Am

ZSa

Nb

a

ARRA

KXSYM

1

patiaAcc

vachaoS

0d

Enzyme and Microbial Technology 46 (2010) 506–512

Contents lists available at ScienceDirect

Enzyme and Microbial Technology

journa l homepage: www.e lsev ier .com/ locate /emt

xylanase with broad pH and temperature adaptability from Streptomycesegasporus DSM 41476, and its potential application in brewing industry

henhua Qiua,b,1, Pengjun Shia,1, Huiying Luoa, Yingguo Baia, Tiezheng Yuana, Peilong Yanga,uchun Liub, Bin Yaoa,∗

Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences,o. 12 Zhongguancun South Street, Beijing 100081, PR ChinaDepartment of Nutrition and Food Hygiene, Hunan Agricultural University, Changsha, Hunan 410128, PR China

r t i c l e i n f o

rticle history:eceived 19 November 2009eceived in revised form 28 January 2010ccepted 9 February 2010

eywords:

a b s t r a c t

A xylanase gene, xynAM6, was isolated from the genomic DNA library of Streptomyces megasporus DSM41476 using colony PCR screening method. The 1440-bp full-length gene encodes a 479-amino acid pep-tide consisting of a putative signal peptide of 36 residues, a family 10 glycoside hydrolase domain anda family 2 carbohydrate-binding module. The mature peptide of xynAM6 was successfully expressed inPichia pastoris GS115. The optimal pH and temperature were pH 5.5 and 70 ◦C, respectively. The enzyme

◦

ylanasetreptomyces megasporuseast expressionashing

showed broad temperature adaptability (>60% of the maximum activity at 50–80 C), had good ther-mostability at 60 ◦C and 70 ◦C, remained stable at pH 4.0–11.0, and was resistant to most proteases. TheKm and Vmax values for oat spelt xylan were 1.68 mg ml−1 and 436.76 �mol min−1 mg−1, respectively, and2.33 mg ml−1 and 406.93 �mol min−1 mg−1 for birchwood xylan, respectively. The hydrolysis productsof XYNAM6 were mainly xylose and xylobiose. Addition of XYNAM6 (80 U) to the brewery mash sig-nificantly reduced the filtration rate and viscosity by 36.33% and 35.51%, respectively. These favorable

e XYN

properties probably mak

. Introduction

Xylan is one of the major components of hemicelluloses inlant cell walls, and is the second most abundant polysaccharidefter cellulose [1]. In nature, complete hydrolysis of xylan requireshe synergistic action of different xylanolytic enzymes, includ-ng endoxylanase, �-xylosidase, and accessory enzymes, suchs �-arabinofuranosidase, acetyl esterase, and �-glucuronidase.mong them, endo-�-1,4-xylanase (EC 3.2.1.8) is very important toatalyze the hydrolysis of long-chain xylan into short xylooligosac-harides [2,3].

In recent years, many kinds of xylanases have been isolated fromarious microorganisms including bacteria, actinomyces, fungind yeasts [4]. Up to now, several xylanase genes have beenloned, and over-expression of xylanases in recombinant systems

as been attempted [5]. Among them, Streptomyces belonging toctinomycetes produce multiple xylanases with different physic-chemical properties, including an extracellular xylanase fromtreptomyces lividans 1326 [6], xys1 from Streptomyces halste-

∗ Corresponding author. Tel.: +86 10 82106053; fax: +86 10 82106054.E-mail address: yaobin@caas-bio.net.cn (B. Yao).

1 These authors contributed equally to this work.

141-0229/$ – see front matter © 2010 Elsevier Inc. All rights reserved.oi:10.1016/j.enzmictec.2010.02.003

AM6 a good candidate for application in brewing industry.© 2010 Elsevier Inc. All rights reserved.

dii JM8 [7], STX-I from Streptomyces thermoviolaceus OPC-520[8], Xyl30 from Streptomyces avermitilis CECT 3339 [9], XynAS9from Streptomyces sp. S9 [10], and XynAS27 from Streptomycessp. S27 [11].

Microbial xylanases have been applied in many industries,including animal feed, baking, paper and pulp, waste treatmentand brewing [1,12–14]. To meet the specific industry’s needs, anideal xylanase should equip with specific properties, such as goodpH and thermal stability, high specific activity, and strong resis-tance to metal cations and chemicals, are also pivotal factors tothe applications. This study describes the cloning, characteriza-tion, and over-expression of a new xylanase gene from Streptomycesmegasporus DSM 41476 in Pichia pastoris. This enzyme belongs tofamily 10 of glycoside hydrolases and shows excellent adaptabilityto acidic to alkaline pHs and mesophilic to moderately halophilictemperatures and superior pH and thermal stability.

