A step-by-step guide to ChIP-seq data...
Transcript of A step-by-step guide to ChIP-seq data...
![Page 1: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/1.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc. Discover more at www.abcam.com
A step-by-step guide to ChIP-seq data analysisDecember 03, 2014
Xi Chen, Ph.D.
EMBL-European Bioinformatics Institute
Wellcome Trust Sanger Institute
![Page 2: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/2.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Target audience
• Wet-lab biologists with no experience of programming and Unix/Linux environment
• ChIP-seq beginners
Alignments Genes and GO terms
Raw sequencing reads
(fastq files)
NTCACCTGCCTGAACTTTGAACCACTCCCAAACACA
ACTTTTTCATGCTTATTATATCTGTTATGGTGATCT
CTCCTTTTCTCTCCCTGTAATATGCCAAGGACTGTG
GGTAGCAGGTGATTTACTTTAGCTAAACACTAATAA
.
.
.
Peaks Motifs
![Page 3: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/3.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Webinar topics
QC of sequencing reads (FastQC)
Read alignment/mapping (Galaxy/bowtie)
Peak calling (Galaxy/macs)
Binding signal visualization (UCSC genome browser)
De novo motif discovery (MEME-ChIP)
Gene ontology of binding sites (GREAT)
Heatmap representation of binding signals (seqMINER)
![Page 4: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/4.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
FOXA1 ChIP-seq data sets
A successful experiment
α-FOXA1, ab5089 & ab23738, MCF7 cells
A failed experiment
α-FOXA1, other vendor, LoVo cells
![Page 5: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/5.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
QC of sequencing reads
http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
![Page 6: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/6.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
QC of sequencing reads
![Page 7: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/7.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
QC of sequencing reads
![Page 8: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/8.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
QC of sequencing reads
FOXA1, MCF7 cells FOXA1, LoVo cells
![Page 9: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/9.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
QC of sequencing reads
FOXA1, MCF7 cells FOXA1, LoVo cells
![Page 10: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/10.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
QC of sequencing reads
FOXA1, MCF7 cells FOXA1, LoVo cells
![Page 11: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/11.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Data upload (Galaxy)
![Page 12: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/12.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Data upload (Galaxy)
Local computer Galaxy FTP
![Page 13: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/13.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Data upload (Galaxy)
Local computer Galaxy FTP
![Page 14: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/14.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Data upload (Galaxy)
![Page 15: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/15.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Data upload (Galaxy)
fastqcssanger (SOLiD)
fastqillumina
fastqsanger
fastqsolexa
![Page 16: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/16.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
FastQ format
Format Illumina pipelines Quality encoding Score range ASCII range
Fastqsanger Starting Illumina 1.8 Phred + 33 0 to 93 33 - 126
Fastqillumina Starting Illumina 1.3
Before Illumina 1.8
Phred + 64 0 to 62 64 - 126
Fastqsolexa Solexa/early Illumina Solexa + 64 -5 to 62 59 - 126
• Cock PJ, Fields CJ, Goto N, Heuer ML, Rice PM. (2010) The Sanger FASTQ file format for
sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res.
38:1767-71
• http://en.wikipedia.org/wiki/FASTQ_format
![Page 17: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/17.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Data upload (Galaxy)
![Page 18: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/18.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Data upload (Galaxy)
![Page 19: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/19.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
View FastQ files
![Page 20: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/20.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
View FastQ files
@FOXA1_MCF7.sra.178 HWI-EAS202_0334:3:1:1102:18899 length=36
AGGATGGCAGGCATGCTAGAAACAGGTCTGGGGGTT
+FOXA1_MCF7.sra.178 HWI-EAS202_0334:3:1:1102:18899 length=36
B@A@BB:B@ABDBBB(7987BB<AA###########
Position 1 2
Base A G
Quality
string
B @
ASCII 66 64
Phred 66-33=33 64-33=31
Error
Prob.
