A Tumorigenic Subpopulation with Stem Cell Properties in ......A Tumorigenic Subpopulation with Stem...

A Tumorigenic Subpopulation with Stem Cell

Properties in Melanomas

Dong Fang,1Thiennga K. Nguyen,

1Kim Leishear,

1Rena Finko,

1Angela N. Kulp,

1Susan Hotz,

2

Patricia A. Van Belle,2Xiaowei Xu,

2David E. Elder,

2and Meenhard Herlyn

1

1Program of Molecular and Cellular Oncogenesis, The Wistar Institute and 2Department of Pathology and Laboratory Medicine,University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania

Abstract

Recent studies suggest that cancer can arise from a cancerstem cell (CSC), a tumor-initiating cell that has propertiessimilar to those of stem cells. CSCs have been identified inseveral malignancies, including those of blood, brain, andbreast. Here, we test whether stem cell–like populations existin human melanomas. In f20% of the metastatic melanomascultured in growth medium suitable for human embryonicstem cells, we found a subpopulation of cells propagating asnonadherent spheres, whereas in standard medium, adherentmonolayer cultures were established. Individual cells frommelanoma spheres (melanoma spheroid cells) could differen-tiate under appropriate conditions into multiple cell lineages,such as melanocytic, adipocytic, osteocytic, and chondrocyticlineages, which recapitulates the plasticity of neural crest stemcells. Multipotent melanoma spheroid cells persisted afterserial cloning in vitro and transplantation in vivo , indicatingtheir ability to self-renew. Furthermore, they were moretumorigenic than adherent cells when grafted to mice. Weidentified similar multipotent spheroid cells in melanoma celllines and found that the stem cell population was enriched ina CD20+ fraction of melanoma cells. Based on these findings,we propose that melanomas can contain a subpopulation ofstem cells that contribute to heterogeneity and tumorigenesis.Targeting this population may lead to effective treatments formelanomas. (Cancer Res 2005; 65(20): 9328-37)

Introduction

Due to their resistance to current therapies, melanomas remain asignificant cause of mortality in Caucasians. Tumors consist ofheterogeneous populations whose biological properties remainpoorly characterized. Melanomas are believed to arise from amature, differentiated melanocyte. However, mounting evidencesuggests that cancer may in fact arise from a transformed stem cell,which is able to self-renew, differentiate into diverse progenies, anddrive continuous growth (1). Cancer stem cells (CSC) have beenidentified in leukemias, and tumors of the breast and brain by tumortype–specific cell surface markers often associated with stem cells(2–5). Stem-like cells were also found in an established glioma cellline by their inability to incorporate a nuclear dye (6, 7). CSCs frombrain tumors could be isolated, because they show in vitro growthcharacteristics similar to those of neural stem cells, which proliferateas nonadherent cell aggregates termed spheres or spheroids (8, 9).

Indirect evidence supports the presence of melanoma stem-likecells. First, melanomas show phenotypic heterogeneity bothin vivo and in vitro , suggesting an origin from a cell withmultilineage differentiation abilities. Melanoma cells retain theirmorphologic and biological plasticity despite repeated cloning(10). Second, melanoma cells often express developmental genes(11). Third, melanoma cells can differentiate into a wide range ofcell lineages, including neural, mesenchymal, and endothelial cells.They frequently exhibit characteristics of neural lineages (12–14).Melanomas from aggressive lesions can develop vessel-likestructures and share with endothelial cells many matrix adhesionreceptors such as h3 integrin or the cell-cell adhesion moleculesMCAM, which are important for invasion and metastasis (15–17).They can also acquire characteristics of stromal fibroblasts byconstricting collagen type I (18) and expressing fibroblast-associated markers such as fibroblast activating protein (19). Insome cases, melanoma lesions contain areas of adipogenic orosteocartilaginous differentiation patterns (20–24).Given this evidence, we asked whether melanomas contain a

tumorigenic stem cell–like population.

Materials and Methods

Primary culture, propagation, and separation of melanoma cells.Metastatic melanomas were obtained in accordance with consent

procedures approved by the Internal Review Boards of the University of

Pennsylvania School of Medicine and The Wistar Institute. They were

obtained within 1 to 2 hours after surgical removal. Tumors were rinsed,trimmed to remove connective tissues, and subjected to enzymatic

dissociation in 1 mg/mL collagenase IV (Invitrogen, Carlsbad, CA) in

DMEM for 4 to 6 hours at 4jC. Single cells were washed with HBSS,resuspended in culture medium, and plated onto noncoated flasks.

For growing melanoma cells, we used two types of media: (a) mouse

embryonic fibroblast (MEF)–conditioned human embryonic stem cell

(hESC) medium (25, 26). Before use, we mixed MEF conditioned with freshhESC medium at a 3:1 ratio and supplemented with basic fibroblast growth

factor (bFGF) at 4 ng/mL. (b) Mel 2% melanoma growth medium, which

was used to establish permanent melanoma cell lines (27). It consisted of

MCDB 153 medium (Sigma, St. Louis, MO; 4 parts), L15 medium (Invitrogen;1 part), 2% FCS, 5 Ag/mL insulin (Sigma), 15 Ag/mL bovine pituitary extract(Cambrex, East Rutherford, NJ), 1.68 mmol/L calcium chloride, and 5 ng/mL

epidermal growth factor (EGF, Sigma). Established melanoma cell lines

WM115 and WM239A were cultured in Mel 2% medium without pituitaryextract and EGF (27). EBV-transformed B-cell lines from melanoma patients

were kindly provided by Dr. D. Herlyn of The Wistar Institute and cultured

in RMPI 1640 with 10% FCS (28).To isolate melanoma cells from heterogeneous primary cultures,

individual cells derived from mechanically or enzymatically dissociated

primary spheres were cloned by limiting dilution assay in hESC medium.

Although one cell showed limited potential for proliferation, new spheroidcultures were regenerated from two single primary cells. For subculture,

spheroid cells were dissociated and replated every 7 to 10 days at a clonal

density of 1,000 cells/mL (29).

Requests for reprints: Meenhard Herlyn, The Wistar Institute, 3601 Spruce Street,Philadelphia, PA 19104. Phone: 215-898-3950; Fax: 215-898-0980; E-mail: [email protected].

I2005 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-05-1343

Cancer Res 2005; 65: (20). October 15, 2005 9328 www.aacrjournals.org

Research Article

Research. on June 15, 2021. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

Evaluation of tumorigenicity and histologic staining. Tumorigenicitywas determined by s.c. injecting single cells into the right flank of severe

combined immunodeficient (SCID) mice at 1.7 � 106 cells per mouse. Tocompare tumorigenicity of melanoma spheroid cells and their adherent

counterparts with limiting amount of cells, mice were treated with 200 Agcyclophosphamide monohybrate (Cytoxan, Sigma), which further sup-

pressed the immune response. Four days later, 2 � 105 tumor cells wereinjected. H&E, melanin, and hemosiderin staining were done on 5-Amparaffin-embedded sections following standard protocols.