2. Materials and methods

2.1. Stains, vectors, media and chemicals

S. megasporus DSM 41476 was purchased from the German Resource Centre forBiological Material (DSMZ). Escherichia coli Top10 (TransGen, Beijing, China) culti-vated at 37 ◦C in Luria-Bertani medium was used as the host for gene cloning andsequencing. P. pastoris GS115 (Invitrogen, Carlsbad, CA, USA) cultivated at 30 ◦Cin yeast extract peptone dextrose medium was used as the host for gene expres-

obial T

sfp

picp

pl(

2

f4Gw3vt

mpPa

2

sFpH(w[

2

scwuaiu23

TP

Z. Qiu et al. / Enzyme and Micr

ion. Plasmids pEASY-T3 (TransGen) and pPIC9 (Invitrogen) were used as vectorsor cloning and expression, respectively. Oat spelt xylan and birchwood xylan wereurchased from Sigma (St. Louis, MO, USA).

Media for selection of positive transformants and growth and induction of P.astoris competent cells including regeneration dextrose base medium (RDB), min-mal dextrose medium (MD) or minimal methanol medium (MM), buffered glycerolomplex medium (BMGY) and buffered methanol complex medium (BMMY) wererepared according to the manual of the Pichia Expression kit (Invitrogen).

The kits for genomic DNA extraction and purification, and plasmid isolation wereurchased from TIANGEN (Beijing, China). The restriction endonucleases, T4 DNA

igase, LA Taq DNA polymerase, dNTP and GC buffer I were purchased from TaKaRaTsu, Japan). Other chemicals were of analytical grade and commercially available.

.2. Cloning of the xylanase-encoding gene xynAM6

Genomic DNA of S. megasporus DSM 41476 was isolated and used as templateor PCR amplification. The core region of the xylanase gene from S. megasporus DSM1476 was amplified by the degenerate primers (GH 10F and GH 10R) specific forH 10 xylanases from Streptomyces as described by Li et al. [10]. The PCR conditionsere as follows: 5 min at 94 ◦C, followed by 30 cycles of 95 ◦C for 30 s, 45 ◦C for

0 s, and 72 ◦C for 30 s. The resulting PCR products were purified and ligated intoector pEASY-T3, transformed into E. coli Top10 cells for sequencing, and subjectedo BLAST analysis.

To obtain the 5′ and 3′ flanking regions of the core region, a modified Ther-al Asymmetric Interlaced (TAIL)-PCR with the GCAD and nested insertion-specific

rimers [15,16] was performed with an annealing temperature (Tm) of 60 ◦C. AllCR products with appropriate size were purified in 1% agarose gels, sequenced andssembled to obtain the full-length xylanase gene, denoted as xynAM6.

.3. Sequence analysis

The sequence assembly was performed using the Vector NTI Suite 7.0oftware, and the nucleotide sequence was analyzed using the NCBI ORFinder tool (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The signal peptide wasredicted using SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/).omology searches in GenBank were performed using the BLAST server

http://www.ncbi.nlm.nih.gov/BLAST). Multiple alignments of protein sequencesere performed using the CLUSTAL W program (http://www.ebi.ac.uk/clustalW/)

17].

.4. Expression of xynAM6 in P. pastoris

The gene fragment for mature protein without the signal peptide codingequence was amplified using expression primers M6picF and M6picR (Table 1) andloned into the EcoRI–NotI site of pPIC9. The recombinant plasmid, pPIC9–xynAM6as linearized using BglII and transformed into P. pastoris GS115 competent cells

sing a Gene Pulser XcellTM Electroporation System (Bio-Rad, Hercules, CA, USA)t 2.5 kV and 4.8 ms. One milliliter of ice-cold 1 mM sorbitol solution was thenmmediately added, and the transformed cells were grown on RDB plates at 30 ◦Cntil colonies appeared, then transferred to MM and MD plates and grown fordays at 30 ◦C to ensure purity. The positive transformants were cultivated in

ml of BMGY and grown at 30 ◦C for 48 h with constant agitation (220 rpm). The

able 1rimers used in this study.

Primers Primers sequence (5′ → 3′)

GH 10F TGGGACGTSGTSAACGAGGH 10R GCATGTCSAGYTCSGTGAM6picF GGGGAATTCGCCGCCCCCTGCGGGAGM6picR GGGGCGGCCGCTCAGCCCGCGGCGCACCTCTGGCCAD1 NTCGASTWTSGWGTTAD2 NGTCGASWGANAWGAAAD3 WGTGNAGWANCANAGAAD4 TGWGNAGWANCASAGAAD5 AGWGNAGWANCAWAGGAD6 CAWCGICNGAIASGAAAD7 TCSTICGNACITWGGAAD8 STTGNTASTNCTNTGCAD9 WCAGNTGWTNGTNCTGAD10 TCTTICGNACITNGGAAD11 TTGIAGNACIANAGGM6FSP1 CGCCGCCGGCCCAGTTGTACM6FSP2 CTCGACCGCCTCCCACTTCATGGM6FSP3 GTTGACCGCCGTGCCGATGAAGCM6RSP1 GGCAACGTGAACGGCTCCGCGATCCAGCAGAACCTCCM6RSP2 CGCCCTCCGACAGCTCCAAGCTCCAGCAGCAGGM6RSP3 CACCTTCCCCGGCGAGGGCGACGCCTGTCCC

echnology 46 (2010) 506–512 507

cells were pelleted by centrifugation and resuspended in 1 ml BMMY (pH 6.0) con-taining 0.5% methanol for induction at 30 ◦C for 48 h. The cell-free supernatantswere collected for xylanase activity assay. Transformants with the highest xylanaseactivity was selected for the high-yield fermentation in 1 l shake flasks contain-ing 300 ml BMGY medium under the same conditions as described above. Xylanaseactivity in the supernatant was assessed at 12 h intervals during the inductionphase.