0.0005 0.0008
![Page 21: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/21.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
FastQ Groomer
![Page 22: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/22.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
FastQ Groomer
![Page 23: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/23.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Read alignment (bowtie mapping)
![Page 24: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/24.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
View sam files
http://samtools.github.io/hts-specs/SAMv1.pdf
![Page 25: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/25.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Filter sam files
![Page 26: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/26.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Peak calling (MACS)
![Page 27: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/27.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Peak calling (MACS)
![Page 28: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/28.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Peak calling sanity check
![Page 29: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/29.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Peak calling sanity check
![Page 30: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/30.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Peak calling sanity check
Whether my ChIP-seq experiments work or not?
• Looking at interval files
• Visual inspection of binding signal
• Looking at motif discovery results
![Page 31: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/31.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Peak calling sanity check
FOXA1, MCF7 cells FOXA1, LoVo cells
# of peaks with < 1% FDR: 42,041 # of peaks with < 1% FDR: 430
Sorting the interval file:
First by FDR (smallest to
largest), then by
fold_enrichment (largest to
smallest)
Smallest to largest Smallest to largest
Fold enrichment range: 3.8 ~ 332.35 Fold enrichment range: 3.05 ~ 20.37
Tags range: 14 ~ 4932 Tags range: 15 ~ 224
![Page 32: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/32.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Peak calling sanity check
FOXA1, MCF7 cells FOXA1, LoVo cells
# of peaks with < 1% FDR: 42,041 # of peaks with < 1% FDR: 430
Sorting the interval file:
First by FDR (smallest to
largest), then by
fold_enrichment (largest to
smallest)
Largest to smallest Largest to smallest
Fold enrichment range: 3.8 ~ 332.35 Fold enrichment range: 3.05 ~ 20.37
Tags range: 14 ~ 4932 Tags range: 15 ~ 224
![Page 33: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/33.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Signal visualization (UCSC)
![Page 34: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/34.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Signal visualization (UCSC)
What to look?
• Peak shape
• Known target genes
• Chromosome-wide view
• Set “Display mode” to “full”
• Set “Vertical viewing range” to “min: 0, max: 200”
• Set “Data viewing scaling” to “use vertical viewing range setting”
![Page 35: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/35.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Signal visualization (UCSC)
FOXA1
MCF7
MCF7
Input
FOXA1
LoVo
IgG
LoVo
![Page 36: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/36.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
De novo motif finding (MEME-ChIP)
FOXA1_summit_100bp.txt
= Column A= Column B + Column E - 50
= Column B + Column E + 50Name
Create coordinates of peak summit ± 50 bp
![Page 37: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/37.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
De novo motif finding (MEME-ChIP)
FOXA1_summit_100bp.fasta
![Page 38: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/38.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
De novo motif finding (MEME-ChIP)
http://meme.nbcr.net/meme/cgi-bin/meme-chip.cgi
![Page 39: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/39.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
De novo motif finding (MEME-ChIP)
![Page 40: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/40.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
De novo motif finding (MEME-ChIP)
![Page 41: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/41.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Gene ontology (GREAT)
http://bejerano.stanford.edu/great/public/html/
FOXA1_summit_100bp.txt
![Page 42: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/42.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Gene ontology (GREAT)
![Page 43: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/43.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Heatmap representation (seqMINER)
http://sourceforge.net/projects/seqminer/
![Page 44: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/44.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Heatmap representation (seqMINER)
http://sourceforge.net/projects/seqminer/
![Page 45: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/45.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Heatmap representation (seqMINER)
http://sourceforge.net/projects/seqminer/
![Page 46: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/46.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Heatmap representation (seqMINER)
Peak file, e.g. FOXA1_summit_100bp.txt
Alignment files
![Page 47: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/47.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Heatmap representation (seqMINER)
![Page 48: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/48.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Heatmap representation (seqMINER)
![Page 49: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/49.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Conclusions & Questions
ChIP-seq
pipeline
• Bardet AF, He Q, Zeitlinger J, Stark A. (2011) A computational pipeline for
comparative ChIP-seq analyses. Nat Protoc. 7:45-61.
Peak
calling
• Feng J, Liu T, Qin B, Zhang Y, Liu XS. (2012) Identifying ChIP-seq enrichment using
MACS. Nat Protoc. 7:1728-40.
