doi:10.1016/j.jmb.2011.03.039 J. Mol. Biol. (2011) 410, 984–996

Contents lists available at www.sciencedirect.com

Journal of Molecular Biologyj ourna l homepage: ht tp : / /ees .e lsev ie r.com. jmb

A Small-Molecule Probe Induces a Conformation in HIVTAR RNA Capable of Binding Drug-Like Fragments

Amy Davidson1, Darren W. Begley1,2,Carmen Lau1 and Gabriele Varani1,3⁎1Department of Chemistry, University of Washington, Box 351700, Seattle, WA 98195, USA2Emerald BioStructures, 7869 Northeast Day Road West, Bainbridge Island, WA 98110, USA3Department of Biochemistry, University of Washington, Box 357350, Seattle, WA 98195, USA

Received 27 January 2011;received in revised form15 March 2011;accepted 17 March 2011

Edited by M. F. Summers

Keywords:HIV;TAR;Tat;RNA;fragment-based ligand design

*Corresponding author. E-mail addvarani@chem.washington.edu.Abbreviations used: TAR, transac

ILOE, interligand nuclear OverhauseOverhauser effect; STD, saturation tNOESY, NOE spectroscopy; RDC, rcoupling; IPAP, in-phase–antiphase

0022-2836/$ - see front matter © 2011 E

The HIV-1 transactivation response (TAR) element–Tat interaction is apotentially valuable target for treating HIV infection, but efforts to developTAR-binding antiviral drugs have not yet yielded a successful candidatefor clinical development. In this work, we describe a novel approachtoward screening fragments against RNA that uses a chemical probe totarget the Tat-binding region of TAR. This probe fulfills two critical roles inthe screen: by locking the RNA into a conformation capable of bindingother fragments, it simultaneously allows the identification of proximalbinding fragments by ligand-based NMR. Using this approach, we havediscovered six novel TAR-binding fragments, three of which were dockedrelative to the probe–RNA structure using experimental NMR restraints.The consistent orientations of functional groups in our data-driven dockedstructures and common electrostatic properties across all fragment leadsreveal a surprising level of selectivity by our fragment-sized screeninghits. These models further suggest linking strategies for the developmentof higher-affinity lead compounds for the inhibition of the TAR–Tatinteraction.

© 2011 Elsevier Ltd. All rights reserved.

Introduction

The development of highly active antiretroviraltherapies over the last two decades has led toremarkable progress in HIV treatment, but drug-resistant strains remain an obstacle to controllingviral infections. Novel therapeutics are thereforeneeded to target vulnerable steps in the viral

ress:

tivation response;r effect; NOE, nuclearransfer difference;esidual dipolar.

lsevier Ltd. All rights reserve

replication cycle that are less prone to mutagenesis.One such target is the activation of RNA transcrip-tion through binding of the viral protein Tat to thetransactivation response (TAR) element. The HIV-1TAR element is a stem–loop located at the 5′ end ofnascent viral transcripts, which has been recognizedas a potentially valuable drug target for sometime.1–3 The cooperative binding of Tat and hostcell cofactor cyclin T1 to TAR recruits the kinaseCDK9 to hyperphosphorylate RNA polymerase II,leading to enhanced transcriptional processivity.Without transactivation, the polymerase producesprimarily short transcripts, and viral replication isdisrupted.4,5 Extensive structural studies of TARRNA have paved the way for the design ofmolecules to compete with the Tat protein inbinding to the TAR element, thus inhibiting viralreplication.3,6–19 However, to date, none of these

d.

985Drug-Like Fragments Binding HIV-1 TAR

efforts have yielded leads with the potency andspecificity required for successful clinical candida-cy. Thus, new approaches may be necessary for thedevelopment of effective small-molecule inhibitorsof this critical interaction.Fragment-based lead discovery could be a valu-

able avenue to discovering new leads, since thistechnique is quickly becoming an establishedstrategy for the discovery and subsequent develop-ment of novel drug leads for protein targets.20–23

However, to date, few studies have reportedsuccess in utilizing RNA as target of fragmentscreens, with one important exception.24–26 Com-pared with proteins, the flexibility, ionic character,and reduced chemical diversity all make targetingRNA with weakly binding fragments particularlychallenging. Previous studies have shown that RNAcan be screened by nuclear magnetic resonance(NMR) spectroscopy with fragment libraries.9,27–29

However, the majority of hits were charged mole-cules unlikely to possess binding site specificity. Onepossible solution lies in designing more focusedlibraries. Since most screening collections have beendeveloped for protein targets, it has been suggestedthat design of an RNA-specific fragment librarycould improve hit rates.28,30 However, it remains tobedemonstratedwhether such a librarywill generatehits with sufficient specificity for development.Unfortunately, aminoglycosides, intercalatingagents, and other known RNA-binding entitiesfrom which such libraries could be developedpossess low intrinsic target specificity, a difficultproperty to reverse.In pursuit of novel lead molecules that bind to

HIV-1 TAR, we have undertaken fragment-basedscreening by NMR. However, to overcome thelimitations described above, we used a target-specific chemical probe to enhance the likelihoodof finding new lead molecules. In this approach, asmall-molecule ligand known to bind the target isused to identify novel, weakly binding fragmentsby detection of interligand nuclear Overhausereffect (ILOE).31 We selected a chemical probeconsisting of an arginine derivative that mimicsthe crucial arginine residue in Tat recognition ofTAR. We hypothesized that such a probe wouldbind the RNA at a specific site, and, once bound, itspresence would allow detection of ILOE signals toidentify proximal fragments. We were surprised toobserve that the small-molecule probe fulfills anadditional role by locking TAR into a conformationconducive to fragment recognition.32 By detectingnuclear Overhauser effects (NOEs) to the probe, wewere able to identify a set of novel, noncharged,drug-like small-molecule fragments that bind toHIV-1 TAR RNA only when the probe is present.The structure of the TAR–probe complex was thendetermined with standard solution-state NMRmethods and used to generate ILOE-driven binding

mode predictions for the most promising fragmenthits. We have thus identified a set of fragmentmolecules that serve as starting points for leaddevelopment through rational, structure-basedelaboration.