2.5. Purification and identification of XYNAM6

To purify the recombinant XYNAM6, the culture supernatant was concentratedby progressive addition of solid ammonium sulfate to 80% of saturation. The precipi-tate was harvested by centrifugation and resuspended in 20 mM Tris–HCl buffer (pH8.0) and dialyzed against the same buffer with three changes. Undissolved materialwas removed. The crude supernatant was loaded onto a HiTrap Q Sepharose XL 5 mlFPLC column (GE Healthcare, Uppsala, Sweden) equilibrated with the same buffer.Proteins were eluted using a linear gradient of NaCl (0–1.0 M) in the same buffer.Fractions having enzyme activity were pooled and concentrated by ultrafiltrationat 4000 × g for 20 min at 4 ◦C using an Amicon Ultra Centrifugal Filter Device PL-10(Millipore, Billerica, MA, USA).

The purified recombinant XYNAM6 was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with a 12% running gel [18]. The lowmolecular weight calibration kit for SDS electrophoresis (GE Healthcare, Piscataway,NJ, USA) was used as a standard. The protein concentration was determined byBradford assay using bovine serum albumin as the standard [19].

2.6. Xylanase activity assay

The xylanase activity was determined by measuring the release of reducingsugar from soluble xylan using 3,5-dinitrosalicylic acid (DNS) method as describedby Miller [20]. The standard assay mixture contained 0.1 ml of appropriately dilutedenzyme and 0.9 ml of McIlvaine buffer (pH 5.5) containing 1% (w/v) oat spelt xylan.After incubation at 70 ◦C for 10 min, the reaction was terminated by adding 1.5 mlof DNS reagent. The mixture was then boiled for 5 min and cooled to room tempera-ture, and the absorption at 540 nm measured. Each reaction and its control were runin triplicate. One unit (U) of xylanase activity was defined as the amount of enzymethat released 1 �mol of reducing sugar equivalent to xylose per minute under theassay conditions.

2.7. Characterization of purified recombinant XYNAM6

The pH optimum for enzymatic activity of purified recombinant XYNAM6 wasdetermined in buffers with pH ranging from 2.0 to 12.0 by assessing activity at 60 ◦Cfor 10 min. The buffers used were 0.1 M McIlvaine buffer (0.2 M Na2HPO4/0.1 M citricacid) for pH 2.0–8.0, 0.1 M Tris–HCl for pH 8.0–9.0, and 0.1 M glycine–NaOH forpH 9.0–12.0. The pH stability of XYNAM6 was determined by measuring residual

enzymatic activity under standard conditions (pH 5.5, 60 ◦C and 10 min) after pre-incubating the enzyme at 37 ◦C in the buffers mentioned above for 1 h.

The optimal temperature for XYNAM6 activity was determined in the tempera-ture range of 20–90 ◦C by measuring enzyme activity in 0.1 M McIlvaine buffer (pH5.5) for 10 min. Thermal stability of purified recombinant XYNAM6 was determinedby assessing the residual enzyme activity under standard conditions (pH 5.5, 70 ◦C

Tm (◦C) GC%

52.0–64.6 33.3–61.140.7–63.4 55.6–61.168.8 76.775.8 85.742.9–40.3 40.0–46.741.1–43.3 31.3–50.030.8–48.1 31.3–50.030.8–49.1 37.5–50.033.6–50.8 37.5–50.042.3–57.0 37.5–62.546.2–49.8 43.8–62.544.1–48.2 37.5–56.342.3–51.3 37.5–50.046.2–53.9 37.5–62.527.6–46.5 26.7–60.056.9 75.057.3 65.257.3 65.268.2 64.968.0 69.769.9 77.4

5 obial T

al

abCmw

w30uala

2

iobDe

mopas

2

(hCpfa

2

MaXfvE2

(c[

�

w

tv

�

�

wr

3

3a

m

08 Z. Qiu et al. / Enzyme and Micr

nd 10 min) after incubation of the enzyme at either 60, 70 or 80 ◦C for differentengths of time.

To investigate the effects of different metal ions and chemical reagents on thectivity of purified recombinant XYNAM6, the enzyme was incubated in McIlvaineuffer (0.1 M, pH 5.5) containing 1 or 10 mM NaCl, KCl, CaCl2, LiCl, CoCl2, CrCl3, NiSO4,uSO4, MgSO4, FeCl3, MnSO4, ZnSO4, Pb(CH3COO)2, AgNO3, HgCl2, EDTA, SDS, and �-ercaptoethanol at 70 ◦C. Incubation of XYNAM6 in the absence of added reagentsas the control experiment.