Flow cytometry and fluorescence-activated cell sorting. Adhesivecells were removed with 0.02% EDTA in HBSS. Cells were washed,

suspended in buffer [0.1% bovine serum albumin (BSA), 0.1% NaN3 in

PBS], and incubated with primary antibodies for 60 minutes at 4jC withconstant agitation. Cells were washed twice with buffer then incubated with

Alexa Fluor 488–conjugated goat anti-mouse secondary antibodies

(Molecular Probes, Eugene, OR) for 60 minutes when unconjugated primaryantibodies were used. Suspended spheroid cells were dissociated mechan-

ically into single cells and stained. Approximately 5 � 103 cells wereanalyzed in an EPICS XL instrument (Beckman-Coulter, Inc., Miami, FL).

Monoclonal antibodies (mAb) against CD3 (PE conjugated), CD4 (PE�),CD8 (PE�), CD20 (FITC�), MCAM, CD117, and CD26 were purchased fromBD PharMingen (San Diego, CA). We purchased mAbs against CD45

(PeliCluster, Amsterdam, The Netherlands), CD34 (PeliCluster), CD133

(Miltenyi Biotech, Auburn, CA), CD31 (Dako, Carpinteria, CA), neural celladhesion molecule (CD56/NCAM, NeoMarkers, Fremont, CA), E-cadherin

(Zymed Laboratories, South San Francisco, CA), N-cadherin (Sigma), von

Willebrand factor (vWF, NeoMarkers), vascular endothelial growth factor-2(VEGFR2, Imclone, New York, NY), and growth-associated phosphoprotein-

43 (GAP-43, Calbiochem, San Diego, CA). mAbs against the surface markers

of hESCs, including stage-specific embryonic antigen (SSEA)-1, SSEA-3,

SSEA-4, TRA-1-60, and TRA-1-81 (25), were obtained from where they wereoriginally developed at The Wistar Institute. mAbs against GD2, chondroitin

sulfate proteoglycan (CSPG), h3 integrin, EGF receptor (EGFR), HLA-DR,and p70NGFR were described previously (30). Isotype-matched mouse pure,

PE- or FITC-conjugated antibodies (BD PharMingen) were used as controls.Fluorescence-activated cell sorting (FACS) was done on a Cytomation

MoFlo cytometer (DakoCytomation, Fort Collins, CO). FITC-conjugated

mAb against human CD20 was used for separation. For sorting double-stained cells, a polyclonal antibody against human CD20 antigen (Neo-

Markers) was used to costain with mAb against MCAM or h3 integrin.Polyclonal antibodies were labeled by PE-conjugated goat antibodies

against rabbit IgG (Sigma) and mAbs by FITC-conjugated rabbit antibodiesagainst mouse IgG (Sigma).

Differentiation assays of melanoma spheroid cells. Melanomaspheres were allowed to sediment, individual cells were removed with the

supernatant. Spheres were dissociated into individual cells before platingonto tissue culture-grade plastic coated with 10 ng/mL fibronectin at the

density of 2 � 103/cm2. Melanogenic differentiation medium, which wasbased on melanocyte growth medium (31) and exclusively differentiated

hESCs into melanocytic lineages,3 contains dexamethasone (0.05 Amol/L,Sigma), insulin-transferrin-selenium (ITS, 1�, Sigma), linoleic acid-BSA(1 mg/mL, Sigma), low-glucose DMEM (30%, Life Technologies, Rockville,

MD), MCDB 201 (20%, Sigma), L-ascorbic acid (10�4 mol/L, Sigma),conditioned media of mouse L-Wnt3a cells (American Type Culture

Collection, Manassas, VA, 50%), stem cell factor (100 ng/mL, R&D System,

Minneapolis, MN), endothelin-3 (100 nmol/L, American Peptide, Sunnyvale,

CA), cholera toxin (20 pmol/L, Sigma), the phorbol ester 12-O-tetradeca-noylphorbol-13-acetate (50 nmol/L, Sigma), and bFGF (4 ng/mL). Differen-

tiation media for mesenchymal lineages were used as described with

modifications (32). Osteogenesis medium consisted of 90% DMEM, 10%

FCS, 1� ITS (Sigma), 1 mg/mL LA-BSA (Sigma), 0.1 Amol/L dexamethasone(Sigma), 0.05 mmol/L L-ascorbic acid-2-phosphate (Sigma), and 10 mmol/L

h-glycerophosphate (Sigma). Alkaline phosphatase was detected after14 days with the Vector Blue alkaline phosphatase substrate kit III (Vector

Laboratories, Burlingame, CA). Adipogenic medium contained 90% DMEM,10% horse serum (Invitrogen), 1� ITS, 1 mg/mL LA-BSA, 1 Amol/L hydro-cortisone (Sigma), 0.5 mmol/L isobutylmethylxanthine (Sigma), and

60 Amol/L indomethacin (Sigma) for 10 to 14 days. Accumulation of lipidvacuoles was visualized by staining with Oil Red O (Sigma). Chondrogenicmedium contained 90% DMEM, 10% FCS, 1� ITS, 1 mg/mL LA-BSA,10 ng/mL transforming growth factor-h1 (R&D System), and 1 mmol/Lpyruvate (Sigma) for 10 to 14 days. Chondrogenic differentiation was

assayed by expression of type II collagen. As controls, undifferentiatedspheres were stained in suspension and then centrifuged onto slides.

Immunocytochemical staining. Cells were fixed with 4% paraformal-dehyde and stained with primary antibodies specific for microphthalmia-

associated transcription factor (MITF, monoclonal, NeoMarkers), sex-determining region Y (SRY)–related transcription factor SOX10 (polyclonal,

Abcam, Cambridge, MA), tyrosinase (TYR, monoclonal, Novocasta, New-

castle upon Tyne, United Kingdom), anti-human nuclei MAB1281(Chemicon, Temecula, CA), and type II collagen (monoclonal, Chemicon).

Isotype-matched mouse antibodies or normal rabbit IgG were used as

controls. After washings, primary antibody binding was detected using the

corresponding Alexa Fluor 488–conjugated secondary antibodies (Molecu-lar Probes). Staining was observed by fluorescence microscopy.