Results

Probe selection

To obtain a suitable probe molecule for screeningHIV-1 TAR RNA with a fragment library, weselected a small panel of arginine derivatives fromcommercial sources. Sixteen compounds wereexamined for adequate solubility and for bindingto TAR by one-dimensional (1D) saturation transferdifference (STD) NMR and 2D proton–proton NOENMR spectroscopy33,34 (Table 1). The strength ofSTD signal attenuation and the presence ofnegative NOEs (positive proton–proton NOEcross-peaks) for these compounds in solution withsubstoichiometric concentrations of TAR RNAwere used as criteria for probe selection. Com-pounds were eliminated due to poor solubility,weak STD signals (associated with weak binding),or proton resonances occurring at the saturationfrequency used to irradiate the target for STD-NMR (see Experimental Methods). Based on strongSTD signal attenuation and positive NOE cross-peaks observed in the presence of TAR (Fig. 1), thearginine derivative ultimately selected for fragmentscreening was MV2003 (Table 1). This moleculecombines an arginine group to bind the recognitionpocket of TAR with a proton-rich methoxy-naphthalene group ideal for detection of ILOEswith screening compounds.

Fragment screening

The fragment library used for screening consistedof 250 molecules from a Maybridge “Rule of 3”collection sorted into mixtures of five to eightligands dissolved in deuterated dimethyl sulfoxide(see Experimental Methods). Despite previous re-ports of poor success with STD-NMR for screeningRNA targets,27,28 we obtained clear binding signa-tures from this small diversity set when the screenwas executed in the presence of MV2003. Using acutoff of 10% STD peak difference as our initialcriteria, we observed more than 100 of thesefragments to bind to the RNA, with clear nonbind-ing fragments generating b3% STD peak intensity.Fragments that generated ≥10% STD and observ-able ILOEs to MV2003 were classified as putativehits, and then sorted into different groups on thebasis of scaffold similarity, each rank-ordered bySTD signal attenuation. A total of 20 fragments with

Table 1. Commercially available small arginine mimicstested for binding to HIV TAR RNA by ligand-observeNMR spectroscopy

ID Chemical

Name MW

( × 103) Structure

STD with TAR

NOE with TAR

MV 2001

L-Arginine methyl ester 261.2

W W

MV 2002

L-Arginine ethyl ester 275.2

W W

MV 2003

Arginine 4-methoxy- -

napthylamide 365.9

S S

MV 2004

PTH-arginine 327.8

W N

MV 2005

N,N-Dimethyl butylamine

101.2

N N

MV 2008

-carbo benzyloxy -L-arginine

308.2

N N

MV 2009

-Benzoyl -L-arginine

278.3

NS NS

MV 2010

[1-(3-Amino propyl)

piperidin-3-yl]methanol

172

W N

MV 2013

Benzoyl arginine-2 -naphthyl

amide

439.9

NS NS

MV 2014

Arginine-7 -amido-4 -methyl

coumarine

331.37

NS NS

MV 2015

Arginine -naphthyl amide

335.83

S S

MV 2016

-Dansyl -arginine

443.95

W N

MV 2017

Guanfacine 282.55

N N

MV 2018

Clonidine 266.55

N N

MV 2019

H-Gly-Arg-4MbNA 459.38

S S

MV 2020

H-Arg-pNA 367.24

M M

α

αN

N

S, strong binding; M, moderate binding; W, weak binding; N, nobinding; NS, not soluble.

986 Drug-Like Fragments Binding HIV-1 TAR

the most intense STD signals were selected from 13different scaffold groups for individual follow-upexperiments to confirm and characterize theirmodes of binding (Table 2).The 20 candidate fragments were analyzed by

ligand-observe NOE spectroscopy (NOESY) alone,with TAR, with MV2003, and with both MV2003and TAR in solution. Of these 20 candidatefragments, 6 were validated as hits. These generatednegative NOE cross-peaks and little to no STD-NMRbinding signals when studied alone, pairwise withMV2003, or pairwise with TAR RNA; these resultsare indicative of nonbinding. However, whenMV2003 and TAR RNA were both added to thesolution, each of these 6 individual fragmentsgenerated positive NOE cross-peaks and gaveclear, unambiguous STD peak differences. Asshown for fragment hit MV1480, these bindingsignatures are undetectable when individual frag-ments are studied with MV2003 in the absence ofTAR, or when analyzed with TAR in the absence ofMV2003 (Fig. 2). The NOE and STD data thusidentify these 6 fragments to effectively participatein binding to TAR RNA only when MV2003 is alsopresent in solution. When mixed with TAR in theabsence of MV2003, these 6 fragments generate nullor negative intramolecular NOE signals, indicativeof fast-tumbling, nonbinding small molecules. Dueto these binding characteristics, these 6 fragmentswere carried forward for further investigation.

Structure of the binary complex

Structure determination of the binary MV2003–TAR complex was made possible by the observationof several intermolecular NOEs in 1H–1H NOESYspectra collected with equimolar samples. Theguanidinium group of the probe molecule bindsnear the U23-C24-U25 bulge region, likely stabiliz-ing partial base triple formation between bulgeresidue U23 and base pair A27-U38 (Fig. 3a) througha cation–π interaction, as seen in previous structuresof HIV TAR RNA with peptidic ligands.15–17,35

Precise positioning of the guanidinium group in thestructure was not possible due to lack of NOE datafor its exchangeable protons. However, protection ofthe U23 imino hydrogen from exchange wasobserved in 1H–1H NOESY data from a sampleprepared in 90% H2O/10% D2O solution, indicatingpartial formation of the base triple. Initial structurecalculations were performed without any hydrogen-bonding restraints between U23 and A27. Theresults verified that other RNA intramolecularNOEs were consistent with partial triple formation,and a single hydrogen-bond restraint was added insubsequent calculations for the U23 imino proton tothe N7 atom of A27.The methoxynaphthalene group of MV2003 binds

in a pseudo-stacking arrangement at the top of the

Fig. 1. NMR spectra for the small molecule MV2003 (a) in the absence of TAR RNA and (b) in the presence of TARRNA. A 2D proton–proton NOE NMR spectrum appears in the middle, with positive (dark blue) and negative (cyan)contour peaks. 1D reference (blue) and saturation (red) transfer difference (STD) spectra are shown on the perimeter.MV2003 was selected for fragment screening based on strong STD signal attenuation and positive NOE cross-peaksobserved in the presence of substoichiometric amounts of HIV-1 TAR.