To determine resistance to different proteases, purified XYNAM6 was incubatedith trypsin (pH 7.6, 25 ◦C), �-chymotrypsin (pH 7.8, 25 ◦C), collagenase (pH 7.4,

7 ◦C), subtilisin A (pH 7.4, 37 ◦C), and proteinase K (pH 7.5, 37 ◦C) at a ratio of.1:1 (protease:XYNAM6, w/w), respectively. After 1 or 2 h treatment, the resid-al activity was measured under standard assay conditions. Protease resistance wasssessed by measuring the residual enzyme activity under standard conditions fol-owing protease treatment. The recombinant enzyme without protease was used ascontrol.

.8. Substrate specificity and kinetic parameters

The substrate specificity of XYNAM6 for various substrate was determined afterncubation at 70 ◦C for 10 min in McIlvaine buffer (0.1 M, pH 5.5) containing onef the following substrates (1%, w/v): oat spelt xylan, birchwood xylan, lichenan,arley glucan, laminarin and CMC-Na. Reactions were terminated by adding 1.5 mlNS. For a fixed amount of XYNAM6 the amount of released reducing sugar wasstimated as described above.

The Km, Vmax, and kcat values for purified recombinant XYNAM6 were deter-ined in McIlvaine buffer (0.1 M, pH 5.5) containing 1–10 mg ml−1 oat spelt xylan

r birchwood xylan, after incubation with XYNAM6 at 70 ◦C for 5 min. The data werelotted according to the Lineweaver–Burk method. Each data point represents anverage of three independent experiments, and each experiment included threeamples.

.9. Analysis of hydrolysis product

Reactions containing purified recombinant XYNAM6 (6 U) and oat spelt xylan100 �g) in 140 �l McIlvaine buffer (pH 5.5) were incubated at 37 ◦C for 12 h. Afterydrolysis, the enzyme was removed from the reaction system using a Nanosepentrifugal 3K Device (Pall, Chicago, USA). The products were analyzed by high-erformance anion-exchange chromatography (HPAEC) with a model 2500 systemrom Dionex (Sunnyvale, CA, USA) [10]. Xylose, xylobiose and xylotriose were useds standards.

.10. Effects of XYNAM6 on the filtration rate and viscosity of mash

Mash was prepared as Celestino et al. described [21] with some modifications.alt (10 g) was firstly triturated in a disintegrator, filtered through a 0.2-mm sieve,

nd dissolved in 50 ml McIlvaine buffer (0.1 M, pH 5.5) containing 1 ml purifiedYNAM6 (40 or 80 U). The reaction system was processed at 45 ◦C for 30 min, 50 ◦C

or 30 min, 60 ◦C for 30 min, and 70 ◦C for 60 min, and then boiled for 5 min. McIl-aine buffer (0.1 M, pH 5.5) instead of enzyme solution was added as controls.ach reaction was stopped by addition of 50 ml cold water and cooled down to0 ◦C.

Ten milliliter of mash after reaction was filtered through a Xinhua filter paper101, Huangzhou, China). Filtration rate in the absence of enzyme was used as aontrol. The reduction of filtration rate was calculated using the standard equation21,22]:

= control − control

× 100 (1)

here is the total flow time of 10 ml and� is the reduction of filtration time.Mash supernatant (5 ml) after filtration by filter paper was placed in a viscosime-

er at 20 ◦C. Mash viscosity in the absence of enzyme was used as a control. Theiscosity reduction was calculated using the following equations [21]:

= �water × t × �twater × �water

(2)

� = �control −��control

× 100 (3)

here � is the viscosity, t is the total flow time through viscometer, �� is theeduction of viscosity, and � is the density.

. Results

.1. Gene cloning of the xylanase gene XYNM6 and sequencenalysis

A 346-bp fragment was amplified from the genomic DNA of S.egasporus DSM 41476 by PCR using the degenerate primers spe-

echnology 46 (2010) 506–512

cific for GH 10 xylanases. The fragment exhibited highest nucleotidesequence identity of 80% with the putative xylanase from Strepto-myces hygroscopicus ATCC 53653 (ZP 05517968). The PCR productsof the 5′ and 3′ flanking regions were then amplified by TAIL-PCR using nested insertion primers, and assembled with the coreregion to generate a 1440-bp full-length gene, and the nucleotidesequence of xynAM6 was deposited in GenBank under accessionnumber GU188674. The open reading frame has the G + C contentof 70.4%. SignalP analysis revealed the existence of an N-terminalsignal peptide at amino acid residues 1–36. The mature protein,XYNAM6, is composed of 443 residues with a theoretical molecularweight of 47.6 kDa.

The deduced amino acid sequence of the ORF was aligned withavailable protein sequences from the GenBank database. The over-all sequence of XYNAM6 showed the highest identity of 50.5% tothe xylanase of Thermomonospora alba ULJB1 (CAB02654). Basedon sequence analysis, the mature protein consists of two functionaldomains, a family 10 catalytic domain and a family 2 carbohydrate-binding module (CBM). Between these two functional domainsthere is a polyglycine sequence rich in proline and glycine (Fig. 1).Two putative catalytic site residues, Glu166 and Glu272, werefound in two conserved regions (WDVVNE and TELDI).