RNA isolation, reverse transcription-PCR, and Western blotting.RNA isolation, reverse transcription-PCR (RT-PCR), and Western blot

analyses were done using primers and antibodies against dopachrometautomerase (DCT/DCT), MITF/MITF, and TYR as described (33, 34). TYR

primers were TGCCAACGATCCTATCTTCC (sense) and TGAGGAGTGG-

CTGCTTTTCT (antisense). A mAb against h-actin (Sigma) was used as acontrol.

Statistical analysis. To assess the statistical significance of differences, aone-sided Student’s t test was done. Ps

WM3523 cells established in Mel 2% medium were morehomogenously positive for GD2 (78.40%), CSPG (96.80%), h3integrin (98.60%), MCAM (98.40%), and p70NGFR (94.80%).Tumor-infiltrating B cells isolated from melanoma lesions wereincluded as negative controls. Only a small fraction of the B cellsexpressed typical melanoma markers (Fig. 1B).Both WM3517 and WM3539 spheres were negative for hemato-

poietic markers (data not shown), whereas WM3523 spherescontained hematopoietic cells. Very few of WM3523 primaryspheroid cells expressed CD3 (0.99%), CD4 (1.21%), and CD8(1.04%), but a significant population of WM3523 spheroid cellsexpressed CD45 (38.90%) and CD20 (41.70%; Fig. 1C). Whereas Bcells uniformly expressed CD45 (99.80%) and CD20 (98.10%),adhesive melanoma cells isolated from the same lesion werehomogeneously negative for all hematopoietic markers tested (Fig.1C). These results suggest that the WM3523 spheres containedboth melanoma and hematopoietic cells.Sphere formation of melanoma cells isolated from hetero-

geneous populations. To ensure the purity of cell population,melanoma cells were clonally isolated from mixed cultures asdescribed in Materials and Methods. All 14 clones of WM3523 werepigmented and were able to produce proliferating melanomaspheres (Fig. 2A). The spheres were grown for >8 months bycontinuous passage. A minor population, ranging from 5% to 10%,grew adherent and subsequently differentiated into small, ovalmelanocytic cells with short dendrites (data not shown), whereasthe major population grew as melanoma spheres. Flow cytometry

analyses of five clones showed that spheroid cells homogeneouslyexpressed melanoma markers CSPG (95.30%), h3 integrin (96.00%),and MCAM (97.50%; Fig. 2B). A significant fraction of cellsexpressed E-cadherin (89.60%) but not N-cadherin (2.54%).Hematopoietic markers CD3 (0.76%) and CD4 (0.90%) remainednegative, with a small portion expressing CD8 (1.22%), CD45(1.10%), and CD20 (3.34%; Fig. 2B). The CD20-positive subpopula-tion coexpressed melanoma-associated MCAM and h3 integrinand was enriched by FACS (Fig. 2C-D). This indicates that a sub-population of melanoma spheroid cells express the hematopoieticmarker CD20.Self-renewal and melanocytic differentiation of melanoma

spheroid cells. After separating WM3523 melanoma spheres intosingle cells and reseeding at a clonal density of 1,000 cells/mL, theyremained in stem cell growth medium as individual cells withoutaggregate formation for 5 hours (Fig. 3A, a). New spheres developedfrom individual cells 4 days after seeding (Fig. 3A, b). Whendissociated spheroid cells were treated with melanocyte differen-tiation medium, a large proportion of cells adhered to flasksprecoated with fibronectin (Fig. 3A, c). Within 4 days, theydifferentiated into melanocytic cells (Fig. 3A, d), whose pelletsdisplayed increased pigmentation (Fig. 3A, e, right) when comparedwith pellets from parental cells (Fig. 3A, e, left). The capacity formelanocytic differentiation of melanoma spheroid cells persisted inlong-term cultures for up to 8 months with no significant decreasein efficiency. Melanoma spheroid cells in stem cell growth mediummaintained their growth potential; whereas under differentiation

Figure 1. Cells from metastatic melanoma lesionsform nonadherent spheres under hESC cultureconditions. A, tumor cell suspension frommelanoma lesion WM3523 before culture (a).Adherent cells (b) and spheres (c ) obtained after2 weeks in Mel 2% and hESC medium,respectively. Cell pellets from adherent cells(left ) with pigmentation or from spheres (right )nonpigmented (d ). Bar, 100 Am (a) and 200 Am(b and c ). Flow cytometry analysis forexpression of melanoma-associated (B) andhematopoietic markers (C ) on spheroid (top ) oradherent (middle ) cultures from lesion WM3523.B cells were used as controls (bottom ). Solid lines,isotype-matched control; shaded areas, specificmarker. Representative of three independentexperiments.

Cancer Research




conditions, cell growth slowed dramatically and stopped after18 days (data not shown). Similarly, standard melanoma growthmedium, Mel 2%, could differentiate melanoma spheroid cells intomelanocytic cells but with lower efficiency (data not shown). Theseresults suggest that melanoma spheroid cells can self-renew anddifferentiate into a melanocytic phenotype.We then characterized melanocytic differentiation by immunos-

taining, RT-PCR, and Western blotting. A fraction of melanomaspheroid cells expressed melanocyte-specific MITF (52.8%) andmelanogenic enzyme TYR (30.8%; Fig. 3B-C). After differentiation,the populations expressing both melanocytic markers increasedsignificantly. In contrast, adherent monolayer melanoma culturesisolated in Mel 2% showed only marginal increases in MITF- orTYR-expressing cells after differentiation (Fig. 3B-C). These resultssuggest that melanoma spheroid cells contain a larger populationof progenitor cells with differentiation potential for melanocyticcells lineage than the adherent cells. RT-PCR and Western blottingdetected expression of melanocyte-specific genes MITF/MITF,TYR/TYR, and DCT/DCT. Significant increases in TYR mRNA

and TYR protein levels were observed after melanocyte differenti-ation (Fig. 3D). The DCT protein was undetectable in undifferen-tiated and differentiated populations; however, its transcriptionalexpression was greatly enhanced after differentiation. Expressionof two phosphorylated MITF proteins (54 and 60 kDa) was in-creased after differentiation regardless of a slight decrease in MITFmRNA. These results show increases in DCT transcription andMITF and TYR proteins correlate with enhanced pigmentation afterdifferentiation.Mesenchymal differentiation of melanoma spheroid cells.