987Drug-Like Fragments Binding HIV-1 TAR

Table 2. Top 20 primary screening fragment hits from 13different scaffold groups and follow-up results from NMRexperiments on individual compounds

988 Drug-Like Fragments Binding HIV-1 TAR

upper RNA helix and below the base of the apicalloop, between the C29-G36 base pair and loopresidue A35 (Fig. 3a). Compared to aromatic groupsof other known TAR-binding arginine derivatives,this ligand binds with a unique orientation (Fig. 3b).Most other TAR-binding small molecules tend to bepositioned further down the helix, participating inaromatic base-stacking interactions with nucleo-bases of the major groove.8,10 By contrast, MV2003contacts the apical loop, where cyclin T1 binds,while also stabilizing partial formation of the U23-A27-U38 base triple.8,15 The dual interactions of themethoxynaphthalene ring with the base of theapical loop and the guanidinium group with thearginine-binding pocket of TAR cause an overalltightening of the RNA major groove aroundMV2003. This creates a small pocket capable ofbinding small-molecule fragments. This cavity wasnot observed with previous structures of TARbound to argininamide or any other argininederivatives (Fig. 3b). In this manner, MV2003locks TAR into a conformation capable of bindingsmall-molecule fragments, while simultaneouslyproviding a chemical probe for fragment-basedscreening by ligand-observe NMR methods. Thebound state of MV2003 provides a promisingfoundation for the development of inhibitorscapable of abrogating both Tat and cyclin T1binding to the viral RNA.

Models of the ternary complexes

NMR data were then collected to assess thefeasibility of structure determination for the topfragment hits in complex with the probe–TARcomplex. Unfortunately, NOESY data did not yieldany intermolecular NOEs between fragment mole-cules and the RNA at stoichiometric concentrations.This is likely due to relatively weak fragment-binding interactions, which result in poor restraintof the fragments to any single bound conformation.However, measurable differences in ILOE cross-peak intensities between protons within the frag-ments and MV2003 bound to TAR suggested theiruse as experimental restraints for docking fragmentsinto the binary probe–RNA structure. We used theprogram HADDOCK (High Ambiguity DrivenDocking) for modeling due to its success inanalyzing ligand–protein complexes.36,37 Of the sixfragment hits validated by control experiments,three were selected for docking experiments on thebasis of uniqueness of structure and adequatemolecular size and complexity for docking. Weused ILOE cross-peak intensities collected on indi-vidual fragments in solution with MV2003 and TARto generate ambiguous interaction restraints be-tween the probe and fragment hits, as well asunambiguous restraints for specific nuclei (seeExperimental Methods).

Fig. 2. Characterization of binding for fragment hit MV1480. Left: Reference (red), saturation (blue) and difference(black) 1D STD-NMR spectra for (a) MV1480 with substoichiometric HIV TAR RNA present; (b) MV1480 with equimolarMV2003 present; (c) MV1480, MV2003, and TAR at 40:40:1 molar ratios. Right: NOE spectra with peak-aligned STD-NMRdata for (d) MV1480 with substoichiometric HIV TAR RNA present; (e) MV1480 with equimolar MV2003 present;(f) MV1480, MV2003, and TAR at 40:40:1 molar ratios. Spectral binding signatures that appear in (c) and (f) indicate thatMV1480 only binds to HIV TAR RNA when MV2003 is present in solution.

989Drug-Like Fragments Binding HIV-1 TAR

Structural differences between the MV2003 binarycomplex and other ligand-bound structures of TAR,plus strong ILOE cross-peaks between fragment hitsand several aromatic protons of MV2003, suggestthat the fragment-binding pocket is located in theRNAmajor groove. Consistent with this hypothesis,modeling studies placed all three fragments in thesame region of the complex, approximately betweennucleotides A27 and C29 (Fig. 4). This resultpositions the fragments on the major groove face

of the RNA, near the methoxynaphthalene ringsystem of MV2003. Similar orientations in thebinding pocket were obtained for all three structur-ally divergent fragment hits, suggesting a commonbinding epitope and demonstrating binding-sitespecificity for these fragments with the MV2003–TAR complex. The HADDOCK models position allfragments with hydrogen bond acceptors towardthe hydrogen-donating guanidinium group ofMV2003, an orientation that is largely determined

Fig. 3. Structure of the binary MV2003–TAR complex. (a) On the far left, 10 representative structures are overlaid, withthe RNA presented as blue lines and MV2003 as red lines. Left center is a surface representation of the RNA in gray, withMV2003 in red. Interactions of the small molecule MV2003 groups with the RNA are displayed on the right. Theguanidinium group is located near the U23-C24-U25 bulge and likely stabilizes partial formation of the U23-A27-U38 basetriple (right center), while the naphthylene ring system stacks at the top of the upper helix (far right). (b) The structure ofthe MV2003–TAR complex (far right) reveals a cavity, highlighted in orange, not observed with previous structures ofTAR bound to other small molecules (surface images are shown in stereo). Protein Data Bank accession numbers for thesestructures, left to right, are 1uts, 1aju, 1lvj, and 2l8h.