3.2. Expression and purification of XYNAM6 in P. pastoris

The gene fragment encoding the mature protein without thesignal peptide was cloned into P. pastoris. Transformants werescreened with the xylanase activity assay. The highest activity was23.2 U ml−1 after methanol induction for 48 h in 1 l shaker flask, andno xylanase activity was detected before induction, confirming thatxynAM6 encodes a functional xylanase.

The recombinant xylanase in the culture supernatant waspurified to electrophoretic homogeneity by ammonium sulfate pre-cipitation and exchange chromatography. The specific activity ofpurified recombinant XYNAM6 was 242.1 U mg−1, with a final yieldof 13.5%. The purified enzyme migrated a single band of about47.6 kDa as on SDS-PAGE (Fig. 2), which was consistent with thecalculated molecular weight.

3.3. Effect of pH and temperature on XYNAM6 activity

Purified recombinant XYNAM6 exhibited the highest xylanaseactivity at pH 5.5, retaining more than 50% of the maximum activ-ity at pH 5.0–9.0 (Fig. 3A). The enzyme was stable over a broadpH range, retaining more than 80% of the maximum activity afterincubation at pH 4.0–12.0 for 1 h at 37 ◦C (Fig. 3C).

The optimal temperature of XYNAM6 at pH 5.5 was 70 ◦C. Attemperatures between 50 and 80 ◦C, the enzyme activity was equalto or greater than 60% of the maximum activity (Fig. 3B). Theenzyme was stable after incubation at 60 and 70 ◦C for 1 h (Fig. 3D).After incubation at 80 ◦C for 20 min, the enzyme lost almost all ofthe activity.

The xylanase activity of XYNAM6 in the presence of differentmetal ions or chemical reagents is shown in Table 2. The enzymeactivity was significantly inhibited by Ag+, Hg2+ and SDS at theconcentrations of 1 and 10 mM. Partial inhibition was observed inthe presence of some metal ions at 10 mM concentration, such asCu2+, Cr3+, Zn2+, and Pb2+. �-Mercaptoethanol of 10 mM signifi-cantly enhanced the activity about 1.4-fold. The addition of otherreagents had little or no effect on the activity.

The purified XYNAM6 was resistant to all test protease. Aftertreatment with trypsin, �-chymotrypsin, collagenase, subtilisin Aand proteinase K for 1 h, the recombinant enzyme retained 94.2%,87.8%, 95.2%, 86.3% and 95.3% of its activity, respectively. Whentreated for 2 h, more than 80% of the activity remained.

Z. Qiu et al. / Enzyme and Microbial Technology 46 (2010) 506–512 509

Fig. 1. The nucleotide and deduced amino acid sequence of xynAM6 gene. The 36-amino acid putative signal peptide is underlined. The putative catalytic amino acid residuesare boxed. Dotted line indicates the putative location of linker region. Two conserved cysteine residues and three exposed tryptophan residues in CBM are shaded in gray.The translational stop codon is indicated by asterisk.

Table 2Effects of metal ions and chemical reagents on purified recombinant XYNAM6 activity.

Chemicals Relative activity (%)a Chemicals Relative activity (%)a

1 mM 10 mM 1 mM 10 mM

None 100 100 Cu2+ 91.48 ± 0.66 54.06 ± 1.32Na+ 109.68 ± 1.01 86.72 ± 0.65 Ca2+ 91.46 ± 0.49 82.47 ± 2.19Co2+ 107.68 ± 0.81 76.73 ± 1.65 Zn2+ 90.12 ± 0.18 87.81 ± 1.45Cr3+ 102.76 ± 0.94 72.15 ± 2.35 Pb2+ 88.65 ± 0.76 71.39 ± 1.35Fe3+ 96.81 ± 0.22 100.86 ± 1.79 Ag+ 55.31 ± 0.75 61.82 ± 0.51Li+ 94.25 ± 0.43 84.94 ± 2.68 Hg+ 6.54 ± 0.33 5.66 ± 2.54Ni+ 92.57 ± 0.26 83.33 ± 0.36 �-Met 105.04 ± 1.09 140.34 ± 0.14K+ 91.99 ± 0.69 86.95 ± 1.63 EDTA 92.52 ± 0.83 99.38 ± 2.31Mg2+ 91.93 ± 0.41 91.41 ± 0.42 SDS 17.83 ± 0.84 0.69 ± 0.86

a Values represent means ± SD (n = 3) relative to the untreated control samples.

510 Z. Qiu et al. / Enzyme and Microbial T

Fig. 2. SDS-PAGE analysis of the purification of recombinant XYNAM6. Lane M, stan-dard protein molecular weight markers; lane 1, XYNAM6 after purification; lane 2,culture supernatants after induction.