Motif
discovery
• Ma W, Noble WS, Bailey TL. (2014) Motif-based analysis of large nucleotide data
sets using MEME-ChIP. Nat Protoc. 9:1428-50.
• Thomas-Chollier M, Darbo E, Herrmann C, Defrance M, Thieffry D, van Helden J. (2012)
A complete workflow for the analysis of full-size ChIP-seq (and similar) data sets
using peak-motifs. Nat Protoc. 7:1551-68.
Gene
ontology
• McLean CY, Bristor D, Hiller M, Clarke SL, Schaar BT, Lowe CB, Wenger AM, Bejerano
G. (2010) GREAT improves functional interpretation of cis-regulatory regions. Nat
Biotechnol. 28:495-501.
• Huang da W, Sherman BT, Lempicki RA. (2009) Systematic and integrative analysis
of large gene lists using DAVID bioinformatics resources. Nat Protoc. 4:44-57.
HOMER
suite• http://homer.salk.edu/homer/
![Page 50: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/50.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc. Discover more at www.abcam.com
Products for your research
![Page 51: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/51.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Abcam Events – 10 Year Anniversary Giveaway
Four all-inclusive conference registrations up for grabs!
It’s our birthday!
Enter our giveaway to win all-inclusive registration to either:
Chromatin: Structure & Function 2015
November 16-19, 2015 - Grand Caymans
Organizer: Tony Kourzarides
Confirmed speakers include:
Shelley Berger, Laurie Boyer, Anne Brunet, Luciano Di Croce, Robert Kingston,
Rob Martienssen, Danny Reinberg, Ramin Shiekhattar, Ali Shilatifard, Ken Zaret
or
Maintenance of Genome Stability 2016
March 7-10, 2016 - Panama
Organizer: Steve Jackson
Enter giveaway @ www.abcam.com/10YearGiveawayCompetition closing date: December 12, 2014
![Page 52: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/52.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
High-sensitivity ChIP kit (ab185913)
Simple to
use Reaction takes place in the wells of the 96-wp:
easy for standardization and high-throughput
Quick Only 5 hours to perform ChIP (compared to 2
days using conventional method)
Inclusive Kit contains all necessary reagents for ChIP
reaction (excluding cross-linking step)
CompatibleEluted DNA can be processed straight away for
DNA sequencing, microarrays or qPCR
Low input Start from as low as 2,000 cells
ChIP-qPCR analysis of RNApolII
enrichment in GAPDH promoters in
MBD-231 cells chromatin using High-
sensitivity ChIP Kit (ab185913).
![Page 53: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/53.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
High-sensitivity solutions for ChIP/ChIPseq
Library
prep
High Sensitivity DNA Library
Preparation Kit (for Illumina)
(ab185905)
ChIP +
Library
prep
ChIP-Seq High Sensitivity Kit
(ab185908)
ChIP High Sensitivity ChIP Kit
(ab185913)
Library obtained from 0.2 ng of human placenta DNA using
High Sensitivity DNA Library Preparation Kit (ab185905).
![Page 54: A step-by-step guide to ChIP-seq data analysisdocs.abcam.com/pdf/webinars/a-step-by-step-guide... · A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D.](https://reader035.fdocuments.us/reader035/viewer/2022062602/5edc5698ad6a402d6666f62f/html5/thumbnails/54.jpg)
Discover more at www.abcam.com Copyright © 2014 Abcam plc.
Bisulfite Sequencing
• Post-Bisulfite DNA Library Preparation Kit (For Illumina®)
(ab185906)
• High-sensitivity (1 µg)
• Post-bisulfite
• Compatible with WGBS, oxBS-seq, RRBS
• Quick (5 hrs from bisulfite DNA to library)
• Bisulfite-Seq High Sensitivity Kit (For Illumina®)
(ab185907)
• High-sensitivity (< 0.5 µg)
• Bisulfite conversion
• Compatible with WGBS, oxBS-seq, RRBS
• Quick (6 hrs from DNA to library)Size distribution of library fragments. Post-
bisulfite DNA library was prepared from 10
ng of input DNA using ab185907.
Size distribution of library fragments.
Post-bisulfite DNA library was prepared
from 10 ng of input DNA using ab185906.