1990) Chromosomal organization of adrenergic receptor genes. Proc. Natl. Acad. Sci. USA 87: 15 16-1 520.
Yarden. Y.. Rodriguez. H.. Wong. S.K.. Brandt. D.R., May. D.C.. Burnier. J.. Harkins. R N . Chen. E.Y., Ramachandran. J.. Ullrich. A.. Ross. E.M. (1986) The avian beta- adrenergic receptor: primary structure and membrane topology. Proc. Natl. Acad. Sci. USA 83: 6795-6799.
Yokomizo. T., Izurni. T.. Chang, K.. Takuwa. Y.. Shimizu, T. (1997) A G-protein- coupled receptor for leukotriene B, that mediates chemotêuis. Nature 387: 620-624.
Zastawny, R.L.. George, S.R.. Nguyen. T., Cheng, R.. Tsatsos. J.. Briones-Urbina. R.. O'Dowd. B.F. (1994) Cloning. charactenzation. and distribution of a p-opioid receptor in rat brain. J. Neurochem. 62: 2099-2 105.
Zastawny, R.L., George, S.R., Bouvier, M.. O' Dowd. B.F. ( 1 997) Adrenergic and related G protein-coupled receptors. In: "Encyclopedia of Human Biology." Second ed. Vollane X: A28- 1 4 2 8 - 1 1. New York. Academic Press. Inc.
IMAGE EVALUATION TEST TARGET (QA-3)
APPLIEO INIAGE . lnc 1653 East Main Street -
I . , , Rochester. NY 14609 USA -- -- - - Phone: 71 W482-O3OO -- -- - - Fax: 71 61288-5989
O 1993. Agpiiad Image. inc.. All Flights Reserved