Fig. 3. Characterization of purified recombinant XYNAM6. (A) Effect of pH on xylanase acin buffers ranging from pH 2.0 to 12.0. (B) Effect of temperature on xylanase activity measactivity. After incubating purified recombinant XYNM6 at 37 ◦C for 1 h in buffers rangingat 70 ◦C. (D) The thermostability of purified recombinant XYNM6. The enzyme was pre-removed at specific time points for measurement of residual activity at 70 ◦C. Each value

echnology 46 (2010) 506–512

3.4. Kinetic parameters

Purified XYNAM6 exhibited high activity on substrate oat speltxylan, and birchwood xylan, but had no activity towards lichenan,barley �-glucan, laminarin and CMC-Na.

The Km, Vmax and kcat values of purified recombinant XYNAM6were 1.68 mg ml−1, 436.76 �mol min−1 mg−1, 346.35 s−1 for oatspelt xylan, respectively. Using birchwood xylan as substrate, theKm, Vmax and kcat values 2.33 mg ml−1, 322.69 �mol min−1 mg−1,255.89 s−1, respectively.

3.5. Analysis of hydrolysis product

The products of hydrolysis of oat spelt xylan and birchwoodxylan by purified recombinant XYNAM6 were analyzed by HPAEC.Xylose and xylobiose were the major hydrolysis products of thexylans from two sources. The hydrolysis products of oat spelt xylanwere 34.45% xylose, 57.37% xylobiose, and 8.18% xylotriose. Themass composition of the hydrolysis products from birchwood xylanwas 39.20% xylose, and 60.80% xylobiose.

3.6. The filtration rate and viscosity of mash

After incubation with 40 U purified XYNAM6, the specific fil-tration rate and viscosity of mash were reduced by 26.73% and25.58%, respectively. When at higher enzyme concentration (80 U),the XYNAM6 led to higher reduction in the filtration rate (36.33%)and viscosity (35.51%).

4. Discussion

Several Streptomyces species, which are very active in the bio-chemical decomposition of lignocellulosic biomass, have been

tivity. The activity assay of purified recombinant XYNAM6 was performed at 60 ◦Cured in 0.1 M McIlvaine buffer (pH 5.5). (C) Effect of pH on stability of the xylanasefrom pH 2.0 to 12.0, the activity was measured in 0.1 M McIlvaine buffer (pH 5.5)

incubated at 60, 70, or 80 ◦C in 0.1 M McIlvaine buffer (pH 5.5), and aliquots werein the panels represents the mean of triplicates plus standard deviation.

obial T

rtpaaCglTabTc

t(aet[hiaacs

iafd8B2saGetaatsbcbcbob[

lhprihXiohUiea

[

[

[

[

[

[

[

[

[

[

[

[

[

[

Z. Qiu et al. / Enzyme and Micr

eported to produce considerable amounts of xylanases [23,24]. Inhis study, we cloned a new GH 10 xylanase gene from S. megas-orus DSM 41476. Sequence analysis showed that the deducedmino acid sequence of xylanase contains three function regions:n N-terminal leader sequence, a glycosyl hydrolase domain and a-terminal CBM domain. A short linker sequence rich in proline,lycine, aspartic acid, and glutamic acid is between the hydro-ase and CBM domains. The CBM of XYNAM6 belongs to CBM2a.wo conserved cysteine residues at the N and C termini (Cys379nd Cys476) have been reported to be involved in a disulphideond [25]. There are three exposed tryptophan residues (Try389,ry408, and Try424), and two of them (Try408 and Try424) form aarbohydrate-binding cleft [26].

The optimal pH of XYNAM6 was 5.5, but it retained morehan 50% of maximum activity under acidic to alkaline conditions5.0–9.0). Even at pH 10.0 and 11.0, 38% and 15% of maximumctivity were detected. Some xylanases from Streptomyces have nonzyme activity at pH 10.0, however, such as XynAS9 from Strep-omyces sp. S9 [10], xylanase from Streptomyces sp. strain AMT-327], STX-I from S. thermoviolaceus OPC-520 [8]. XYNAM6 was alsoighly stable over a broad pH range, retaining over 80% of the activ-

ty after incubation at pH 4.0–12.0. Its activity and stability underlkaline condition may be understood by analyzing some key aminocids and the surface amino acid composition [28]. The mechanismsausing enzyme stable under alkaline conditions needs furthertudies on crystallization and site-directed mutagenesis.