990 Drug-Like Fragments Binding HIV-1 TAR

by specific burial of the fragment scaffold against theMV2003 naphthalene group (Fig. 4). Thus, thefragment ring systems align with the naphthalenegroup of MV2003, while hydrophilic functionalgroups point toward the guanidinium group andthe RNA phosphate backbone in the TAR bulgeregion. These preliminary structures immediatelysuggest linking strategies to create a single hydro-phobic core to be buried in the TAR major groove,while presenting two polar functional groups for

interaction with RNA bulge residues and the U23-A27-U38 base triple.

Discussion

It has been known for some time that an arginineside chain within Tat protein is particularly impor-tant for binding TAR, and argininamide itself cancapture some of the characteristics of the Tat–TAR

Fig. 4. HADDOCK docking results for MV1303, MV1315, andMV1480, showing orientations for each fragment againstthe TAR–MV2003 complex. (a) The dashed lines represent the ILOE data used as experimental restraints for modeling. (b)The 10 structures with the fewest number of NOE violations and lowest pairwise RMSD from the average structure areoverlaid for each fragment.

991Drug-Like Fragments Binding HIV-1 TAR

interaction.3,38–40 In this study, we observe thatbinding of an arginine derivative to TAR induces apocket in the major groove of the upper helixcapable of burying other small molecules. In thismanner, our “probe” plays a role similar to that ofthe crucial arginine of Tat protein for TAR recogni-tion by reorganizing the RNA structure; the forma-tion of a new binding pocket allows binding of otherfragments and suggests that more powerful ligandscan be generated by linking the fragments together.Thus, NMR-based fragment screening by detectionof ILOEs to our chemical probe has allowed thediscovery of drug-like molecules that bind a newpocket within TAR. Such fragments can now beused to design and elaborate lead compounds thatcontain novel drug-like motifs not previouslyapplied to RNA-binding molecules.The arginine derivative selected as our chemical

probe contains two functional regions: a polararginine side chain for interaction with the TARUCU bulge, and a nonpolar, hydrogen-rich regionfor detection of 1H–1H ILOE to binding fragments. Itproved ideal for fragment-based screening, since itlocked the RNA into a conformation capable ofgenerating NMR-detectable interactions that the free

RNA does not possess. The combination of themethoxynaphthalene group and arginine side chainmimics other known TAR ligands and contacts twoof the crucial TAR interaction sites identified inprevious studies of Tat mimetics.3,13,15,16,41 By usingthis TAR binding motif to direct our fragmentsearch, we can now efficiently design anti-TARlead compounds based on the models of the ternarycomplex (Fig. 4).Despite the use of the probe, follow-up studies

were essential to identify and validate TAR-bindingfragments from primary screening. Of the 20fragments selected for further analysis, 5 failed togenerate binding signals when separated from thescreening mixture, even with MV2003 and TARRNA present in solution (Table 2). These com-pounds likely generated false-positive signals due tosolubility limits or aggregation in the presence ofother fragments at relatively high (i.e., millimolar)concentration during screening. An additional 6 hitsgenerated positive NOE cross-peaks in the absenceof RNA, either alone or in the presence of MV2003,and were therefore excluded from further study.Among the remaining candidates, 3 generatednegative NOE cross-peaks alone or with MV2003

Fig. 5. Three fragment hits (left) and two nonhits (right)from scaffold Group 11 screened against HIV TAR RNA inthe presence of MV2003. Even small changes in thefragment lead to complete loss of binding activity.

992 Drug-Like Fragments Binding HIV-1 TAR

present, but positive NOE cross-peaks when alonewith TAR in solution. These fragments (MV1062,MV1159, and MV1425) appear to bind to TAR withor without MV2003 present, suggestive of nonspe-cific binding to RNA (Table 2). The remaining 6fragment hits generated binding signals only whenboth MV2003 and TAR RNA were present, indica-tive of affinity for a pocket within TAR insufficientlypopulated without the chemical probe. Furtherdemonstration of binding site specificity is apparentwhen these fragments are compared to nonhitssharing the same scaffold (Fig. 5). This comparisonshows that small changes to functional groups andtheir placement can disrupt recognition of thefragments by the MV2003–TAR complex. Thislevel of specificity for small-molecule fragmentswas surprising, but very encouraging for leaddevelopment.

Conclusion

We have undertaken a fragment-based screen todiscover new hits for HIV-1 TAR RNA, but we havedone so by first targeting the Tat-binding site withan arginine-derived probe. The arginine derivativewe have chosen induces a new conformation of TARRNA, and its use has enabled us to discovernoncharged, drug-like fragments with weak butspecific affinity for this RNA. The chemical probeinduces the formation of a small cavity in the majorgroove of the RNA for which the fragmentmolecules display a high degree of binding-sitespecificity. Remarkably, small changes in fragmentstructure, specifically to polar functional groups, canresult in total loss of binding, further supporting thebinding specificity, most likely due to stableformation of the binding pocket. Based on HAD-DOCK-generated models, all true positive fragment

hits share the characteristic of hydrogen bondacceptors oriented toward the guanidinium groupof MV2003, and hydrogen bond donors or neutralatoms oriented toward the RNA backbone. Thisfunctional group orientation is apparently deter-mined by the burial of the fragment scaffold againstthe probe naphthalene group in the RNA majorgroove. The probe and fragment hits that we haveidentified in this work will now guide the discoveryof new HIV-1 Tat–TAR inhibitors.The approach presented here represents one of

few published attempts to experimentally screenand successfully discover novel RNA binding motifsby ligand-based NMR.30,42,43 It is also an uncommonexample of utilizing an all-purpose, drug-likelibrary of molecules, biased toward protein targets,to successfully screen and identify novel chemicalentities that bind to RNA. With proper selection ofchemical probe, the screening methods used in thisstudy could be expanded to other RNA drug targetswith potential for medicinal intervention throughsmall-molecule inhibition.