Melanocytes are derived from the neural crest during embryonicdevelopment. The transient neural crest consists of pluripotentstem cells that give rise to a wide array of lineages, includingneurosecretory cells, peripheral neurons, glia, and the cephalicmesenchyme (bone and cartilage; ref. 35). To determine whetherWM3523 melanoma spheroid cells can differentiate similarly toneural crest stem cells, we examined neural and mesenchymaldifferentiation. The cells failed to differentiate into neural lineagesin defined medium containing 60% DMEM, 40% MCDB 201, 0.05Amol/L dexamethasone, 1� ITS, 1 mg/mL LA-BSA, 10�4 mol/LL-ascorbic acid, and 100 ng/mL bFGF (ref. 36; data not shown). Onthe other hand, WM3523 melanoma spheroid cells readilydifferentiated into mesenchymal lineages with varying efficiencies:adipogenic (31.0%), chondrogenic (18.6%), and osteogenic (5.6%;Fig. 4A-B). Few or no undifferentiated melanoma spheroid cellsstained for Oil Red O (5.6%), type II collagen (1.6%), or alkalinephosphatase (0.0%). Adherent monolayer melanoma cells estab-lished in Mel 2% showed significant potential for adipogenesis only(4.0%; Fig. 4B). These results suggest that multipotent stem cells areenriched in melanoma spheroid populations isolated in stem cellgrowth medium.To verify the common origin of melanocytic lineages and differ-

entiated mesenchymal cells, we double stained with melanocyte-associated transcription factors MITF or SOX10 and mesenchymalmarkers Oil Red O or alkaline phosphatase (Fig. 4C). In adipogenicmedium, differentiated melanoma cells containing multiple MITF-or SOX10-positive nuclei also displayed Oil Red O staining (Fig. 4C).In osteogenic medium, differentiated melanoma cells expressingalkaline phosphatase also exhibited diffuse MITF or SOX10expression. These data indicate a common origin for differentiatedmesenchymal cell lineages and melanocytic cells, and thatmesenchymal differentiation is not due to contaminating non-tumor stem cells.The percentage of differentiated mesenchymal cell types varied

considerably among clones. Of six tested, clones 4, 6, and 11could differentiate into melanogenic, adipogenic, chondrogenic,and osteogenic lineages. Other clones were either tripotent(melanogenic, adipogenic, and chondrogenic lineages), bipotent(melanogenic and adipogenic), or unipotent (melanogenic). Themesenchymal differentiation capacity of melanoma spheroid cellspersisted in long-term cultures up to 8 months, albeit withdecreased efficiency (particularly in osteogenic differentiation).Melanoma spheroid cell lines WM3517 and WM3539 showeddifferentiation capacity for the melanocytic lineage only (data notshown).Multipotent melanoma spheroid cells derived from estab-

lished melanoma cell lines. We explored whether a stem cellpopulation could be isolated from long-established melanoma celllines. A total of 18 cell lines were tested in stem cell cultureconditions using hESC medium. Spheroid phenotypes developed inWM115 and WM239A, a pair of primary and metastatic melanoma

Figure 2. Isolated melanoma cells form new spheres. A, single cells fromWM3523 spheroid cultures re-formed spheres (left) and spheres could becontinuously propagated after repeated dissociations (right ). Bar, 200 Am.B, flow cytometry analyses show that isolated WM3523 spheroid populationshomogeneously contain cells expressing melanoma markers. C, flow cytometryanalysis of WM3523 spheroid cells coexpressing both CD20 and MCAM(fraction 2). A fraction of cells coexpressing CD20 and h3 integrin were alsodetected (data not shown). D, identification of a fraction of melanoma spheroidcells coexpressing CD20 and MCAM/ h3 integrin. Representative of experimentsusing three independent clones (clones 4, 6, and 11). Bar, 50 Am.

A Stem Cell Population in Melanomas

www.aacrjournals.org 9331 Cancer Res 2005; 65: (20). October 15, 2005



cell lines derived from the same patient (37). When adherentcultures of WM115 cells (Fig. 5A, a) were exposed to hESC medium,spheres appeared after f7 days (Fig. 5A, b). These spheroid cellsconsistently formed new spheres when separated into single cells(Fig. 5A, c). Adipogenic, osteogenic, and chondrogenic differenti-ation was extensively induced under appropriate conditions inWM115 spheroid cells but not in the adherent population (Fig. 5A,d-f and B). Similar differentiation capacities were observed inWM239A spheroid cells established in stem cell medium (data notshown).Flow cytometry analysis showed that, although the majority of

hematopoietic and melanoma cell surface markers on WM115spheroid cells retained expression levels similar to those of WM115adhesive cells, a subpopulation of WM115 spheroid cells expressedthe hematopoietic marker CD20 and showed reduced expression ofEGFR (a marker for epithelial differentiation; Fig. 5C). Melanomacells coexpressing MCAM or h3 integrin and CD20 were confirmedby FACS and fluorescence microscopy (Fig. 5D-E). These datasuggest that a multipotent stem cell population can be isolatedfrom established melanoma cell lines and that this populationgrows and differentiates similarly to fresh isolates. Moreover, asubpopulation of melanoma spheroid cells derived from melanomacell lines is also similar to freshly isolated cells in that itcoexpresses the hematopoietic marker CD20.

Multipotent melanoma spheroid cells are capable offorming tumors in vivo and self-renewing after transplanta-tion. We examined the tumorigenic capacity of WM115 andWM3523 spheroid cells by s.c. injection in SCID mice. All miceinjected with WM115 spheroid cells (n = 5), or WM3523 spheroidcells (clone 4, n = 5; clone 6, n = 3) developed tumors (Fig. 6A). Themajority of tumors were observed between 28 and 40 days. Tumorsconsisted of large cells with abundant eosinophilic cytoplasm, ovalto irregular nuclei, and dominant nucleoli. Most tumors alsocontained giant tumor cells (data not shown). Their melanocyticorigin was confirmed by positive staining for melanin and not forhemosiderin (Fig. 6A ; data not shown). These results suggest thatmelanoma spheroid cells isolated in stem cell medium aretumorigenic.We then isolated and cultured melanoma cells from tumors

grown in mice. Typical melanoma spheres were formed within 2to 3 weeks in stem cell medium (Fig. 6A). These tumor cellscould be stained by a specific monoclonal antibody againsthuman nuclei, confirming their human origin (data not shown).Melanogenic, adipogenic, chondrogenic, and osteogenic differen-tiation of these spheroid cells were observed under appropriatedifferentiation conditions (data not shown). These results indicatethat a stem cell population exists in melanomas after in vivotransplantation. Therefore, a self-renewing stem cell population