Compared with majority of xylanases, XYNAM6 was superiorn temperature-related properties. XYNAM6 had optimal temper-ture at 70 ◦C and retained 65% of maximal activity at 80 ◦C. Only aew xylanases have similar biochemical characteristics as XYNAM6id; these include STXF10 from Streptomyces thermonitrificans NTU-8 [29], XynAS9 from Streptomyces sp. S9 [10], xylanase fromacillus halodurans S7 [30], xylanase from Bacillus sp. Strain NG-7 [31], and xylanase from Geobacillus sp. MT-1 [32]. However,ome of these xylanases were not stable at 70 ◦C. For example,fter incubation at 70 ◦C for 30 min, XynAS9 and xylanase fromeobacillus sp. MT-1 rapidly lost all of activity. Therefore, XYNAM6xhibited better adaptability and stability within the mesophilico moderately halophilic range, exhibiting >60% of the maximumctivity at 50–80 ◦C and retaining 95% and 53% of initial activityfter pre-incubation at 60 and 70 ◦C for 1 h, respectively. Addi-ion of Hg2+, Cu2+, and Zn2+ inhibited the activity of XYNAM6ignificantly, suggesting that XYNAM6 is a thiol-sensitive enzymeecause these heavy metal ions bind free mercapto groups (–SH) inysteine residues. The Km values of XYNAM6 for oat spelt xylan andirchwood xylan were 1.68 and 2.33 mg ml−1, respectively, indi-ating that XYNAM6 had better affinity for oat spelt xylan thanirchwood xylan. The substrate preference of XYNAM6 towardsat spelt xylan was similar to the xylanases isolated from otheracteria such as Geobacillus sp. MT-1 [32] and Streptomyces sp. S910].

Arabinoxylans are the major non-starch polysaccharides of bar-ey grain. During the mashing process, arabinoxylans can increaseigh wort viscosity and turbidity, and ultimately causing someroblems such as reduced yields of extracts, decreased filtrationates, and some gelatinous precipitates in the finished beer [33]. Toncrease the degradation efficacy of arabinoxylans in barley malts,igh temperature and addition of xylanase are developed [34].YNAM6 with suitable enzyme characteristics met the brewing

ndustry’s needs, such as exhibiting highest activity in the pH rangef 5.0–6.0 at 70 ◦C, good thermal and pH stability, less complex

ydrolysis products, and resistance to most cations and proteases.nder simulated mashing conditions, addition of XYNAM6 resulted

n significant reduction of filtration rate and viscosity at lownzyme concentrations. These superior properties make XYNAM6n ideal candidate for application in the brewing industry.

[

[

echnology 46 (2010) 506–512 511

Acknowledgements

This work was supported by the Chinese National High Tech-nology Research and Development Program (863 Program, grant2007AA100601), National Key Technology R&D Program of China(2006BAD12B05-03), and Key program of Transgenic Plant Breed-ing (2008ZX003-002).

References

[1] Polizeli M, Rizzatti A, Monti R, Terenzi H, Jorge J, Amorim D. Xylanasesfrom fungi: properties and industrial applications. Appl Microbiol Biotechnol2005;67:577–91.

[2] Collins T, Gerday C, Feller G. Xylanases, xylanase families and extremophilicxylanases. FEMS Microbiol Rev 2005;29:3–23.

[3] Chávez R, Bull P, Eyzaguirre J. The xylanolytic enzyme system from the genusPenicillium. J Biotechnol 2006;123:413–33.

[4] Sunna A, Antranikian G. Xylanolytic enzymes from fungi and bacteria. Crit RevBiotechnol 1997;17:39–67.

[5] Kulkarni N, Shendye A, Rao M. Molecular and biotechnological aspects ofxylanases. FEMS Microbiol Rev 1999;23:411–56.

[6] Morosoli R, Bertrand JL, Mondou F, Shareck F, Kluepfel D. Purification and prop-erties of a xylanase from Streptomyces lividans. Biochem J 1986;239:587–92.

[7] Ruiz-Arribas A, Fernandez-Abalos JM, Sanchez P, Garda AL, Santamaria RI. Over-production, purification, and biochemical characterization of a xylanase (Xys1)from Streptomyces halstedii JM8. Appl Environ Microbiol 1995;61:2414–9.

[8] Tsujibo H, Miyamoto K, Kuda T, Minami K, Sakamoto T, Hasegawa T, et al.Purification, properties, and partial amino acid sequences of thermostablexylanases from Streptomyces thermoviolaceus OPC-520. Appl Environ Microbiol1992;58:371–5.

[9] Hernández A, López JC, Santamaría R, Díaz M, Fernández-Abalos JM, Copa-Patino JL, et al. Xylan-binding xylanase Xyl30 from Streptomyces avermitilis:cloning, characterization, and overproduction in solid-state fermentation. IntMicrobiol 2008;11:133–41.

10] Li N, Meng K, Wang Y, Shi P, Luo H, Bai Y, et al. Cloning, expression, andcharacterization of a new xylanase with broad temperature adaptability fromStreptomyces sp. S9. Appl Microbiol Biotechnol 2008;80:231–40.

11] Li N, Shi P, Yang P, Wang Y, Luo H, Bai Y, et al. A xylanase with high pH stabilityfrom Streptomyces sp. S27 and its carbohydrate-binding module with/withoutlinker-region-truncated versions. Appl Microbiol Biotechnol 2009;83:99–107.

12] Beg QK, Kapoor M, Mahajan L, Hoondal GS. Microbial xylanases and their indus-trial applications: a review. Appl Microbiol Biotechnol 2001;56:326–38.