Experimental Methods

RNA preparation

HIV-1 TAR RNA was prepared in vitro from commer-cially synthesized DNA templates (IDT) using in-housepurified T7 RNA polymerase and commercially availablenucleotides (Sigma) and purified as described.44 Theconstruct used in all experiments was of the sequence 5′-G17GCAGAUCUGAGCCUGGGAGCUCUCUGCC45-3′.Prior to each NMR experiment, the RNA samples wereannealed by heating at 95 °C briefly, and then quickcooling on ice. For screening, the RNA was dissolved in90% H2O/10% 2H2O (v/v). For NMR experiments, theRNA was lyophilized from 99.9% 2H2O twice, and thendissolved in 99.99% 2H2O.

NMR experiments for fragment screening and bindingcharacterization

NMR samples for fragment screening were prepared bydiluting purified, snap-cooled HIV-1 TAR RNA into NMRscreening buffer [10 mM potassium phosphate, 0.1 mMEDTA (ethylenediaminetetraacetic acid), and 10% (v/v)2H2O, adjusted to pH 6.6 and sterile-filtered]. Samplescontained pools of fragments at 500 μM each in thepresence of 20 μM RNA with 500 μM of the chemicalprobe MV2003. Follow-up experiments were conductedwith focused pools and individual fragments at 200 μMwith MV2003 also at 200 μM and the RNA at 5 or 10 μM.All screening and follow-up experiments were conductedon a 750-MHz Bruker AV spectrometer with a TXI probeat 280 K. Screening was done using ligand-observe,proton-based 1D STD-NMR33 and 2D NOESY45 accordingto previously published methods.46

For STD-NMR experiments, 32 scans and 32,000 pointswere acquired over a 14-ppm sweep width, with a total

Table 3. Statistics for HADDOCK-driven modeling of theternary complexes, generated by docking individualfragments to the TAR–MV2003 binary complex structure

Fragment Statistics for 10 reported docking results

MV1303 No. of ILOEs used for docking 5Avg. no. of ILOES violated (N0.5 Å) 0Avg. no. of ILOES violated (N0.3 Å) 1Avg. RMSD from mean (interface) 1.0

Avg. RMSD from mean (all ) 2.1MV1315 No. of ILOEs used for docking 8

Avg. no. of ILOES violated (N0.5 Å) 0Avg. no. of ILOES violated (N0.3 Å) 0Avg. RMSD from mean (interface) 1.4

Avg. RMSD from mean (all ) 2.1MV1480 No. of ILOEs used for docking 8

Avg. no. of ILOES violated (N0.5 Å) 0Avg. no. of ILOES violated (N0.3 Å) 2Avg. RMSD from mean (interface) 1.4

Avg. RMSD from mean (all ) 2.9

993Drug-Like Fragments Binding HIV-1 TAR

recycle delay of 4.0 s for each mixture. Reference andsaturation free induction decays (FIDs) were acquired inan interleaved fashion over the course of a singleexperiment for each NMR sample and processed sepa-rately with identical phases and processing parameters. Alow-power 30-ms spin–lock pulse was added to filter outlow-level RNA peaks, and a WATERGATE sequence wasused to suppress bulk water signal.47 STD-NMR pre-saturation was done using a 3.0-s train of Gaussian-shaped pulses with a spectral width of approximately750 Hz. The selective saturation pulse was focused at5.5 ppm to excite ribose proton resonances of the target,and reference irradiation was focused at 30 ppm. Themajority of fragment molecules, as well as MV2003, werefree of proton resonances near this saturation frequency.Fragments with proton peaks close to 5.5 ppm wereexcluded from STD-NMR-based experiments due to thelikelihood of direct irradiation by the selective excitationpulse. STD peak intensities were measured by subtractingthe integral area of a saturation spectrum peak from thatof the corresponding reference spectrum. Previous studiessuggest a cutoff value for fragment-based NMR screeninghits to be an STD amplification factor (SAF) of 2.5 for oneor more ligand protons.46 This SAF value corresponds toapproximately 10% STD peak intensity for all fragmentsstudied at the same ligand/target ratio and was used as apreliminary hit criterion for subsequent screening.For NOESY experiments, 2048×160 points were col-

lected with a mixing time of 500 ms and a recycle delay of2.0 s, with WATERGATE47 solvent suppression for eachmixture or sample. To derive restraints for HADDOCK,we used the same NOESY parameters to collect data forsamples containing 200 μM fragment, 200 μM MV2003,and 5 μM TAR RNA in the same buffer, at 50-, 100-, 150-,and 200-ms mixing times.

NMR experiments for structure determination

NMR spectra for structure determination were collectedon Bruker DRX 500-MHz and DMX 600-MHz spectrom-eters equipped with cryocooled HCN probes with triple-axis gradients. Data were processed with NMRPipe48 and

analyzed in Sparky.49 NOESY experiments in D2O wererecorded at two mixing times (100 and 200 ms). NOESYexperiments recorded in water at 4 °C were collected withWATERGATE solvent suppression47 and mixing times of100 and 200 ms. 3D 13C NOESY–HMQC (heteronuclearmultiple-quantum coherence) spectra were recorded at600 MHz with a mixing time of 100 ms.To determine optimal concentrations in solution for

structural characterization of the complex, we monitoredTAR imino chemical shifts by 1D proton NMR whiletitrating in MV2003. Significant changes in chemical shiftfor several imino peaks were observed during the titrationup to a 4:1 stoichiometric ratio, after which changes wereminimal. This result indicated that the primary bindingsite for MV200350 was fully titrated at a 4:1 ratio ofMV2003 to TAR, and NMR data for structural studieswere collected under these conditions.Resonance assignments were already available for TAR

bound to a single argininamide and several Tat-derivedpeptides.3,51 Comparison of 1H–1H NOESY spectra forthese previously determined complexes and the MV2003-bound RNA revealed several similar chemical shiftvalues near the 5′ and 3′ ends of the RNA, that is, forresidues that are not involved in binding the peptides orMV2003. These observations, along with clearly identifi-able adenine H2 proton resonances, were used togenerate initial proton assignments.52 HCCH–correlatedspectroscopy (COSY) and HMQC–NOESY experimentswere then collected to complete proton assignments.To measure residual dipolar couplings (RDCs), we

collected in-phase–antiphase (IPAP) heteronuclear singlequantum coherence (HSQC) data for unaligned samples ofthe MV2003–RNA complex as reference.53 The samplewas then partially aligned using Pf1 phage (Asla Ltd.) in a99.9% D2O buffer (10 mM potassium phosphate, pH 6.6)to a final concentration of 15 mg/mL of phage. The IPAPexperiment was repeated for this partially aligned sample.Heteronuclear one-bond 1H–13C couplings were mea-sured from the IPAP data in the presence (Jw/pf1) and inthe absence of phage (Jw/outpf1). RDC values weredetermined with the equation RDC= Jw/pf1− Jw/outpf1.