Figure 3. Self-renewal and melanocyticdifferentiation of melanoma spheroid cells.A, morphology of WM3523 melanomaspheroid cells cultured in either hESC ormelanocyte differentiation medium. Singlecells 5 hours after seeding in hESCmedium (a) and after 4 days beginning todevelop spheres (b). Single cells 5 hoursafter having been cultured in melanocytedifferentiation medium begin attaching tosubstrate (c ) and after 4 days developtypical spindle-shaped morphology (d ).The cell pellet from undifferentiated cells islightly pigmented (e, left ) and that fromdifferentiated cultures is heavily pigmented(e, right). B, immunocytochemistry ofmelanocytic markers MITF and TYR inundifferentiated WM3523 melanomaspheroid cells (top, arrows ) anddifferentiated cells, four days after treatedwith melanocyte differentiation medium(bottom, arrows ). Representative oftriplicate experiments using threedependent clones (clones 4, 6, and 11).C, percentage of MITF- and TYR-expressing cells in WM3523 spheroidand adherent populations prior to(open columns ) and after (filled columns )melanocytic differentiation. Columns,mean from three independent experimentsin duplicate using WM3523 melanomaspheroid clones (clones 4, 6, and 11);bars, FSEM. D, RT-PCR and Western blotanalyses for MITF /MITF, DCT /DCT, andTYR /TYR expression in undifferentiatedand differentiated melanoma spheroidcells. We included 293 cells and epidermalmelanocytes as negative and positivecontrols, respectively. Representativeexperiment of three independentexperiments using three WM3523 spheroidclones (clones 4, 6, and 11).

Cancer Research




persists not only in long-term cultures but also in tumorstransplanted in vivo .To address whether multipotent melanoma spheroid cells

differed in tumorigenicity from adherent monolayer melanomacells, we implanted melanoma spheroid cells or adherentmonolayer cells into Cytoxan-treated SCID mice at 2 � 105 cellsper mouse, an amount that usually does not induce tumors. Afterf35 days, mice transplanted with spheroid cells had developedpigmented tumors, whereas tumors were not observed in miceinjected with adherent cells. When mice were sacrificed 70 daysafter injection, three animals in the spheroid group (n = 5) hadsmall to large tumors compared with only one small tumor in oneof the adherent groups (n = 5). Total tumor weight and volumefrom the spheroid group were significantly larger than the adherentgroup (Fig. 6B). This suggests that melanoma spheroid cellsisolated in hESC culture conditions are more tumorigenic.Multipotent stem cells are enriched in the CD20+ fraction of

melanoma spheres. We consistently observed CD20+ populationsin WM3523 and WM115 melanoma spheroid cells but not in thecorresponding adherent populations. Individual CD20+ tumor cellscould be detected by immunohistochemistry in f20% ofmetastatic melanoma lesions, supporting our in vitro observations

(data not shown). We did cell sorting to determine whether thestem cell population was within CD20+ fractions. Both positive andnegative fractions from WM3523 and WM115 proliferated exten-sively after sorting. Their phenotypes were confirmed by flowcytometry (data not shown). The CD20+ fractions of WM3523 cellsformed larger spheres compared with the CD20� fraction. InWM115 cells, only the CD20+ fraction proliferated as spheres,whereas the CD20� fraction remained as single cells (data notshown). These data suggest that the stem cell population mayreside within the CD20+ fraction.The CD20+ or CD20� fractions of WM3523 and WM115 were

then subjected to differentiation. Whereas WM115 CD20�

fraction remained in suspension, the other three populationsadhered to substrate, indicating their differentiation potentials(data not shown). Although similar percentages showed immu-noreactivity for MITF in both CD20+ and CD20� fractions fromboth spheroid cell lines after melanocytic differentiation, onlyCD20+ fractions showed substantial potential for mesenchymaldifferentiation (Fig. 6C-D). These data confirm that multipotentstem cells are enriched in the CD20+ fraction of melanomaspheroid cells isolated from fresh tumor lesions and establishedcell lines.

Figure 4. Mesenchymal differentiation of melanoma spheroidcells. A, single WM3523 melanoma spheroid cells were treated inmedia for adipogenic (left), chondrogenic (middle ), and osteogenic(right ) differentiation. We visualized lipid vacuole accumulation inmelanoma cells, including a few multinucleated cells (arrows ),differentiated in adipogenic medium by Oil Red O staining (red).Type II collagen (green, arrows ) and alkaline phosphatase(blue, arrow ) were detected in cells treated with chondrogenic andosteogenic medium, respectively. Undifferentiated cells werestained as controls (bottom ). Bars, 50 Am. B, differentiationefficiencies for melanoma spheroid and adherent cells. Individualbars indicate percent positive cells in each population. Columns,mean obtained from three clonal melanoma spheroid cell lines(clones 4, 6, and 11) and five different passages of adhesive cellsranging from 4 to 20; bars, FSEM. C, differentiation of melanomaspheroid cells was induced in adipogenic (1 and 3 ) and osteogenic(2 and 4) medium, respectively. After 10 days, cells wereimmunostained for melanocytic markers MITF or SOX10 (green ),and nuclear dye Hoechst 33258 (blue , adipogenesis only), thendouble stained with Oil Red O or alkaline phosphatase,respectively. MITF or SOX10 immunoreactive cells displayedmarkers for mesenchymal lineages (i.e., Oil Red O and alkalinephosphatase, arrows ), after differentiation. Bar, 50 Am.





Discussion

We report a subpopulation of melanoma cells with characteristicsof primitive progenitors for melanocytes, neural crest cells, that giverise to a broad range of cell types. When cultured in medium usedfor hESCs, melanoma cells proliferated as nonadherent spheres.When initially isolated from the lesion, the spheres contained bothmelanoma and hematopoietic cells. After cloning, a subpopulationof melanoma cells could be isolated that maintained stem cellcharacteristics; they were able to self-renew and differentiate intomelanogenic, adipogenic, chondrogenic, and osteogenic lineages.These melanoma spheroid cells were also found in establishedcell lines, suggesting that a subpopulation of melanoma cells inlong-term culture can maintain stem cell properties.Our studies reveal that melanoma lesions can contain a

subpopulation with stem cell properties and a fraction of moredifferentiated tumor cells. The adherent population establishedin vitro under standard conditions displays spindle to epithelioidmorphology. In general, these cells reflect the stage of tumorprogression from which they were initially derived, and those cells

from metastatic lesions are tumorigenic in mice (27). They arecharacterized for their expression of melanoma-associated anti-

gens such as MCAM or h3 integrin, which facilitate invasion andmetastasis (16, 17). The second population, described for the firsttime here, can differentiate and self-renew. This population is

characterized by its ability to form spheres. Sphere formation was

initially observed in cultured neural stem cells (38). Cells within

neural spheres have stem cell properties that manifest as self-renewal and multilineage differentiation potential (39). Recently,

sphere formation was found when stem cells from a variety of

normal and tumor tissues were isolated (3, 5, 40, 41), suggestingthat sphere formation may be a common growth characteristic of

stem cells.It is not surprising that melanoma spheroid cells are capable of

mesenchymal differentiation, because mesenchymal and melano-cytic cells may originate from the same embryonic tissue, theneural crest (35). Differentiation of human melanomas intomesenchymal lineages has also been described in fat andosteocartilaginous differentiation (20–24). Differentiating cells were