13] Wu YB, Ravidran V, Thomas DG, Birtles MJ, Hendricks WH. Influence of methodof whole wheat inclusion and xylanase supplementation on the performance,apparent metabolisable energy, digestive tract measurements and gut mor-phology of broilers. Brit Poultry Sci 2004;45:385–94.

14] Bajpai P. Application of enzymes in the pulp and paper industry. BiotechnolProg 1999;15:147–57.

15] Liu YG, Whittier RF. Thermal asymmetric interlaced PCR: automatable ampli-fication and sequencing of insert end fragments from P1 and YAC clones forchromosome walking. Genomics 1995;25:674–81.

16] Zhou J, Huang H, Meng K, Shi P, Wang Y, Luo H, et al. Cloning of a newxylanase gene from Streptomyces sp. TN119 using a modified thermal asymmet-ric interlaced-PCR specific for GC-rich genes and biochemical characterization.Appl Biochem Biotechnol 2010;160:1277–92.

17] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitiv-ity of progressive multiple sequence alignment through sequence weighting,positions-specific gap penalties and weight matrix choice. Nucleic Acids Res1994;22:4673–80.

18] Laemmli UK. Cleavage of structural proteins during the assembly of the headof bacteriophage T4. Nature 1970;227:680–5.

19] Bradford MM. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein–dye binding. AnalBiochem 1976;72:248–54.

20] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducingsugar. Anal Chem 1959;31:426–8.

21] Celestino KR, Cunha RB, Felix CR. Characterization of a beta-glucanase producedby Rhizopus microsporus var. microsporus, and its potential for application in thebrewing industry. BMC Biochem 2006;7:23.

22] Vlasenko EY, Ryan AI, Shoemaker CF, Shoemaker SP. The use of capillary vis-cometry, reducing end-group analysis, and size exclusion chromatographycombined with multi-angle laser light scattering to characterize endo-1,4-�-d-glucanases on carboxymethylcellulose: a comparative evaluation of the threemethods. Enzyme Microb Technol 1998;23:350–9.

23] Johnson KG, Harrison BA, Schneider H, MacKenzie CR, Fontana JD. Xylan-hydrolysing enzymes from Streptomyces spp. Enzyme Microb Technol

1988;10:403–9.

24] Shareck F, Roy C, Yaguchi M, Morosoli R, Kluepfel D. Sequences of three genesspecifying xylanases in Streptomyces lividans. Gene 1991;107:75–82.

25] Xu GY, Ong E, Gilkes NR, Kilburn DG, Muhandiram DR, Harris-Brandts M, etal. Solution structure of a cellulose-binding domain from Cellulomonas fimi bynuclear magnetic resonance spectroscopy. Biochemistry 1995;34:6993–7009.

5 obial T

[

[

[

[

[

[

[

[33] Viëtor RJ, Voragen AGJ, Angelino SAGF, Pilnik W. Non-starch polysaccha-rides in barley and malt: a mass balance of flour fractionation. J Cereal Sci

12 Z. Qiu et al. / Enzyme and Micr

26] Simpson PJ, Xie H, Bolam DN, Gilbert HJ, Williamson MP. The structural basisfor the ligand specificity of family 2 carbohydrate-binding modules. J Biol Chem2000;275:41137–42.

27] Nascimento RP, Coelho RRR, Marques S, Alves L, Girio FM, Bon EPS, et al. Produc-tion and partial characterisation of xylanase from Streptomyces sp. strain AMT-3isolated from Brazilian cerrado soil. Enzyme Microb Technol 2002;31:549–55.

28] Mamoa G, Thunnissen M, Hatti-Kaul R, Mattiasson B. An alkaline activexylanase: insights into mechanisms of high pH catalytic adaptation. Biochimie2009;91:1187–96.

29] Cheng HL, Tsai CY, Chen HJ, Yang SS, Chen YC. The identification, purification,and characterization of STXF10 expressed in Streptomyces thermonitrificansNTU-88. Appl Microbiol Biotechnol 2009;82:681–9.

30] Mamo G, Delgado O, Martinez A, Mattiasson B, Hatti-Kaul R. Cloning, sequenceanalysis, and expression of a gene encoding an endoxylanase from Bacillushalodurans S7. Mol Biotechnol 2006;33:149–59.

[

echnology 46 (2010) 506–512

31] Gupta N, Reddy VS, Maiti S, Ghosh A. Cloning, expression, and sequenceanalysis of the gene encoding the alkali-stable, thermostable endoxylanasefrom alkalophilic, mesophilic Bacillus sp. Strain NG-27. Appl Environ Microbiol2000;66:2631–5.

32] Wu SJ, Liu B, Zhang XB. Characterization of a recombinant thermostablexylanase from deep-sea thermophilic Geobacillus sp. MT-1 in East Pacific. ApplMicrobiol Biotechnol 2006;72:1210–6.

1991;14:73–83.34] Li Y, Lu J, Gu G, Shi Z, Mao Z. Mathematical modeling for prediction of endo-

xylanase activity and arabinoxylans concentration during mashing of barleymalts for brewing. Biotechnol Lett 2004;26:779–85.