Structure determination of TAR–MV2003binary complex

The structure of the complex was calculated withXplor-NIH software using a simulated annealingprotocol.54 Distance restraints were established fromNOE intensities in 2D NOESY spectra at 100-ms mixingtime and from 3D NOESY–HSQC spectra at 100-msmixing time for overlapped resonances. Standard pla-narity and hydrogen-bond restraints were applied tounambiguously base-paired nucleotides, as identifiedfrom NOESY spectra in water. Dihedral angle restraintsfor the bulge and loop nucleotides were experimentallyestablished whenever possible: the strength of theintranucleotide H1′–H8 peak was used to restrain theglycosidic angle, while the sugar puckers were deter-mined from the intensity of the H1′–H2′ couplings in1H–1H total COSY (TOCSY) experiments.Structures were first calculated without RDCs to test for

convergence and adherence to the NOE data. RDCrestraints were then applied as susceptibility anisotropy(sani) restraints with a harmonic potential well. The

994 Drug-Like Fragments Binding HIV-1 TAR

powder pattern-like distribution of RDCs55 was used tocalculate starting values for Da and R of approximately−21 and 0.3, respectively. Optimal values of Da and Rwere then established by a grid search over Da valuesranging from −15 to −36 in increments of 2 Hz and Rvalues ranging from 0.15 to 0.45 in 0.05 increments. Thelowest-energy structures were found for Da=−24 andR=0.35. These parameters were used in subsequentrefinement on calculations of the final 100 structures.Twenty converged structures of the complex were

selected as those with lowest total, NOE, and sani energiesfrom the population of structures with no NOE restraintviolations greater than 0.5 Å nor dihedral angle violationsgreater than 5°. These structures were visualized withMolMol,56 and a final set of 10 structures was selected forconvergence to the mean structure.

Fragment docking with MV2003–TARbinary complex

CNS-style topology and parameter files were generatedwith the PRODRG online server, with use of theelectrostatic option.57 Nonpolar hydrogen atoms wereadded from topology and parameters files using PhenixeLBOW software.58 Docking runs using HADDOCK wereperformed with primarily default settings, except for theaddition of RNA restraints on base-pair planarity, sugarpucker, and backbone dihedral angles. ILOE signals from2D NOESY experiments for individual fragments in thepresence of probe and RNA were used to generateambiguous interaction restraints (AIRs) between frag-ments and probe, with both entities characterized as“active residues.” The top five to eight strongest ILOEpeaks at 100-ms mixing time were translated intounambiguous distance restraints.37,59 Five hundred initialstructures were generated with rigid-body docking, andthe 100 lowest-energy structures were subsequently usedfor semiflexible simulated annealing and solvent explicitrefinement. Solutions were ranked according to the RMSDfrom average structure and the total number of ambigu-ous and unambiguous NOE violations using HADDOCKanalysis software. The 10 structures with lowest RMSDand NOE violations for fragments MV1303, MV1315, andMV1480 are shown in Fig. 4. Table 3 provides statistics forthese structures.

Accession numbers

Coordinates for the TAR–MV2003 structure have beendeposited in the Protein Data Bank with accession number2L8H.

References

1. Jones, K. A. & Peterlin, B. M. (1994). Control of RNAinitiation and elongation at the HIV-1 promoter.Annu. Rev. Biochem. 63, 717–743.

2. Karn, J., Gait, M. J., Churcher, M. J., Mann, D. A.,Mikaelian, I. P. & Pritchard, C. (1994). Control ofhuman immunodeficiency virus gene expression bythe RNA binding proteins Tat and Rev. In (Nagai, K.& Mattaj, I. W., eds), IRL Press, Oxford.

3. Aboul-ela, F., Karn, J. & Varani, G. (1995). Thestructure of the human immunodeficiency virustype-1 TAR RNA reveals principles of RNA recogni-tion by Tat protein. J. Mol. Biol. 253, 313–332.

4. Karn, J. (1999). Tackling Tat. J. Mol. Biol. 293, 235–254.5. Peterlin, B. M. & Price, D. H. (2006). Controlling the

elongation phase of transcription with P-TEFb. Mol.Cell, 23, 297–305.

6. Lapidot, A., Vijayabaskar, V., Litovchick, A., Yu, J. &James, T. L. (2004). Structure–activity relationships ofaminoglycoside-arginine conjugates that bind HIV-1RNAs as determined by fluorescence and NMRspectroscopy. FEBS Lett. 577, 415–421.

7. Lind, K. E., Du, Z., Fujinaga, K., Peterlin, B. M. &James, T. L. (2002). Structure-based computationaldatabase screening, in vitro assay, and NMR assess-ment of compounds that target TAR RNA. Chem. Biol.9, 185–193.

8. Du, Z., Lind, K. E. & James, T. L. (2002). Structure ofTAR RNA complexed with a Tat-TAR interactionnanomolar inhibitor that was identified by computa-tional screening. Chem. Biol. 9, 707–712.

9. Mayer, M. & James, T. L. (2002). Detecting ligandbinding to a small RNA target via saturation transferdifference NMR experiments in D2O and H2O. J. Am.Chem. Soc. 124, 13376–13377.