Figure 5. A subpopulation with stem cell propertiesderived from an established melanoma cell lineWM115. A, morphology of WM115 melanoma cell linefrom a primary lesion cultured in Mel 2% (a ). Spheresformed 1 week after cultured in hESC medium (b )and re-formed after single spheroid cells werere-seeded at a clonal density(c). WM115 spheroid cellswere exposed to medium for either adipogenic(d , Oil Red O), osteogenic (e, blue , alkalinephosphatase), or chondrogenic (f, green , type IIcollagen; blue , Hoechst 33258) differentiationconditions. Bars, 200 Am (a and b ), 100 Am (c ), 50 Am(d, e , and f ). B, quantification of mesenchymaldifferentiation of adherent and spheroid WM115 cells.C, flow cytometry analysis of WM115 spheroid andadherent monolayer cells. D, flow cytometry analysisof WM115 spheroid cells revealed a fraction of cellsexpressing both MCAM and CD20. E, cellscoexpressing MCAM/h3 integrin and CD20 wereidentified by fluorescence microscopy.

Cancer Research




often multinucleated, their cultures could not be maintained forextended periods of time, and their differentiation was irreversible.Furthermore, melanoma spheroid cells gave rise to cells thatexpressed both melanocytic and mesenchymal markers. These dataconfirmed that the mesenchymal progenitors are not derived fromcontaminating normal mesenchymal stem cells but rather are aproperty of the tumor itself.In sphere-forming melanoma cell lines, WM3517 and WM3539,

spheroid cells were able to undergo only melanogenic differenti-ation, suggesting they might arise from a cell at a later stage ofdifferentiation, such as a lineage-committed melanocyte precursorcell. Multipotent WM3523 melanoma spheroid cells had a stablecapacity for self-renewal over prolonged culture periods. Clones ofWM3523 spheroid cells showed differences in their stability ofdifferentiation potential. Over time in culture, some clones couldno longer differentiate into all four cell lineages but only intothree, two, or one suggesting the control mechanisms for eachdifferentiation lineage is unique.Neoplastic melanocytic cells frequently exhibit characteristics

of other neural crest derivatives both in vitro and in vivo .

Differentiation of melanoma cells into neural lineages has beenwell shown (12–14); however, in this study, melanoma spheroidcells failed to differentiate into neural lineages. The differentiationmedium contains bFGF, which has been used to induce neuraldifferentiation of hESCs and bone marrow–derived stem cells(36, 42, 43). In this case, the plasticity of melanoma spheroid cellswas limited.Multipotent melanoma spheroid cells isolated from fresh tumors

persist in culture for a long time (8 months) when passaged atclonal densities and as tumor xenografts. Similar multipotentmelanoma spheroid cells can also be isolated from established celllines. Importantly, multipotent melanoma spheroid cells can beserially recloned from a minimum of two cells during 8 months inculture. We have provided evidence that this subpopulation ofmelanoma cells is able to self-renew and meet other criteria ofstem cells. Moreover, melanoma spheroid cells have differentiationpotential similar to neural crest stem cells, supporting the notionthat melanomas may arise from a transformed melanocyte stemcell. Recent studies suggest that neural crest stem cells persist inthe skin in adult animals and are capable of differentiating into

Figure 6. Tumorigenic capacity of melanoma spheroidcells in vivo and CD20-positive fraction harboringstem cell populations. A, tumors developed in miceinjected with WM115 (top ) and WM3523 (bottom )melanoma spheroid cells, respectively. Tumorsshowed typical melanoma morphology (H&E).Fontana-Masson staining confirmed the presence ofvariable melanin pigment in tumors (melanin). Spheroidcultures were then derived from mouse tumors(cultured). B, tumorigenic capacity of WM3523spheroid (clone 4) and adherent cells were comparedas detailed in Materials and Methods. Total tumorweight and volume from each group (open columns ,spheroid; filled columns , adherent). Columns, means;bars, FSEM. C-D, CD20+ fractions in both WM115and WM3523 (clone 4) spheroid cells retainedpotentials for adipogenic, chondrogenic, andosteogenic differentiation, whereas their CD20�

fractions rarely differentiated into the above lineages.Differentiated cells (arrows ). In melanocyticdifferentiation, both nuclear (arrowheads ) and diffuse(arrows ) MITF-positive cells were observed.





neurons, smooth muscle cells, Schwann cells, adipocytes, andmelanocytes (41, 44, 45). Lineage-committed melanocyte stem cellshave also been reported in mouse hair follicles (46). In humans,equivalent stem cells have not yet been identified but potentiallyexist in adult skin to maintain homeostasis and to repair damageafter injury. These long-lived stem cells may accumulate mutationsand become a candidate for transformation. With its capacity forself-renewal, this subpopulation of transformed stem cells maysubsequently initiate and sustain malignancy.Increasing evidence supports this scenario. A link between

epithelial cancer and bone marrow–derived cells (most likelymesenchymal stem cells) has been shown in a mouse model ofgastric cancer. Stem cells were recruited into gastric glands,differentiated into gastric epithelial cells, and developed intointraepithelial cancer (47). Moreover, mesenchymal stem cellstransduced with the telomerase hTERT gene display neoplasticpotential and contributes to mesenchymal tumor formation (48).These results show that stem cells can be transformed underappropriate conditions and give rise to malignancy. Alternatively,a transformed, differentiated melanocyte may have undergone adedifferentiation process and regained stem cell properties such asself-renewal (1). Within neural crest derivatives, dedifferentiation ofone lineage into a precursor pool that then gives rise to otherlineages has been well shown (49, 50). In addition, results fromchronic myelogenous leukemia indicate that a lineage-restrictedprogenitor or mature cell can acquire stem cell privileges afteroncogenic transformation (51, 52).The loss of E-cadherin seems important for epithelial-

mesenchymal transitions, which facilitate morphogenesis duringdevelopment and tumor progression (melanomas; refs. 53, 54). Inthis study, the sustained expression of E-cadherin was observed inboth WM3523 melanoma spheroid cells (89.60%) and its adherentmelanoma counterparts (99.6%; data not shown). Only a minorfraction of both spheroid and adherent populations of WM115

express E-cadherin. These results suggest that E-cadherin expres-sion is not critical for stem cell properties of melanoma spheroidcells.We have discovered, however, that a small subpopulation of

CD20+ melanoma cells harbors multipotent stem cells, as in thecase of WM115 melanoma spheroid cells. WM3523 melanomaspheroid cells could maintain sphere-forming capacity even amongthe CD20� population; however, these negative cells had limitedcapacity to undergo mesenchymal differentiation. Most interest-ingly, CD20 has been identified by gene expression profiling as oneof the top 22 genes that define aggressive melanomas (55). Inmetastatic melanomas, we have identified individual CD20+ tumorcells (data not shown). Monoclonal antibodies against CD20 havebecome a standard treatment for non-Hodgkin’s lymphoma (56).CD20 seems a potential target for melanoma as well, although acorrelation between differentiation ability and tumorigenicity isstill under investigation by comparing CD20+ with CD20� fractions.In summary, our studies clearly show the presence of a stem cell

population in melanomas. Like all stem cells, melanoma spheroidcells are also capable of proliferation, differentiation, and self-renewal. In addition, melanoma spheroid cells possess highertumorigenicity. Understanding the highly tumorigenic, stem cellorigin of melanomas has important implications for efficienttherapy.

Acknowledgments

Received 4/19/2005; revised 7/13/2005; accepted 8/2/2005.Grant support: NIH grants CA25874, CA80999, CA10815, and CA76674 and

Commonwealth Universal Research Enhancement Program, Pennsylvania Departmentof Health.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank James Hayden for support with photography pigmentation of cell pellets,Gian Ascione for editorial assistance, and the staff at the Flow Cytometry Facility fortheir analyses.

References1. Reya T, Morrison SJ, Clarke MF, Weissman IL. Stemcells, cancer, and cancer stem cells. Nature 2001;414:105–11.

2. Bonnet D, Dick JE. Human acute myeloid leukemia isorganized as a hierarchy that originates from a primitivehematopoietic cell. Nat Med 1997;3:730–7.

3. Singh SK, Clarke ID, Terasaki M, et al. Identification ofa cancer stem cell in human brain tumors. Cancer Res2003;63:5821–8.

4. Al-Hajj M, Wicha MS, Benito-Hernandez A, MorrisonSJ, Clarke MF. Prospective identification of tumorigenicbreast cancer cells. Proc Natl Acad Sci U S A 2003;100:3983–8.

5. Singh SK, Hawkins C, Clarke ID, et al. Identification ofhuman brain tumour initiating cells. Nature 2004;432:396–401.

6. Kondo T, Setoguchi T, Taga T. Persistence of a smallsubpopulation of cancer stem-like cells in the C6 gliomacell line. Proc Natl Acad Sci U S A 2004;101:781–6.

7. Setoguchi T, Taga T, Kondo T. Cancer stem cellspersist in many cancer cell lines. Cell Cycle 2004;3:414–5.

8. Galli R, Binda E, Orfanelli U, et al. Isolation andcharacterization of tumorigenic, stem-like neural pre-cursors from human glioblastoma. Cancer Res 2004;64:7011–21.

9. Yuan X, Curtin J, Xiong Y, et al. Isolation of cancerstem cells from adult glioblastoma multiforme. Onco-gene 2004;23:9392–400.

10. Kath R, Jambrosic JA, Holland L, Rodeck U, Herlyn M.Development of invasive and growth factor-independent

cell variants from primary human melanomas. CancerRes 1991;51:2205–11.

11. Hendrix M, Seftor EA, Meltzer PS, et al. The stem cellplasticity of aggressive melanoma tumor cells. In: S Sell.Stem cells handbook. Totowa (NJ): Humana Press, Inc.;2003. p. 297–306.

12. Reed JA, Finnerty B, Albino AP. Divergent cellulardifferentiation pathways during the invasive stage ofcutaneous malignant melanoma progression. Am JPathol 1999;155:549–55.

13. Fang D, Hallman J, Sangha N, et al. Expression ofmicrotubule-associated protein 2 in benign and malig-nant melanocytes: implications for differentiation andprogression of cutaneous melanoma. Am J Pathol 2001;158:2107–15.

14. Brocker EB, Magiera H, Herlyn M. Nerve growth andexpression of receptors for nerve growth factor intumors of melanocyte origin. J Invest Dermatol 1991;96:662–5.

15. Hendrix MJ, Seftor EA, Hess AR, Seftor RE. Vasculo-genic mimicry and tumour-cell plasticity: lessons frommelanoma. Nat Rev Cancer 2003;3:411–21.

16. Hsu MY, Shih DT, Meier FE, et al. Adenoviral genetransfer of h3 integrin subunit induces conversion fromradial to vertical growth phase in primary humanmelanoma. Am J Pathol 1998;153:1435–42.

17. Satyamoorthy K, Muyrers J, Meier F, Patel D, HerlynM.Mel-CAM-specific genetic suppressor elements inhibitmelanoma growth and invasion through loss of gapjunctional communication. Oncogene 2001;20:4676–84.

18. Klein CE, Steinmayer T, Kaufmann D, Weber L,Brocker EB. Identification of a melanoma progression

antigen as integrin VLA-2. J Invest Dermatol 1991;96:281–4.

19. HuberMA, Kraut N, Park JE, et al. Fibroblast activationprotein: differential expression and serine proteaseactivity in reactive stromal fibroblasts of melanocyticskin tumors. J Invest Dermatol 2003;120:182–8.

20. Banerjee SS, Coyne JD, Menasce LP, Lobo CJ, HirschPJ. Diagnostic lessons of mucosal melanoma withosteocartilaginous differentiation. Histopathology 1998;33:255–60.

21. Cruz J, Reis-Filho JS, Lopes JM. Primary cutaneousmalignant melanoma with lipoblast-like cells. ArchPathol Lab Med 2003;127:370–1.

22. Giele H, Hollowood K, Gibbons CL, Wilson DJ,Athanasou NA. Subungual melanoma with osteocartila-ginous differentiation. Skeletal Radiol 2003;32:724–7.

23. Hoorweg JJ, Loftus BM, Hilgers FJ. Osteoid and boneformation in a nasal mucosal melanoma and itsmetastasis. Histopathology 1997;31:465–8.

24. Grunwald MH, Rothem A. Desmoplastic cartilagi-nous formation in malignant melanoma. J Cutan Pathol1987;14:255.

25. Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al.Embryonic stem cell lines derived from human blasto-cysts. Science 1998;282:1145–7.

26. Xu C, Inokuma MS, Denham J, et al. Feeder-freegrowth of undifferentiated human embryonic stem cells.Nat Biotechnol 2001;19:971–4.

27. Hsu MY, Elder DE, Herlyn M. Melanoma: the Wistar(WM) melanoma cell lines. In: Masters JRW, Palsson B,editors. Human cell culture. London: Kluwer AcademicPublisher; 1999. p. 259–74.