10. Murchie, A. I., Davis, B., Isel, C., Afshar, M., Drysdale,M. J., Bower, J. et al. (2004). Structure-based drugdesign targeting an inactive RNA conformation:exploiting the flexibility of HIV-1 TAR RNA. J. Mol.Biol. 336, 625–638.

11. Raghunathan, D., Sanchez-Pedregal, V. M., Junker, J.,Schwiegk,C.,Kalesse,M., Kirschning,A.&Carlomagno,T. (2006). TAR-RNA recognition by a novel cyclicaminoglycoside analogue.Nucl.Acids Res. 34, 3599–3608.

12. Leeper, T. C., Athanassiou, Z., Dias, R. L., Robinson,J. A. & Varani, G. (2005). TAR RNA recognition by acyclic peptidomimetic of Tat protein. Biochemistry,44, 12362–12372.

13. Davis, B., Afshar, M., Varani, G., Murchie, A. I., Karn,J., Lentzen, G. et al. (2004). Rational design ofinhibitors of HIV-1 TAR RNA through the stabilisa-tion of electrostatic “hot spots”. J. Mol. Biol. 336,343–356.

14. Brodsky, A. S. & Williamson, J. R. (1997). Solutionstructure of the HIV-2 TAR-argininamide complex.J. Mol. Biol. 267, 624–639.

15. Davidson, A., Leeper, T., Athanassiou, Z., Patora-Komisarska, K., Karn, J., Robinson, J. & Varani, G.(2009). Simultaneous recognition of HIV-1 TARRNA bulge and loop sequences by cyclic peptidemimics of Tat protein. Proc. Natl Acad. Sci. USA, 106,11931–11936.

16. Davidson, A., Patora-Komisarska, K., Robinson, J. A.& Varani, G. (2011). Essential structural requirementsfor specific recognition of HIV TAR RNA by peptidemimetics of Tat protein.Nucleic Acids Res. 39, 248–256.

17. Ludwig, V., Krebs, A., Stoll, M., Dietrich, U., Ferner, J.,Schwalbe, H. et al. (2007). Tripeptides from syntheticamino acids block the Tat–TAR association and slowdown HIV spread in cell cultures. ChemBioChem, 8,1850–1856.

18. Mayer, M., Lang, P. T., Gerber, S., Madrid, P. B., Pinto,I. G., Guy, R. K. & James, T. L. (2006). Synthesis and

995Drug-Like Fragments Binding HIV-1 TAR

testing of a focused phenothiazine library for bindingto HIV-1 TAR RNA. 13, 993–1000.

19. Hsieh, M, Collins, E., Blomquist, T. & Lustig, B. (2002).Flexibility of BIV TAR-Tat: models of peptide binding.J. Biomol. Struct. Dyn. 20, 243–251.

20. Congreve, M., Chessari, G., Tisi, D. &Woodhead, A. J.(2008). Recent developments in fragment-based drugdiscovery. J. Med. Chem. 51, 3661–3680.

21. Erlanson, D. A., McDowell, R. S. & O'Brien, T. (2004).Fragment-based drug discovery. J. Med. Chem. 47,3463–3482.

22. Hajduk, P. J. & Greer, J. (2007). A decade of fragment-based drug design: strategic advances and lessonslearned. Nat. Rev. Drug. Discov. 6, 211–219.

23. Rees, D. C., Congreve, M., Murray, C. W. & Carr, R.(2004). Fragment-based lead discovery. Nat. Rev.Drug. Discov. 3, 660–672.

24. Parsons, J., Castaldi, M. P., Dutta, S., Dibrov, S. M.,Wyles, D. L. & Hermann, T. (2009). Conformationalinhibition of the hepatitis C virus internal ribosomeentry site RNA. Nat. Chem. Biol. 5, 823–825.

25. Seth, P. P., Miyaji, A., Jefferson, E. A., Sannes-Lowery,K. A., Osgood, S. A., Propp, S. S. et al. (2005). SAR byMS: discovery of a new class of RNA-binding smallmolecules for the hepatitis C virus: internal ribosomeentry site IIA subdomain. J. Med. Chem. 48, 7099–7102.

26. Swayze, E. E., Jefferson, E. A., Sannes-Lowery, K. A.,Blyn, L. B., Risen, L. M., Arakawa, S. et al. (2002).SAR by MS: a ligand based technique for drug leaddiscovery against structured RNA targets. J. Med.Chem. 45, 3816–3819.

27. Lepre, C. A., Peng, J., Fejzo, J., Abdul-Manan, N.,Pocas, J., Jacobs, M. et al. (2002). Applications ofSHAPES screening in drug discovery. Comb. Chem.High Throughput Screen. 5, 583–590.

28. Johnson, E. C., Feher, V. A., Peng, J. W., Moore, J. M. &Williamson, J. R. (2003). Application of NMR SHAPESscreening to an RNA target. J. Am. Chem. Soc. 125,15724–15725.

29. Mayer, M. & James, T. L. (2004). NMR-basedcharacterization of phenothiazines as a RNA bindingscaffold. J. Am. Chem. Soc. 126, 4453–4460.

30. Bodoor, K., Boyapati, V., Gopu, V., Boisdore, M.,Allam, K., Miller, J. et al. (2009). Design andimplementation of an ribonucleic acid (RNA) directedfragment library. J. Med. Chem. 52, 3753–3761.

31. Li, D., DeRose, E. F. & London, R. E. (1999). Theinter-ligand Overhauser effect: a powerful newNMR approach for mapping structural relationshipsof macromolecular ligands. J. Biomol. NMR, 15,71–76.

32. Zhang, Q. & Al-Hashimi, H. M. (2009). Domain-elongation NMR spectroscopy yields new insightsinto RNA dynamics and adaptive recognition. RNA,15, 1941–1948.