Cancer Research




28. Somasundaram R, Swoboda R, Caputo L, et al. ACD4+, HLA-DR7-restricted T-helper lymphocyte clonerecognizes an antigen shared by human malignantmelanoma and glioma. Int J Cancer 2003;104:362–8.

29. Groszer M, Erickson R, Scripture-Adams DD, et al.Negative regulation of neural stem/progenitor cellproliferation by the Pten tumor suppressor genein vivo . Science 2001;294:2186–9.

30. Satyamoorthy K, DeJesus E, Linnenbach AJ, et al.Melanoma cell lines from different stages of progressionand their biological and molecular analyses. MelanomaRes 1997;7 Suppl 2:S35–42.

31. Hsu MY, Li L, Herlyn M. Cultivation of normal humanepidermal melanocytes in the absence of phorbol esters.Methods Mol Med 2004;107:13–28.

32. Pittenger MF, Mackay AM, Beck SC, et al. Multi-lineage potential of adult human mesenchymal stemcells. Science 1999;284:143–7.

33. Fang D, Setaluri V. Role of microphthalmia tran-scription factor in regulation of melanocyte differenti-ation marker TRP-1. Biochem Biophys Res Commun1999;256:657–63.

34. Fang D, Kute T, Setaluri V. Regulation of tyrosinase-related protein-2 (TYRP2) in human melanocytes:relationship to growth and morphology. Pigment CellRes 2001;14:132–9.

35. Le Douarin NM, Kalcheim C. The neural crest. In: LeDouarin NM, Kalcheim C, editors. Cambridge (UK):Cambridge University Press; 1999.

36. Jiang Y, Jahagirdar BN, Reinhardt RL, et al. Pluri-potency of mesenchymal stem cells derived from adultmarrow. Nature 2002;418:41–9.

37. Herlyn M, Balaban G, Bennicelli J, et al. Primarymelanoma cells of the vertical growth phase: similar-

ities to metastatic cells. J Natl Cancer Inst 1985;74:283–9.

38. Weiss S, Reynolds BA, Vescovi AL, Morshead C, CraigCG, van der Kooy D. Is there a neural stem cell in themammalian forebrain? Trends Neurosci 1996;19:387–93.

39. Reynolds BA, Weiss S. Clonal and population analysesdemonstrate that an EGF-responsive mammalian embry-onic CNS precursor is a stem cell. Dev Biol 1996;175:1–13.

40. Dontu G, Abdallah WM, Foley JM, et al. In vitropropagation and transcriptional profiling of humanmammary stem/progenitor cells. Genes Dev 2003;17:1253–70.

41. Toma JG, Akhavan M, Fernandes KJ, et al. Isolation ofmultipotent adult stem cells from the dermis ofmammalian skin. Nat Cell Biol 2001;3:778–84.

42. Zhang SC, Wernig M, Duncan ID, Brustle O,Thomson JA. In vitro differentiation of transplantableneural precursors from human embryonic stem cells.Nat Biotechnol 2001;19:1129–33.

43. Reubinoff BE, Itsykson P, Turetsky T, et al. Neuralprogenitors from human embryonic stem cells. NatBiotechnol 2001;19:1134–40.

44. Sieber-Blum M, Grim M, Hu YF, Szeder V. Pluripotentneural crest stem cells in the adult hair follicle. Dev Dyn2004;231:258–69.

45. Fernandes KJ, McKenzie IA, Mill P, et al. A dermalniche for multipotent adult skin-derived precursor cells.Nat Cell Biol 2004;6:1082–93.

46. Nishimura EK, Jordan SA, Oshima H, et al. Dominantrole of the niche in melanocyte stem-cell fate determi-nation. Nature 2002;416:854–60.

47. Houghton J, Stoicov C, Nomura S, et al. Gastriccancer originating from bone marrow-derived cells.Science 2004;306:1568–71.

48. Serakinci N, Guldberg P, Burns JS, et al. Adult humanmesenchymal stem cell as a target for neoplastictransformation. Oncogene 2004;23:5095–8.

49. Dupin E, Glavieux C, Vaigot P, Le Douarin NM.Endothelin 3 induces the reversion of melanocytes toglia through a neural crest-derived glial-melanocyticprogenitor. Proc Natl Acad Sci U S A 2000;97:7882–7.

50. Dupin E, Real C, Glavieux-Pardanaud C, Vaigot P,Le Douarin NM. Reversal of developmental restrictionsin neural crest lineages: transition from Schwann cellsto glial-melanocytic precursors in vitro . Proc Natl AcadSci U S A 2003;100:5229–33.

51. Jamieson CH, Ailles LE, Dylla SJ, et al. Granulo-cyte-macrophage progenitors as candidate leukemicstem cells in blast-crisis CML. N Engl J Med 2004;351:657–67.

52. Manz MG, Miyamoto T, Akashi K, Weissman IL.Prospective isolation of human clonogenic commonmyeloid progenitors. Proc Natl Acad Sci U S A 2002;99:11872–7.

53. Thiery JP. Epithelial-mesenchymal transitions indevelopment and pathologies. Curr Opin Cell Biol2003;15:740–6.

54. Hsu MY, Wheelock MJ, Johnson KR, Herlyn M. Shiftsin cadherin profiles between human normal melano-cytes and melanomas. J Investig Dermatol Symp Proc1996;1:188–94.

55. Bittner M, Meltzer P, Chen Y, et al. Molecularclassification of cutaneous malignant melanoma bygene expression profiling. Nature 2000;406:536–40.

56. Coiffier B, Lepage E, Briere J, et al. CHOP chemo-therapy plus rituximab compared with CHOP alone inelderly patients with diffuse large-B-cell lymphoma.N Engl J Med 2002;346:235–42.





2005;65:9328-9337. Cancer Res Dong Fang, Thiennga K. Nguyen, Kim Leishear, et al. MelanomasA Tumorigenic Subpopulation with Stem Cell Properties in

Updated version

http://cancerres.aacrjournals.org/content/65/20/9328

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/65/20/9328.full#ref-list-1

This article cites 51 articles, 13 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/65/20/9328.full#related-urls

This article has been cited by 53 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/65/20/9328To request permission to re-use all or part of this article, use this link

http://cancerres.aacrjournals.org/content/65/20/9328http://cancerres.aacrjournals.org/content/65/20/9328.full#ref-list-1http://cancerres.aacrjournals.org/content/65/20/9328.full#related-urlshttp://cancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://cancerres.aacrjournals.org/content/65/20/9328http://cancerres.aacrjournals.org/

A Tumorigenic Subpopulation with Stem Cell Properties in ......A Tumorigenic Subpopulation with Stem...

Documents

Transcript of A Tumorigenic Subpopulation with Stem Cell Properties in ......A Tumorigenic Subpopulation with Stem...