33. Mayer, M. & Meyer, B. (1999). Characterization ofligand binding by saturation transfer differenceNMR spectroscopy. Angew. Chem., Int. Ed. 38,1784–1788.

34. Noggle, J. & Schirmer, R. (1971). The Nuclear Over-hauser Effect Academic Press Inc., New York.

35. Pitt, S. W., Majumdar, A., Serganov, A., Patel, D. J. &Al-Hashimi, H. M. (2004). Argininamide bindingarrests global motions in HIV-1 TAR RNA: compar-

ison with Mg+2-induced conformational stabilization.J. Mol. Biol. 338, 7–16.

36. Dominguez, C., Boelens, R. & Bonvin, A. M. (2003).HADDOCK: a protein–protein docking approachbased on biochemical or biophysical information.J. Am. Chem. Soc. 125, 1731–1737.

37. van Dijk, A. D. J., Boelens, R. & Bonvin, A. M. J. J.(2005). Data-driven docking for the study of biomo-lecular complexes. FEBS J. 272, 20.

38. Zacharias, M. & Hagerman, P. J. (1995). The bend inRNA created by the trans-activation response elementbulge of human immunodeficiency virus is straight-ened by arginine and by Tat-derived peptide. Proc.Natl Acad. Sci. USA, 92, 6052–6056.

39. Puglisi, J. D., Tan, R., Calnan, B. J., Frankel, A. D. &Williamson, J. R. (1992). Conformation of the TARRNA-arginine complex by NMR spectroscopy. Sci-ence, 257, 76–80.

40. Puglisi, J. D., Chen, L., Frankel, A. D. & Williamson,J. R. (1993). Role of RNA structure in argininerecognition of TAR RNA. Proc. Natl Acad. Sci. USA,90, 3680–3684.

41. Aboul-ela, F. & Varani, G. (1998). Recognition of HIV-1 TAR RNA by Tat protein and Tat-derived peptides.J. Mol. Struct. 423, 29–39.

42. Yu, L., Oost, T. K., Schkeryantz, J. M., Yang, J., Janowick,D. & Fesik, S. W. (2003). Discovery of aminoglycosidemimetics by NMR-based screening of Escherichia coli A-site RNA. J. Am. Chem. Soc. 125, 4444–4450.

43. Johnson, E. C., Feher, V. A., Peng, J. W., Moore, J. M. &Williamson, J. R. (2003). Application of NMR SHAPESscreening to an RNA target. J. Am. Chem. Soc. 125,15724–15725.

44. Varani, G., Abou-ela, F. & Allain, F. H. T. (1996). NMRinvestigation of RNA structure. Prog. Nucl. Magn.Spectrosc. 29, 51–127.

45. Becattini, B. & Pellecchia, M. (2006). SAR by ILOEs: anNMR-based approach to reverse chemical genetics.Chemistry, 12, 2658–2662.

46. Begley, D. W., Zheng, S. & Varani, G. (2010).Fragment-based discovery of novel thymidylatesynthase leads by NMR screening and group epitopemapping. Chem. Biol. Drug. Des. 76, 218–233.

47. Piotto, M., Saudek, V. & Sklenar, V. (1992).Gradient-tailored excitation for single-quantumNMR spectroscopy of aqueous solutions. J. Biomol.NMR, 2, 661–665.

48. Delaglio, F., Grzesiek, S., Vuister, G. W., Zhu, G.,Pfeifer, J. & Bax, A. (1995). NMRPipe: a multidimen-sional spectral processing system based on UNIXpipes. J. Biomol. NMR, 6, 277–293.

49. Goddard, T. D. & Kneller, D. G. Sparky 3. Universityof California, San Francisco, CA.

50. Ferner, J., Suhartono, M., Breitung, S., Jonker, H.R. A., Hennig, M., Wöhnert, J. et al. (2009).Structures of HIV TAR RNA–ligand complexesreveal higher binding stoichiometries. ChemBio-Chem. 10, 1490–1494.

51. Aboul-ela, F., Karn, J. & Varani, G. (1996). Structure ofHIV-1 TAR RNA in the absence of ligands reveals anovel conformation of the trinucleotide bulge. NucleicAcids Res. 24, 3974–3981.

52. Wuthrich, K. (1986).NMR of Proteins and Nucleic Acids.Wiley, New York.

996 Drug-Like Fragments Binding HIV-1 TAR

53. Andersson, P., Nordstrand, K., Sunnerhagen, M., Lie-pinsh, E., Turovskis, I. &Otting, G. (1998). Heteronuclearcorrelation experiments for the determination of one-bond coupling constants. J. Biomol. NMR, 11, 445–450.

54. Schwieters, C. D., Kuszewski, J. J., Tjandra, N. &Marius Clore, G. (2003). The Xplor-NIH NMRmolecular structure determination package. J. Magn.Reson. 160, 65–73.

55. Clore, G. M., Gronenborn, A. M. & Bax, A. (1998). Arobust method for determining the magnitude of thefully asymmetric alignment tensor of oriented macro-molecules in the absence of structural information.J. Magn. Reson. 133, 216–221.

56. Koradi, R., Billeter, M. & Wuthrich, K. (1996).MOLMOL: a program for display and analysis of

acromolecular structures.J. Mol. Graphics, 14, 51–55;29–32.

57. Schuettelkopf, A. W. & van Aalten, D. M. F. (2004).PRODRG—a tool for high-throughput crystallogra-phy of protein-ligand complexes. Acta Crystallogr. 60,1355–1363.

58. Moriarty, N., Grosse-Kunstleve, R & Adams, P. (2009).electronic Ligand Builder and Optimization Workbench(eLBOW): a tool for ligand coordinate and restraintgeneration. Acta Crystallogr., Sect. D: Biol. Crystallogr. 65,1075–1080.

59. Meyer, B. & Peters, T. (2003). NMR spectroscopytechniques for screening and identifying ligand bindingto protein receptors. Angew. Chem., Int. Ed. Engl. 42,864–890.